Use of self-assembling polypeptides as tissue adhesives
12156955 · 2024-12-03
Assignee
Inventors
Cpc classification
A61L24/108
HUMAN NECESSITIES
A61L31/047
HUMAN NECESSITIES
C08L89/00
CHEMISTRY; METALLURGY
A61L26/0047
HUMAN NECESSITIES
C08L89/00
CHEMISTRY; METALLURGY
A61L2300/252
HUMAN NECESSITIES
A61L27/54
HUMAN NECESSITIES
International classification
A61L27/54
HUMAN NECESSITIES
Abstract
The present invention relates to a self-assembling polypeptide, such as a silk polypeptide including a spider silk polypeptide, for use as tissue adhesive. The present invention also relates to the use of a self-assembling polypeptide such as a silk polypeptide as tissue adhesive. Further, the invention is directed to the use of a self-assembling polypeptide such as a silk polypeptide to glue one or more cosmetic compounds on skin, mucosa, and/or hair. Furthermore, the invention is directed to a self-assembling polypeptide such as a silk polypeptide for use in gluing one or more pharmaceutical compounds on tissue, skin, mucosa, and/or hair.
Claims
1. A method for adhering tissue comprising the steps of: (i) providing a solution comprising a silk polypeptide but without a cross-linking agent, wherein the silk polypeptide is not cross-linked, (ii) applying the solution to at least one of at least two tissue layers, thereby forming a silk polypeptide film on the at least one of the at least two tissue layers, and (iii) contacting the at least two tissue layers, thereby adhering the at least two tissue layers together.
2. The method of claim 1, wherein the silk polypeptide is coupled to one peptide capable of enhancing the adhesive effect.
3. The method of claim 2, wherein the adhesive effect is mediated via binding of the peptide to a cell adhesion mediating protein (CAMP).
4. The method of claim 3, wherein the peptide comprises at least one CAMP recognition sequence.
5. The method of claim 4, wherein the CAMP recognition sequence comprises a module containing RGD, GER, GEK, GEN, IDAPS (SEQ ID NO: 45), GPR, HHLGGAKQAGDV (SEQ ID NO: 46), CDPGYIGSR (SEQ ID NO: 47), AEIDGIEL (SEQ ID NO: 48), QIDS (SEQ ID NO: 49), or LTD.
6. The method of claim 1, wherein the silk polypeptide is a spider silk polypeptide.
7. The method of claim 6, wherein the spider silk polypeptide is selected from the group consisting of ADF-3 (SEQ ID NO: 1), ADF-4 (SEQ ID NO: 2), MaSp I (SEQ ID NO: 43), MaSp II (SEQ ID NO: 44), (C).sub.m, (C).sub.mNR.sub.z, NR.sub.z(C).sub.m, (AQ).sub.n, (AQ).sub.nNR.sub.z, NR.sub.z(AQ).sub.n, (QAQ).sub.o, NR.sub.z(QAQ).sub.o, (QAQ).sub.oNR.sub.z, wherein m is an integer of 8 to 48, n is an integer of 6 to 24, o is an integer of 8 to 16, z is an integer of 1 to 3 and NR stands for a non-repetitive unit.
8. The method of claim 7, wherein the spider silk polypeptide is C.sub.16NR4, C.sub.32NR4, (AQ).sub.12NR3, (AQ).sub.24NR3, (AQ).sub.12, (AQ).sub.24, C.sub.16, C.sub.32, NR4C.sub.16NR4, NR4C.sub.32NR4, NR3C.sub.16NR3, NR3C.sub.32NR3, NR4(AQ).sub.12NR4, NR4(AQ).sub.24NR4, NR3(AQ).sub.12NR3, NR3(AQ).sub.24NR3, (QAQ).sub.8 or (QAQ).sub.16.
9. The method of claim 3, wherein the CAMP is an integrin, a selectin, or a cadherin.
10. The method of claim 1, wherein tissue is adhered i) in the treatment of a wound, ii) in the treatment of a sutured wound, iii) in the fixation of transplants, iv) in surgical interventions, or v) in the processing of food.
11. The method of claim 10, wherein the wound is selected from the group consisting of a topical wound, deep wound, gaping wound, stab wound, puncture wound, penetration wound, surgical incision, laceration, cut, and trauma.
