STRAIN OF LACTOBACILLUS ACIDOPHILUS HAVING ANALGESIC PROPERTIES IN THE GASTROINTESTINAL SYSTEM

20180036355 ยท 2018-02-08

    Inventors

    Cpc classification

    International classification

    Abstract

    The invention proposes the use of at least one strain of Lactobacillus acidophilus to prepare a support administered to humans or animals with an analgesic purpose in the gastrointestinal system.

    Claims

    1. Use of at least one strain of Lactobacillus acidophilus to prepare a support administered to humans or animals for an analgesic purpose in the gastrointestinal system.

    2. Use according to claim 1 characterized in that the strain of Lactobacillus acidophilus is selected from the group consisting of the strain registered at the ATCC under the number PTA-4797 and Lactobacillus acidophilus NCFM.

    3. Use according to claim 1, characterized in that the analgesia is mediated via the opioid receptors and/or cannabinoid receptors.

    4. Use according to claim 1, characterized in that the support administered is a pharmaceutically acceptable support or a food product.

    5. Use according to claim 1, characterized in that the support administered is a dairy product of animal or vegetable origin.

    6. Process for selecting a microorganism to prepare a support administered to humans or animals for an analgesic purpose in the gastrointestinal system comprising the following stages: i) bringing the microorganism to be tested into contact with at least one epithelial cell; and ii) detecting the expression of the opioid receptors and/or cannabinoid receptors in least one epithelial cell.

    7. Process according to claim 6 characterized in that at least one epithelial cell of stage i) or ii) comes from the cell line ATCC HTB-38 or from the cell line Caco-2.

    8. Process according to claim 6 characterized in that stage ii) is carried out by detecting the receptors for the opioids and/or the CB1 receptors and/or the CB2 receptors.

    9. Process according to claim 6 characterized in that stage ii) is carried out by detecting the expression of the messenger RNA of the opioid receptors and/or cannabinoid receptors.

    Description

    [0049] FIG. 1 represents, as a function of time, the messenger RNA expression kinetics of the receptors for the opioids, expressed in the ATCC HTB-38 epithelial cells during stimulation by 4 different microorganisms.

    [0050] FIG. 2 represents, as a function of time, the messenger RNA expression kinetics of the CB1 receptors, expressed in the ATCC HTB-38 epithelial cells during stimulation by 3 different microorganisms.

    [0051] FIG. 3 represents, as a function of time, the messenger RNA expression kinetics of the CB2 receptors, expressed in the ATCC HTB-38 epithelial cells during stimulation by 3 different microorganisms.

    [0052] FIG. 4 represents the MOR mRNA expression under different conditions.

    [0053] FIG. 5 represents the colonic TNF alpha mRNA expression in untreated mice and in L. acidophilus treated mice.

    [0054] FIG. 6 represents the colonic KC mRNA expression in untreated mice and in L. acidophilus treated mice.

    [0055] FIG. 7 represents the colonic IL-1 beta mRNA expression in untreated mice and in L. acidophilus treated mice.

    [0056] FIGS. 8, 10, 12 represent immunostained epithelial cells.

    [0057] FIGS. 9, 11, 13 represent the percentage of immunostained epithelial cells.

    [0058] The following examples illustrate the invention without limiting its scope.

    EXAMPLES

    Example 1

    1/Preparation of the Epithelial Cells:

    [0059] The colon cancer cell line HT-29 (ATCC HTB-38) is cultured in DMEM medium with respectively 20 and 10% foetal calf serum at 37 C. in an atmosphere containing 5% CO.sub.2. The ATCC HTB-38 cell line is brought into contact with the different strains of microorganisms to be tested for 1; 3; 4; 8; 18 or 24 hours. The ATCC HTB-38 epithelial cells are then recovered and immersed in liquid nitrogen in order to make it possible to quantify the mRNA and the protein of the receptors for the opioids and/or cannabinoid receptors.

