SYNERGISTIC CANCER TREATMENT
20180036309 ยท 2018-02-08
Inventors
- Scott W. Lowe (New York, NY)
- Neal Rosen (New York, NY, US)
- Eusebio Manchado-Robles (New York, NY, US)
- Susann Weissmueller (New York, NY, US)
Cpc classification
C12Y207/10001
CHEMISTRY; METALLURGY
A61K31/519
HUMAN NECESSITIES
C12Y207/12002
CHEMISTRY; METALLURGY
A61K45/06
HUMAN NECESSITIES
G01N2800/52
PHYSICS
A61K31/713
HUMAN NECESSITIES
G01N2333/912
PHYSICS
C12Q2600/106
CHEMISTRY; METALLURGY
A61K31/5025
HUMAN NECESSITIES
G01N33/57492
PHYSICS
A61K31/496
HUMAN NECESSITIES
A61K31/506
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
International classification
A61K31/519
HUMAN NECESSITIES
A61K31/713
HUMAN NECESSITIES
Abstract
The use of mitogen activated kinase inhibition therapy in combination with receptor tyrosine kinase therapy for the treatment of cancer is described.
Claims
1. A method of treating cancer in a subject, comprising: administering receptor tyrosine kinase (RTK) inhibition therapy to a subject who has received or is receiving mitogen activated kinase (MAK) inhibition therapy.
2. The method of claim 1, wherein the subject shows resistance to the MAK inhibition therapy.
3. The method of claim 1, wherein the subject does not show resistance to the MAK inhibition therapy.
4. The method of claim 1, wherein the subject is suffering from a KRAS mutant tumor.
5. The method of claim 4, wherein the KRAS mutant tumor is or comprises a lung tumor.
6. The method of claim 1, wherein the subject has tumors with detectable FRS2 phosphorylation.
7. A method of treating cancer in a subject, comprising: administering to a subject suffering from or susceptible to a KRAS mutant tumor a combination of MAK inhibition therapy and RTK inhibition therapy.
8. The method of claim 7, wherein the MAK inhibition therapy is or comprises MEK inhibition therapy.
9. The method of claim 8, wherein the MEK inhibition therapy is or comprises administration of a MEK inhibitor.
10. The method of claim 9, wherein the MEK inhibitor is or comprises an agent that reduces level and/or activity of a MEK.
11. The method of claim 9, wherein the MEK inhibitor binds to the MEK.
12. The method of claim 9, wherein the MEK inhibitor binds to a ligand of the MEK.
13. The method of claim 9, wherein the MEK inhibitor binds to a transcript encoding the MEK.
14. The method of claim 9, wherein the MEK inhibitor binds to a kinase that phosphorylates the MEK.
15. The method of claim 9, wherein the MEK inhibitor is or comprises an antibody agent.
16. The method of claim 9, wherein the MEK inhibitor is or comprises a small molecule.
17. The method of claim 9, wherein the MEK inhibitor is or comprises a nucleic acid.
18. The method of claim 9, wherein the MEK inhibitor is selected from the group consisting of Trametinib.
19. The method of claim 7, wherein the RTK inhibitor is or comprises an agent that reduces level and/or activity of a RTK.
20. The method of claim 19, wherein the RTK inhibitor binds to the RTK.
21. The method of claim 19, wherein the RTK inhibitor binds to a ligand of the RTK.
22. The method of claim 19, wherein the RTK inhibitor binds to a transcript encoding the RTK.
23. The method of claim 19, wherein the RTK inhibitor binds to a kinase that phosphorylates the RTK.
24. The method of claim 19, wherein the RTK inhibitor is or comprises an antibody agent.
25. The method of claim 19, wherein the RTK inhibitor is or comprises a small molecule.
26. The method of claim 19, wherein the RTK inhibitor is or comprises a nucleic acid.
27. The method of claim 19, wherein the RTK inhibitor is selected from the group consisting of Ponatinib, BGJ398 or AZD4547.
28. The method of claim 7, wherein the step of administering comprises administering one or both of the MAK and RTK inhibitors with reduced dosing relative to an appropriate reference regimen.
29. The method of claim 27, wherein the appropriate reference regimen is a monotherapy regimen for the relevant inhibitor.
30. The method of claim 28, wherein the appropriate reference regimen is one correlated with clinical benefit in subjects suffering from a KRAS mutant tumor.
31. A method of selecting RTK inhibition therapy comprising steps of: determining in a sample from a subject who has received MEK inhibition therapy a level or activity of one or more RTKs; determining that the level or activity is elevated relative to an appropriate reference level; determining an appropriate RTK inhibition therapy based on the level or activity of one or more RTKs.
32. The method of claim 31, wherein the appropriate reference level is a level observed in a sample from the subject prior to administration of the MEK inhibition therapy.
33. The method of claim 31, wherein the appropriate reference level is a level correlated with absence of RTK induction due to MEK inhibition therapy.
34. The method of claim 31, wherein the step of determining comprises detecting RTK level on a cell surface.
35. The method of claim 31, wherein the step of determining comprises detecting level of a nucleic acid encoding the RTK.
36. The method of claim 31, wherein the step of determining comprises detecting RTK activity.
37. The method of claim 31, wherein the sample is or comprises tumor cells.
38. A method comprising steps of: contacting a tumor sample from a subject receiving MEK inhibition therapy with reagents that detect FRS2 phosphorylation state; and detecting the FRS2 phosphorylation state in the sample.
39. A method of treating cancer in a subject, comprising: administering therapy that does not include receptor tyrosine kinase (RTK) inhibition therapy to a subject having tumors in which FRS2 phosphorylation has not been detected.
40. A method comprising steps of detecting a change in FRS2 phosphorylation state in a tumor sample from a subject receiving MEK inhibition therapy; and altering therapy received by the subject.
41. The method of claim 40, wherein the change comprises detecting enhanced FRS2 phosphorylation; and the step of altering comprises administering RTK inhibition therapy
42. The method of claim 40 wherein: the subject is further receiving or has further received RTK inhibition therapy; the change is a decrease in FRS2 phosphorylation; and the step of altering comprises terminating RTK inhibition therapy
Description
BRIEF DESCRIPTION OF THE DRAWING
[0008] The following figures are presented for the purpose of illustration only and are not intended to be limiting
[0009]
[0010]
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
DEFINITIONS
[0039] Administration: As used herein, the term administration refers to the administration of a composition to a subject or system (e.g., to a cell, organ, tissue, organism, or relevant component or set of components thereof). Those of ordinary skill will appreciate that route of administration may vary depending, for example, on the subject or system to which the composition is being administered, the nature of the composition, the purpose of the administration, etc. For example, in certain embodiments, administration to an animal subject (e.g., to a human) may be bronchial (including by bronchial instillation), buccal, enteral, interdermal, intra-arterial, intradermal, intragastric, intramedullary, intramuscular, intranasal, intraperitoneal, intrathecal, intravenous, intraventricular, mucosal, nasal, oral, rectal, subcutaneous, sublingual, topical, tracheal (including by intratracheal instillation), transdermal, vaginal and/or vitreal. In some embodiments, administration may involve intermittent dosing. In some embodiments, administration may involve continuous dosing (e.g., perfusion) for at least a selected period of time.