12. The method of claim 10, wherein the surgical interventions are selected from the group consisting of cardiovascular surgical interventions, cardiothoracic surgical interventions, gastrointestinal surgical interventions, pneumothoracic surgical interventions, neurosurgical interventions, urological surgical interventions, dental surgical interventions, reconstructive surgical interventions, surgical interventions in the ear, surgical interventions in the nose, surgical interventions in the throat area, lymphatic, biliary and cerebrospinal fistulae, air leakages during thoracic and pulmonary surgical interventions, orthopaedic surgical interventions, gynaecological surgical interventions, cosmetical surgical interventions, and vascular surgical interventions.
Description
FIGURE LEGEND
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
EXAMPLES
(9) 1. Production of eADF4 (C.sub.16), C.sub.16spRGD, and ntagCysC.sub.16-c(RGDfK)
(10) 1.1 Production of eADF4 (C.sub.16)
(11) The recombinant spider silk protein eADF4 (also designated as C.sub.16 herein) is based on the consensus sequence of one of three spidroins of the dragline silk of the European garden spider (Araneus diadematus). The consensus motif (C module) of ADF4 (GSSAAAAAAAASGPGGYGPENQGPSGPGGYGPGGP (SEQ ID NO: 21)) is repeated 16 times in the recombinant protein (
(12) 1.2 Genetic Modification of eADF4 (C.sub.16)
(13) DNA cassettes encoding RGD and a spacer sequence were created by annealing two synthetic oligonucleotides. For the RGD-tag: GATCCATGGGCGGTCGTGGTG ACTCTCCGGGTTAATGAA (SEQ ID NO: 72) and AGCTTTCATTAACCCGGAGAGTCACCACGACCGCCCATG (SEQ ID NO: 73) and for the spacer sequence: GATCCATGGGCGGTGGCTCTGGTTAATGAA (SEQ ID NO: 74) and AGCTTT CATTAACCAGAGCCACCGCCCATG (SEQ ID NO: 75) were used. The resulting amino acid sequence for the specific tag spRGD was GGSGGRGDSPG (SEQ ID NO: 53) (
(14) 1.3 Chemical Coupling of RGD to a Cysteine-Modified Variant of eADF4 (C.sub.16)
(15) For high coupling specificity, chemical coupling of RGD peptides was performed with the cysteine containing eADF4 (C.sub.16) variant ntag.sup.CysC.sub.16 which has been previously established by Spiess et al. (Structural characterization and functionalization of engineered spider silk films, Soft Matter, 2010, 6: 4168-74) (
(16) 2. Preparation of the Silk Protein Solution
(17) C.sub.16 and C.sub.16spRGD have been produced as described above. Respective amounts of C.sub.16 and C.sub.16spRGD were dissolved in 6M Guanidinium thiocyanate and dialyzed for at least 3 days at 4 C. against 5 mM Tris, pH 9. After dialysis, the samples were centrifuged for 15 min at 14.000 rpm at 4 C. Then the protein concentration was estimated by UV-Vis spectrometer. The protein solutions were diluted with 5 mM Tris solution, pH 9 to the requested concentrations.
(18) 3. Adhesive Test
(19) 3.1 Preparation of Skin
(20) Pig skin was used for the adhesive test. The pig skin was cut into pieces having a size of about 9.511.0 cm (a size which fits in a Petri dish having a diameter of 14.5 cm) using a scalpel. The pieces were fixed at their edges with nails onto a board to tighten the skin (see
(21) 3.2 Application of the Silk Protein Solution to the Skin
(22) The C.sub.16 or C.sub.16spRGD solution as produced above was dropped on the cutting area using a pipette (at low protein concentrations of <40 mg/ml), or spread on the cutting area using a spatula or cell scraper (at high protein concentrations of 40 mg/ml) to cover the surface of the wound (see
(23) The adhesive effect was tested by bending (e.g. rolling) the pig skin piece as prepared above (see
(24) In the following, the results of the adhesive test using pig skin pieces treated with C.sub.16spRGD solutions having a concentration of 30, 40, 50, and 70 mg/ml (see Tables 2 and 3), or C.sub.16 solutions having a concentration of 40, 50, and 70 mg/ml (see Table 3) are shown.
