Nanotube-Based Biosensor for Pathogen Detection
20180038815 · 2018-02-08
Inventors
- April GU (Newton, MA, US)
- Nimet YILDIRIM (Malden, MA, US)
- Jinyoung LEE (Seoul, KR)
- Hanchul CHO (Yongin, Gyeonggi-do, KR)
- Ahmed Busnaina (Needham, MA)
Cpc classification
G01N33/5308
PHYSICS
G01N27/12
PHYSICS
G01N33/56916
PHYSICS
B82Y15/00
PERFORMING OPERATIONS; TRANSPORTING
B01L2300/023
PERFORMING OPERATIONS; TRANSPORTING
B01L3/502715
PERFORMING OPERATIONS; TRANSPORTING
G01N1/28
PHYSICS
B01L3/502761
PERFORMING OPERATIONS; TRANSPORTING
G01N33/54353
PHYSICS
International classification
G01N27/12
PHYSICS
B01L3/00
PERFORMING OPERATIONS; TRANSPORTING
G01N33/53
PHYSICS
Abstract
A simple and highly sensitive single walled carbon nanotube (SWNT) sensor is provided for detection of a variety of analytes, including small molecules, macromolecules, and pathogens. The high sensitivity, specificity, stability, and rapid operation of the sensor render it useful for detection and quantification of low level contaminants such as pharmaceuticals and pathogens in environmental samples, including wastewater and natural bodies of water.
Claims
1. A sensor for quantification of an analyte in a sample, the sensor comprising: a substrate; a pair of metal electrodes deposited onto a surface of the substrate with a gap between the electrodes; a bridge contacting both electrodes of the pair and forming a conductive pathway between the electrodes and across the gap, the bridge comprising or consisting of one or more single walled carbon nanotubes (SWNT) non-covalently functionalized with a recognition agent capable of specifically recognizing said analyte; wherein a conductometric circuit connected to said electrodes detects changes in resistance of the SWNT in relation to an amount of analyte present in the sample.
2. The sensor of claim 1, wherein the bridge comprises a plurality of aligned SWNT that are assembled on the substrate by a directed assembly method and not grown in situ.
3. The sensor of claim 2, wherein the assembled and aligned SWNT comprises SWNT that do not extend the full length from one of the pair of electrodes to the other.
4. The sensor of claim 1, wherein the recognition agent is an antibody, a nucleic acid aptomer, or a nucleic acid probe that hybridizes to a nucleic acid aptomer.
5. The sensor of claim 1, wherein the recognition agent is covalently attached to a coupling agent that is non-covalently attached to the SWNT via - stacking interactions.
6. The sensor of claim 1, wherein the coupling agent is 1-pyrenebutanoic acid succinimidyl ester.
7. The sensor of claim 1, wherein the conductometric circuit is built into the sensor.
8. The sensor of claim 1, wherein the conductometric circuit is external to the sensor.
9. The sensor of claim 1 or claim 7, which is configured to connect to an external sensor reading device.
10. The sensor of claim 7, further comprising a wireless transmitter.
11. The sensor of claim 7, further comprising a processor.
12. The sensor of claim 7, further comprising a display.
13. The sensor of claim 7, configured as a microfluidic or nanofluidic device.
14. The sensor of claim 13, further comprising a sample processing module.
15. The sensor of claim 13 or claim 14, further comprising one or more additional components selected from the group consisting of pumps, valves, filters, membranes, microdialyzers, and fluid reservoirs.
16. The sensor of claim 1 capable of providing quantification of an analyte in less than 30 min.
17. The sensor of claim 1 that is reusable or disposable.
18. The sensor of claim 1 that is produced by a nanoimprinting process.
19. The sensor of claim 1, wherein the substrate is flexible.
20. The sensor of claim 1, wherein the analyte is a microbe.
21. The sensor of claim 20, wherein the microbe is a virus, bacterium, fungus, or protist.
22. The sensor of claim 21, wherein the microbe is a bacterium, and the sensor is capable of quantifying the presence of the bacterium at a concentration from 1 to about 1,000,000 CFU/mL in the sample.
23. The sensor of claim 22, wherein the bacterium is Escherichia coli.
24. The sensor of claim 21, wherein the microbe is a virus, and the sensor is capable of quantifying the virus at a concentration of 10-10,000 PFU/mL in the sample.