    2/Detection and Quantification of the Messenger RNAs of the Receptors for the Opioids and/or Cannabinoid Receptors:

    [0060] Real-Time PCR:

    [0061] The total RNA of the epithelial cell lines in culture is isolated by use of a column extraction kit (Macherey-Nagel). In brief, the cells are ground in lysis buffer containing 1% -mercapto-ethanol then passed onto a first type of column allowing the elimination of all the waste. After treatment with DNAse, the RNA will be retro-transcribed into complementary DNA amplified by PCR in real time (ABPrism 7000, Perkin) at a hybridization temperature of 60 C. using primers specific to the receptors for the opioids or cannabinoid receptors:

    TABLE-US-00001 forthe receptorsfortheopioids(MOR) (Sense:ATgCCAgTgCTCATCATTAC, Anti-sense:gATCCTTCgAAgATTCCTgTCCT) and forthereferencegene:-actin (S:TCACCCACACTgTgCCCATCTACgA, AS:CAgCggAACCgCTCATTgCCAATg); fortheCB1cannabinoidreceptors, SenseCCTAGATGGCCTTGCAGATACC; CB1Anti-senseTGTCATTTGAGCCCACGTACAG; CB2SenseGCTAAGTGCCCTGGAGAACGT; CB2Anti-senseTCAGCCCCAGCCAAGCT.

    3/Results:

    [0062] The results are presented in FIGS. 1 to 3. The results are expressed by the ratio between the target gene (-actin)/ receptors for the opioids (MOR) and/or cannabinoid receptors (CB1, CB2).

    [0063] The receptors for the opioids and/or cannabinoid receptors are expressed in the ATCC HTB-38 epithelial cells line (FIGS. 1 to 3).

    [0064] Some microorganisms such as the strain Lactobacillus are capable of inducing the expression of the mRNA of the receptors for the opioids and/or cannabinoid receptors.

    [0065] The results show a significant induction of the receptors for the opioids and/or cannabinoid receptors by the epithelial cells in culture.

    [0066] This induction is particularly strong with the strain Lactobacillus acidophilus.

    [0067] FIGS. 1 and 2 show that after 3 hours' incubation of the epithelial cells with Lactobacillus acidophilus an approximately 1000-fold increase is observed in the basal expression level of the mRNA of the receptors for the opioids (FIG. 1) and CB1 (FIG. 2).

    [0068] FIG. 3 shows that after 3 hours' incubation of the epithelial cells with Lactobacillus acidophilus an approximately 100-fold increase is observed in the basal expression level of the mRNA of the CB2 receptors (FIG. 3).

    [0069] Conversely, no induction of the receptors for the opioids was detected with a commensal E. coli strain (FIG. 1). The induction of the opioid receptors and/or cannabinoid receptors by the Lactobacillus acidophilus strain is of the same order of magnitude as that obtained by TNF- at a dose of 10 ng/ml.

    Example 2

    1/Materials & Methods

    [0070] Bacterial strain. Lactobacillus acidophilus NCFM strain according to the present invention was grown anaerobically in deMan, Rogosa, Sharpe (MRS) broth (Becton Dickinson) overnight at 37 C. For in vitro experiments, bacteria were used when they reached the exponential phase. Cultures were assessed for purity by Gram staining prior to animal inoculation.

    [0071] Animals and experimental infection. Animal experiments were performed in accredited establishments at Institut Pasteur from Lille according to governmental guidelines. Balb/c mice were housed five per cage and had free access to standard mouse chow and tap water under a 12-h daylight cycle. Animals received 10.sup.9 CFU of Lactobacillus acidophilus strain, which were resuspended in 0.5% CMC (CarboxyMethyl Cellulose, Sigma), once a day by gastric gavage during fourteen days. Animals were killed by cervical dislocation. All colons were excised from animals and cut into two parts. One part was fixed overnight in 4% paraformaldehyde acid and embedded in paraffin. The second part of the colon was used for quantification of mu-opioid receptor (MOR), cannabinoid receptors (CB1 and CB2), and inflammatory cytokines TNF, KC, and IL-1 mRNA.

    [0072] Induction of TNBS colitis and study design. Since the expression of MOR is regulated by inflammation (Philippe D et al, JCI 2003; Pol O et al, Mol Pharmacol 2001; Pol O et al, Curr Top Med Chem 2004), we used TNBS-induced colitis as a positive control. Animal experiments were performed in accredited establishments at Institut Pasteur from Lille according to governmental guidelines. Animals were housed five per cage and had free access to standard mouse chow and tap water. For colitis induction, mice were anesthetized for 90-120 minutes and received an intrarectal administration of TNBS (40 l, 150 mg/kg) dissolved in a 1:1 mixture of 0.9% NaCl with 100% ethanol. Control mice received a 1:1 mixture of 0.9% NaCl with 100% ethanol or a saline solution using the same technique. Animals were sacrificed 4 days after TNBS administration.