(25) TABLE-US-00003 TABLE 2 Results of a first C.sub.16spRGD adhesive test with different silk protein concentrations at an incubation time of 15 min and 1 h C.sub.16spRGD concentration [mg/ml] after 15 min after 1 h 30 x 40 + x: no adhesive effect, +: adhesive effect at the edges of the cutting surface, : adhesive effect at the complete cutting surface
(26) TABLE-US-00004 TABLE 3 Results of a second C.sub.16 and C.sub.16spRGD adhesive test with different silk protein concentrations and volumes at an incubation time of 1 h Concentration Volume [l/cm.sup.2] [mg/ml] C.sub.16 C.sub.16spRGD References 50 70 Ref-Tris x 50 Ref 40 + + x 25 70 Ref-Tris x 50 Ref 40 x Ref-Tris: Tris buffer Ref: H.sub.2O x: no adhesive effect, +: adhesive effect at the edges of the cutting surface, : adhesive effect at the complete cutting surface
(27) An adhesive effect of C.sub.16 and C.sub.16spRGD has been shown for all samples treated with C.sub.16 and C.sub.16spRGD solutions (concentration 40 to 70 mg/ml, volume of 50 l/cm.sup.2 and concentration 40 to 70 mg/ml, volume of 25 l/cm.sup.2) after an incubation time of 1 hour. In each case, the skin flap remained connected to the cutting area during bending (see, for example,
(28)
(29) Similar results were achieved with pig skin pieces having the skin flap completely removed. The cutting area was covered with the C.sub.16 and C.sub.16spRGD solutions as described above. Afterwards, the skin flap was repositioned on the cutting area. The adhesive test was carried out as described above.
(30) 4. Pulling Test
(31) 4.1 Preparation of Skin
(32) Pig skin was used for the pulling test. The pig skin was cut into pieces having a size of about 6.011.0 cm using a scalpel. The pieces were fixed at their edges with nails onto a board to tighten the skin. In a next step, pig skin stripes having a size of 1.5 cm6 cm were cut out from the pig skin pieces (see
(33) 4.2 Application of the Silk Protein Solution to the Skin
(34) The above described incision/cutting procedure separated the pig skin stripe in two halves. The pig skin stripe halves were separated from each other to treat the cutting areas with the C.sub.16 or C.sub.16spRGD solution as produced above. Therefore, the C.sub.16 or C.sub.16spRGD solution was dropped on the cutting areas using a pipette (at low protein concentrations of <40 mg/ml), or spread on the cutting areas using a spatula or cell scraper (at high protein concentrations of 40 mg/ml) to cover the surface of the wound. The two pig skin stripe halves were subsequently repositioned so that the treated cutting areas came in contact with each other (see
(35) 4.3 Sample Preparation for Pulling Test
(36) Upon expiry of the incubation time of 30 min, a super glue (e.g. UHU Kunststoff Spezialsekundenkleber) was applied to the skin side of the stripe. The super glue was spread using a spatula or cell scraper. No glue was applied to the cutting site. Plastic slides (e.g. Rinzle plastic micro-slides) having a length of 2.5 and 3.5 cm were subsequently connected with the glued site of the skin stripe (the slide having a length of 2.5 cm was positioned on the short site of the skin slide and the slide having a length of 3.5 cm was positioned on the longer site of the skin slide) (see
(37) The adhesion force under tangential stress was tested using a tensile tester (e.g. Zwicki Z 0.5; Zwick Roell, 50 N load cell). Therefore, the glued pig skin stripe was fixed in the tensile tester using sample holders as shown in
(38) The parameters of the pulling test were as follows:
(39) TABLE-US-00005 Preload: 0.01 MPa Testing speed: 10 mm/min Clamping length at starting position: 15.00 mm Speed tensile modulus: 10 mm/min
(40) In the following, the results of the pulling test using pig skin stripes treated with C.sub.16spRGD or C.sub.16 solutions having a concentration of 35 mg/ml are shown.
(41) TABLE-US-00006 TABLE 4 Results of the C.sub.16 and C.sub.16spRGD pulling test Concentration [35 mg/ml] of Incubation time Average .sub.max (N) C.sub.16 30 min 2.92 C.sub.16spRGD 30 min 5.29
(42) The average maximal adhesion strength is indicated in Table 4. The maximal adhesion strength can be defined as the maximal load per unit width of the bond line required to produce progressive separation of two bonded adherents, particularly flexible adherents. The average maximal adhesion strength for C.sub.16spRGD was increased by about 80% compared to the average maximal adhesion strength for C.sub.16.
(43) The above experimental data clearly demonstrate that silk proteins (e.g. C.sub.16) or modified silk proteins (e.g. C.sub.16spRGD) function as tissue adhesives. Thus, silk proteins can be used, for example, as tissue adhesives to treat wounds or sutured wounds.
