CANCER INITIATING CELL AND USE THEREOF
20180037871 ยท 2018-02-08
Inventors
- Thai-Yen Ling (Taipei City, TW)
- Sui-Yuan CHANG (Taipei City, TW)
- Tai-Ling Chao (Taipei City, TW)
- Sing-Yi Gu (Taipei City, TW)
- Yufeng Jane Tseng (Taipei City, TW)
- Ming-Tsung Hsu (Taipei City, TW)
Cpc classification
C12N2710/10022
CHEMISTRY; METALLURGY
C12N7/00
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
C12N2740/10043
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to a cancer initiating cell comprising an isolated coxsackievirus and adenovirus receptor positive mouse pulmonary stem/progenitor cell that overexpresses Oct-4.
Claims
1. A cancer initiating cell comprises an isolated coxsackievirus and adenovirus receptor positive mouse pulmonary stem/progenitor cell (CAR.sup.|/mPSC) that overexpresses Oct-4,
2. The cancer initiating cell of claim 1, wherein the CAR.sup.+/mPSC comprises a vector for encoding an Oct-4 gene.
3. The cancer initiating cell of claim 2, wherein the sequence of the Oct-4 gene is SEQ ID NO: 1.
4. The cancer initiating cell of claim 1, wherein the expression level of the Oct-4 in the CAR.sup.+/mPSC is 16 times higher than that of an normal CAR.sup.+/mPSC.
5. The cancer initiating cell of claim 1, which is a lung cancer initiating cell.
6. The cancer initiating cell of claim 1, which has tumorigenic capacity, wherein the tumorigenic capacity comprises tumor formation, tumor regeneration, metastatic capacity or combination thereof.
7. The cancer initiating cell of claim 1, which exhibits a CD 133 expression, an aldehyde dehydrogenase (ALDH) activity, a chemoresistance or combination thereof.
8. The cancer initiating cell of claim 1, which has a function for angiogenesis.
9. The cancer initiating cell of claim 1, which has a function for participating in tumor blood vessel formation
10. The cancer initiating cell of claim 1, which expresses a surface marker of an endothelial cell, wherein the surface marker of the endothelial cell comprises CD31, CD105, CD34. CD144 or combination thereof.
11. The cancer initiating cell of claim 8, which has a function for activating ANG/Tie2 signal pathway to enhance the angiogenesis.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0006] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color thawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0007]
[0008]
[0009]
[0010]
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
SUMMARY OF THE INVENTION
[0026] The present invention relates to a cancer initiating cell comprising an isolated coxsackievirus and adenovirus receptor positive mouse pulmonary stem/progenitor cell that overexpresses Oct-4 (CAR.sup.+/mPSC.sup.Oct-4.sup._.sup.hi).
DETAILED DESCRIPTION OF THE INVENTION
[0027] Solid tumors are thought to arise in organs that contain stem cell populations. The tumors in these organs consist of heterogeneous populations of cancer cells that differ markedly in their ability to proliferate and form new tumors; this difference in tumor-forming ability has been reported for example with breast cancer cells and with central nervous system tumors. While the majority of the cancer cells have a limited ability to divide, recent studies suggest that a population of cancer cells, termed cancer stem cells or cancer initiating cells (CICs), has the exclusive ability to extensively self-renew and form new tumors. Growing evidence suggests that pathways that regulate the self-renewal of normal stem cells are deregulated or altered in cancer stem cells, resulting in the continuous expansion of self-renewing cancer cells and tumor formation.
[0028] In this invention, cancer initiating cells (CICs) are generated in animal model to better understand the properties and characteristics of CICs, and these findings can aid cancer research to provide insight into early diagnosis and treatment of lung cancer. In previous studies, mouse pulmonary stem/progenitor cells (mPSCs) were enriched by using serum-free primary selection culture followed by FACS isolation using the coxsackievirus and adenovirus receptor (CAR) as the positive selection marker in the culture. These CAR.sup.+/mPSCs exhibited stem/progenitor properties, could differentiate into type-I pneumocytes, and possessed angiogenic potential. The present invention identifies pulmonary Oct-4+ stem/progenitor cells and demonstrates their susceptibility to SARS coronavirus (SARS-CoV) infection in vitro. Lung, stem/progenitor cells differentiate into alveolar pneumocytes and angiogenesis is induced within a 3D gelatin-microbubble scaffold. The present invention demonstrates that CAR.sup.+/mPSCs can be transformed via the overexpression of Oct-4 and then develop the typical CICs phenotype and type-I pneumocytes derived from CAR.sup.+/mPSCs are tested as well. In the experiments described herein, the characteristics of the transformed cells are examined using in vitro assays, including cell cycle and telomerase activity analysis, sphere forming assay, detection of CD133 expression and ALDH activity, and chemoresistance assay. In addition, in vivo assays, including limiting dilution transplantation and tumor metastasis assays in SCID mice, are used to further study the characteristics of the transformed cells. Since the capacity to induce angiogenesis is another trait of CICs, endothelial tube formation assay and in ovo chicken chorioallantoic membrane (CAM) assay are used to evaluate the angiogenic potential of the transformed cells.
[0029] In the present invention, overexpression of the pluripotent transcription factor Oct-4 in CAR.sup.+/mPSCs generated transformed cells is demonstrated, which is referred to as CAR.sup.+/mPSCs.sup.Oct-4.sup._.sup.hi. These transformed cells possess cancer/tumor initiating capacity and chemoresistance, as well as exhibiting remarkable expression of certain proangiogenic factors, including angiopoietins (ANGs) and VEGF, and enhanced angiogenic potential. Besides, the CAR.sup.+/mPSCs.sup.Oct-4.sup._.sup.hi exhibits the expression of the endothelial cells markers, including CD31, CD105, CD34, and CD144. Moreover, CAR.sup.+/mPSCs.sup.Oct-4.sup._.sup.hi actively participates in tumor blood vessel formation and activates the ANGs/Tie2 signaling pathway. These findings provide novel insights into the possible origin and generation of CICs, help elucidate the pathways responsible for CICs-mediated blood vessel formation, and offer new strategies for anti-angiogenic therapy in lung cancer.
[0030] As used herein, a or an may mean one or more. As used herein in the claim(s), when used in conjunction with the word comprising, the words a or an may mean one or more than one.
[0031] Therefore, the present invention provides a cancer initiating cell (CIC) which comprises an isolated coxsackievirus and adenovirus receptor positive mouse pulmonary stem/progenitor cell (CAR.sup.+/mPSC) that overexpresses Oct-4 (CAR.sup.+/mPSC.sup.Oct-4.sup._.sup.hi).
[0032] As used in the specification and claims, the term cancer initiating cell (CIC) is interchangeable and refers to a solid cancer stem cell. The cancer initiating cell is defined and functionally characterized as a small subset of cells from a tumor that can grow indefinitely in vitro under appropriate conditions (ability for self-renewal), is able to form tumors in vivo using only a small number of cells (<10.sup.2 cells). Other common approaches to characterize CIC involve morphology and examination of cell surface markers, transcriptional profile, and drug response.