    Quantitative real-Time PCR

    [0073] Total RNA was isolated from whole colonic tissues using Rneasy kit (Macherey Nagel, Hoerdt, France) according to the manufacturer's instructions. RNA quantification was performed using spectrophotometry. After treatment at 37 C. for 30 min with 20-50 units of RNase-free DNase I (Roche Diagnostics Corporation, Indianapolis, Ind., USA), oligo-dT primers (Roche Diagnostics Corporation, Indianapolis, USA) were used to synthesize single-stranded cDNA. mRNAs were quantified using SYBR green Master Mix (Applera, Courtaboeuf, France) with specific mouse oligonucleotides (see table I), in a GeneAmp Abiprism 7000 (Applera, Courtaboeuf, France). In each assay, calibrated and no-template controls were included. Each sample was run in triplicate. SYBR green dye intensity was analyzed using the Abiprism 7000 SDS software (Applera, Courtaboeuf, France). All results were normalized to the unaffected housekeeping gene -actin.

    TABLE-US-00002 TABLEI Genes Primersequences(5'.fwdarw.3') -actin S:5'-gggTCAgAAggATTCCTATg-3' AS:5' ggTCTCAAACATgATCTggg-3' MOR S:5'-CCGGCAGCCCTTCCA-3' AS:5'-GAGGCCCACTACACACACGAT-3' CB1 S:5' .GCCCGCATGGACATTAGG-3' AS:5'AGGGCCCCAGCAGATGA-3' CB2 S:5'-CTCAATTTTTCTGGTCCCTATG-3' AS:5-AGTCTGGCACCGCTAAACAAG-3' TNFalpha S:5'-TgggAgTAgACAAggTACAACCC-3' AS:5' CATCTTICTCAAAATTCgAgTgACAA-3' IL-1beta S:5'-gATCCACACTCTCCAgCTgCA-3' AS:5'-CAACCAACAAgTgATATTCTCCATg-3' KC S:5'-ggCgCCTATCgCCAATg-3' AS:5'-CTggATgTTCTTgAggTgAATCC-3'

    MOR-CB1-CB2 Immunohistochemistry

    [0074] Immunohistochemistry was performed on colon embedded-paraffin sections of mice receiving the Lactobacillus acidophilus strain. Untreated animals were used as controls. After permeabilisation during 5 min in PBS containing 0.1% triton X-100 at 4 C., sections were incubated for 15 min with 1.5% goat normal serum and 15 min with blocking buffer (1% BSA in milk) to minimize non-specific adsorption of the antibodies. The tissues were subsequently incubated with the rabbit polyclonal primary antibody directed against CB1 (1:200, Cayman Chemical, Ann Arbor, USA) or CB2 (1:10, Alpha Diagnostic, San Antonio, USA) or MOR (1:500, Diasorin, Antony, France) for 2 to 12 hours at room temperature. Sections were then incubated for 1 h at room temperature with Alexa 488 goat anti-rabbit IgG conjugated to FITC fluorochrome (dilution 1:100, Dako Laboratories, Trappes, France). Between each stage, sections were rinsed twice for 5 min in PBS containing 0.05% triton X-100. Then slides were counterstained with Hoescht solution (0.125 mg/mL) and mounted for microscopy. Negative controls consisted of staining with normal rabbit serum instead of specific antibody. Immunofluorescence was revealed under a fluorescence microscope (Leica, Bensheim, Germany). The number of MOR, CB1 and CB2 immunoreactive epithelial cells was counted in five different high power fields (HPF) and expressed per 100 epithelial cells.

    2/Results:

    [0075] The results are presented in FIGS. 4 to 13.

    [0076] 1) Lactobacillus acidophilus induces in vivo MOR mRNA expression in the colon of mice (FIG. 4).