25. The sensor of claim 24, wherein the virus is adenovirus.
26. The sensor of claim 1, wherein the analyte is a pharmaceutical, a hormone, a toxin, or a heavy metal.
27. The sensor of claim 1, wherein the analyte is a macromolecule.
28. The sensor of claim 1, wherein the sample is an environmental sample.
29. The sensor of claim 1, wherein the sample is wastewater, tapwater, or drinking water.
30. The sensor of claim 1, wherein the sample is a bodily fluid from a subject.
31. The sensor of claim 1 that shares a common substrate with one or more other sensors, the other sensors capable of quantifying said analyte or a different analyte.
32. A system for quantifying an analyte, the system comprising the sensor of claim 1 and one or more additional devices to assist in quantifying the analyte.
33. The system of claim 32, comprising a sensor reading device.
34. The system of claim 33, wherein the sensor and reading device are integrated into a single unit.
35. The system of claim 33, wherein the reading device is a separate unit from the sensor.
36. The system of claim 35, wherein the sensor attaches to or fits within the reading device for analysis.
37. The system of claim 33, wherein the reading device comprises one or more modules selected from the group consisting of a receiver, a transmitter, a display, a programmable processor, and a sample processing module.
38. The system of claim 33, wherein the reading device comprises or consists of a microfluidic or nanofluidic device.
39. A method of quantifying an analyte, the method comprising the steps of: (a) providing the sensor of any of claims 1-31 or the system of any of claims 32-38 and a sample suspected of containing the analyte, wherein the recognition agent of the sensor is a nucleic acid probe that hybridizes to a nucleic acid aptamer that specifically binds the analyte; (b) optionally conditioning the sample by filtration, dilution, concentration, dialysis, centrifugation, or another method; (c) contacting the sample, or the conditioned sample, with the aptamer and allowing the aptamer to bind to the analyte; (d) separating unbound aptamer from the analyte; (e) hybridizing the unbound aptamer obtained in step (d) to the nucleic acid probe in the sensor; and (f) determining a change in conductance or resistance of the SWNT in the sensor.
40. The method of claim 39, wherein step (f) comprises applying a series of different step voltages and measuring the current at each voltage.
41. The method of claim 40, wherein the voltages are in the range 0 to about 100 mV.
42. The method of claim 39, further comprising calibrating the sensor using a series of standard solutions having known concentrations of the analyte.
43. The method of claim 39 capable of quantifying the analyte in less than 30 min.
44. The method of claim 39, wherein the analyte is a microbe.
45. The method of claim 44, wherein the microbe is a virus, bacterium, fungus, or protist.
46. The method of claim 34, wherein the analyte is a bacterium, and the method provides a linear response over the range from about 1 to about 1,000,000 CFU/mL using a plot of log(bacteria concentration) vs. R/R0, where R0 is the SWNT resistance prior to adding the sample, and R is the SWNT resistance in the presence of the sample minus R0.
47. The method of claim 46, wherein the bacterium is Escherichia coli.
48. The method of claim 44, wherein the microbe is a virus, and the method provide a linear response over the range from about 10 to about 10,000 PFU/mL using a plot of log(virus concentration) vs. R/R0, where R0 is the SWNT resistance prior to adding the sample, and R is the SWNT resistance in the presence of the sample minus R0.
49. The method of claim 48, wherein the virus is adenovirus.
50. The method of claim 39, wherein the analyte is a pharmaceutical, a hormone, a toxin, or a heavy metal.
51. The method of claim 39, wherein the analyte is a macromolecule.
52. The method of claim 39, wherein the sample is an environmental sample.
53. The method of claim 39, wherein the sample is wastewater, tapwater, or drinking water.
54. The method of claim 39, wherein the sample is a bodily fluid from a subject.
55. A method of quantifying an analyte, the method comprising the steps of: (a) providing the sensor of any of claims 1-31 or the system of any of claims 32-38 and a sample suspected of containing the analyte, wherein the recognition agent of the sensor is an antibody that specifically binds to the analyte; (b) optionally conditioning the sample by filtration, dilution, concentration, dialysis, centrifugation, or another method; (c) contacting the sample, or the conditioned sample, with the SWNT of the sensor and allowing the analyte to bind to the antibody; and (d) determining a change in conductance or resistance of the SWNT in the sensor.