[0033] The CAR.sup.+/mPSC that overexpresses Oct-4 means the expression level of the Oct-4 in the CAR.sup.+/mPSC is 10 times higher than that of a normal cell. In a preferred embodiment, the expression level of the Oct-4 in the CAR.sup.+/mPSC is 16 times higher than that of a normal cell. In a more preferred embodiment, the expression level of the Oct-4 of the CAR.sup.+/mPSC is 20 times higher than that of a normal cell. As used herein, the normal cell is a normal CAR.sup.+/mPSC. The expression level is an expression level of a DNA, a RNA or a protein. In a preferred embodiment, the expression level is the expression level of the protein. The protein is encoded by an Oct-4 gene. In a more preferred embodiment, the sequence of the Oct-4 gene is SEQ ID NO: 1. In another embodiment, the Oct-4 gene is an Oct-4 cDNA.
[0034] In another embodiment, the CAR.sup.+/mPSC comprises a vector, wherein the vector comprises a nucleotide sequence for encoding an Oct-4 gene. In a preferred embodiment, the sequence of the Oct-4 gene is SEQ ID NO: 1.
[0035] In an embodiment, the CAR+/mPSC.sup.Oct-4.sup._.sup.hi exhibits soft agar colony formation, a sphere formation and an immortalization of characteristics.
[0036] In another embodiment, the CAR+/mPSC.sup.Oct-4.sup._.sup.hi has a cancer cell function, wherein the cancer cell function comprises cell proliferation, cell migration, cell invasion or combination thereof.
[0037] In an embodiment, the CAR+/mPSC.sup.Oct-4.sup._.sup.hi possesses a tumor initiating capacity. In a preferred embodiment, the CAR+/mPSC.sup.Oct-4.sup._.sup.hi has a tumorigenic capacity, wherein the tumorigenic capacity comprises tumor formation, tumor regeneration, metastatic capacity or combination thereof. Some embodiments of the CAR+/mPSC.sup.Oct-4.sup._.sup.hi of this invention grows indefinitely and forms tumors from <10.sup.3 cells in vitro. In a preferred embodiment, the CAR+/mPSC.sup.Oct-4.sup._.sup.hi grows indefinitely and forms tumors from <10.sup.2 cells in vitro.
[0038] Different biomarkers for lung CICs have been proposed including CD133 expression, aldehyde dehydrogenase (ALDH) activity, and chemoresistance. In an embodiment, the CAR+/mPSC.sup.Oct-4.sup._.sup.hi exhibits CD133 expression, ALDH activity, chemoresistance or combination thereof. The chemoresistance means that the CAR+/mPSC.sup.Oct-4.sup._.sup.hi is resistant to a chemo-radiotherapy and/or a chemo-drug. Therefore, the cancer initiating cell is a lung cancer initiating cell. In an embodiment, the CAR+/mPSC.sup.Oct-4.sup._.sup.hi is a lung cancer initiating cell.
[0039] In one embodiment, the CAR+/mPSC.sup.Oct-4.sup._.sup.hi has a function for angiogenesis. In a preferred embodiment, the CAR+/mPSC.sup.Oct-4.sup._.sup.hi has a function for participating in a blood vessel formation. Therefore, the CAR+/mPSC.sup.Oct-4.sup._.sup.hi not only possesses angiogenic potential but also participates in the tumor blood vessel formation. In another embodiment, the CAR+/mPSC.sup.Oct-4.sup._.sup.hi has a function for ANG/Tie2 signal pathway to enhance the angiogenesis. In a preferred embodiment, the CAR+/mPSC.sup.Oct-4.sup._.sup.hi has a function for activating Tie2 signal pathway to enhance the angiogenesis.
[0040] In another embodiment, the CAR+/mPSC.sup.Oct-4.sup._.sup.hi expresses a surface marker of an endothelial cell, wherein the surface marker of the endothelial cell comprises CD31, CD105, CD34, CD144 or combination thereof.
[0041] The present invention also provides an use of a animal with a tumor for screening an anti-cancer drug, wherein the tumor is induced by a cancer initating cell (CIC), wherein the cancer initiating cell comprises an isolated coxsackievirus and adenovirus receptor positive mouse pulmonary stem/progenitor cell (CAR.sup.+mPSC) that overexpress Oct-4 (CAR.sup.+/mPSC.sup.Oct-4.sup._.sup.hi).
[0042] In one embodiment, the animal is a mouse.
[0043] The phrases isolated refer to material, which is substantially or essentially free from components which normally accompany it as found in its native state.
[0044] Anti-cancer drug refers to a drug comprising a composition having an anti-tumor activity as its active ingredient. Anti-tumor activity refers to a tumor growth suppressing effect, a tumor cytotoxic effect and/or a tumor-regression effect.
[0045] The CAR.sup.+/mPSC that overexpresses Oct-4 means the expression level of the Oct-4 in the CAR.sup.+/mPSC is 10 times higher than that of a normal cell. In a preferred embodiment, the expression level of the Oct-4 in the CAR.sup.+/mPSC is 16 times higher than that of a normal cell. In a more preferred embodiment, the expression level of the Oct-4 of the CAR.sup.+/mPSC is 20 times higher than that of a normal cell. As used herein, the normal cell is a normal CAR.sup.+/mPSC. The expression level is an expression level of a DNA, a RNA or a protein. In a preferred embodiment, the expression level is the expression level of the protein. The protein is encoded by an Oct-4 gene. In a more preferred embodiment, the sequence of the Oct-4 gene is SEQ ID NO: 1.
[0046] In another embodiment, the CAR.sup.|/mPSC comprises a vector, wherein the vector comprises a nucleotide sequence for encoding an Oct-4 gene. In a preferred embodiment, the sequence of the Oct-4 gene is SEQ ID NO: 1.
[0047] In one embodiment, the cancer initiating cell is a lung cancer initiating cell. In a preferred embodiment, the tumor is a lung tumor. In another embodiment, the anti-cancer drug is a drug for treating a cancer initiating cell. In a preferred embodiment, the anti-cancer drug is an anti-lung cancer drug. In a more preferred embodiment, the anti-cancel drug is a drug for treating a lung cancer initiating cell.
[0048] The term anti-cancer as described herein comprises treating cancer and inhibiting cancer. Moreover, the anti-cancer comprises treating and/or inhibiting the cancer initiating cell. As used herein, the term treating comprising curing, healing, alleviating, relieving, altering, remedying, ameliorating, improving or affecting the disease, the symptoms of disease, or the predisposition toward disease. Treating and/or inhibiting the cancer initiating cell can include, for example, ameliorating, preventing, eliminating, or reducing the number of CICs in a subject, eliminating CICs in a subject, etc.