[0040] Agent: The term agent as used herein may refer to a compound or entity of any chemical class including, for example, polypeptides, nucleic acids, carbohydrates, lipids, small molecules, metals, and/or combinations thereof. In some embodiments, an agent is or comprises a natural product in that it is found in and/or is obtained from nature. In some embodiments, an agent is or comprises one or more entities that is man-made in that it is designed, engineered, and/or produced through action of the hand of man and/or is not found in nature. In some embodiments, an agent may be utilized in isolated or pure form; in some embodiments, an agent may be utilized in crude form. In some embodiments, potential agents are provided as collections or libraries, for example that may be screened to identify or characterize active agents within them. In some particular embodiments, an agent is or comprises a small molecule, an antibody, an antibody fragment, an aptamer, an siRNA, an shRNA, a DNA/RNA hybrid, an antisense oligonucleotide, a ribozyme, a peptide, a peptide mimetic, a peptide nucleic acid (PNA) etc. In some embodiments, an agent is or comprises a polymer. In some embodiments, an agent is not a polymer and/or is substantially free of any polymer. In some embodiments, an agent contains at least one polymeric moiety. In some embodiments, an agent lacks or is substantially free of any polymeric moiety. In some embodiments, an agent is provided and/or utilized in salt form.
[0041] Antiproliferative Agent: As used herein, the term antiproliferative agent refers to a substance that, when administered or applied to a source of dividing cells (e.g., a cell culture, a tissue sample, an organism, etc), reduces the extent (e.g., the number of cell doublings) and/or frequency (e.g., the rate of cell division events) of cell proliferation as compared with that observed under otherwise comparable conditions absence the antiproliferative agent.
[0042] Approximately: As used herein, the term approximately or about, as applied to one or more values of interest, refers to a value that is similar to a stated reference value. In certain embodiments, the term approximately or about refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).
[0043] Combination therapy: As used herein, the term combination therapy refers to those situations in which a subject is simultaneously exposed to two or more therapeutic regimens or modalities (e.g., to two or more therapeutic agents). In some embodiments, two or more regimens or modalities are administered or applied simultaneously (e.g., one or more individual doses of each of two or more agents, may be administered at substantially the same time); in some embodiments, such regimens or modalities may be administered sequentially (e.g., at least a first dose of a first agent is administered prior to at least a first dose of a second agent); in some embodiments, such regimens or modalities such that individual doses or applications overlap.
[0044] Determine: Certain methodologies described herein include a step of determining. Those of ordinary skill in the art, reading the present specification, will appreciate that such determining can utilize or be accomplished through use of any of a variety of techniques available to those skilled in the art, including for example specific techniques explicitly referred to herein. In some embodiments, determining involves manipulation of a physical sample. In some embodiments, determining involves consideration and/or manipulation of data or information, for example utilizing a computer or other processing unit adapted to perform a relevant analysis. In some embodiments, determining involves receiving relevant information and/or materials from a source. In some embodiments, determining involves comparing one or more features of a sample or entity to a comparable reference.
[0045] Dosage form: and unit dosage form, as used herein, the term dosage form refers to physically discrete unit of a therapeutic agent for a subject (e.g., a human patient) to be treated. Each unit contains a predetermined quantity of active material calculated or demonstrated to produce a desired therapeutic effect when administered to a relevant population according to an appropriate dosing regimen. For example, in some embodiments, such quantity is a unit dosage amount (or a whole fraction thereof) appropriate for administration in accordance with a dosing regimen that has been determined to correlate with a desired or beneficial outcome when administered to a relevant population (i.e., with a therapeutic dosing regimen). It will be understood, however, that the total dosage administered to any particular patient will be selected by a medical professional (e.g., a medical doctor) within the scope of sound medical judgment.
[0046] Dosing regimen: (or therapeutic regimen), as used herein is a set of unit doses (typically more than one) that are administered individually to a subject, typically separated by periods of time. In some embodiments, a given therapeutic agent has a recommended dosing regimen, which may involve one or more doses. In some embodiments, a dosing regimen comprises a plurality of doses each of which are separated from one another by a time period of the same length; in some embodiments, a dosing regimen comprises a plurality of doses and at least two different time periods separating individual doses. In some embodiments, the therapeutic agent is administered continuously (e.g., by infusion) over a predetermined period. In some embodiments, a therapeutic agent is administered once a day (QD) or twice a day (BID). In some embodiments, a dosing regimen comprises a plurality of doses each of which are separated from one another by a time period of the same length; in some embodiments, a dosing regimen comprises a plurality of doses and at least two different time periods separating individual doses. In some embodiments, all doses within a dosing regimen are of the same unit dose amount. In some embodiments, different doses within a dosing regimen are of different amounts. In some embodiments, a dosing regimen comprises a first dose in a first dose amount, followed by one or more additional doses in a second dose amount different from the first dose amount. In some embodiments, a dosing regimen comprises a first dose in a first dose amount, followed by one or more additional doses in a second dose amount same as the first dose amount. In some embodiments, a dosing regimen is correlated with a desired or beneficial outcome when administered across a relevant population (i.e., is a therapeutic dosing regimen).
[0047] Improve, increase, reduce, etc: As used herein, terms such as improve, increase, reduce, etc., which necessarily imply a comparison, refer to a comparison with an appropriate comparable reference or standard. For example, in some embodiments, level and/or activity of an agent or marker of interest may be reduced under a set of conditions or circumstances of interest (e.g., after administration of therapy) as compared with its level and/or activity under a comparable set of conditions (e.g., prior to administration of the therapy or after administration of the therapy to an appropriate reference subject). In some embodiments, an appropriate reference may be a historical reference. In some embodiments, an appropriate reference may be an average, e.g., as may be observed within or across a relevant population.
[0048] Inhibition Therapy: As used herein, the term inhibition therapy refers to administration of therapy such that level and/or activity of a target is reduced (e.g., as compared with that observed under otherwise comparable conditions absent administration of the therapy). In some embodiments, inhibition therapy involves administration of an inhibitor agent. In some embodiments, an inhibitor agent is one whose presence, level, or form may correlate with inhibition (e.g., reduction in level and/or activity) of a target, as compared for example with that observed under otherwise comparable conditions absent the inhibitor agent. In some embodiments, an inhibitor agent is a direct inhibitor in that it directly binds to or interacts with a target. In some embodiments, an inhibitor is an indirect inhibitor in that it may not bind to or interact with the target itself, but rather may bind to or interact with another entity, with the result that level and/or activity of the target is reduced. To give but a few examples, where a target is or comprises a polypeptide, an inhibitor agent may, for example, bind to the polypeptide (e.g., so that interaction with a binding partner is inhibited), may bind to an interaction partner of the polypeptide (e.g., such that interaction is inhibited), may bind to a substrate or product of the polypeptide (e.g., so that frequency or extent of a reaction is inhibited), may bind to a regulator of the polypeptide (e.g., so that inhibition by the regulator is enhanced or activation by the regulator is reduced), may bind to a nucleic acid encoding the polypeptide (e.g., so that it's expression is reduced), or to an agent that directs or impacts expression or processing thereof, etc. In general, an inhibitor agent may be of any chemical class (e.g., may be or comprise a carbohydrate, an isotope, a lipid, a metal, a nucleic acid, a polypeptide, a small molecule, etc), and/or in some instances may be or comprise a virus or cell.