56. The method of claim 55, wherein step (d) comprises applying a series of different step voltages and measuring the current at each voltage.
57. The method of claim 56, wherein the voltages are in the range 0 to about 100 mV.
58. The method of claim 55, further comprising calibrating the sensor using a series of standard solutions having known concentrations of the analyte.
59. The method of claim 55 capable of quantifying the analyte in less than 30 min.
60. The method of claim 55, wherein the analyte is a microbe.
61. The method of claim 60, wherein the microbe is a virus, bacterium, fungus, or protist.
62. The method of claim 55, wherein the analyte is a bacterium, and the method provides a linear response over the range from about 1 to about 1,000,000 CFU/mL using a plot of log(bacteria concentration) vs. R/R0, where R0 is the SWNT resistance prior to adding the sample, and R is the SWNT resistance in the presence of the sample minus R0.
63. The method of claim 62, wherein the bacterium is Escherichia coli.
64. The method of claim 60, wherein the microbe is virus, and the method provide a linear response over the range from about 10 to about 10,000 PFU/mL using a plot of log(virus concentration) vs. R/R0, where R0 is the SWNT resistance prior to adding the sample, and R is the SWNT resistance in the presence of the sample minus R0.
65. The method of claim 64, wherein the virus is adenovirus.
66. The method of claim 55, wherein the analyte is a pharmaceutical, a hormone, a toxin, or a heavy metal.
67. The method of claim 55, wherein the analyte is a macromolecule.
68. The method of claim 55, wherein the sample is an environmental sample.
69. The method of claim 55, wherein the sample is wastewater, tapwater, or drinking water.
70. The method of claim 55, wherein the sample is a bodily fluid from a subject.
71. A method of fabricating the sensor for quantifying an analyte, the method comprising the steps of: (a) depositing a pair of electrodes on an insulating surface of a substrate, with a gap between the electrodes; (b) depositing one or more SWNT to form a conductive bridge between the electrodes and across the gap; (c) functionalizing the SWNT non-covalently with a recognition agent capable of specifically recognizing said analyte; wherein a conductometric circuit connected to said electrodes detects changes in resistance of the SWNT in relation to an amount of analyte present in the sample.
72. The method of claim 71, wherein in step (b) one or more SWNT are deposited using an electric field-assisted directed assembly process.
73. The method of claim 71, wherein the recognition agent is covalently attached to a coupling agent that is non-covalently attached to the SWNT via - stacking interactions.
74. The method of claim 73, wherein the coupling agent is 1-pyrenebutanoic acid succinimidyl ester.
75. The method of claim 71, further comprising fabricating a conductometric circuit on the substrate.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
DETAILED DESCRIPTION OF THE INVENTION
[0043] The invention provides a simple and highly sensitive single walled carbon nanotube (SWNT) based sensor for a wide variety of analytes, including chemicals of low molecular weight (e.g., <1500 Da), macromolecules, and microbes, including pathogenic microbes. The sensor relies on functionalization of the SWNT with analyte-specific aptamers or antibodies. The sensor can be used with different assay formats, including a direct detection mode, where the analyte binds to a recognition agent (e.g., an antibody or aptamer) attached to the SWNT, or it can be used in an indirect competitive detection mode, in which a sample is mixed with an aptamer that specifically binds to the analyte, and unbound aptamer is detected by its ability to hybridize to a complementary or partially complementary probe sequence, which is attached to the SWNT and serves as recognition agent. The assays produce linear standard curves over a wide range of concentrations, e.g., down to the low nM level for small molecules and down to about 1 CFU/mL for bacteria and 1 PFU/mL for viruses. The detection system can be regenerated successfully with low concentrations of SDS or NaOH solutions over 100 times without significant deterioration of performance. Specificity is high, generally more than 80% over related analytes such as other viruses and bacteria. The sensor also allows rapid determinations of analyte concentration in a sample, generally in less than 1 hour and often in less than 30 minutes.