    [0077] After two weeks of Lactobacillus acidophilus administration (10.sup.9 CFU per day), a 24 fold increase of MOR mRNA expression was found in the colon by comparison with untreated animals (p<0.05). This induction of MOR mRNA by the Lactobacillus acidophilus strain was more important compared to the two fold induction found in our positive controls corresponding to colitis induced by TNBS (FIG. 4).

    [0078] 2) Lactobacillus acidophilus induce in vivo expression of MOR, CB1 and CB2 in colonic epithelial cells of mice (FIGS. 8-13)

    [0079] To evaluate at the translational level the induction of MOR, CB1 and CB2 specifically on epithelial cells of the colon, we performed immunohistochemistry using antibodies directed specifically against these receptors. In all sections, epithelial stained cells for MOR (6010 vs 53%), CB1 (608 vs 204%) or CB2 (407 vs 205%) were significantly more numerous in mice receiving the Lactobacillus acidophilus strain compared to control mice (FIGS. 8-13). The green staining was mainly localized in epithelial cells located at the surface of the epithelium, in contact with luminal bacteria (FIGS. 8-13). Controls omitting the first antibody or the use of an irrelevant antibody were negative.

    [0080] 3) Lactobacillus acidophilus administration is associated with a decrease inflammatory cytokine expression in the colon of mice (FIGS. 5-7)

    [0081] In order to evaluate if the Lactobacillus acidophilus-induced expression of MOR, CB1 and CB2 by colonic epithelial cells may have functional significance in mice, we compared the mRNA levels of different inflammatory cytokines in untreated mice and animals receiving the Lactobacillus acidophilus strain during 14 days. More than 50% decreased expression of inflammatory cytokines TNF, KC and IL-1 mRNA levels was observed in Lactobacillus acidophilus-treated animals compared to controls suggesting that Lactobacillus acidophilus strain reduces the physiological expression of inflammatory cytokines in the colon of mice through at least in part an overexpression of MOR, CB1 and CB2 by epithelial cells.

    Example 3

    1/Materials and Methods

    [0082] In vitro, epithelial colonic cells HT-29 or Caco-2 were incubated during 0 to 6 hours with different probiotics or bacteria (100 bacteria/cell): L. acidophilus (NCFM), L. salivarius (UCC118), L. paracasei (LPC37), commensal E. coli, adherent-invasive E. coli (LF82). The role of the NFkappaB pathway in the induction of the expression of the mu-opioid receptor (MOR) and of the cannabinoid receptors (CB1 and CB2) by probiotics was tested by pre-treating the HT-29 cells by a specific inhibitor, the caffeic acid phenetyl ester (CAPE). TNFalpha (10 ng/ml, 2 hours), which is an inductor of the expression of G coupled proteins, was used as a positive control. After the selection of the most efficient probiotic for inducing in vitro the expression of the receptors (MOR, CB1 and CB2 receptors), an in vivo study was made with Balb/c mice (n=10) by oral administration of 10.sup.9 CFU of probiotic during 15 days. The expression of MOR, CB1 and CB2 was assessed in the epithelial cells and in the colon of mice by real time PCR and by immunohistochemistry. The inflammatory cytokines (TNF alpha, KC and IL-1 beta) mRNA was assessed by real time PCR in the colon of the mice.

    2/Results

    [0083] Only the strains L. acidophilus and L. salivarius, were able to quickly induce, already from the first hour of incubation, a strong MOR expression in the epithelial cells. This expression induction was similar to the expression induction observed with TNF alpha induced cells. For CB1 (848180 vs 22955, p<0.05) and CB2 (1498333 vs 341163, p<0.01), only L. Acidophilus induced the expression of these receptors. The inhibition of the NFkappaB pathway by CAPE did not induce modifications of the expression of MOR by epithelial cells stimulated with L. acidophilus. In vivo, the administration of L. acidophilus strongly induced the expression of MOR mRNA (240.75, p<0.01) at the colonic level. The study by immunohistochemistry confirmed in vivo the induction of the MOR, CB1 and CB2 expression by colonic cells in animals receiving L. acidophilus. The induction of these receptors is linked with a diminution of at least 50% of the expression of colonic inflammatory cytokines.

    3/Conclusion

    [0084] L. acidophilus is the most efficient strain for inducing the expression of MOR, CB1 and CB2 in vitro in epithelial cell lines and in vivo in the colon.