[0049] Receptor tyrosine kinase: The term receptor tyrosine kinase, as used herein, refers to members of the protein family of receptor tyrosine kinases (RTK), which includes but is not limited to sub-families such as Epidermal Growth Factor Receptors (EGFR) (including ErbB1/EGFR, ErbB2/HER2, ErbB3/HER3, and ErbB4/HER4), Fibroblast Growth Factor Receptors (FGFR) (including FGF1, FGF2, FGF3, FGF4, FGF5, FGF6, FGF7, FGF18, and FGF21) Vascular Endothelial Growth Factor Receptors (VEGFR) (including VEGF-A, VEGF-B, VEGF-C, VEGF-D, and PIGF), RET Receptor and the Eph Receptor Family (including EphA1, EphA2, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA9, EphA10, EphB1, EphB2. EphB3, EphB4, and EphB6).
[0050] Reduced Dosing: as used herein refers to administration of a reduced number of doses, reduced frequency of doses, and/or reduced magnitude of one or more doses relative to appropriate relevant reference regimen.
[0051] Reference: as used herein the term reference describes a standard, control, or other appropriate reference against which a comparison is made as described herein. For example, in some embodiments, a reference is a standard or control agent, animal, individual, population, sample, sequence, series of steps, set of conditions, or value against which an agent, animal, individual, population, sample, sequence, series of steps, set of conditions, or value of interest is compared. In some embodiments, a reference is tested and/or determined substantially simultaneously with the testing or determination of interest. In some embodiments, a reference is a historical reference, optionally embodied in a tangible medium. Typically, as would be understood by those skilled in the art, a reference is determined or characterized under conditions comparable to those utilized in the assessment of interest.
[0052] Refractory: As used herein, the term refractory refers to any subject or condition that does not respond with an expected clinical efficacy following the administration of provided compositions as normally observed by practicing medical personnel.
[0053] Response: As used herein, a response to treatment may refer to any beneficial alteration in a subject's condition that occurs as a result of or correlates with treatment. Such alteration may include stabilization of the condition (e.g., prevention of deterioration that would have taken place in the absence of the treatment), amelioration of symptoms of the condition, and/or improvement in the prospects for cure of the condition, etc. It may refer to a subject's response or to a tumor's response. Tumor or subject response may be measured according to a wide variety of criteria, including clinical criteria and objective criteria. Techniques for assessing response include, but are not limited to, clinical examination, positron emission tomatography, chest X-ray CT scan, MRI, ultrasound, endoscopy, laparoscopy, presence or level of tumor markers in a sample obtained from a subject, cytology, and/or histology. Many of these techniques attempt to determine the size of a tumor or otherwise determine the total tumor burden. Methods and guidelines for assessing response to treatment are discussed in Therasse et. al., New guidelines to evaluate the response to treatment in solid tumors, European Organization for Research and Treatment of Cancer, National Cancer Institute of the United States, National Cancer Institute of Canada, J. Natl. Cancer Inst., 2000, 92(3):205-216. The exact response criteria can be selected in any appropriate manner, provided that when comparing groups of tumors and/or patients, the groups to be compared are assessed based on the same or comparable criteria for determining response rate. One of ordinary skill in the art will be able to select appropriate criteria.
[0054] Subject: as used herein, means any mammal, including humans. In certain embodiments of the present invention the subject is an adult, an adolescent or an infant. In some embodiments, terms individual or patient are used and are intended to be interchangeable with subject. Also contemplated by the present invention are the administration of the pharmaceutical compositions and/or performance of the methods of treatment in-utero.
[0055] Substantially: As used herein, the term substantially refers to the qualitative condition of exhibiting total or near-total extent or degree of a characteristic or property of interest. One of ordinary skill in the biological arts will understand that biological and chemical phenomena rarely, if ever, go to completion and/or proceed to completeness or achieve or avoid an absolute result. The term substantially is therefore used herein to capture the potential lack of completeness inherent in many biological and chemical phenomena.
[0056] Therapeutic regimen: A therapeutic regimen, as that term is used herein, refers to a dosing regimen whose administration across a relevant population is or is expected to be correlated with a desired or beneficial therapeutic outcome.
[0057] Therapeutically effective amount: as used herein, is meant an amount that produces the desired effect for which it is administered. In some embodiments, the term refers to an amount that is sufficient, when administered to a population suffering from or susceptible to a disease, disorder, and/or condition in accordance with a therapeutic dosing regimen, to treat the disease, disorder, and/or condition. In some embodiments, a therapeutically effective amount is one that reduces the incidence and/or severity of, and/or delays onset of, one or more symptoms of the disease, disorder, and/or condition. Those of ordinary skill in the art will appreciate that the term therapeutically effective amount does not in fact require successful treatment be achieved in a particular individual. Rather, a therapeutically effective amount may be that amount that provides a particular desired pharmacological response in a significant number of subjects when administered to patients in need of such treatment. In some embodiments, reference to a therapeutically effective amount may be a reference to an amount as measured in one or more specific tissues (e.g., a tissue affected by the disease, disorder or condition) or fluids (e.g., blood, saliva, serum, sweat, tears, urine, etc.). Those of ordinary skill in the art will appreciate that, in some embodiments, a therapeutically effective amount of a particular agent or therapy may be formulated and/or administered in a single dose. In some embodiments, a therapeutically effective agent may be formulated and/or administered in a plurality of doses, for example, as part of a dosing regimen.
[0058] Treatment: As used herein, the term treatment (also treat or treating), in its broadest sense, refers to any administration of a substance (e.g., provided compositions) that partially or completely alleviates, ameliorates, relives, inhibits, delays onset of, reduces severity of, and/or reduces incidence of one or more symptoms, features, and/or causes of a particular disease, disorder, and/or condition. In some embodiments, such treatment may be administered to a subject who does not exhibit signs of the relevant disease, disorder and/or condition and/or of a subject who exhibits only early signs of the disease, disorder, and/or condition. Alternatively or additionally, in some embodiments, treatment may be administered to a subject who exhibits one or more established signs of the relevant disease, disorder and/or condition. In some embodiments, treatment may be of a subject who has been diagnosed as suffering from the relevant disease, disorder, and/or condition. In some embodiments, treatment may be of a subject known to have one or more susceptibility factors that are statistically correlated with increased risk of development of the relevant disease, disorder, and/or condition.
DETAILED DESCRIPTION OF CERTAIN EMBODIMENTS
Protein Kinases and Malignancy
[0059] Protein kinases represent a large multigene family consisting of more than 500 proteins. Without wishing to be bound by any particular theory kinases can play a prominent role in the development and therefore treatment of a number of human diseases in oncology, neurology and immunology. Kinase function and expression is tightly regulated. In some embodiments, kinases can lead to proliferative disorders and/or malignancy due to, among other things, mutation, overexpression, over activation, or repression of activity.
Receptor Tyrosine Kinases
[0060] Receptor tyrosine kinases (RTKs) are cell surface receptors for, among other things, growth factors, cytokines, and hormones. In some embodiments, RTKs can regulate normal cellular processes. In some embodiments, RTKs can play a role in development and progression of many types of cancer.
[0061] Fibroblast growth factor receptors (FGFR) are a family of RTKs. FGFR family members often differ from one another, amongst other things, in their ligand affinities and tissue distribution. A full-length representative protein for example consists of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with, amongst other things, fibroblast growth factors, often setting in motion a cascade of downstream signals, ultimately influencing, among other things, mitogenesis and differentiation.