[0044]
[0045] The sensor can detect the presence or absence of, and quantify, within certain limits of detection, any analyte for which a specific recognition element can be obtained, wherein the recognition element can be coupled to SWNT resulting in an increase in resistance (or decrease in conductance) of the SWNT in the presence of the analyte. Examples of suitable analytes are chemicals (i.e., small organic molecules and certain inorganic compounds or elements, including any type of small molecule drug, toxic substances, food components, pesticides, insecticides, and the like), macromolecules (peptides, polypeptides, proteins, glycoproteins, nucleotides, nucleic acids, carbohydrates, polysaccharides, and the like), and cells (cells of a human or animal body, microbes such as viruses, bacteria, fungi, and protists, including pathogenic or diseased varieties thereof).
[0046] The analyte is present in a sample, which is preferably a liquid sample, although contents of solid or gaseous samples can be transferred into liquid solutions or suspensions for analysis. The liquid sample can be, for example, an environmental sample, such as from a natural body of water, or collected rain, snow, or ice (which can be melted to provide liquid), or it can be a waste liquid or effluent from an industrial plant or a municipal waste treatment system, or it can be purified or treated water from a potable water supply system, or drinking water in bottled or other form. The liquid sample can also be any type of bodily fluid or secretion from a human or animal body, such as blood, serum, plasma, or urine. If the concentration or form of the liquid sample is not suitable for direct assay by the sensor, the sample can be filtered, diluted, concentrated, dialyzed, precipitated, freeze-dried and reconstituted, or otherwise conditioned prior to analysis.
[0047] In order for the SWNT to be suitably functionalized, a coupling agent is non-covalently bound to the SWNT. Preferred coupling agents interact with SWNT by - interactions, which form a tight but non-covalent bond to the outer wall of the SWNT. One example of a suitable coupling agent is 1-pyrenebutanoic acid succinimidyl ester (PBSE), and related analogues or derivatives. PBSE is a versatile coupling agent which attaches to SWNT through non-covalent - stacking that does not damage the geometric and electronic configuration of the SWNT. Its aromatic hydrophobic domain spontaneously binds to the hydrophobic SWNT sidewalls through non-covalent molecular adsorption. Furthermore, the electrons enhance the electronic and thermal properties of SWNT. In addition, the hydrophilic domain of PBSE, the succinimidyl ester group, provides a reactive amine site that can provide covalent attachment sites for attaching a variety of biological and non-biological ligands to the PBSE and thus to the SWNT. Thus, any analogue or derivative of PBSE that preserves the - stacking interaction, usually through an unsaturated 6-membered carbon ring or similar aromatic ring structure, as well as a group subject to nucleophilic attack by amino groups or other groups on the recognition agent (e.g., an aptamer or antibody molecule) can be used. Preferably, the coupling agent also has a linker portion that separates the aromatic portion from the leaving group, in order to provide flexibility and reactivity with the recognition group. For example, the C4 linker of PBSE can be shortened to a C2 or C3 linker or lengthened up to a C12 linker; preferably, it is a C3, C4, or C5 linker.
[0048] While the recognition agent can be any binding molecule or ligand that forms a stable non-covalent or covalent bond with the analyte, or a molecular component of the analyte, preferred recognition agents are aptamers of DNA or other nucleic acids capable of hybridizing and forming double stranded molecules, and antibodies. Suitable antibodies include intact natural antibodies and analyte-binding fragments thereof, such as single chain antibodies, nanobodies, diabodies, F.sub.ab fragments, recombinant antibodies, and the like. Methods are known in the art for routinely generating both aptamers and antibodies with a high degree of specificity for binding practically any analyte. It is understood that binding of the recognition agent to the analyte can be routinely optimized with regard to time, concentration of analyte and recognition agent, and solution conditions.
[0049] The detection range and limit of detection (LOD) of the sensor for a given analyte will depend on the design of the assay as well as the quality of the recognition agent and chemistry of the coupling agent. In general, a broad range of linear dependence on analyte concentration can be obtained for chemicals in the range from about 1 nM to about 1 mM, or from about 1 nM to about 1 M, or from about 1 M to about 1 mM, or from about 10 nm to about 1 M, or from about 100 nM to about 100 M can be achieved. For bacteria, a linear detection range can be obtained over about 1 CFU/mL to about 1 million CFU/mL, or about 10 CFU/mL to about 100,000 CFU/mL, or about 10 CFU/mL to about 1 million CFU/mL, or less than about 100,000 CFU/mL, less than about 10,000 CFU/mL, less than about 1,000 CFU/mL, or less than about 100 CFU/mL. For viruses, a linear detection range can be obtained over about 1 PFU/mL to about 1 million PFU/mL, or about 10 CPU/mL to about 100,000 PFU/mL, or about 10 PFU/mL to about 1 million PFU/mL, or less than about 100,000 PFU/mL, less than about 10,000 PFU/mL, less than about 1,000 PFU/mL, or less than about 100 PFU/mL. The LOD for bacteria can be about 1, 2, 5, 10, or 20 CFU/mL, and for viruses can be about 1, 2, 5, 10, or 20 PFU/mL.