(44) 5. Implant Coating with Silk Proteins
(45) Textured silicone implants (Polytech Health & Aesthetics/Germany) having a diameter of 2.6 cm and a volume of 3 ml were covered with a silk protein layer of a thickness of 10 m according to the following protocol: C.sub.16 protein was produced as described above. 1.35 g of C.sub.16 protein was dissolved in 135 ml of 6M Guanidinium Thiocyanate under gentle agitation. 135 ml of 50 mM Tris buffer (pH 9 (Roth) 4 C.) was slowly added to obtain a homogeneous solution. The resulting protein solution was dialyzed overnight against 50 mM Tris buffer pH 9 at 4 C. Guanidinium-SCN remnants were removed via cross-flow filtration at 4 C. while Tris buffer (50 mM, pH 9) was constantly added. Subsequently the C.sub.16 protein solution was concentrated to 60 ml. The final concentration was 10.8 mg/ml (determined by UV/Vis-Spectroscopy, Beckman Coulter, DU 800).
(46) The coating was performed in a sterile chamber (sterilized at 140 C. for 1 hour). The silicone implants were washed with ethanol and dried at RT prior to the coating process. The silicone implants were coated 3 times with the C.sub.16 protein solution (30 ml at 10.8 mg/ml) by dipping the silicone implants into the solution for 120 s and drying at air for 300 s, respectively. For post-treatment, the transplants were dipped in KH.sub.2PO.sub.4 solution (1M pH4 (Roth, 99%), NaCl 0.91% w/v (Roth, 99.5%)) for 120 s and dried for 120 s before washing the transplants in a saline solution (9 g/l). After sterilization by gamma-irradiation with a dose of 5 kGray (at Isotron, Allershausen), the silk protein coated implants were implanted submuscular in the back of Sprague-Dawley rats having a weight of 250 to 300 mg. As a control, uncoated implants were used.
(47) After 3 months, the Sprague-Dawley rats were sacrificed. The implants were exposed and subsequently analyzed. The results are illustrated in
(48) These data allow the conclusion that wounds which are glued with self-assembling proteins, particularly silk proteins, exhibit reduced or no scarring and/or reduced or no fibrosis, particularly capsular fibrosis.
(49) 6. Safety Tests
(50) 6.1 Acute Eye Irritation Test
(51) The acute eye irritation test was performed according to DIN EN ISO 1093-1 und GLP conditions. Particularly, 0.3 mg spider silk protein eADF4 (C.sub.16) dissolved in 100 l phosphate-buffered saline was applied to one of the two eyes of three female New Zealand white rabbits. The non-treated eye of each female New Zealand white rabbit was taken as a control. This treatment did not cause any signs of pain and did not result in any clinical findings. It showed neither eye damage (a risk of serious damage to the eyes could be excluded according to GHS H 318 (Global Harmonizing System)) nor eye irritation (eADF4 (C.sub.16) was not classified as irritant according to GHS H 319).
(52) 6.2 Immunogenicity Test
(53) A composition of eADF4 (C.sub.16) was administered subcutaneously to five female BALB/c mice at final doses of 2, 10 and 50 g, respectively. One week before and two, five and eight weeks after administration, sera were harvested and analyzed for the presence of antibodies directed against the test substances. The entire group of five mice showed no significant specific antibody formation (see
(54) 6.3 Acute Systemic Toxicity Test
(55) The Acute systemic toxicity test was performed according to DIN EN ISO 10993-11 under GLP conditions. Particularly, eADF4 (C.sub.16) was given once i.p. at a dose of 250 mg/kg to female NMRI mice. Two groups of five female mice each were tested, one with the test item dissolved in phosphate-buffered saline, one with the vehicle. No test item group animal showed any clinical findings at the end of the observation period. There was no significant change of body weight. No further findings, such as macroscopic findings or change of organ weights were noted during the observation period.
(56) 6.4 Acute Skin Irritability Test
(57) The acute skin irritability test was performed according to OECD 404 guidelines und GLP conditions. Particularly, an ADF4 (C.sub.16) film patch of 42.5 mg and 6 cm.sup.2 area was moistened with 100 l saline, applied to previously shaved skin on the backs of each of three male New Zealand white rabbits, and fixated with sterile gauze pads and hypoallergic plaster. After four hours incubation the film patches were removed and the treated skin was examined. The treatment with a eADF4 (C.sub.16) film did not cause any erythema formation or edema formation directly after the application or during the observation period. No general clinical findings and no initial pain reaction were observed after administration.