Ras Network Components and Signaling
[0062] In some embodiments, proteins that can regulate the activity of kinases can include members of the Ras superfamily. The Ras superfamily can include but is not limited to Ras, Rho, Ran, Rab and Arf Without wishing to be bound by any particular theory these family members share a common domain which provides GTPase and nucleotide exchange activity. In some embodiments, the Ras protein subfamily includes KRAS, NRAS, and HRAS. In some embodiments, the Ras subfamily plays a role in regulation of cell proliferation. In some embodiments, mutations in Ras subfamily proteins can lead to constitutively active proteins. In some embodiment the constitutive activity can lead to cancer.
[0063] In some embodiments, members of the Ras superfamily can regulate the activity of mitogen-activated protein kinases (MAPK) which are also or formerly known as extracellular signal-related kinases (ERK). In some embodiments, this can be referred to as the Ras/MAPK signaling pathway. Without wishing to be bound by any particular theory regulation of MAP kinase activity can occur as a result of a signaling cascade that is initiated by a molecule or extracellular ligand activating a receptor at the surface of a cell. In some embodiments, the receptor can be a receptor tyrosine kinase (RTK). In some embodiments, activation of the RTK leads to autophosphorylation which can promote binding of guanine nucleotide exchange factors (GEF) to the RTK. In some embodiments, binding of the GEF to a phosphorylated RTK leads to activation of the GEF which can promote the removal of GDP from a member of the Ras subfamily allowing the Ras subfamily member protein to bind GTP and become active. In some embodiments, the active Ras subfamily member phosphorylates a member of the Raf kinase family. In some embodiments the Raf kinase family can include A-Raf, B-Raf, and C-Raf. In some embodiments, Raf kinase family members can phosphorylate, amongst other things, MEK. In some embodiments phosphorylated MEK can activate downstream MAPK/ERKs.
FGFR1
[0064] Fibroblast growth factor receptor 1 (FGFR1), a member of the FGFR family, also known as basic fibroblast growth factor receptor 1, fms-related tyrosine kinase-2, and CD331, has ligands which are, among other things, members of the fibroblast growth factor family.
[0065] Somatic mutations and/or gene amplifications of FGFR1 occur in several diseases including breast and lung cancers. Amplified expression of FGFR1 is generally associated with poor prognosis and relapse in cancer patients. Amplification of FGFR1 is a feature in 20% of lung cancer patients. Chromosomal translocations can also be a factor in FGFR1's involvement in cancer.
[0066] In some embodiments, the role of FGFR1 in cancer is abetting cancer progression and metastasis. Fibroblast growth factors can trigger the autophosphorylation of FGFR1 at important tyrosine residues within the activation loop of the tyrosine kinase domain. This autophosphorylation, among other things, results in a change of the structural conformation of the tyrosine kinase domain from an inactive form to an active one. Activated tyrosine kinase domains can phosphorylate tyrosine residues at other sites in FGFR1 along with FGFR1-bound adaptor protein. Phosphorylation of tyrosine residues at the C-terminal region of FGFR1 allows for recruitment and activation of phospholipase Cy (PLC). This can lead to catalysis and transformation of phosphatidylinositol diphosphate (PIP2) to diacylglycerol (DAG) and inositol triphosphate (IP3). In some embodiments, FGFR1 signaling concurrently activates both Ras-MAPK/ERK and PI3K pathways. Both these pathways play a role in the proliferation and survival of cancer cells.
[0067] Fibroblast growth factor signals can be propagated downstream into the RAS-MAPK or PI3K-AKT signaling cascades. In some embodiments, this signal propagation is conducted by FGFR1-bound adaptor proteins. In some embodiments, fibroblast growth factor receptor substrate 2 (FRS2) serves as an adapter protein that links activated fibroblast growth factor receptors to downstream signaling pathways. FRS2 proteins act as docking proteins downstream of certain species of RTKs, including FGF receptors, neurotrophin receptors, RET, and ALK. FRS2 proteins bind to these RTKs via the PTB domain and become phosphorylated on tyrosine residues upon activation of these RTKs.
[0068] FGFR1 can phosphorylate FRS2. Phosphorylated FRS2 binds the adapter protein Growth factor receptor bound 2 (GRB2) and the Protein tyrosine phosphatase, non-receptor type (SHP-2). In a FGFR1/FRS2 signaling pathway, SHP-2 can act as a adapter protein. Shc and GRB2 can form a complex with the Guanine nucleotide exchange factor Son of sevenless protein (SOS). Translocation of this complex to the plasma membrane by binding to phosphorylated FRS2 allows SOS to activate v-Ha-ras Harvey rat sarcoma viral oncogene homolog (H-Ras) by GTP exchange due to its close proximity to membrane-bound H-Ras. Once in the active GTP-bound state, H-Ras interacts with several effector proteins, including v-Raf-1 murine leukemia viral oncogene homolog 1 (c-Raf-1). That results in activation of the Mitogen-activated protein kinase kinases 1 and 2 (MEK1/2)/Mitogen-activated protein kinases 1 and 3 (ERK1/2) signaling cascade. This cascade leads to phosphorylation of the target transcription factor ELK1.
[0069] Additionally, when GRB2 is bound to tyrosine-phosphorylated FRS2, the C-terminal SH3 domain of GRB2 can form a complex with the proline-rich region of GRB2-associated binding protein 1 (GAB1) to serve as an interface between these two docking proteins. Phosphatidylinositol-3-kinase kinase (PI3K) is one of the effectors of GAB1 and thus can be involved in FGF-induced activation of PI3K. Assembly of a FRS2/GRB2/GAB1 complex induced by FGF stimulation can lead to activation of PI3K and downstream effector proteins.
KRAS and Cancer
[0070] Without wishing to be bound by any particular theory KRAS is a member of the Ras family that is implicated in the development of cancers. In some embodiments, oncogenic point mutations in KRAS contribute to the formation of a large proportion of human tumors. Oncogenic KRAS mutations often compromise the GTPase activity of the protein, causing accumulation of KRAS in the active GTP-bound state and hyperactivation of KRAS effectors that can initiate and maintain malignant transformations. In some embodiments, oncogenic mutations in KRAS are found in 25-35% of lung adenocarcinomas. in some embodiments, mutations in the KRAS protein can lead to the development of, among other things, lung cancer, pancreatic cancer, colorectal cancer, endometrial cancer, biliary malignancy, cervical cancer, bladder cancer, liver cancer, leukemia, and breast cancer.
[0071] Without wishing to be bound by any particular theory, despite our understanding of RAS biology, cancer patients harboring KRAS mutations are currently treated with cytotoxic chemotherapies that are rarely effective. As the MAPK/ERK signaling pathway has been shown to be critical for the initiation and maintenance of KRAS mutant tumors in experimental systems, targeting downstream MAPK/ERK signaling effectors, such as MEK kinases, has been proposed as an alternative strategy to potentially manage KRAS-mutant tumors. In some embodiments the present disclosure recognizes that although MEK inhibitors show significant antitumor activity in BRAF.sup.V600E tumors and newer inhibitors produce a more effective ERK signaling inhibition through blocking MEK feedback reactivation mediated by CRAF, effectiveness of MEK inhibitors is marginal in KRAS-mutant cancers.