[0050] Detection assays according to the invention can be carried out in a short period of time, such as less than one hour, less than 50 min, less than 40 min, less than 30 min, less than 20 min, or less than 10 min.
EXAMPLES
Example 1
Fabrication of an SWNT-Based Sensor by a Nanoimprinting Process
[0051] A flexible biosensor was fabricated by directed assembly and printing transfer using a reusable damascene template. The method was similar to that described in Cho et al., 2015. The damascene template was fabricated as described in WO2013/070931. The damascene template and a plain gold template were used as electrode and counter electrode, respectively. Both the damascene template and counter electrode were immersed into a suspension of SWNT (0.001 wt % semiconducting SWNT). A DC power supply was used to apply a potential of 2 to 2.5V between the two electrodes, with a positive potential at the damascene template. Negatively charged SWNT were attracted onto the positively-charged conductive patterns on the damascene template. The template was then withdrawn at a constant pulling speed of 5 mm/min to 10 mm/min using a dip coater, while keeping the voltage on. Highly dense and uniform SWNT assembly was achieved on the conductive patterns in the damascene template.
[0052] Assembled SWNT were then transferred onto a polyethylene-naphthalate (PEN) film (Teonex Q65A, Teijin DuPont) using the nanoimprinting technique. To improve the surface energy of the PEN film so as to increase the transfer yield, the PEN film was pretreated with an oxygen inductively coupled plasma (ICP). A nanoimprint tool was utilized for the printing transfer process. So as to be above the glass transition temperature of PEN (115 C.), a process temperature of 160 C. was used, and 170 psi pressure was applied to the template and PEN film for 1 min. After cooling to room temperature, the film was gently peeled off from the template. Above the glass transition temperature, the PEN film engulfed the assembled SWNT tightly, and high yield transfer was achieved. Metal electrodes were fabricated on the PEN-based sensor as layers of Cr and Au (5 nm and 100 nm, respectively) which covered and contacted the SWNT bundles deposited by nanoimprinting. The electrodes were fabricated using photolithography, electron beam deposition, and a lift off process. An array of completed sensors is shown in
Example 2
Quantification of Oxytetracycline (OTC) Using an SWNT-Based Sensor
[0053] An indirect competitive mode sensing mechanism was used, which included steps of pre-mixing, measurement of resistance change, and regeneration. The indirect detection mode was deemed to be the best in view of the potential problems caused by the large number of contaminants in waste water samples and to a high non-specific adsorption onto sensor surface. Additionally, using an indirect detection mode with non-immobilized aptamers provides much more relaxed binding between OTC and the aptamers, and also reduces the required binding time. The sensor's sensing time, sensitivity, specificity, resistance to background interference and reusability were evaluated. The developed OTC sensing system exhibited a sensitive response concentration range and detection limit comparable to OTC levels in environmental water and therefore can be used for on-site analysis without any pre-concentration or treatment steps.