[0049] In one embodiment, the subject is an animal. Preferably, the subject is a mammal. More preferably, the subject is a human.
[0050] The present invention further provides a method for screening an anti-cancer drug, comprising: (a) implanting cancer initiating cells (CICs) into an animal, wherein the cancer initiating cells comprise isolated coxsackievirus and adenovirus receptor positive mouse pulmonary stem/progenitor cells (CAR.sup.|/mPSCs) that overexpress Oct-4 (CAR.sup.+/mPSC.sup.Oct-4.sup._.sup.hi), wherein the CICs develop and form a tumor; (b) administering a candidate drug to the animal; and (c) evaluating an effect of the candidate drug on the tumor containing the CICs.
[0051] In one embodiment, the anti-cancer drug is a drug for treating a cancer initiating cell. In a preferred embodiment, the anti-cancer drug is an anti-lung cancer drug. In a more preferred embodiment, the anti-cancer drug is a drug for treating a lung cancer initiating cell.
[0052] In another embodiment, the animal is a rodent, preferably a rat or a mouse.
[0053] The CAR.sup.|/mPSCs that overexpress Oct-4 means the expression level of the Oct-4 gene in each CAR.sup.+/mPSCs is 10 times higher than that of a normal cell. In a preferred embodiment, the expression level of the Oct-4 gene in each CAR.sup.+/mPSCs is 16 times higher than that of a normal cell. In a more preferred embodiment, the expression level of the Oct-4 gene of each CAR.sup.+/mPSCs is 20 times higher than that of a normal cell. The expression level is an expression level of a DNA, a RNA or a protein. In a preferred embodiment, the expression level is the expression level of the protein. The protein is encoded by an Oct-4 gene. In a more preferred embodiment, the sequence of the Oct-4 gene is SEQ ID NO: 1. In another embodiment, the Oct-4 gene is a Oct-4 cDNA.
[0054] In another embodiment, each CAR.sup.+/mPSCs comprises a vector, wherein the vector comprises nucleotide sequence for encoding an Oct-4 gene. In a preferred embodiment, the sequence of the Oct-4 gene is SEQ ID NO: 1.
[0055] The term tumor refers to benign as well as to malignant neoplasias in their respective stages. The first stage of neoplastic progression is an increased number of relatively normal appearing cells, the hyperplastic stage. There are several stages of hyperplasia in which the cells progressively accumulate and begin to develop an abnormal appearance, which is the emergence of the dysplastic phase.
[0056] The term candidate drug as used herein, means any molecule, e.g. a protein or a pharmaceutical, i.e., a drug, with the capability of substantially inhibiting the growth of a tumor cell.
[0057] In an embodiment, the cancer initiating cells (CICs) are lung, cancer initiating, cells. In a preferred embodiment the tumor is a lung tumor. In the latter case initial evaluation of the effects of the candidate drug will be, e.g., the visual assessment of the size and severity of the tumor. This has the additional advantage that the visual inspection of the tumor allows an immediate and continuous assessment of drug efficacy. In the case of non visible tumors, drug effect evaluation will usually require the animal to be sacrificed to inspect the tumor. Neoplasias can be detected according to standard techniques well known to those of skill in the art. Such methods include, apart from visual inspection (for lesions on the skin), histochemical and immunohistochemical techniques, and the like. Typically the drug candidate(s) are evaluated for their ability to inhibit the formation and/or the growth of tumors developed from the transplanted cell line. The present invention further comprises a step of determining whether the candidate drug is the anti-cancer drug according to a result of the evaluating effect of the candidate drug from the step (c).
[0058] In addition, the present invention provides a method for screening an anti-cancer drug, comprising: (1) providing a tumor tissue, wherein the tumor tissue comprises cancer initiating cells (CICs), wherein the cancer initiating cells comprise isolated coxsackievirus and adenovirus receptor positive mouse pulmonary stem/progenitor cells (CAR.sup.+/mPSCs) that overexpress Oct-4 (CAR.sup.+/mPSC.sup.Oct-4.sup._.sup.hi); (2) contacting said tumor tissue with a candidate drug; and (3) detecting an effect of the candidate drug on the tumor tissue.
[0059] In one embodiment, the cancer initiating cells are a lung cancer initiating cell. In a preferred embodiment, the tumor tissue is a lung tumor tissue. In another embodiment, the anti-cancer drug is a drug for treating a cancer initiating cell. In a preferred embodiment, the anti-cancer drug is an anti-lung cancer drug. In a more preferred embodiment, the anti-cancer drug is a drug for treating a lung cancer initiating cell.
[0060] The CAR.sup.+/mPSC that overexpresses Oct-4 means the expression level of the Oct-4 in the CAR.sup.+/mPSC is 10 times higher than that of a normal cell. In a preferred embodiment, the expression level of the Oct-4 in the CAR.sup.+/mPSC is 16 times higher than that of a normal cell. In a more preferred embodiment, the expression level of the Oct-4 of the CAR.sup.+/mPSC is 20 times higher than that of a normal cell. The expression level is an expression level of a DNA, a RNA or a protein. In a preferred embodiment, the expression level is the expression level of the protein. The protein is encoded by an Oct-4 gene. In a more preferred embodiment, the sequence of the Oct-4 gene is SEQ ID NO: 1.
[0061] In another embodiment, each CAR.sup.+/mPSCs comprises a vector, wherein the vector comprises nucleotide sequence for encoding an Oct-4 gene. In a preferred embodiment, the sequence of the Oct-4 gene is SEQ ID NO: 1.
[0062] In one embodiment, the step of detecting the effect of the candidate drug on the tumor tissue comprises observing a change in the cancer initiating cell over time, cancer development process, or a biological property thereof, in the tumor tissue. The present invention further comprises a step of determining whether the candidate drug is the anti-cancer drug according to a result of the inhibiting effect of the test compound from the step (3).
[0063] The present invention also provides a method for scanning a candidate drug for anti-cancer, comprising: (i) collecting a culture solution containing cancer initiating cells (CICs), wherein the cancer initiating cells comprise isolated coxsackievirus and adenovirus receptor positive mouse pulmonary stem/progenitor cells (CAR.sup.+/mPSCs) that overexpress Oct-4 (CAR.sup.+/mPSC.sup.Oct-4.sup._.sup.hi); (ii) extracting an exosomal protein from CICS; (iii) analyzing the exosomal protein; and (iv) comparing a drug database with an analyzing result from step (iii) to obtain the candidate drug.
[0064] In one embodiment, the cancer initiating cells are a lung cancer initiating cell. In a preferred embodiment, the candidate drug for anti-cancer is a candidate drug for treating a cancer initiating cell. In a more preferred embodiment, the candidate drug for anti-cancer is a candidate drug for treating a lung cancer initiating cell. In another embodiment, the candidate drug for anti-cancer is a candidate drug for anti-lung cancer.
[0065] In another embodiment, the drug database is a DrugBank.