Treatment of Cancer and Development of Resistance
[0072] In some embodiments, therapeutic interventions for cancer are targeted to, among other things, inhibit protein kinase expression or activity. In some embodiments, therapeutic interventions for cancer are targeted to, among other things, proteins that can regulate the expression or activity of kinases. In some embodiments, proteins that can regulate the expression or activity of kinases can be, among other things, receptors or enzymes.
[0073] In some embodiments, treatment of cancers with protein kinase inhibitor therapy (e.g., via administration of protein kinase inhibitors) can lead to resistance. In some embodiments, this resistance can arise from mutations in kinases. In some embodiments, resistance can result from feedback activation loops. In some embodiments, a feedback activation loop results from targeted inhibition of selective kinases increasing expression or activity of other kinases that regulate tumor growth or survival. Among other things the present invention recognizes a need for additional therapeutic options including therapeutics treating those cancers that have developed resistance to a therapeutic. In some particular embodiments the present invention makes the unexpected observation that treatment of cancer with inhibitors targeting kinases in the same signaling pathway can result in synergistic inhibition of tumor growth or tumor volume.
[0074] In some embodiments, the present invention recognizes that resistance to treatment of a tumor with inhibitors of MEK can result from increased expression or activity of RTKs. In some embodiments, the present invention recognizes that treatment of a cancer which has developed resistance to inhibitors of MEK with a therapeutic agent that inhibits a RTK and a therapeutic agent that inhibits a mitogen activated kinase can result in reduced tumor growth or tumor volume. In some embodiments, the MEK inhibitor can be Trametinib In some embodiments, the RTK can be a member of the FGFR family. In some embodiments, the inhibitor of the RTK can be Ponatinib, BGJ398 or AZD4547. In some embodiments the inhibitors can be administered in combination at reduced dosing.
[0075] In some embodiments the present invention recognizes that increased expression or activity of RTKs can be utilized to identify subjects that would benefit from treatment with an RTK inhibitor. The present invention recognizes that subjects that have been treated with a MEK inhibitor may have developed resistance to a MEK inhibitor due to increased expression or activity of RTKs. In some embodiments measuring expression of RTKs on the surface of cells subsequent to a subjects treatment with a MEK inhibitor
RTK Inhibition Therapy
[0076] In some embodiments the present disclosure provides, among other things, therapeutic regimens that comprise administering RTK inhibition therapy to subjects, e.g., to cancer patients. In some embodiments, such cancer patients will be receiving, will have received, and/or will be scheduled to receive one or more chemotherapy regimens. In some embodiments, such cancer patients will be receiving, will have received, and/or will be scheduled to receive one or more mitogen activated (MAK) kinase therapies.
[0077] In general, RTK inhibition therapy is any therapeutic modality or regimen whose administration to a subject acts as an inhibitor of RTK (i.e., results in reduction in level and/or activity of ZDHHC9). Those skilled in the art will appreciate that, in some embodiments, a particular therapeutic modality or regimen may be considered to be RTK inhibition therapy if it has been demonstrated to achieve statistically significant RTK inhibition when administered to a relevant population; demonstration that RTK inhibition actually occurs, or occurs to a particular degree in each or any specific individual to whom the therapy is administered is not required.
[0078] In some embodiments, RTK inhibition therapy can be achieved by an RTK inhibitory agent. In some embodiments, an RTK inhibitory agent can be any class of agent. In some embodiments, an RTK inhibitory agent can be, among other things, a nucleic acid, an antibody, or a small molecule. In some embodiments, an RTK inhibitory agent may target two or more RTKs. In some embodiments, an RTK inhibitory agent may target one RTK. In some embodiments, an RTK inhibitory agent may be a potent inhibitor of two or more RTKs. In some embodiments, an RTK inhibitory agent may a potent inhibitor of one RTK. In some embodiments, an RTK inhibitory agent may target FGFR1. In some embodiments, an RTK inhibitory agent may target FGFR1 and one or more other RTKs.
EXEMPLIFICATION
Example 1: RTK and MEK Signaling in Cancer
[0079] The present Example describes studies demonstrating that KRAS-mutant lung cancers, which are notoriously difficult to treat and specifically are known to develop resistance to MEK inhibition, achieve such resistance, at least in part, through reactivation of ERK signaling. Thus, the present Example highlights a dependency of KRAS-mutant cancers on MAPK signaling pathway, and identifies the source of a problem associated with traditional MEK inhibition strategies for treatment of at least these tumors. The present Example specifically demonstrates that ERK-dependent feedback inhibition of FGFR1 activity mediates the unresponsiveness of KRAS-mutant lung cancers to MEK inhibition. The present Example therefore supports and confirms provided strategies for treatment of KRAS-mutant tumors (e.g., KRAS-mutant lung tumors) as described herein, including for example through combination therapy regimens in which MEK inhibitor therapy is combined with therapy that suppresses reactivation of ERK signaling and/or otherwise reduces resistance to MEK inhibitor therapy. In some embodiments, MEK inhibitor therapy is combined with therapy that inhibits one or more aspects of the same biological pathway; in some embodiments, MEK inhibitor therapy is combined with therapy that targets FGFR1 activity.
[0080] To understand the molecular mechanism that mediates the resistance of KRAS-mutant tumors to MEK inhibition, the sensitivity of BRAF and KRAS-mutant cancers of multiple lineages to MEK inhibitors was determined using the Genomic of Drug Sensitivity in Cancer (GDSC) dataset.
[0081] Among other things, as described herein, it was found that BRAF-mutant tumor cells were significantly more sensitive to multiple MEK inhibitors such as AZD6244 (selumetinib), PD0325901, and RDEA119 than tumor cells harboring oncogenic mutations in KRAS (
[0082] Without wishing to be bound by any particular theory, we propose that differential sensitivity between BRAF and KRAS-mutant lung cancer cells to MEK inhibition may reflect the fact that mutant KRAS signals through multiple downstream effectors, whereas BRAF mediates its oncogenic effects mainly through MEK.