[0054] OTC was purchased from Sigma-Aldrich (MO, USA), and the linker; 1-pyrenebutanoic acid-succinimidyl ester (PBSE) was purchased from Invitrogen (CA, USA). A single-stranded DNA aptamer with binding specificity for OTC was isolated by a SELEX process from a random ssDNA library (Javed H. Niazi, Lee, Kim, & Gu, 2008) and, together with the corresponding probe-DNA, was purchased from Integrated DNA Technologies (USA). The sequences for the aptamer and the aminated probe-DNA were: 5-GGAATTCGCTAGCACGTTGACGCTGGTGCCCGGTTGTGGTGCGAGTGTTGTGTGGATC CGAGCTCCACGTG-3 (aptamer, SEQ ID NO:1) and 5-/5AmMC6/CACGTGGAGCTCGG ATCCACACAACA-3 (probe, SEQ ID NO:2). Both aptamer and probe DNA were dissolved in 100 mM PBS and kept frozen at 20 C. for storage. A buffer solution of 100 mM PBS was used for dissolving all DNA sequences, OTC, and water sample effluents, which contained 200 mM NaCl, 25 mM KCl, 10 mM MgCl.sub.2 and had a pH of 7.4. For sensor specificity tests, the antibiotics amoxicillin, diaminofen, genomiycin, amphotericin, and ciprofloxacin (Thermo Fisher Scientific Inc. PA, USA) were tested. For sidewall functionalization of CNT with PBSE, the transfer-printed SWNT electrodes were soaked in a PBSE solution (2 mg/ml PBSE in N,N dimethylformamide) for 2 h at room temperature, washed thoroughly with N,N-DMF to remove excess PBSE, and then with deionized water. The IV profile of the linker-modified SWNT was observed. Probe-DNA was dissolved in bicarbonate buffer (0.1 mM, pH 9.2) and then stored at 20 C. until use. For probe-DNA immobilization, PBSE-modified SWNT electrodes were incubated with 0.01 and 0.05 mg/ml probe DNA for overnight at 4 C. Excess probe-DNA was then removed by washing with phosphate buffer and deionized water, and the IV profile of the electrode was tested immediately.
[0055] Sensor resistance measurements were conducted using a probe station (4156C, Agilent Technologies Co., Ltd., USA) at ambient conditions. The electrical properties of the probe-modified SWNT device upon introduction of OTC aptamer was measured using meter probes (SE-TL, SIGNATONE, USA) connecting with source and drain (the gold electrodes). A pulsed source-drain bias of 0 to 100 mV was maintained throughout the measurements of sensor resistance, with a pulse width of 1.0 s. The plates were cleaned thoroughly with PBS (pH 7.4) and deionized water, and then dried with nitrogen gas after the electrical measurements for each sample.
[0056] The assay using the SWNT aptamer-based sensor for detection of OTC is represented in
[0057] Different concentrations of OTC (0, 10, 25, 50, 75, 100, 150, and 200 g/L) and 100 g/L OTC-aptamer were mixed for 6 minutes and injected onto the gold chip surface. Before this injection the IV profile was observed for the gold electrode. After 3 minutes to allow for hybridization of the free aptamers to the probe DNA (immobilized on the SWNT), the IV profile of the SWNT was observed again. The normalized changes in resistance (R/R.sub.0) were calculated for each OTC concentration. The increase in the OTC concentrations in the sample and known aptamer mixture led to proportional decrease in residual free aptamer, therefore the R/R.sub.0 decrease.
[0058] The linear range of OTC detection was between 10 and 75 g/L (20-325 nM), and the lower detection limit (LOD) was determined to be 1.125 g/L (2.5 nM), based on the dose response curve that is 3 times the signal standard deviation. Sensor specificity was assessed via comparison of the sensor signals of OTC with those other antibiotics, all at 150 g/L, and each data value the average of three independent experimental results. According to the results shown in
[0059] The repeatability and stability of the sensor for OTC detection were investigated, and the results are shown in
Example 3
Quantification of Adenovirus Using an SWNT-Based Sensor
[0060] The sensing mechanism of the antibody-based SWNT biosensor for direct detection of adenovirus is represented in
[0061] Adenovirus hexon mouse anti-virus monoclonal (3G0) antibody-LS-055826 was purchased from LifeSpan Biosciences, Inc. Seattle, Wash. Adenovirus serotypes 5 (rAd5), Rotavirus Wa, and Salmonella Typhimurium (CGMCC 1.1589) were purchased from SinoGenoMax Co., Ltd. (Beijing, China). Lentivirus (LV-CMV-vector control) was purchased from KeraFAST, Inc. (Boston, Mass.). E-coli 0157:H7 strain was kindly provided by Dr. Kim Lewis from Biology Department at Northeastern University (MA, U.S.). Human lung carcinoma cell line A549 was obtained from Prof. Rebecca Carrier's laboratory in Chemical Engineering Department at Northeastern University. Human lung carcinoma cell line A549 was cultures in the condition described by Jiang et al., 2009. A549 cells were grown in Ham's F12 medium containing 5% FBS, 2 mML-glutamine, 100U/m1 penicillin, and 100 mg/ml streptomycin. Cells were sub-cultured at 4- to 5-day intervals with a trypsin-EDTA solution. Adenovirus plaque assays using A549 cells was as described previously (Jiang et al., 2009).