[0066] In one embodiment, the present invention further comprises a step after the step (iv), which is (v) assaying a cell toxicity of the candidate drug to CICs. If the candidate drug has a significant toxic effect on the cancer initiating cell, the candidate drug is an anti-cancer drug or a drug for treating cancer initiating cell.
[0067] Besides, the present invention provides a method of preparing a population of cancer initiating cells, comprising the steps: (1) providing vectors comprising a nucleotide sequence for encoding Oct-4 cDNA; (2) transfecting the vectors into a population of coxsackievirus and adenovirus receptor positive mouse pulmonary stem/progenitor cells (CAR+/mPSCs), wherein the vectors overexpress Oct-4 cDNA by increasing the number of copies of the nucleotide sequence in the CAR+/mPSCs relative to the number of copies that is normally present in a wild-type CAR+/mPSCs; and (3) isolating the population of CAR+/mPSCs that overexpress Oct-4 (CAR.sup.+/mPSC.sup.Oct-4.sup._.sup.hi) from the step (2).
[0068] In one embodiment, the gene sequence of the Oct-4 cDNA is SEQ ID NO: 1.
[0069] In another embodiment, the Oct-4 cDNA has a function for encoding an Oct-4 protein.
[0070] The term vector is used herein to refer to a nucleic acid molecule having nucleic sequences that enable its replication in a host cell. A vector can also include nucleic sequences to permit ligation of nucleic sequences within the vector, wherein such nucleic sequences are also replicated in a host cell. Representative vectors include plasmids, cosmids, and viral vectors. Preferably, the vectors are retroviral vectors.
EXAMPLES
[0071] The examples below are non-limiting and are merely representative of various aspects and features of the present invention.
Example 1
Materials and Methods
[0072] The coxsackievirus and adenovirus receptor positive mouse pulmonary stem/progenitor cells (CAR.sup.+/mPSC) were isolated from primary cultures according to coxsackievirus and adenovirus receptor positive (CAR-positive) expression by fluorescence-activated cell sorting (FACS). CAR.sup.+/mPSCs and CAR.sup.+/mPSC-derived type-I pneumocytes were transfected with retroviral vector encoding Oct-4 (SEQ ID NO: 1). Oct-4 hyperexpression cells, CAR.sup.+/mPSCs.sup.Oct-4.sup._.sup.hi clones were subjected to Western blot analysis, telomerase repeat amplification assay, flow cytometry analysis, soft agar colony formation assay, sphere formation assay, reverse transcription PCR and real-time PCR analysis gene expression, tube formation assay and CAM assay. In vivo tumorigenic potential was evaluated by limiting dilution transplantation and metastasis assays in SCID mice. Derived tumors were treated with immunohistochemical and immunofluorescence staining.
Cell Culture
[0073] Human lung adenocarcinoma cell line A549, mouse axillary lymph node/vascular epithelial cell line SVEC4-10 and human embryonic kidney cell line (HEK) 293T were obtained from the Bioresource Collection and Research Center of Taiwan. A549, SVEC4-10 and HEK293T cells were maintained in Dulbecco's modified Eagle medium (DMEM, Sigma-Aldrich) with 10% FBS at 37 C. in humidified incubator with 5% CO.sub.2.
Serum-Free Primary Selection Culture of Mouse Pulmonary Stem/Progenitor Cells
[0074] Neonatal ICR mice (postnatal between 1 to 3 days) were sacrificed by cervical dislocation. The lung tissues were separated and collected in pre-chilled Hank's buffer with penicillin (100 units/mL) and streptomycin (100 g/mL). Lung tissues were cut into small pieces of 1 to 2 mm in diameter in digested medium containing 0.1% protease type-XIV (Sigma-Aldrich) and 1 ng/mL DNase-I (Sigma-Aldrich) in Minimum Essential Medium Eagle (MEM) medium at 4 C. overnight. Afterwards, 10% FBS/MEM medium was added to neutralize the protease/DNase-I and tissue suspensions were gently pipetted with 10-mL pipettes several times. Tissue debris was filtered through a 100 m nylon cell strainer. The cells were washed and resuspended in MCDB-201 medium (Sigma-Aldrich) supplemented with insulin/transferrin/selenium (ITS) (Invitrogen). These cells were cultivated at a density of 3 10.sup.5 cells/mL in collagen-I (Becton Dickinson Biosciences) coated cell culture dishes. After 1 day of incubation, the cells were refreshed on MCDB-201 medium supplemented with ITS and recombinant 1 ng/mL epidermal growth factors (Invitrogen). Pulmonary epithelial colonies formed in the culture when cells were confluent at day 10 to 14. These primary cells were applied to CAR-positive mPSCs isolation using FACS.
CAR.SUP.+./mPSCs Isolation
[0075] Cell suspensions obtained from the primary cultures were analyzed for CAR-positive cells using a FACS caliber instrument (Becton Dickinson Biosciences). Briefly, 110.sup.6 cells were incubated with goat polyclonal anti-CAR antibody (R&D Systems) at 4 C. for 1 h. After washing, cells were incubated with Alexa488-coupled donkey anti-goat IgG (Jackson ImmunoResearch) at 4 C. for 1 h. Cell fluorescence was evaluated using an FACSAria cell sorter (Becton Dickinson Biosciences), and data were analyzed using CellQuest (Becton Dickinson Biosciences). Cells were purified to >90% according to CAR-positive expression, and referred to as CAR.sup.+/mPSCs. CAR.sup.+/mPSCs were centrifuged using low speed centrifugation (1100 rpm for 5 min) and re-suspended for later use, including Oct-4 transfection and cell differentiation experiments.
Oct-4 Transfection
[0076] CAR.sup.+/mPSCs were isolated from primary cultures according to CAR-positive expression by FACS as described previously. Detailed methods are described in Supplementary Methods. CAR.sup.+/mPSCs and CAR.sup.+/mPSCs-derived type-I pneumocytes were transfected with retroviral vectors encoding Oct-4 (SEQ ID NO: 1). Briefly, the retroviral vector plasmid pMXs-mOct-4 (Addgene) and packaging plasmids (pCMV-gag-pol-PA and pCMV-VSVg) were introduced into HEK293T cells using GeneJuice transfection reagent (Novagen). After 48 h, viral supernatants were passed through a 0.45 m filter and supplemented with 10 g/mL polybrene. CAR.sup.+/mPSCs and derived type-I pneumocytes were seeded at 110.sup.4 cells per 35 mm dish, and incubated in the viral supernatants for 16 h. Transfected cells were cultivated in mES/MCDB201 (1:1) medium and supplied with mitomycin C inactivated MEF cells (feeder cells). Cobblestone-like colonies formed between day 18 and day 25. At day 28, colonies were manually isolated and further expanded on Matrigel (Becton Dickinson Biosciences) supplement in mES/MCDB201 (1:1) medium to establish the C1, E9, and C7 cell clones. For C1-GFP clone generation, C1 clone was transfected with retroviral vectors encoding GFP. Briefly, the retroviral vector plasmid pMXs-puro GFP (Addgene) and packaging plasmids (pCMV-gag-pol-PA and pCMV-VSVg) were introduced into HEK293T cells using GeneJuice transfection reagent (Novagen). After 48 h, viral supernatants were passed through a 0.45 m filter and supplemented with 10 g/mL polybrene. C1 clone were seeded at 110.sup.4 cells per 35 mm dish and incubated in the viral supernatants for 16 h. Puromycin (2.5 g/mL) was add to the medium, after 5 d, GFP-positive colonies were determined for expansion, referred to as C1-GFP clone.