[0083] As described herein, we have identified genes whose inhibition sensitizes KRAS-mutant lung cancer cells to Trametinib. We built a custom shRNA library targeting the full complement of 536 human kinases (human kinome). This library, containing 3216 shRNAs (6 shRNA per gene), was cloned into the tet-responsive miR30-based TRMPV backbone, a vector optimized for negative-selection RNAi screening, and was transduced into the Tet-on-competent KRAS-mutant lung cancer cell line H23 (
[0084] The results of our screen show that knockdown of MAPK/ERK signaling effectors sensitizes KRAS mutant lung cancer cells to Trametinib. To address the molecular mechanism underlying the synergistic effect of inhibiting MEK and other MAPK/ERK pathway effectors, we tested the durability of ERK signaling inhibition over time in KRAS-mutant lung cancer cell lines treated with 25 nM of Trametinib. Although Trametinib has been reported to stably inhibit ERK signaling by blocking MEK feedback reactivation mediated by RAF, we observed increased ERK phosphorylation in all KRAS-mutant cell lines after 6-12 days of MEK inhibition (
[0085] Similar combined effects were observed after co-treatment of KRAS-mutant lung cancer cells with trametinib and the ERK inhibitor SCH772984 (
[0086] ERK signaling rebound was accompanied with an activation of PI3K pathway as indicated by an increase in AKT phosphorylation, suggesting that substantial compensatory feedback mechanisms are induced by MEK inhibition in KRAS-mutant lung cancer cells (
[0087] We examined whether pharmacologic inhibition of RAF and ERK kinases recapitulate the enhanced antiproliferative effects of BRAF, CRAF or ERK2 knockdown in Trametinib-treated KRAS-mutant lung cancers. To date, multiple BRAF inhibitors are clinically available, whereas ERK inhibitors are still under preclinical development. Co-treatment of KRAS-mutant lung cancers with Trametinib and the BRAF inhibitor verumafenib resulted in a significant reduction in the antiproliferative effects of Trametinib compared to cells treated with Trametinib alone. Without wishing to be bound by any particular theory, we propose that this paradoxical effect is a consequence of enhanced ERK signaling in cells treated with the drug combination and it is consistent with the properties of BRAF inhibitors to transactivate RAF dimers in the context of wild-type BRAF cells (Supplementary
[0088] Feedback activation of RTKs following targeted inhibition of selective kinases has previously been reported to lead to drug resistance. As receptor tyrosine kinase FGFR1 was identified as one of the top candidate genes in our RNAi screen, we next investigated whether activation of FGFR1 signaling contributes to the resistance of KRAS-mutant lung cancers to MEK inhibition. Analysis of expression confirmed that FGFR1 and/or its ligand FGF2 were significantly upregulated in KRAS-mutant lung cancers upon treatment with Trametinib (
[0089] The ability of FGFR1 inhibition to sensitize cells to trametinib showed distinct specificities: for example, only shRNAs targeting FGFR1 or FRS2, but not those targeting family members FGFR2 and 3, sensitized KRAS-mutant lung cancer cells to trametinib (
[0090] We investigated the effect of pharmacologic inhibition of FGFR1 in KRAS-mutant lung cancer. To this end, we decided to use FDA-approved ponatinib, a multikinase inhibitor that potently inhibits FGFR1 and has been in clinical development for the treatment of FGFR1-amplified lung cancers. Inhibition of FGFR1 by ponatinib significantly reduced the phosphorylation of FRS2, ERK, and AKT in FGF2-treated H23 cells (
[0091] To address the mechanism underlying the synergy between FGFR1 and MEK inhibition, we tested phospho-levels of ERK and AKT in lysates of drug-treated cells. Whereas ponatinib alone did not affect the levels of pERK, suggesting that FGFR1 is not required for ERK signaling in KRAS-mutant cells, FGFR1 inhibition prevented feedback activation of ERK and AKT signaling following MEK inhibition (
[0092] To further investigate the specificity of FGFR1 in promoting Trametinib-resistance in KRAS-mutant lung cancer, we explored whether other specific RTKs might mediate the same response. MEK inhibition led to upregulation of MET and ERBB2, but not EGFR, and correlated with activation of MET signaling (
[0093] We also tested the effectiveness of combining FGFR1 and MEK inhibition in vivo by using KRAS-mutant lung cancer xenografts. To this end, A549 and H23 xenografts harboring tet-responsive FGFR1 or non-targeting control shRNAs were treated with doxycycline and a daily dose of 3 mg/kg of Trametinib when tumors reached 150 mm.sup.3. Relative to vehicle-treated controls, treatment with Trametinib alone led to only a modest inhibition of tumor growth in H23 xenografts and no significant tumor inhibition in A549 xenografts. However, the combination of FGFR1 knockdown with Trametinib led to potent tumor inhibition and caused tumor regression in most tumors (
[0094] We examined the efficacy of combining ponatinib and Trametinib in A549 and H2122 xenograft models. When tumors reached 150-200 mm.sup.3, vehicle, Trametinib, ponatinib, or the drug combination was orally administrated at an effective dose. Each inhibitor alone resulted in marginal growth inhibition, with no regression observed in any tumor. In contrast, combination of ponatinib and Trametinib provoked regression of all tumors (
[0095] To evaluate the clinical relevance of our findings, we assessed the FRS2 phosphorylation in tumor biopsies before and after trametinib treatment from two patients with KRAS-mutant lung adenocarcinoma. In both cases, a pronounced increase in pFRS2 levels was observed in the post-treatment biopsies (
[0096] Using a non-biased screening approach, this study has shown that reactivation of ERK signaling represents a mechanism that limits the overall response of KRAS-mutant lung tumors to MEK inhibition. Prevention of ERK signaling rebound by genetic or pharmacologic means enhanced the antitumor properties of MEK inhibition, highlighting the predominance of MAPK signaling in these tumors. The strong feedback activation of FGFR1 elicited by MEK inhibition explains the strong synergistic effect observed between FGFR1 and MEK inhibition, and provides a rational for the poor clinical response of KRAS-mutant lung cancer to Trametinib. This effect was specific: although induction of other RTKs was observed in trametinib-treated KRAS-mutant lung cancer cells, only shRNAs targeting FGFR1, but not other FGFR family members or other RTKs conferred sensitivity to trametinib, and only inhibition of FGFR1 blocked the reactivation of both ERK and AKT. Consistent with this, an unbiased ORF screen for identifying genes able to overcome KRAS addiction identified FGFR1, but not other RTKs, as sufficient to allow proliferation in the presence of KRAS suppression. Accordingly, combined use of trametinib and FGFR1 inhibitors, including the FDA-approved drug ponatinib, produced a marked increase in anti-tumor activity leading to tumor regression. Sensitivity to the combination was precisely predicted by FRS2 phosphorylation, which is indicative of FGFR activation; in principle, post treatment biopsies indicating an increase in pFRS2 levels following trametinib treatment would be predictive of success of the combination. Although careful attention to additive or synergistic toxicities will be required for the clinical implementation of these observations, it seems likely that targeting a specific RTK such as FGFR1 will be more tolerable than targeting more pleiotropic factors such as AKT and presents a rationale for developing more specific FGFR1 antagonists. Regardless, our study provides compelling evidence that targeting adaptive resistance mechanisms can improve the efficacy of molecular targeted therapies and suggests a path towards developing rational therapies for KRAS-mutant lung cancer.
Example 2: Experimental Methods
[0097] The present Example describes experimental methods used to achieve the preceding results.
[0098] Pooled Negative-Selection RNAi Screening
[0099] A custom shRNA library targeting the full complement of 526 human kinases was designed using miR30-adapted DSIR predictions refined with sensor rules (six shRNAs per gene) and constructed by PCR-cloning a pool of oligonucleotides synthesized on 12k customized arrays (Agilent Technologies and CustomArray) as previously described (Supplementary Table 1). The list of genes was obtained from KinBase Database (http://kinase.com/human/kinome/) and was manually curated. After sequence verification, 3156 shRNAs (5-6 per gene) were combined with 20 positive- and negative-control shRNAs at equal concentrations in one pool. This pool was subcloned into the TRMPV-Neo vector and transduced in triplicates into Tet-on H23 KRAS mutant lung cancer cells using conditions that predominantly lead to a single retroviral integration and represent each shRNA in a calculated number of at least 1,000 cells. Transduced cells were selected for 6 days using 1 mg ml.sup.1 G418 (Invitrogen); at each passage more than 30 million cells were maintained to preserve library representation throughout the experiment. After drug selection, T0 samples were obtained (30 million cells per replicate (n=3)) and cells were subsequently cultured in the presence or absence of trametinib (25 nM) and 1 g ml.sup.1 doxycycline to induce shRNA expression. After ten population doublings (Tf), about fifteen million shRNA-expressing (dsRed+/Venus+260) cells were sorted for each replicate using a FACSAriaII (BD Biosciences). Genomic DNA from T0 and Tf samples was isolated by two rounds of phenol extraction using PhaseLock tubes (5prime) followed by isopropanol precipitation. Deep-sequencing template libraries were generated by PCR amplification of shRNA guide strands as previously described. Libraries were analyzed on an Illumina Genome Analyzer at a final concentration of 8 pM; 50 nucleotides of the guide strand were sequenced using a custom primer (miR30EcoRISeq, (SEQ ID NO.1: TAGCCCCTTGAATTCCGAGGCAGTAGGCA). To provide a sufficient baseline for detecting shRNA depletion in experimental samples, we aimed to acquire >500 reads per shRNA in the T0 sample, which required more than twenty million reads per sample to compensate for disparities in shRNA representation inherent in the pooled plasmid preparation or introduced by PCR biases. With these conditions, we acquired T0 baselines of >500 reads for (97.9%) shRNAs. Sequence processing was performed using a customized Galaxy platform.