[0062] A dose-response curve for adenovirus detection was determined for an adenovirus concentration from 1 PFU/mL to 10.sup.6 PFU/ml).
Example 4
Quantification of E. coli Using an SWNT-Based Sensor
[0063] Different E. coli strains (E. coli O157 H:7, E. coli MG1655, E. coli MV1978, E. coli MV1973) were kindly provided from Professor Kim Lewis at the Antimicrobial Discovery Center in Northeastern. Bacillus cereus and Comamonas testosterone were isolated from the aeration basin of Clemson Municipal Wastewater Treatment Plant by Prof Ferdi L Hellweger's group from Civil and Environmental Engineering at Northeastern University. Recombinant Adenovirus serotype 5 (rAd5), Rotavirus Wa, and Salmonella Typhimuriu (CGMCC 1.1589) were obtained from Tsinghua University (Beijing, China). All bacteria strains were inoculated into lysogeny broth (LB) and grown for 16 h at 37 C. The cultures containing bacteria were centrifuged at 3,000 rpm for 5 min and washed with phosphate-buffered solution (PBS) (10 mM, pH 7.4) three times. The pellets were then dispersed in PBS. Serial dilutions of cultures were made in PBS; 50 l diluted suspension were inoculated onto agar plates for enumeration, and after growing them in the same conditions, they were counted by light microscope. The bacterial densities were determined also by measuring the OD.
[0064] A DNA aptamer against E-coli O157:H7 (isolated by a SELEX process from a random ssDNA library), probe DNA, and non-specific DNA were purchased from Integrated DNA Technologies (IA, USA). The sequences were: 5-GTC TGC GAG CGG GGC GCG GGC CCG GCG GGG GATGCGC-3 (aptamer, SEQ ID NO:3), 5-NH.sub.2(CH.sub.2).sub.6-GCGCATCCCCCGCCGGGCC-3 (probe, SEQ ID NO:4), 5-Cy5.5-CCGGTGGG TGGTCAGGTGGGATAGCGTTCCGCGTATGGCCCAGCCATCACGGGTTCGCACCA-3 (non-specific DNA sequence used for control, SEQ ID NO:5). Aptamer, probe, and non-specific DNA oligonucleotides were dissolved in 100 mM PBS (pH 7.4) and kept frozen at 20 C. for storage.
[0065] The sensing mechanism of the aptamer-based biosensor for detection of E-coli is represented in
[0066] An increase in E-coli concentrations in the sample led to a proportional decrease in residual free aptamer, and therefore a proportional decrease in the resistance change.
[0067] This application claims the priority of U.S. Provisional Application No. 62/092,534, filed 16 Dec. 2014 and entitled Pathogen Detection in Environmental Waste Water, the whole of which is hereby incorporated by reference.
[0068] As used herein, consisting essentially of allows the inclusion of materials or steps that do not materially affect the basic and novel characteristics of the claim. Any recitation herein of the term comprising, particularly in a description of components of a composition or in a description of elements of a device, can be exchanged with consisting essentially of or consisting of.
[0069] While the present invention has been described in conjunction with certain preferred embodiments, one of ordinary skill, after reading the foregoing specification, will be able to effect various changes, substitutions of equivalents, and other alterations to the compositions and methods set forth herein.
REFERENCES
[0070] Chen, R. J., Zhang, Y., Wang, D., & Dai, H. (2001). Noncovalent sidewall functionalization of single-walled carbon nanotubes for protein immobilization. Journal of the American Chemical Society, 123(16), 3838-3839. [0071] Cho, H., Somu, S., Lee, J. Y., Jeong, H., & Busnaina, A. (2015). High-rate nanoscale offset printing process using directed assembly and transfer of nanomaterials. Adv Mater, 27(10), 1759-1766. doi: 10.1002/adma.201404769. [0072] Jiang, H., Patel, P. H., Kohlmaier, A., Grenley, M. O., McEwen, D. G., & Edgar, B. A. (2009). Cytokine/Jak/Stat signaling mediates regeneration and homeostasis in the Drosophila midgut. Cell, 137(7), 1343-1355.