RNA Extraction, Reverse Transcription PCR, and Real-Time PCR
[0077] Total RNA was extracted using TRIzol (Invitrogen). For cDNA synthesis, M-MLV RT (Promega) was used according to the manufacturer's instructions. Reverse transcription PCR was performed using Taq polymerase (Invitrogen) according to the manufacture's protocol. Real-time PCR was performed using the 7900 HT real-time PCR instrument (Applied Biosystems). Primer sequences are listed in Table 1. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) expression was used for normalization.
TABLE-US-00001 TABLE1 RT-PCRandReal-timeprimersequence AnnealTemperature ProductSize Gene Accession ForwardPrmiers(5.fwdarw.3) ReversePrimers(5.fwdarw.3 ( C.) (bp) RT-PCR CAR NM_009988 CGATGTCAAGTCTGGCGA GAACCGTGCAGCTGTATG 57 356 Oct-4 NM_013633 ATGGCTGGACACCTGGCTTC CCAGGTTCTCTTGTCTACCTC 62 1121 Sox2 NM_011443 TAGAGCTAGACTCGGGGCGATGA TTGCCTTAAACAAGACCA 562 297 Nanog NM_028016 AAAGGATGAAGTGCAAGCGGTGG CTGGCTTTGCCCTGACTTTAAGC 58 520 GAPDH NM_008084 ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA 58 452 Real-timePCR ANG1 NM_009640 GCATTCTTCGCTGCCATTCT TCTCCCTCCGTTTTCTGGATT ANG2 NM_007426 CCAACGCCTTAACCGATCTC ACCCCGAGTCTGTGGATTGAC VEGF NM_009595 TTGTGTTGGGAGGAGGATGTC GAAGCCTTTCATCCCATTGTCT PLGH NM_08827 TGGCTGCTGTGGTGATGAA TGCATAGTGATGTTGGCTGTCTT PDGF NM_011057 TTTCCAGACTTGGGCTTGGA AACGGACCCCCAGATCAGA GCSF NM_009971 GCAGGCTCTATCGGGTATTTCC AGTTGGCAACATCCAGCTGAA VCAM1 NM_0011693 TGCGAGTCACCATTGTTCTGAT ACCCCTCCGTCCTCACCTT bFGF NM_008006 TGGTATGTGCCACTGAAAGGA TCCAGGTCCCGTTTTGGAT VEGFR2 NM_010612 ACTGCAGTGATTGCCATGTTCT TCATTGGCCCGCTTAACG Tie2 NM_013690 CTTCATGTACAAGGGGCATTTC GTGGGTGGCTTGCTTGGT GAPDH NM_008084 CCAGCCTCGTCCCGTAGA CGCCCAATACGGCCAAA
Western Blot Analysis
[0078] Cell lysates were extracted in RIPA buffer (Pierce) and quantified by a BCA protein assay kit (Pierce) according to the manufacturer's protocol. Equal amounts (30 g) of total protein were separated using sodium dodecyl sulfate polyacrylamide gel electrophoresis and blotted onto activated polyvinylidene difluoride membranes (Millipore). After blocking with 5% fat-free milk, the membranes were incubated with primary antibodies, as listed in Table 2. The blots were then incubated with secondary antibody conjugated with horseradish peroxidase and immunoreacted bands were detected by enhanced chemiluminescence detection (Millipore).
Flow Cytometry Analysis
[0079] In CD133 expression analysis, cells were dissociated into single cells, washed, and suspended in PBS. Cells were labeled with allophycocyanin (APC)-conjugated anti-mouse CD1133 (BioLegend), and then analyzed using the FACS caliber instrument. In cell cycle distribution analysis, cells were cultivated in 6-well plates. After incubating for 24 h, cells were collected, washed with PBS, and fixed in 70% ethanol at 20 C. overnight. Subsequently, the cells were washed once with PBS and re-suspended in PBS containing 200 g/mL RNase A and 50 g/mL propidium iodide. FACS caliber instrument was used to analyze the cell cycle distribution. CD31 and GFP expression in tumors, tissue dissociation kit (Miltenyi Biotec) was used to dissociate tumors into cell suspension. Cell suspension was stained with APC conjugated anti-mouse CD31 (BioLegend) and subsequently analyzed using the FACS-caliber instrument.
ALDH Activity Assay
[0080] The aldehyde dehydrogenase (ALDH) activity of cells was detected using the ALDEFLUOR assay kit (StemCell Technologies) according to the manufacturer's protocol. The cells were suspended in an ALDEFLUOR assay buffer containing BODIPY-aminoacetaldehyde (BAAA) and incubated for 60 min at 37 C. The cells were treated with an ALDH inhibitor, diethylaminobenzaldehyde (DEAB), as a negative control. Propidium iodide staining identified nonviable cells. The FACS-caliber instrument was used to analyze the ALDH activity of cells in a green fluorescence channel (520-540 nm).
Telomerase Repeat Amplification Assay
[0081] Telomerase activity was measured using the telomerase repeat amplification (TRAP) assay. Cells were homogenized in a TRAP lysis buffer. Protein (20 g) was used in the telomerase reaction, along with 50 L of a TRAP reaction buffer containing 20 mM Tris-HCl (pH 8.3), 1.5 mM MgCl.sub.2, 63 mM KCl, 0.05% Tween-20, 1 mM EGTA, 50 M deoxynucleotide triphosphate (Pharmacia), 0.1 g each of labeled TS, ACX, and U2 primers, 510.sup.3 attomoles of an internal control primer (TSU2), 2 units of Taq DNA polymerase (Invitrogen), and 2 L of CHAPS extract. After incubating at 3 C. for 30 min, the telomerase-extended products were amplified through PCR under the following conditions: 30 cycles with each cycle comprising incubations at 94 C. for 30 s, 60 C. for 30 s, and 72 C., for 45 s. The reaction mixture was heated to 94 C. for 5 min to inactivate telomerase. Amplified products were resolved on a 12% polyacrylamide gel electrophoresis, stained with ethidium bromide and viewed under LTV light.
Soft Agar Colony Formation Assay
[0082] A soft agar colony formation assay was performed by seeding 310.sup.3 cells in 35 mm tissue culture dishes containing a layer of 0.35% low-melting agarose/ES/MCDB-201 over a layer of 0.5% low-melting agarose/ES/MCDB-201. Additional complete media was added every 2 d. After 2 wk, colonies were fixed with 0.05% crystal violet and methanol and colony formation was photographed and quantified using light microscopy.
Sphere Formation Assay
[0083] Cells were seeded in a 24 well ultra low-attachment plate (Corning) at a density of 1,000 cells per well and grown in serum-free DMEM, supplemented with 2% B27 (Invitrogen), 20 ng/mL EGF, and 20 ng/mL bFGF (Invitrogen). After cultivation for 14 d, primary spheres were harvested using centrifugation, dissociated with trypsin, and re-suspended in this medium. The secondary spheres (>70 m) were photographed and quantified after 10 days.
Xenograft Tumor Assay
[0084] All animal experiments were reviewed and approved by the Institutional Animal Care and Use Committee of National Taiwan University College of Medicine. For teratoma formation assay, 110.sup.6 cells of CAR.sup.+/mPSCs.sup.Oct-4.sup._.sup.hi C1, E9, and C7 clones were subcutaneously injected into 8-week-old male severe combined immunodeficiency (SCID) mice. For limiting dilution transplantation experiment, the C1 clone (10.sup.5, 10.sup.4, 10.sup.3 and 10.sup.2 cells) or CAR.sup.+/mPSCs (10.sup.6 cells) were subcutaneously injected into SCID mice. For C1-GFP clone and A549 cells derived tumor experiments. C1-GFP clone (110.sup.5 cells) or A549 (110.sup.6 cells) were subcutaneously injected into SCID mice. Tumor dimensions were measured using calipers once every 3 d, and volumes (cm.sup.3) were calculated according to the standard formula: lengthwidth.sup.2/2. At the end of the experiment, the tumors were surgically excised and photographed. In metastasis assay, 310.sup.5 cells of C1 clone, and CAR.sup.+/mPSCs were injected into the lateral tail vein of SCID mice. Lung metastatic nodules were evaluated at week 5 by necropsy and histological examination. Kaplan-Meier analysis was used for comparing the survival rates of mice injected with C1 clone and those injected with CAR.sup.+/mPSCs.
[0085] In secondary tumor experiments, 110.sup.6 of C1 clone developed tumor tissue after 4 weeks subcutaneous transplantation. Tumor tissue was cut into mini pieces and digested in trypsin-EDTA. Cell suspension was collected through 100 m cellular strainer. Cell differentiated high and low CAR expression using FACSAriaII cell sorter. 110.sup.5, 10.sup.4, 10.sup.3 and 110.sup.2 cell number (n=4/group) of CAR.sup.high and CAR.sup.low population were subcutaneously transplanted on the back of SCID mice. The secondary tumor formation was recorded for 5 weeks and then CAR expression in secondary tumor was further validated.
Immunohistochemistry and Immunofluorescence Staining
[0086] Tumors were fixed in formalin and subsequently dehydrated, paraffin embedded, and sectioned. Tumor sections were subjected to antigen retrieval with microwave irradiation in a citrate buffer (10 nM, pH 6.0). The sections were incubated at 4 C. with primary antibody overnight. For immunohistochemical staining, the sections were incubated with corresponding HRP-coupling secondary antibodies at room temperature for 1 h, and visualized using 0.05% 3,3-diaminobenzidine (DAB), and the nuclei were counter-stained with hematoxylin. For immunofluorescence staining, corresponding fluorescence coupling with a secondary antibody was performed at room temperature for 1 h. The nuclei were counter=stained with DAPI. Negative controls were prepared using identical conditions, and control IgG was used as a substitute for the primary antibody. Antibodies are listed in Table 2. Sections were examined using the Nikon Eclipse 800. Immunohistochemical staining sections were quantified using TissueFax (TissueGnostics GmbH) scanning, and the percentage of immune-positive population were analyzed with HistoQuest software (TissueGnostics GmbH).
TABLE-US-00002 TABLE 2 Antibody application Protein Assay Cat. No. Company Host Dilution Incubation Time CAR IF AF2654 R&D Systems goat 1:100 O/N, 4 C. T1 IF sc23564 Santa Cruz goat 1:200 O/N, 4 C. AQP5 IF AB15858 Millipore rabbit 1:200 O/N, 4 C. CAR IHC AF2654 R&D Systems goat 1:100 O/N, 4 C. Oct-4 IHC sc5279 Santa Cruz mouse 1:100 O/N, 4 C. phospho-Src IHC ab79308 Abcam rabbit 1:100 O/N, 4 C. phospho--catemin IHC ab53050 Abcam rabbit 1:100 O/N, 4 C. c-myc IHC ab32072 Abcam rabbit 1:500 O/N, 4 C. cycline D1 IHC ab134175 Abcam rabbit 1:200 O/N, 4 C. TTF1 IHC M3575 Dako mouse 1:100 O/N, 4 C. NAPSA IHC NB110-68133H Novus Biologicals mouse 1:500 O/N, 4 C. CK7 IHC ab9021 Abcam mouse 1:1000 O/N, 4 C. CK-HMW IHC ab76714 Abcam mouse 1:50 O/N, 4 C. CD31 IHC ab28364 Abcam rabbit 1:100 O/N, 4 C. CD105 IHC ab107595 Abcam rabbit 1:50 O/N, 4 C. vWF IHC ab9378 Abcam rabbit 1:100 O/N, 4 C. Oct-4 WB sc5279 Santa Cruz mouse 1:200 O/N, 4 C. Survivin WB ab182132 Abcam rabbit 1:1000 O/N, 4 C. cleaved caspase-3 WB 9664 Cell signaling rabbit 1:1000 O/N, 4 C. cleaved caspase-9 WB 9509 Cell signaling rabbit 1:1000 O/N, 4 C. Tic2 WB sc9026 Santa Cruz rabbit 1:200 O/N, 4 C. phospho-Tic2 WB ABS219 Millipore rabbit 1:2000 O/N, 4 C. ANG1 WB sc6320 Santa Cruz goat 1:200 O/N, 4 C. ANG2 WB 2948 Cell signaling rabbit 1:1500 O/N, 4 C. Grb2 WB ab32037 Abcam rabbit 1:1000 O/N, 4 C. ERK WB sc93 Santa Cruz rabbit 1:500 O/N, 4 C. phospho-ERK WB sc7383 Santa Cruz mouse 1:500 O/N, 4 C. GAPDH WB ab181602 Abcam rabbit 1:1000 O/N, 4 C. CAR FC AF2654 R&D Systems goat 1:100 1 hr, 4 C. CD31-APC FC 102509 BioLegand 1:100 1 hr, 4 C. CD133-APC FC 141208 BioLegand 1:100 1 hr, 4 C. Control IgG IF 012-000-003 Jackson ImmunoResearch rat 1:200 O/N, 4 C. Control IgG IF 005-000-003 Jackson ImmunoResearch goat 1:200 O/N, 4 C. Control IgG IF 011-000-003 Jackson ImmunoResearch rabbit 1:200 O/N, 4 C. Control IgG FC 400511 BioLegand 1:100 1 hr, 4 C. AlexaFlour488-anti-goat IgG IF 705-545-003 Jackson ImmunoResearch donkey 1:200 1 hr, RT Cy3-anti-goat IgG IF 705-165-147 Jackson ImmunoResearch donkey 1:500 1 hr, RT Cy3-anti-mouse IgG IF 115-165-003 Jackson ImmunoResearch goat 1:500 1 hr, RT Cy3-anti-rabbit IgI IF 711-165-152 Jackson ImmunoResearch donkey 1:500 1 hr, RT AlexaFlour488-anti-rabbit IgG IF 111-095-003 Jackson ImmunoResearch goat 1:500 1 hr, RT IF, Immunofluorescence; IHC, Immunohistochemistry; WB, Western blot; FC, Flow cytometry; O/N, Overnight; RT, Room temperature.
Cell Viability Assay
[0087] Cells were seeded at 310.sup.3 cells per well in 96-well plates and incubated for 18 h. Cells were treated with cisplatin (Sigma-Aldrich) or paclitaxel (Sigma-Aldrich) at various concentrations. After 48 h, WST-1 assay (Roche) was performed to determine cell viability according to the manufacturer's instructions. Cell viability was expressed as a percentage of the non-treated group, and the IC.sub.50 values were determined.
Chick Chorioallantoic Membrane (CAM) Assay
[0088] Fertilized chicken eggs were incubated at 37 C. in an atmosphere of 80% humidity. At day 8 of the development, 110.sup.6 cells were loaded onto a membrane and implanted on the top of the growing CAM. At day 11, CAM was fixed with 4% paraformaldehyde, and photographed using a stereomicroscope and digital camera. Branching points were quantified using NIH Image J software with the angiogenesis plugin.
In Vitro CAR.sup.+/mPSCs.sup.Oct-4.sup._.sup.hi Tube Formation Assay
[0089] Cells were cultivated in an endothelial cell growth medium (EGM) (Lonza) for 7 d. Cells were collected and suspended in DMEM supplemented with 2% FBS and seeded on Matrigel. After 8 h, cells were stained with calcein-AM (Invitrogen), and images were obtained using a fluorescence microscope (Zeiss).
CAR.sup.+/mPSCs.sup.Oct-4.sup._.sup.hi C1 Clone and SVEC4-10 Co-Culture for Tube Formation
[0090] Matrigel was plated on 35 mm Ibidi dishes. C1 clone derived spheres labeled with the green fluorescent tracer, calcein-AM, were mixed with SVEC4-10 cells that had been stained with a red fluorescent cell tracer dye, PHK26 (Sigma-Aldrich). Nuclei were counter-stained with Hoechst33342. The cellular mixture was seeded onto Matrigel plated dishes in DMEM containing 2% FBS and 5% Matrigel. Tube formation was recorded using time-lapse immunofluorescence confocal microscopy.
Inhibition of Tie2 Kinase Inhibitor
[0091] Tie2 kinase inhibitor is a potent, reversible and selective ATP-binding site-targeting Tie2 kinase. The chemical formula was 4-(6-methoxy-2-naphthyl)-2-(4-methylsulfinyl phenyl-5-(4-pyridyl)-1H-imidazole (CAS number:948557-43-5) (ab141270, Abcam, Cambridge, Mass.). The cytotoxicity of Tie2 kinase inhibitor (2 M) for CAR.sup.+/mPSCs.sup.Oct-4.sup.
[0092] In tube formation experiments, tube formation of EGM cultured CAR.sup.+/mPSCs.sup.Oct-4.sup._.sup.hi C1 clone was treated with 2 M Tie2 kinase inhibitor. After 8 h, cells were stained with calcein-AM (Invitrogen), and images were obtained using a fluorescence microscope (Zeiss).
[0093] In blood vessel formation assay, 110.sup.6 cells of CAR.sup.+/mPSCs.sup.Oct-4.sup._.sup.hi C1 clone were treated with 2 M Tie2 kinase inhibitor and proceeded CAM assay. At day 11, CAM was fixed with 4% paraformaldehyde, and photographed using a stereomicroscope and a digital camera. Branching points were quantified using NIH Image J software with the angiogenesis plugin.
[0094] 110.sup.5 cells of CAR.sup.+/mPSCs.sup.Oct-4.sup._.sup.hi C1 clone were subcutaneously injected into 8-week-old male severe combined immunodeficiency (SCID) mice. 50 mg/kg BW Tie2 kinase inhibitor were administered via ip once every two days from 10 to 25 days. Tumor dimensions were measured using calipers once every 2 or 3 d, and volumes (cm.sup.3) were calculated according to the standard formula: lengthwidth.sup.2/2. At the end of the experiment, the tumors were surgically excised and photographed.
Statistical Analysis
[0095] Quantitative data from at least three independent experiments are expressed as meanstandard deviation (SD). Student's t-tests were used to compare the differences between groups. Survival curves were obtained using the Kaplan-Meier analysis. P<0.05 is considered statistically significant.
Results
Transfection of Oct-4 for Hyperexpression in CAR.SUP.+./mPSCs
[0096] Tissue specific stem cells are small in number yet largely responsible for tissue homeostasis. In previous studies, CAR.sup.+/mPSCs were successfully identified and isolated (
[0097] Overexpression of Oct-4 through retrovirus transfection was performed in both CAR.sup.+/mPSCs and CAR.sup.+/mPSCs-derived type-I pneumocytes. In the experiment, CAR.sup.+/mPSCs were transfected with Oct-4 (
TABLE-US-00003 TABLE 3 Frequency of cobblestone-like colony formation Frequency of Cell Type colony formation CAR.sup.+/mPSCs 0.09 0.04% CAR.sup.+/mPSCs with N.D. sham control CAR.sup.+/mPSCs-derived N.D. Type-I pneumocytes Data are presented as mean SD
[0098] The frequency of cobblestone-like colony formation in CAR.sup.+/mPSCs ranged from 0.05-0.13% (Table 3). Meanwhile, no cobblestone-like colonies were observed in the sham control transfection in CAR.sup.+/mPSCs (data not shown). Retroviral transfection of CAR.sup.+/mPSCs-derived type-I pneumocytes was performed at day 8 when type-I pneumocytes were well-differentiated (
[0099] The cobblestone-like colonies were isolated and established as separate cell clones. To evaluate phenotypic alterations, cell clones from 3 independent experiments, named C1, E9, and C7, were selected for further examinations. Western blot analysis showed that Oct-4 was highly expressed in the C1, E9, and C7 clones; thus, they were referred as CAR.sup.+/mPSCs.sup.Oct-4.sup._.sup.hi clones (
TABLE-US-00004 TABLE 4 Analysis of G.sub.1-, S-, and G.sub.2/M-phases of cell cycle in CAR.sup.+/mPSCs.sup.Oct-4.sup.
[0100] Additionally, the C1, E9, and C7 clones could propagate for more than 50 passages, with a doubling time of 231 h (
TABLE-US-00005 TABLE 5 Doubling time Doubling Time (h) CAR.sup.+/mPSCs 63.5 9.0 CAR.sup.+/mPSCs.sup.Oct-4.sup.
[0101] While telomerase activity was detected in the 12.sup.th, 20.sup.th and 50.sup.th passages of the C1, E9, and C7 clones, it was not detected in CAR.sup.|/mPSCs (
CAR.sup.+/mPSCs.sup.Oct-4.sup._.sup.hi Exhibited Tumorigenic Potential
[0102] In order to evaluate the pluripotent potential of CAR.sup.|/mPSCs.sup.Oct-4 hi clones, teratoma formation assays were performed with the C1, E9, and C7 clones. 110.sup.6 cells of C1, E9, or C7 clones were subcutaneously implanted in SCID mice. After 20 to 24 d, teratomas of approximately 1 cm had developed (
[0103] The tumorigenic potential of CAR.sup.+/mPSCs.sup.Oct-4.sup._.sup.hi clones was then quantified. Anchorage-independent growth was evaluated using a soft agar colony formation assay. After 2 weeks, the C1, E9, and C7 clones had formed more significant soft agar colonies number compared to the human lung adenocarcinoma cell line A549. However, no such colonies were observed for CAR.sup.+/mPSCs (
TABLE-US-00006 TABLE 6 Quantification of colonies and spheres Colonies number Spheres number CAR.sup.+/mPSCs 0 0 CAR.sup.+/mPSCs.sup.Oct-4.sup.
[0104] In the assays, the C1 clone exhibited the most pronounced tumorigenic behaviors, including the highest proliferation rate, highest efficiency in anchorage-independent colony formation, and secondary sphere generation; therefore, the C1 clone was selected for subsequent in vivo tumorigenic experiments. To determine the tumorigenicity of the C1 clone, a limiting dilution transplantation experiment was performed. Tumor formation potencies were 6/6, 5/6, and 5/6 in 10.sup.5, 10.sup.4, and 10.sup.3 cell concentrations of C1 clone injections, respectively. In addition, a low cell concentration of C1 clone (10.sup.2) was sufficient for tumor formation (4/6) at an average of 28 d after injection (
CAR.sup.+/mPSCs.sup.Oct-4.sup._.sup.hi Exhibited Lung Cancer CICs Traits
[0105] Different biomarkers for lung CICs have been proposed, including CD133 expression, ALDH activity, and chemoresistance. These biomarkers were utilized to further investigate CICs characteristics in CAR.sup.+/mPSCs.sup.Oct-4.sup._.sup.hi clones. Flow cytometry analysis revealed that about 17.4-31.7% of cells were CD133.sup.+ among the C1, E9, and C7 clones, whereas CD133.sup.+ cells were nearly undetectable in CAR.sup.+/mPSCs (
TABLE-US-00007 TABLE 7 IC.sub.50 of cisplatin and paclitaxel for CAR.sup.+/ mPSCs.sup.Oct-4.sup.
[0106] It has been well documented that the protein survivin inhibits apoptosis and plays an important role in conferring chemoresistance to CICs. The present invention found that survivin expression was significantly higher in the C1, E9, and C7 clones compared to CAR.sup.+/mPSCs (
[0107] Thus, the present invention further compared the differences of the CAR.sup.+/mPSCs, the CAR.sup.+/mPSCs.sup.Oct-4.sup._.sup.hi and the A549 cells (human lung adenocarcinoma cell line) (Table 3). Compared to the CAR.sup.|/mPSCs. CAR.sup.+/mPSCs.sup.Oct-4.sup._.sup.hi had many traits of a cancer initiating cell. The A549 cells are cancer cells but not cancer initiating cells. Compared to the A549 cells, the CAR.sup.+/mPSCs.sup.Oct-4.sup._.sup.hi had higher expression levels of soft agar colony, sphere formation, CD133 and aldehyde dehydrogenase (ALDH) activity. Besides, a small number (10.sup.3 cells) of the CAR.sup.+/mPSCs.sup.Oct-4.sup._.sup.hi could form a tumor and had a tumor regeneration capacity. These data indicated the CAR.sup.+/mPSCs.sup.Oct-4.sup._.sup.hi was the cancer initiating cell.
TABLE-US-00008 TABLE 8 Comparison of CAR.sup.+/mPSCs, CAR.sup.+/ mPSCs.sup.Oct-4.sup.
[0108] In the previous study, CAR.sup.+/mPSCs were shown to express the proangiogenic factors, including vascular endothelial growth factor A (VEGFa), granulocyte colony stimulating factor (GCSF), vascular cell adhesion molecule 1 (VCAM-1), and basic fibroblast growth factor (bFGF), which initiated endothelial cell tube formation. Therefore, the present invention wanted to evaluate the potential for angiogenesis in the CAR.sup.+/mPSCs.sup.Oct-4.sup._.sup.hi clones. Real-time PCR analysis was performed and the present invention found that proangiogenic factors, including angiopoietin 1 (ANG1), angiopoietin 2 (ANG2), VEGFa, placental growth factor (PLGF), platelet-derived growth factor A (PDGFa). GCSF, VCAM-1, and bFGF, were expressed at significantly higher levels in the C1, E9, and C7 clones compared with CAR.sup.+/mPSCs (
[0109] To further elucidate the functional contribution of CAR.sup.+/mPSCs.sup.Oct-4.sup._.sup.hi in angiogenesis, tube formation of endothelial cells after incubation with the C1 clone was monitored. C1 clone-derived spheres labeled with the green fluorescent tracer, calcein-AM, were mixed with SVEC4-10 cells that had been labeled with the red fluorescent tracer, PKH26, and then were co-cultured for tube formation. C1 clone-derived spheres recruited SVEC4-10 cells and established tube network (
[0110] One skilled in the art readily appreciates that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. The cells, method of creating the same, and uses thereof are representative of preferred embodiments, are exemplary, and are not intended as limitations on the scope of the invention. Modifications therein and other uses will occur to those skilled in the art. These modifications are encompassed within the spirit of the invention and are defined by the scope of the claims.
[0111] It will be readily apparent to a person skilled in the art that varying substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention.
[0112] All patents and publications mentioned in the specification are indicative of the levels of those of ordinary skill in the art to which the invention pertains. All patents and publications are herein incorporated by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference.
[0113] The invention illustratively described herein suitably may be practiced in the absence of any element or elements, limitation or limitations, which are not specifically disclosed herein. The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention that in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention as defined by the appended claims.