[0100] Using selection criteria that required an shRNA depletion averaging greater than 4-fold after ten population doublings and an effect greater than 4-fold in trametinib-treated cells with respect to untreated ones, 64 shRNAs were identified. The 8 targets for which at least two shRNAs were selectively depleted following trametinib treatment were subject to secondary validation in cell competition assays using multiple KRAS-mutant lung cancer cell lines. 6 targets validated in the cell line in which the primary screen was performed (H23 cells) and 4 (BRAF, CRAF, ERK2, and FGFR1) across a panel of KRAS-mutant lung cancer cells, and as such these represented the top hits of our screen.
[0101] Plasmids and Recombinant Proteins
[0102] All vectors were derived from the Murine Stem Cell Virus (MSCV, Clontech) retroviral vector backbone. miR30-based shRNAs were designed and cloned as previously described and sequences are available in Supplementary Table 1. shRNAs were cloned into the TRMPV-Neo (pSIN-TREdsRed-miR30-PGK-Venus-IRES-NeoR) and MLP (LTR-miR30-PGK-PuroR-IRESGFP) vectors as previously described. All constructs were verified by sequencing. Recombinant proteins FGF2 (8910, Cell Signaling), HGF (100-39, Peprotech), EGF (AF-100-15, Peprotech), and NRG1 (100-03, Peprotech) were used at 50 ngml-1 290 for 10 minutes.
[0103] Cell Culture, Compounds, and Competitive Proliferation Assays
[0104] H23, H460, H2030, H358, H2122, H2009, H1975, H1650, Ludlu-1, H1703, SW480, SW620, and DLD-1 cells were cultured in RPMI media; A549, 3T3, H1299, MIAPACA-2, PANC-1, and murine KRASG12D; p53R270H cells were cultured in DMEM media. All media contained 10% FBS and 100 IUml.sup.1 penicillin/streptomycin. All cells were grown in a humidified incubator at 37 C. with 5% CO2 and were tested regularly for mycoplasma contamination. All cell lines used were negative for mycoplasma.
[0105] Trametinib (S2673), SCH772984 (S7101), Gefitinib (S1025), Crizotinib (S1068), CP-724714 (S1167), Afatinib (S1011), BGJ398 (S2183), AZD4547 (S2801), and Ponatinib (S1490) were obtained from Selleckchem. Drugs for in vitro studies were dissolved in dimethyl sulfoxide (DMSO) to yield 5 or 10 mM stock solutions and stored at 80 C.
[0106] For shRNA experiments, human lung cancer cells were modified to express the ecotropic receptor and rtTA3 using retroviral transduction of MSCV-RIEP (MSCV-rtTA3-IRES-EcoR-PGKPuro) followed by drug selection (1 ugml.sup.1 puromycin for 1 week). The resulting cell lines were transduced with ecotropically packaged TRMPV-Neo-shRNA retroviruses, selected with 1 mgml.sup.1 G418 for 1 week, and treated with 1 gml.sup.1 doxycycline to induce shRNA expression. shRNA-transduced cells were mixed with non-transduced cells (8:2) and cultured with doxycycline in the presence or absence of trametinib (25 nM), and the relative change in Venus+/dsRed+(shRNA expressing) cells was monitored on a Guava Easycyte (Millipore). Experiments were performed independently two or three times.
[0107] Lentiviral Production
[0108] Lentiviruses were produced by co-transfection of 293T cells with lentiviral-Cre backbone construct and packaging and envelope vectors (psPAX2 and VSV-G) using the calcium phosphate method. Supernatant was collected 48, 60 and 72 h post-transfection, concentrated by ultracentrifugation at 24,000 r.p.m. for 120 min and resuspended in an appropriate volume of HBSS solution (Gibco).
[0109] Clonogenic and Apoptosis Assay
[0110] For clonogenic assays, cells were seeded in triplicate into 6-well plates (5-1010.sup.3 cells per well) and allowed to adhere overnight in regular growth media. Cells were then cultured in the absence or presence of drug as indicated in complete media for 10-14 days. Growth media with or without drug was replaced every 2 days. Remaining cells were fixed with methanol (1%) and formaldehyde (1%), stained with 0.5% crystal violet, and photographed using a digital scanner. Relative growth was quantified by densitometry after extracting crystal violet from the stained cells using 10% of acetic acid. All experiments were performed at least three times. Representative experiments are shown.
[0111] For apoptosis assay, around 110.sup.6 cells were seeded into 10-cm plates and cultured in the presence or absence of drugs as indicated. After 6 days, apoptosis and cell death were determined using AnnexinV-APC apoptosis detection kit according to the manufacturer's instruction (Affymetrix eBioscience). Data were acquired using a FACS Calibur (BD Biosciences). All experiments were performed independently three times.
[0112] Quantitative Analysis of Drug Synergy
[0113] Drug synergism was analyzed using CompuSyn software (Version 1.0) (http://www.combosyn.com), which is based on the Median-Effect Principle (Chou) and the Combination Index-Isobologram Theorem (Chou-Talalay). CompuSyn software generates combination index (CI) values, where CI<1 indicates synergism; CI=0.75-1.25 indicates additive effects; and CI>1 indicates antagonism. Following the instruction of the software, drug combinations at non-constant ratios were used to calculate Combination Index (CI) in our study.
[0114] Immunoblotting and RAS-GTP Assay.
[0115] Phospho-lysis buffer (50 mM Tris pH 7.5, 1% Tween-20, 200 mM NaCl, 0.2% NP-40) supplemented with phosphatase inhibitors (5 mM Sodium Fluoride, 1 mM Sodium Orthovanadate, 1 mM Sodium Pyrophosphate, 1 mM -glycerophosphate), and protease inhibitors (Protease Inhibitor Cocktail Tablets, Roche) was used for cell lysis and protein concentration was determined by Bradford protein Assay kit (Biorad). Proteins were separated by SDS-Page and immunoblotted and transferred to polyvinyl difluoride (PVDF) membranes (Millipore) according to standard protocols. Membranes were immunoblotted with antibodies against pERK.sup.T202/Y204 (9101), tERK (9107), pAKT.sup.S473 (4060), tAKT (9272), pFRS2.sup.Y436 (3861), pSTAT3.sup.Y705 (9145), pMEK.sup.S217/221 (9154), MEK (4694), pMET.sup.Y1234/1235 (3077), MET (8198), pERBB2.sup.Y1221/1222 (2243), pEGFR.sup.Y1068 (3777), EGFR (4267), pERBB3.sup.Y1289 (4791), and PTEN (9559) from Cell Signaling; CRAF (SC-227), and BRAF (SC-5284) from Santa Cruz Biotechnology; and KRAS (WH0003845M1) from Sigma in 5% BSA in TBS blocking buffer. After primary antibody incubation, membranes were probed with ECL anti-rabbit IgG, anti-mouse IgG or anti-goat IgG secondary antibody (1:10,000) from GE Healthcare Life Science and imaged using the FluorChem M system (protein simple). GTP-bound RAS was measured using the CRAF RAS-binding-domain (RBD) pull down and detection kit (8821, Cell Signaling) as instructed by the manufacturer. All immunoblots were performed independently at least twice.
[0116] qRT-PCR
[0117] Total RNA was isolated using TRIZOL (Invitrogen), and cDNA was obtained using the TaqMan reverse transcription reagents (Applied Biosystems). Real-time PCR was carried out in triplicate in three independent experiments using SYBR Green PCR Master Mix (Applied Biosystems) on the ViiA 7 Real-Time PCR System (Invitrogen). GAPDH or -actin served as endogenous normalization controls.
[0118] Animal Studies
[0119] All mouse experiments were approved by the Memorial Sloan Kettering Cancer Center (MSKCC) Animal Care and Use Committee (protocol no. 12-04-006). Mice were maintained under specific pathogen-free conditions, and food and water were provided ad libitum. 5-7-week-old, female athymic NCR-NU-NU (Harlan laboratories) mice were used for animal experiments with human cell lines and patient-derived xenografts. For A549, H23, and H2122 xenografts, cells (1010.sup.6) were harvested on the day of use and injected in growth-factor reduced Matrigel/PBS (50% final concentration). One flank was injected subcutaneously per mouse. For JHU-LX55a patient-derived xenograft, a poorly differentiated lung adenocarcinoma bearing a KRAS.sup.G12C mutation, tumors were cut into pieces and inserted into a pocket in the subcutaneous space as previously described. After inoculation, mice were monitored daily, weighed twice weekly, and caliper measurements begun when tumors became visible. Tumor volume was calculated using the following formula: tumor volume=(Dd.sup.2)/2, in which D and d refer to the long and short tumor diameter, respectively. When tumors reached a size of 150-300 mm.sup.3, mice were randomized into 7-8 per group and treated with vehicle, trametinib and/or ponatinib per os for 5 consecutive days followed by 2 days off treatment, at 3 mg/kg and 30 mg/kg, respectively. No obvious toxicities were observed in the vehicle- or drug-treated animals as assessed by difference in body weight between vehicle- and drug-treated mice taking tumor size into account.
[0120] For drug efficacy studies using a genetically engineered mouse model of lung cancer, Kras.sup.LSLG12D/+ and Trp.sup.53fl/fl mice were anaesthetized by intraperitoneal injection of ketamine (80 mg per kg) and xylazine (10 mg per kg) and infected intratracheally with 2.510.sup.5 infectious particles of Lenti-Cre per mouse, as previously described. Mice were evaluated by CT imaging to quantify lung tumor burden before being assigned to various treatment study cohorts. Mice were treated with vehicle, trametinib and/or ponatinib per os for 4 consecutive days followed by 3 days off treatment, at 3 mg/kg and 30 mg/kg, respectively. CT imaging evaluation was repeated every week during the treatment. Investigators were not blind with respect to treatment.
[0121] CT imaging CT Scans were performed on the Mediso Nano SPECT/CT System covering only the lungfields of each mouse. Each scan averaged approximately 6 min using 240 projections with an exposure time of 1,000 ms set at a pitch of 1 degree. The tube energy of the X-ray was 55 kVp and 145 A. The in-plane voxel sizes chosen were small and thin creating a voxel size of 737373 m. The final reconstructed image consisted of 3683681,897 voxels. Scans were analysed with the Osirix software.
[0122] Patient Samples
[0123] Patients with KRAS mutation-positive advanced lung adenocarcinomas were enrolled in the phase I/II clinical study of trametinib and navitoclax (NCT02079740) and the response was assessed per RECIST (response evaluation criteria in solid tumors) criteria. Biopsies were obtained before treatment, and within 2-4 weeks after starting the treatment with trametinib. Specifically, for patient #1, the post-treatment biopsy was obtained after treatment with navitoclax for 7 days, followed by co-treatment with navitoclax and trametinib for 16 days. The post-treatment biopsy from patient #2 was obtained after co-treatment with navitoclax and trametinib for 22 days. All human studies were approved by the Massachusetts General Hospital Institutional Review Board, and informed consent to study was obtained as per protocol from all patients.
[0124] Immunohistochemistry
[0125] Tissues were fixed overnight in 4% paraformaldehyde, embedded in paraffin, and cut into 5 mm thick sections. Sections were subject to hematoxylin and eosin staining, and immunohistochemical staining following standard protocols. The following primary antibodies were used: pERK.sup.T202/Y204 (4370) and pAKT.sup.S473 (4060) (Cell signaling), and pFRS2.sup.Y436 (ab193363) (Abcam).
[0126] Statistical Analysis
[0127] Data are expressed as means.e.m or means.d. Group size was determined based on the results of preliminary experiments and no statistical method was used to predetermine sample size. Group allocation and outcome assessment were not performed in a blinded manner. All samples that met proper experimental conditions were included in the analysis. Statistical significance was determined using Student's t-test or two-way ANOVA using Prism 6 software (GraphPad Software). Significance was set at P<0.05.
Example 3: Standard Clinical Dosing Regimens
[0128] The present Example reports current clinical dosing regimens known in the art for with certain inhibitory agents (e.g., when used as monotherapy) that may be utilized in accordance with the present invention.
[0129] Ponatinib: Current recommended clinical dosing regimens for Ponatinib include: (a) a once daily dose of 45 mg *e.g. administered orally (tablet), for the treatment of leukemia with doses of 30 mg or 15 mg in the event of adverse reactions. [Iclusig Product Insert]; (b) a once daily dose of 45 mg *e.g. administered orally (tablet), for the treatment of endometrial carcinoma [as reported in NCT01888562] or lung cancer [as reported in NCT01935336]
[0130] BGJ398: Current recommended clinical dosing regimens for BGJ398 include: a once daily dose of 125 mg *e.g. administered orally (tablet), for the treatment of solid tumors or hematological malignancies [as reported in NCT02160041].
[0131] AZD4547: Current recommended clinical dosing regimens for AZD4547 include: a 2 week on, 1 week off schedule of a once daily dose of 80 mg *e.g administered orally (tablet), for the treatment of breast cancer [as reported in NCT02299999], lung cancer [as reported in NCT01795768], gastric cancer and esophageal cancers [as reported in NCT01457846].
[0132] Tramentinib: Current recommended clinical dosing regimens for Ponatinib include: a dose of 2 mg *e.g. administered orally (tablet), for the treatment of unresectable or metastatic melanoma with BRAF mutations [MEKINST Product Insert].
EQUIVALENTS
[0133] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments, of the invention described herein. The scope of the present invention is not intended to be limited to the above Description, but rather is as set forth in the following claims: