BACILLUS SUBTILIS JCK-1398 STRAIN INDUCING RESISTANCE IN VARIOUS PLANTS, AND COMPOSITION AND METHOD FOR CONTROLLING PINE WILT DISEASE BY USING SAME

Abstract

The present invention relates to a Bacillus subtilis JCK-1398 strain (Accession No. KCTC 14084BP) having induced resistance activity in pine trees and various plants, a pesticidal or antibacterial composition comprising same as an active ingredient, a composition for controlling plant diseases or pests, and a control method using same. The Bacillus subtilis JCK-1398 strain of the present invention was experimentally confirmed to have control activity against pests, nematodes, and fungi, which cause various plant diseases, by inducing resistance in a host. Thus, the Bacillus subtilis JCK-1398 strain of the present invention can be effectively used to control related plant diseases and can be spread over a wide area through foliar spraying, and therefore is expected to be able to prevent the spread of pine wilt disease at low cost.

Claims

1. A Bacillus subtilis JCK-1398 strain (accession number KCTC 14084BP) that activates induced resistance in a plant against a disease or pest.

2. The strain of claim 1, wherein the strain includes the nucleotide sequence of gyrA of SEQ ID NO: 33.

3. The strain of claim 1, wherein the strain exhibits a control effect against at least one plant disease or pest selected from the group consisting of pine wilt disease, bacterial spot, dollar spot, and Aculops lycopersici.

4. A pesticidal or antibiotic composition containing at least one selected from the group consisting of the strain of claim 1, a culture of the stain, a concentrate of the culture, a dried product of the culture, a culture supernatant of the strain.

5. The composition of claim 4, wherein the composition exhibits pesticidal activity against at least one selected from the group consisting of Bursaphelenchus xylophilus and Aculops lycopersici.

6. The composition of claim 4, wherein the composition exhibits antibacterial activity against at least one selected from the group consisting of Xanthomonas euvesicatoria and Sclerotinia homoeocarpa.

7. A composition for controlling a plant disease or pest, the composition containing at least one selected from the group consisting of the strain of claim 1, a culture of the stain, a concentrate of the culture, a dried product of the culture, and a culture supernatant of the strain.

8. The composition of claim 7, wherein the plant disease or pest is selected from the group consisting of pine wilt disease, bacterial spot, dollar spot, and Aculops lycopersici.

9. The composition of claim 7, wherein the composition is used as a combination agent with a synthetic agrochemical.

10. The composition of claim 8, wherein the synthetic agrochemical is tebuconazole.

Description

BRIEF DESCRIPTION OF DRAWINGS

[0049] FIG. 1 confirms the expression of induced resistance-related genes by the Bacillus subtilis JCK-1398 strain according to one example of the present invention.

[0050] FIG. 2 shows the phylogenetic analysis result of the gyrA nucleotide sequence of the Bacillus subtilis JCK-1398 strain according to one example of the present invention.

[0051] FIG. 3A confirms the pine wilt disease control effect of the Bacillus subtilis JCK-1398 strain according to one example of the present invention, showing the seedling test result of a culture of the JCK-1398 strain on Pinus densiflora seedlings expressed by a disease progression curve.

[0052] FIG. 3B confirms the pine wilt disease control effect of the Bacillus subtilis JCK-1398 strain according to one example of the present invention, showing Pinus densiflora seedlings treated with a culture of the JCK-1398 strain (a), untreated (b), and uninoculated (c).

[0053] FIG. 4A confirms the pine wilt disease control effects of the Bacillus subtilis JCK-1398 strain according to one example of the present invention, showing the pine wilt disease control effects of a culture, culture filtrate, and cell fraction of the JCK-1398 strain at 0.D 600=0.8.

[0054] FIG. 4B confirms the pine wilt disease control effects of the Bacillus subtilis JCK-1398 strain according to one example of the present invention, showing Pinus densiflora seedlings treated with a culture of the JCK-1398 strain (a), a culture filtrate of the JCK-1398 strain (b), a cell fraction of the JCK-1398 strain (c), untreated (d), and uninoculated (e).

[0055] FIG. 5A confirms the pine wilt disease control effect of the Bacillus subtilis JCK-1398 strain depending on the treatment time according to one example of the present invention, showing the seedling test result of the culture of the JCK-1398 strain on Pinus densiflora seedlings expressed by a disease progression curve.

[0056] FIG. 5B confirms the pine wilt disease control effect of the Bacillus subtilis JCK-1398 strain depending on the treatment time according to one example of the present invention, indicating a control effect of the culture of the JCK-1398 strain 60 days after inoculation with Bursaphelenchus xylophilus.

[0057] FIG. 5C confirms the pine wilt disease control effect of the Bacillus subtilis JCK-1398 strain depending on the treatment time according to one example of the present invention, showing Pinus densiflora seedlings treated 2 weeks before - 1 week before (a), 3 weeks before - 1 week before (b), and 4 weeks before - 1 week before (c) inoculation with Bursaphelenchus xylophilus, untreated (d), and uninoculated (e).

[0058] FIG. 6 confirms the pine wilt disease control effect of the Bacillus subtilis JCK-1398 strain depending on the treatment concentration according to one example of the present invention.

[0059] FIG. 7A confirms the pine wilt disease control effect of the Bacillus subtilis JCK-1398 strain according to one example of the present invention, showing the seedling test result of a culture of the JCK-1398 strain on Pinus densiflora adult trees expressed by a disease progression curve.

[0060] FIG. 7B confirms the pine wilt disease control effects of the Bacillus subtilis JCK-1398 strain according to one example of the present invention, showing the control effects of the Bacillus subtilis JCK-1398 strain through first and second field tests.

[0061] FIG. 7C confirms the pine wilt disease control effect of the Bacillus subtilis JCK-1398 strain according to one example of the present invention, showing Pinus densiflora adult trees treated with a 50-fold diluted solution of a spray-dried powder of the JCK-1398 strain (a), emamectin benzoate (b), and uninoculated (c).

[0062] FIG. 8 confirms the pine wilt disease control effects of combination agents of a Bacillus subtilis JCK-1398 20% SC formulation and the induced resistance elicitors ASM and MeSA according to one example of the present invention.

[0063] FIG. 9 confirms the pine wilt disease control effects of a Bacillus subtilis JCK-1398 20% SC formulation and a Bacillus subtilis JCK-1398 10% SC formulation at various concentrations according to one example of the present invention.

[0064] FIG. 10A confirms the pine wilt disease control effect of a Bacillus subtilis JCK-1398 10% SC formulation in adult trees aged 30 years according to one example of the present invention, showing the evaluation result of practical application by use using an unmanned helicopter, expressed by a disease progression curve.

[0065] FIG. 10B confirms the pine wilt disease control effect of a Bacillus subtilis JCK-1398 10% SC formulation in adult trees aged 30 years according to one example of the present invention, showing the disease severity 6 months after the inoculation with Bursaphelenchus xylophilus.

[0066] FIG. 11 confirms the bacterial spot control effect of a culture of the Bacillus subtilis JCK-1398 strain according to one example of the present invention.

[0067] FIG. 12 confirms the dollar spot control effect of a culture of the Bacillus subtilis JCK-1398 strain according to one example of the present invention.

[0068] FIG. 13 confirms the Aculops lycopersici control effects of a Bacillus subtilis JCK-1398 strain 20% SC formulation according to one example of the present invention.

BEST MODE FOR CARRYING OUT THE INVENTION

[0069] The present invention is directed to a Bacillus subtilis JCK-1398 strain (accession number KCTC 14084BP) that activates induced resistance in a plant against disease and pests.

MODE FOR CARRYING OUT THE INVENTION

[0070] Hereinafter, the present invention will be described in more detail with reference to exemplary embodiments. These exemplary embodiments are only for illustrating the present invention, and it would be obvious to those skilled in the art that the scope of the present invention is not construed as being limited to the exemplary embodiments.

Example 1: Screening of strains inducing induced resistance

[0071] To obtain strains inducing induced resistance against pine wilt disease, 500 plant-originate microbial strains were isolated from various plants. Strains (25 strains) inducing induced resistance were selected from about the 500 isolated plant-originated microbial strains by using Arabidopsis thaliana transformed with a vector having PR-1 promoter labeled with GUS. The results are shown in Table 1 below.

TABLE-US-00001 TABLE 1 Strain Activity JCK-757 * JCK-758-1 * JCK-758-2 * JCK-761 * JCK-767 * JCK-947 * JCK-1005 * JCK-1180 * JCK-1182 * JCK-1187 * JCK-1217 * JCK-1222 * JCK-1229 * JCK-1233 * JCK-1266 * JCK-1287 * JCK-1288 * JCK-1307 * JCK-1308 * JCK-1309 * JCK-1318 * JCK-1320 * JCK-1328 * JCK-1333 * JCK-1398 *

Example 2: In vitro induced resistance assay using pine callus

[0072] The 25 strains selected in Example 1 were investigated for expression of induced resistance-related genes of Pinus densiflora callus.

[0073] Specifically, a pine resistance-inducing strain was cultured in 500 pl of LM medium in 12-well microplates to an absorbance of 0.8 at 600 nm (OD 600), and then the surface of 100 mg of Pinus densiflora callus was treated with 500 pl of the culture, and the callus surface and the culture of the pine resistance-inducing strain were sufficiently incubated for 24 hours in a shaking incubator at 50 rpm and 25° C. in a dark condition. Then, the callus that had been incubated was separated by centrifugation at 600×g for 5 to 10 minutes using a centrifuge. RNA was extracted from the separated callus to synthesize cDNA, and the specifically increased expression of induced resistance-related genes was investigated through RT-PCR or qRT-PCR. The results are shown in FIG. 1 and Table 2. The induced resistance-related genes used in qRT-PCR are shown in Table 3 below.

TABLE-US-00002 TABLE 2 No Name Expression level 1 PR-1b family 1.35 2 PR-2 family 1.02 3 PR-3 family class 1 0.70 4 PR-3 family class 4 2.84 5 PR-4 family 10.20 6 PR-5 family 2.21 7 PR-9 family 1.49 8 PR-10 family 1.56 9 Antimicrobial peptide 11.91 10 Cytochrome P450 1.06 11 Extensin 0.84 12 Hydroxyproline-rich glycoprotein precursor 0.50 13 Metallothionein-like protein 1.59 14 Xyloglucan endotransglycosylase 0.72

TABLE-US-00003 TABLE 3 SEQ ID Sequence Size NO Name (5′.fwdarw.3′) (bp) 1 PR-1b family For TGCCCCTTCAGGTAAATCGT 125 2 PR-1b family Rev GCGGGTCGTAGTTGCAGATAA 3 PR-2 family For CGACAACATTCGCCCCTTCT 130 4 PR-2 family Rev CTGCAGCGCGGTTTGAATAT 5 PR-3 family class 1 For ACCTACAGCGCTTCATTGC 120 6 PR-3 family class 1 Rev TGTGGTTTCATGCGACGTTT 7 PR-3 family class 4 For CCATCGAAGCCCAGGTAATTT 90 8 PR-3 family class 4 Rev AGCCGGGAAGCAATATTATGGT 9 PR-4 family For CCCCGTTACTGTCAATTGCAT 90 10 PR-4 family Rev AAAGCGTGACGGTGCGTATT 11 PR-5 family For GAACCAGTGCCCATACACAGTCT 96 12 PR-5 family Rev CCTGCGGCAACGTTAAAAGTC 13 PR-9 family For ACACCACCGTGCTGGACATT 118 14 PR-9 family Rev GTGCGGGAGTCGGTGTAGAG 15 PR-10 family For TGTCTCAAGTGGAGGCAAGGA 90 16 PR-10 family Rev AAGCGACAATTTCAGGCAAAAC 17 Antimicrobial peptide For GCGTTGCTCATACCCGTTTT 90 18 Antimicrobial peptide Rev GCAGCACTTAGCACTGGATGAA 19 Cytochrome P450 For AACATGTCCTGCAGCACGAA 95 20 Cytochrome P450 Rev GTGCACCGCAAGTAAACCAA 21 Extensin For CGAATGTAATTCCGAAGTTGCA 110 22 Extensin Rev CCATCCCAAACCACCAGTCT 23 Hydroxyproline-rich GAGAAACTGGCACCGTCTTAGGA 140 glycoprotein precursor For 24 Hydroxyproline-rich ACCTCCCCCTCCATCTCACA glycoprotein precursor Rev 25 Metallothionein-like protein For TCAGGCTGCTGCGTTATTTG 120 26 Metallothionein-like protein Rev TGTCAGCGCAGTCACAATTTG 27 Xyloglucan TCTGCGCCCCTACTTTTCC 121 endotransglycosylase For 28 Xyloglucan AGCTGGGCGATTGATCATGT endotransglycosylase Rev 29 Elongation factor-1 alpha For GGGAAGCCACCCAAAGTTTT 160 30 Elongation factor-1 alpha Rev TACATGGGAAGACGCCGAAT

[0074] As can be confirmed from FIG. 1 and Table 2, the present inventive Bacillus subtilis JCK-1398 strain among the 25 selected strains specifically increased genes for proteins, such as PR-1b family, PR-3 family class 4, PR-4 family, PR-5 family, PR-9 family, PR-10 family, antimicrobial peptide, and metallothionein-like protein.

Example 3: Molecular biological identification and phylogenetic

[0075] classification

[0076] The Bacillus subtilis JCK-1398 strain was streaked on a tryptic soy agar (TSA, Difco) solid medium, followed by static culture at 30° C. for 1 day. The obtained single colonies were seeded into a tryptic soy agar (TSA, Difco) liquid medium by using a sterilized loop, followed by shaking culture at 30° C. and 150 rpm for 1 day. Then, genomic DNA (gDNA) of the strain was extracted using the DOKDO-Prep Bacterial Genomic DNA Purification Kit (Elpis Biotech) according to the protocol. The extracted gDNA was mixed with a polymerase chain reaction-premix (PCR-premix) by iNtRON Biotechnology and a primer set capable of amplifying gyrase A subunit (gyrA) gene, and then the gyrA gene of the JCK-1398 strain was amplified through PCR. The primer set used in PCR is shown in Table 4 below.

TABLE-US-00004 TABLE 4 SEQ ID NO Name Sequence (5′-> 3′) 31 gyrA For CAG TCA GGA AAT GCG TAC GTC CTT 32 gyrA Rev CAA GGT AAT GCT CCA GGC ATT GCT

[0077] PCR was performed starting at 95° C. for 5 min, followed by 30 cycles of 95° C. for 30 s, 55° C. for 30 s, and 72° C. for 30 s, and then at 72° C. for 7 min, and the amplification was ended at 12° C. Nucleotide sequencing of the amplified PCR product was carried out by Genotech (Daejon, South Korea), and the nucleotide sequence of the gyrA gene of the JCK-1398 strain was obtained (SEQ ID NO: 33). The obtained nucleotide sequence of the gyrA gene was compared with nucleotide sequences of the GenBank database by using nBlast search in NCBI. In addition, nucleotide sequences of gyrA gene having high similarity were ensured from the GenBank database, and all the nucleotide sequences and the nucleotide sequence of the gyrA gene of the JCK-1398 strain were aligned by the BioEdit Sequence Alignment Editor, and phylogenetic analysis was carried out on the basis of the neighbor-joining (NJ) algorithm by using the Mega Program (version 6.0) with the number of boot-strap trials set to 1,000. The results are shown in FIG. 2.

TABLE-US-00005 TABLE 5 SEQ ID NO Name Sequence (5′ .fwdarw. 3′) 33 Bacillus GATGTTTGTAGAGCAGTTTGTTTGTA subtilis CAGATTGTTTAAGATGACATTCGCA JCK-1398 TTGGCATCGCGTCTGATTTCAATGA strain CAATTCTCATACCTGTACGATCTGA gyrA CTCATCACGCAGATCTGTGATACCC sequence TCTATCTTTTTGTCCCTTACGAGAT CAGCAATTTTCTCAATTAATTTCGC CTTATTTACTTGGTAAGGTAACTCT GTAACGATAATTCTTTCTTTACCCG AAGATGTTTGTTCGATCTCAGCTTT TGCCCGGATCGTGATAGAGCCTCGG CCTGATTCGTATGCTTTCCGGATAC CGCTGCGGCCCAAGATTTGACCCGC AGTCGGGAAATCAGGTCCTGGAATG ACTTCCATAAGCTCTGGAATGGTAA TGTCCGGATTCTCACTGACAGCAAG TACTCCGTCAATGATTTCTCCCAGC TGGTGCGGAGGAATGTTTGTTGCCA TACCTACCGCAATGCCGGCAGCACC GTTCACGAGCAGATTCGGGAACCTT GAAGGCATAACGACAGGTTCTCTTT CTGACCCGTCATAGTTATCCTGGTA ATCGATTGTGTCTTTTGTGATGTCA CGAAGAATCTCCATTGAGATTTTAG ACATTCTTGCTTCTGTATAACGCAT GGCCGCCGCTGAGTCTCCGTCAACA GAACCGAAGTTTCCGTGACCGTCAA CGAGCATATAACGGTAGTTGAAATC CTGAGCCATTCTGACCATGGATTCA TATACCGCTGAATCACCGTGCGGGT GGTATTTCCCGATAACTTCTCCAAC GATACGCGCGGATTTTTTATAAGGC TTGTCACTTGTCATGCCTAAATCAT TCATTGCATACAAAATCCGTCTATG AACTG

[0078] As can be confirmed in FIG. 2, the JCK-1398 strain was identified as a

[0079] Bacillus subtilis strain.

Example 4: Control effect against pine wilt disease

[0080] To investigate the control effect of a culture of the Bacillus subtilis JCK-1398 strain against pine wilt disease, a seedling test was performed using Pinus densiflora seedlings aged 3-4 years (approximately 5.5 m in diameter and approximately 35-45 cm in height from the soil).

4-1. Preparation of culture of JCK-1398 strain

[0081] The JCK-1398 strain suspended in a 20% glycerol solution and stored in a −80° C. deep freezer was subjected to static culture in TSA at 30° C. for about 24 hours. Then, TSB was placed in a test tube, the entrance of which was then closed with a cotton plug, followed by sterilization. One colony of the cultured JCK-1398 strain was scraped by a platinum loop and seeded into TSB, and then further cultured with shaking at 150 rpm and 30° C. in an aerobic condition for about 24 hours. The culture of the JCK-1398 strain was placed in a 250-m1 Erlenmeyer flask containing 50 ml of sterilized TSB until the optical density value was 1.0 at 600 nm in a UV spectrometer, thereby preparing a suspension. Then, shaking culture was performed at 30° C. and 150 rpm in the aerobic condition for about 24 hours.

4-2. Spraying of culture of JCK-1398 strain

[0082] First, each pine tree was sufficiently pre-treated with 5 ml of Tween 20 (250 pg/ml) and then dried for 2 hours, so as to enable the culture of the JCK1398 strain to be well adsorbed into leaves. Then, the culture of the JCK-1398 strain obtained in Experimental Example 4-1 was diluted in an aqueous solution containing Tween 20 (250 pg/ml) to an optical density value of 0.8, and then the resultant solution was placed in a fine sprayer and each pine tree was foliar-sprayed with 5 ml of the solution.

4-3. Culture of Bursaphelenchus xylophilus

[0083] Botrytis cinerea, which is food for Bursaphelenchus xylophilus, seeded into a potato dextrose agar (PDA) medium and was subjected to static culture for 7 days in a 25° C. incubator. Bursaphelenchus xylophilus (National Institute of Forest Science) was inoculated onto the cultured Botrytis cinerea, followed by static culture for 7 days in a 25° C. incubator. The cultured Bursaphelenchus xylophilus was harvested using the Baermann funnel method, and then adjusted to 20,000 nematodes/ml by examining the number of nematodes under an optical microscope.

4-4. Control effect against pine wilt disease

[0084] About 1 cm of a woody part of the pine trees, which had been pre-treated with the culture of the JCK-1398 strain in Experimental Example 4-2 by foliar spraying, was cut to the deep endothelial area by a sterilized knife. Thereafter, a sterilized cotton wool made with 0.5 cm in width and 1 cm in length was inserted in the cut site, and the inoculation with the isolated Bursaphelenchus xylophilus at 2,000 nematodes in 100 pl (inoculation 1 week after the treatment with a chemical, such as the culture of the JCK-1398 strain) was performed, and the inoculated site was sealed with Parafilm to prevent drying (bark peeling inoculation method). The degree of wilting was observed 45 days after the inoculation with Bursaphelenchus xylophilus, and the results are shown in FIGS. 3A and 3B and Table 6.

TABLE-US-00006 TABLE 6 Time after inoculation 0 Days 34 Days 39 Days 42 Days 45 Days 50 Days Disease severity (%) JCK-1398 0 4 6 8 16 24 Untreated 0 24 26 54 78 84

[0085] As can be confirmed in FIGS. 3A to 3B and Table 6, the culture of the JCK-1398 strain showed a disease severity as low as 24% against pine wilt disease in the Pinus densiflora seedlings and a control value of 71.4% compared with an untreated group.

Example 5: Evaluation of in vitro nematicidal activity

5-1. Securing of Culture Filtrate of JCK-1398 Strain and Nematodes to be Controlled

[0086] The JCK-1398 strain was cultured by the same method as in Example 4-1 and then centrifuged at 13,000 rpm for 30 minutes by using a centrifuge, thereby harvesting a culture filtrate. The culture filtrate was subjected to bacterial eradiation using a 0.2 um sterile micro-syringe filter.

[0087] As for Meloidogyne incognita, eggs thereof were obtained from tomato roots, which were artificially infected with Meloidogyne incognita in a greenhouse at Chonnam National University, Gwangju, Korea, and larvae (second instar larvae) hatched from the eggs were separated using the Baermann funnel method and used for experiments. Bursaphelenchus xylophilus was harvested by the same method as in Example 4-3.

5-2. Securing of culture filtrate of JCK-1398 strain and nematodes

[0088] A suspension of each nematode secured in Example 5-1 was placed in each well of a 96-well microplate, and then each well was treated with the culture filtrate of the JCK-1398 strain at a concentration of 0.625 to 20%, and thus the final volume of the well was 100 pl. After sample treatment, the 96-well plate was agitated for 30 seconds and stored at room temperature in a plastic case with a relative humidity of 100%. At 72 hours after sample treatment, nematicidal rates were determined using the following equation under an optical inverted microscope. Each experiment was repeated three times, and the results are shown in Table 7.

[0089] [Equation]

[0090] Nematicidal rate (%)=((mortality rate of treated group - mortality rate of control group)/(100- mortality rate of control group))×100

TABLE-US-00007 TABLE 7 Control value Nematode 20% 10% 5% 2.5% 1.25% 0.625% Meloidogyne incognita 97.45 13.15 — — — — Bursaphelenchus — — — — — — xylophilus

[0091] As can be seen in Table 7 above, Meloidogyne incognita showed a nematicidal activity of 97.45% in the group treated with a 20% culture filtrate and a nematicidal activity of 13.15% in the group treated with a 10% culture filtrate, but no nematicidal activity was shown at concentrations lower than 5%.

[0092] Bursaphelenchus xylophilus showed no nematicidal activity in any treated group, indicating that the control effect of Bacillus subtilis JCK-1398 against pine wilt disease was due to the induced resistance but not the direct nematicidal activity.

Example 6: Induced Resistance Elicitor Exhibiting Control Effect Against Pine Wilt Disease

[0093] Based on the results of Example 5, the presence of induced resistance elicitors (a culture, a culture filtrate, and a cell fraction) exhibiting the control effect of the Bacillus subtilis JCK-1398 strain against pine wilt disease was investigated. The JCK-1398 strain was cultured by the same method as in Example 4-1 and adjusted to an optical density value of 0.8.

[0094] The culture of the JCK-1398 strain was separated into a culture filtrate and a cell fraction by centrifugation (1,300 rpm, 15 min). The precipitated cell fraction was suspended by addition of the same volume of phosphate-buffered saline used before centrifugation. Each pine tree was sufficiently pre-treated with 5 ml of Tween 20 (250 pg/ml) and then dried for 2 hours, so as to enable each sample (a culture, a culture filtrate, and a cell fraction) to be well adsorbed into leaves. Then, each of the culture, culture filtrate, and cell fraction was dissolved in an aqueous solution containing Tween 20 (250 pg/ml) to an optical density value of 0.8, and then placed in a fine sprayer and each pine tree was foliar-sprayed with 5 ml of each sample. The nematicidal substance emamectin benzoate as a control group was dissolved in an aqueous solution containing 10% methanol to 20 mg/ml, followed by trunk injection. The results are shown in FIGS. 4A and 4B and Table 8.

TABLE-US-00008 TABLE 8 Treated group Culture Culture filtrate Cell fraction EB Control value (%) 61.7 64.2 42.0 97.0

[0095] As can be confirmed in FIGS. 4A and 4B and Table 8, the culture and culture filtrate of the JCK-1398 strain exhibited control effects of 61.7% and 64.2%, respectively, but the cell fraction thereof exhibited a slightly low control effect of 42%.

[0096] These results indicate that the control effect of the JCK-1398 strain against pine wilt disease was due to extracellular secretions.

Example 7: Optimal Treatment Time for Control Effect Against Pine Wilt Disease

[0097] Based on the results of Example 6, the optimal treatment time was investigated through in vivo assay of the culture of the Bacillus subtilis JCK-1398 strain against pine wilt disease. The in vivo assay was performed using Pinus densiflora seedlings aged 3-4 years (approximately 5.5 m in diameter and approximately 35-45 cm in height from the soil).

[0098] The JCK-1398 strain was cultured by the same method as in Example 4-1 and adjusted to an optical density value of 0.8, and then each pine tree was foliar-sprayed with 5 ml of the culture. The treatment with the culture was performed twice at different times: 2 weeks and 1 week before, 3 weeks and 1 week before, and 4 weeks and 1 week before inoculation with Bursaphelenchus xylophilus. The inoculation with Bursaphelenchus xylophilus was performed 7 days after the second treatment with the culture by the same method as in Example 4-4. Last, the degree of wilting was observed 60 days after the inoculation with Bursaphelenchus xylophilus, and the results are shown in FIGS. 5A to 5C and Tables 9 and 10.

TABLE-US-00009 TABLE 9 Time after inoculation 0 Days 30 Days 35 Days 46 Days 49 Days 54 Days 57 Days 60 Days Disease severity 2 weeks before - 0 16 29 30 32 40 40 40 (%) 1 week before 3 weeks before - 0 14 20 28 28 58 70 78 1 week before 4 weeks before - 0 10 14 26 28 48 58 60 1 week before Untreated group 0 32 46 58 68 84 88 98

TABLE-US-00010 TABLE 10 2 weeks before- 3 weeks before- 4 weeks before- Treated group 1 week before 1 week before 1 week before Control value 59.2 20.4 38.8 (%)

[0099] As can be confirmed in FIGS. 5A to 5C and Tables 9 and 10, the disease severity of pine wilt disease was maintained at similar levels regardless of the treatment time until 49 days after the inoculation, but thereafter, the disease severity was greatly changed depending on the treatment time (FIG. 5A). Consequently, the treatment at 2 weeks before - 1 week before inoculation (59.2%) showed an excellent control effect compared with the treatment at 3 weeks before - 1 week before inoculation (20.4%) and the treatment at 4 weeks before - 1 week before inoculation (38.8%).

Example 8: Optimal Treatment Concentration for Control Effect Against Pine Wilt Disease

[0100] Based on the results of Example 7, the optimal treatment concentration was investigated through in vivo assay of a spray-dried powder of the Bacillus subtilis JCK-1398 strain against pine wilt disease. Likewise, the in vivo assay was performed using Pinus densiflora seedlings aged 3-4 years.

[0101] Specifically, a spray-dried powder of the JCK-1398 strain prepared by the method in Table 11 was prepared into 50-fold, 500-fold and 5,000-fold diluted solutions by using sterile water, and then each pine tree was foliar-sprayed with each diluted solution twice at an interval of 7 days by the same method as in Example 4-2. Last, Bursaphelenchus xylophilus was inoculated 7 days after the second treatment with the diluted solution by the same method as in Example 4-4. The degree of wilting was observed 55 days after the inoculation with Bursaphelenchus xylophilus, and the results are shown in FIG. 6 and Table 12.

TABLE-US-00011 TABLE 11 Spray drying JCK-1398 Inlet and outlet temperatures 190~198° C./90~98° C. Spraying rate 10,000 rpm Carrier Culture 70 L Spray-dried powder 11 kg QC 2.4 × 10.sup.9 cfu/g CFU (x50) 4.8 × 10.sup.7 cfu/g

TABLE-US-00012 TABLE 12 50-Fold 500-Fold 5000-Fold Treated group diluted solution diluted solution diluted solution Control value (%) 85.5 60.5 69.8

[0102] As can be confirmed in FIG. 6 and Table 12, the 50-fold diluted solution (85.5%) of the spray-dried powder of the JCK-1398 strain showed an excellent control effect compared with the 500-fold diluted solution (60.47%) and the 5,000-fold diluted solution (69.77%).

Example 9: Control Effect Against Pine Wilt Disease

[0103] Based on the above results, the field test was additionally performed using Pinus densiflora adult trees aged 15 years (root diameter: 8-11 cm, height: 6-8 m) in order to investigate the control effect of the Bacillus subtilis JCK-1398 strain against pine wilt disease in adult trees. The field test was performed twice in 2018 (first field test) and 2019 (second field test). In the first field test, a spray-dried powder of a culture of the JCK-1398 strain (prepared by the same method as in Example 8) was used, and in the second field test, a spray-dried powder of a culture of the JCK-1398 strain was formulated into JCK-1398 20% SC (emulsion) before use. The JCK-1398 20% SC formulation was formulated with a composition of a JCK-1398 spray-dried powder (20.0%), CR-NF 135B (4.5%), xanthan gum (0.03%), a defoamer (0.1%), and water (75.37%).

[0104] The spray-dried powder of the culture of the JCK-1398 strain and the JCK-1398 20% SC formulation were diluted 50-fold and 2000-fold, respectively, in an aqueous solution containing 250 pg/ml Tween 20, and then placed in a sprayer, and each pine tree was foliar-sprayed with about 1 L of each diluted solution. The treatment by foliar spraying was performed twice at an interval of 1 month. One week after each second treatment, each pine tree was inoculated, by trunk injection, with Bursaphelenchus xylophilus at 20,000 nematodes in the first field test and at 10,000 nematodes in the second field test. For a control group, A-Pharm (emamectin benzoate 2.15%, emulsion, Syngenta) was applied at 1 ml per diameter at breast by trunk injection, and the A-Pharm was applied once 1 week before the inoculation with Bursaphelenchus xylophilus. The untreated group was treated with only 250 pg/ml Tween 20 without chemical agents in the same manner. The results are shown in FIGS. 7A to 7C and Tables 13 and 14.

TABLE-US-00013 TABLE 13 Times after inoculation 1 Month 2 Months 3 Months 4 Months 5 Months 6 Months Disease JCK-1398 0 0.5 12 25 20 25 severity EB 0 1 2.5 7.5 7.5 10 (%) Untreated 0 16 48.5 72.5 72.5 72.5 group

TABLE-US-00014 TABLE 14 2018-Year field test 2019-Year field test Spray-dried powder JCK-1398 20% Treated group of JCK-1398 EB SC formulation EB Control value (%) 65.5 86.2 68.8 75

[0105] As can be confirmed in FIGS. 7A to 7C and Tables 13 and 14, the 50-fold diluted solution of the spray-dried powder of the JCK-1398 stain (JCK-1398) and the JCK-1398 20% SC formulation (20% SC formulation) exhibited control effects of 65.5% and 68.8%, respectively, compared with the untreated group. The reproducibility of the control effect of the JCK-1398 strain against pine wilt disease was confirmed through two field tests.

Example 10: Synergistic Effect of Pine Wilt Disease Control by Combination Agents

[0106] Based on the results of the examples, a field test was additionally performed using Pinus densiflora adult trees aged 15 years (root diameter: 8-11 cm, height: 6-8 m) in order to investigate the control effect of combination agents of the Bacillus subtilis JCK-1398 strain with the induced resistance elicitors acibenzolar-S-methyl (ASM) and methyl salicylate (MeSA) against pine wilt disease in adult trees.

[0107] A JCK-1398 20% SC formulation, an ASM 5% SC formulation, and a MeSA 20% EC-LV agent were prepared to 2000-fold dilution, 0.1 mM, and 0.5 mM, respectively. A JCK-1398 20% SC+ASM 5% SC combination agent and a JCK-1398 20% SC+MeSA 20% EC-LV combination agent were prepared such that the final concentrations thereof included the half the concentration of each single agent in the treated groups. Each sample was placed in a sprayer, and each pine tree was treated with 1 L of each sample twice at an interval of 1 month. One week after the second treatment, the inoculation with 10,000 nematodes of Bursaphelenchus xylophilus was performed by trunk injection. As for a control group, A-Pharm (emamectin benzoate 2.15%, emulsion, Syngenta) was applied at 1 ml per diameter at breast by trunk injection, and the A-Pharm was applied once one week after the inoculation with Bursaphelenchus xylophilus. The untreated group was treated with only 250 pg/ml Tween 20 without chemical agents in the same manner. The results are shown in FIG. 8 and Table 15.

TABLE-US-00015 TABLE 15 Treated ASM MeSA 20% JCK-1398 ASM 5% SC + MeSA 20% EC-LV + EB 2.15% group 5% SC EC-LV 20% SC JCK-1398 20% SC JCK-1398 20% SC EC Control 27.3 33.9 23.1 46.2 53.8 61.5 value (%)

[0108] As can be confirmed in FIG. 8 and Table 15, the JCK-1398 20% SC formulation, the ASM 5% SC formulation, the MeSA 20% EC-LV formulation showed control effects of 23.1%, 27.3%, and 33.9%, respectively, compared with an untreated group. However, the JCK-1398 20% SC+ASM 5% SC combination agent and the JCK-1398 20% SC+MeSA 20% EC-LV combination agent showed synergistic control effects of 46.2% and 53.8%, respectively, compared with the untreated group.

[0109] It was therefore confirmed that the Bacillus subtilis JCK-1398 strain can control pine wilt disease more effectively through a synergistic effect when applied together with the induced resistance elicitors ASM and MeSA.

Example 11: Preparation of Aerial Spraying Formulations and Control Effects Thereof Against Pine Wilt Disease

[0110] In order to investigate the control effects of the Bacillus subtilis JCK-1398 strain against pine wilt disease through aerial spraying in adult trees, a novel formulation was prepared. The JCK-1398 10% SC formulation was formulated with a composition of a spray-dried powder of JCK-1398 (10.0%), CR-NF 135B (3.0%), xanthan gum (0.01%), a defoamer (0.1%), propylene glycol (5.0%), sodium benzoate (0.2%), and water (81.69%).

[0111] The JCK-1398 10% SC formulation and the JCK-1398 20% SC formulation (existing formulation, Example 9) each were prepared into 10-fold, 100-fold, and 500-fold diluted solutions, and each pine tree aged 3 years was foliar-sprayed with 100 μl (1/50 of the existing treatment amount) of each of the diluted solutions twice at an interval of 7 days, 2 weeks and 1 week before inoculation. Last, the inoculation with Bursaphelenchus xylophilus was performed 7 days after the second treatment with the diluted solution by the same method as in Example 4-4, and the degree of wilting was determined 40 days after the inoculation with Bursaphelenchus xylophilus. The results are shown in FIG. 9 and Table 16.

TABLE-US-00016 TABLE 16 JCK-1398 20% SC JCK-1398 10% SC 10-fold 100-fold 500-fold 10-fold 100-fold 500-fold Treated diluted diluted diluted diluted diluted diluted group solution solution solution solution solution solution EB Control 51.7 58.6 79.3 87.9 79.3 86.2 100.0 value (%)

[0112] As can be confirmed in FIG. 9 and Table 16, when compared with the JCK-1398 20% SC formulation, the JCK-1398 10% SC formulation exhibited stable control effects at all the concentrations of the 10-fold diluted solution (87.9%), the 100-fold diluted solution (79.3%), and the 500-fold diluted solution (86.2%). Therefore, JCK-1398 10% SC was selected as a final formulation for subsequent aerial spraying.

Example 12: Evaluation of practical application of JCK-1398 10% SC formulation for aerial spraying in Bursaphelenchus xylophilus control

[0113] On the basis of the results, a field test was performed using Pinus densiflora aged 30 years in order to investigate the control effect of JCK-1398 10% SC for aerial spraying against pine wilt disease in adult trees.

[0114] After a 50-fold diluted solution of the JCK-1398 10% SC formulation was prepared, 3.6 L (80 L/1 ha) of the diluted solution was aerial-sprayed to the Jinju Experimental Forest (450 M.sup.2) by using an unmanned aerial vehicle or unmanned helicopter. The treatment by aerial spraying was performed three times, 2 months before, 1 month before, and 1 month after inoculation with Bursaphelenchus xylophilus. One week after the second treatment, each pine tree was inoculated with 20,000 worms of Bursaphelenchus xylophilus by the same method as in Example 9. The results are shown in FIGS. 10A and 10B and Table 17.

TABLE-US-00017 TABLE 17 Disease severity (%) 0 Months 1 Month 2 Months 3 Months 4 Months 6 Months Treated group after after after after after after JCK-1398 10% 0.0 0.0 0.0 3.3 3.3 20.0 SC Untreated 0.0 0.0 0.0 20.0 23.3 73.3 group

[0115] As can be confirmed in FIGS. 10A and 10B and Table 17, the JCK-1398 10% SC formulation (20.0%) showed very low severity compared with the untreated group (73.3%), 6 months after the inoculation with Bursaphelenchus xylophilus. That is, it was confirmed that the JCK-1398 10% SC formulation showed a control effect of 72.7% and thus can also control pine wilt disease very effectively in fields, like in the seedling assay.

Example 13: Control effects against various plant diseases

[0116] Based on the resistance-inducing effect of the Bacillus subtilis JCK-1398 strain, the control effects against various plant diseases were investigated using a spray-dried powder of a culture of the JCK-1398 strain for experiments for expanded application.

13-1. Control Effect Against Bacterial Spot (Pathogen: Xanthomonas Euvesicatoria)

[0117] To 500-fold and 5,000-fold diluted solutions of a spray-dried powder of the JCK-1398 strain prepared by the same method as in Example 8 were added the surfactant Tween 20 (250 pg/ml), and then 8- to 9-leaf stage chili pepper plants (Hungnong Seed, Bultap chili pepper) were treated with the resultant solutions at 20 ml per pot by soil drenching and foliar spraying. Each sample was applied 4 days before inoculation with Xanthomonas euvesicatoria inoculum. As for a control group, the synthetic agrochemical pesticides Sungbocycline wettable powder (oxytetracycline, SUNGBO Chemicals) and Ilpum wettable powder (oxolinic acid 20% WP, Dongbang Agro) each were applied at a predetermined amount (1,000-fold diluted solution), and as for an untreated group, only Tween 20 (250 pg/ml) was applied in the same manner without chemical agents.

[0118] Then, Xanthomonas euvesicatoria was subjected to static culture in TSA at 30° C. for about 48 hours, and then the cells were harvested using 2 ml of sterile water. The inoculum was prepared by diluting the harvested Xanthomonas euvesicatoria to an optical density value of 0.1 at 600 nm through a UV spectrometer. Each seedling was foliar-sprayed with 5 ml of the inoculum. The inoculated seedlings were placed in a growth room maintained at 25±2° C. and humidity of 95% for 3 days. Thereafter, the disease severity was observed with constant irrigation and foliar watering, and the results are shown in FIG. 11 and Table 18.

[0119] Each treatment was repeated three times, and each experiment was repeated twice. The disease severity was determined using an index of 0 to 6 according to Abbasi, and thus the severity of bacterial spot formed on chili pepper leaves was investigated. The criteria of the index for disease severity were as follows: [0120] 0=No disease [0121] 1=1-2 small spots on 1-2 leaves [0122] 2=Several spots on multiple leaves [0123] 3=Many spots agglomerated on leaf [0124] 4=Many spots agglomerated on many leaves [0125] 5=Severe disease and defoliation [0126] 6=Plant death

TABLE-US-00018 TABLE 18 Oxolinic JCK-1398 X500 JCK-1398 X5000 acid Oxytetracyclin Folia Soil Folia Soil Folia Soil Treated group spraying drenching spraying drenching spraying drenching Control value 20.8 37.5 31.3 52.1 27.1 20.8 (%)

[0127] As can be confirmed in FIG. 11 and Table 18, the 5,000-fold diluted solution of the spray-dried powder of the Bacillus subtilis JCK-1398 strain showed a control effect of 52.1% for soil drenching and a control effect of 31.3% for foliar spraying. In addition, the 500-fold diluted solution showed a control effect of 37.5% for soil drenching and a control effect of 20.8% for foliar spraying. Therefore, the treatment of chili pepper plants with cultures of the JCK-1398 strain is expected to be useful in the control of bacterial spot by effectively inducing resistance.

13-2. Control effect against dollar spot (pathogen: Sclerotinia homoeocarpa)

[0128] As for diluted solutions of a culture of JCK-1398, the JCK-1398 strain was cultured by the same method as in Example 4-1, and then a solution obtained by diluting the culture to an optical density value of 0.08 at 600 nm through a UV spectrometer was used as a 100-fold diluted solution, and a solution obtained by diluting the culture to an optical density value of 0.008 was used as a 1,000-fold diluted solution. JCK-1398 20% SC was prepared by using diluted solutions of a culture of JCK-1398, obtained by dilution to 100-fold and 1,000-fold with sterile water. As for an untreated group, a solution obtained by addition of Tween-20 to 250 pg/ml was used, and as for a control group, Tebuconazole 25% EC (Horikuo emulsion) was used at a predetermined amount (2,000-fold diluted solution) and the half thereof (4,000-fold diluted solution).

[0129] Each sample was applied by soil drenching treatment 4 days before the inoculation with Sclerotinia homoeocarpa inoculum. The 100-fold and 1,000-fold diluted solutions of the culture of JCK-1398 were applied as single agents or applied as combination agents with a 4,000-fold diluted solution of Tebuconazole 25% EC. The 100-fold and 1,000-fold diluted solutions of the culture of JCK-1398 20% SC were applied as single agents, or applied as combination agents with a 4,000-fold diluted solution of Tebuconazole 25% EC.

[0130] Then, the flora of Sclerotinia homoeocarpa was torn off as an agar plug with a size of 2×2 mm in width and length, and seeded in PDA medium, and then cultured in a thermostat at 25° C. for 5 days. The flora of the strain cultured in a bran-chaff medium (9 g of bran, 1.5 g of rice husk, and 10 ml of distilled water) sterilized twice was cut into a size of 1×1 cm in width×length, followed by each transplantation of 5 pieces, and then the entrance was blocked with only a Bio-Sili stopper, followed by culture in a thermostat at 25° C. for 7 days. Then, the cultured cells were placed together with the medium in a grinder, and 110 ml and 1.1 ml of streptomycin sulfate (200 pg/ml) were added, followed by grinding.

[0131] Last, creeping bentgrass pots grown for about 1 month after sowing were punched to form a hole of about 1 cm in the centers thereof, and then the inoculation with the ground inoculum at 3.3 ml per pot was performed. The inoculated grass was observed at a humidity of 95% and a temperature of 25° C. until a difference between an untreated group and a treated group was seen. The disease severity was calculated by examining the diseased area compared with the total pot area, and three pots were experimented twice per treated group. The results are shown in FIG. 12 and Table 19.

TABLE-US-00019 TABLE 19 Treated group Control value (%) JCK-1398 culture Single agent 16.16 X100 Combination agent 97.26 JCK-1398 culture Single agent 0.00 X1000 Combination agent 26.03 JCK-1398 20% SC Single agent 2.19 X100 Combination agent 84.93 JCK-1398 20% SC Single agent 34.25 X1000 Combination agent 73.97 Tebuconazole 25% EC Single agent 78.08 X2000 Tebuconazole 25% EC Single agent 41.10 X4000

[0132] As can be confirmed in FIG. 12 and Table 19, the treatment with the JCK-1398 cultures (100-fold diluted solution and 1,000-fold diluted solution) and JCK-1398 20% SC (100-fold diluted solution) as single agents showed disease severity similar to those of an untreated group. However, the treatment with the combination agent of the JCK-1398 culture (100-fold diluted solution) and the 4,000-fold diluted solution of Tebuconazole 25% EC showed a control effect as high as 97.26%, and the treatment with the combination agents of the JCK-1398 20% SC (100-fold diluted solution and 1,000-fold diluted solution) and the 4,000-fold diluted solution of Tebuconazole 25% EC showed control effects of 84.93% and 73.97%, respectively, indicating a dose-dependent control effect. Therefore, the cultures of the JCK-1398 strain of the present invention are expected to significantly reduce the treatment amount of agrochemicals used in the control of dollar spot.

13-3. Control effect against Aculops lycopersici (pest)

[0133] JCK-1398 20% SC was prepared by using diluted solutions of a culture of JCK-1398, obtained by dilution to 250-fold, 500-fold, and 1,000-fold with sterile water. As for an untreated group, a solution obtained by addition of Tween-20 at 250 pg/ml was used, and as for a control group, a Sunchungtan liquid (fosthiazate 30% SL, FarmHannong) was used at a predetermined amount (4,000-fold diluted solution).

[0134] The treatment with each sample was performed on 4- to 5-leaf stage Lycopersicon esculentum Mill at 20 ml per tree by soil drenching. JCK-1398 20% SC was applied twice at an interval of 3 days, and the Sunchungtan liquid was applied once. Then, Aculops lycopersici was naturally generated by maintaining appropriate temperature and humidity (25-28° C., 30%) for the generation thereof. Aculops lycopersici was generated 2 weeks after second chemical treatment. After 2 weeks of generation of Aculops lycopersici, the length of the aerial part was measured to investigate the control effect against Aculops lycopersici. The results are shown in FIG. 13 and Table 20.

TABLE-US-00020 TABLE 20 Fosthiazate JCK-1398 20% SC 30% SL Untreated Treated group X250 X500 X1000 X4000 group Length (cm) 26.13 21.75 15.88 32.00 16.83

[0135] As can be confirmed in FIG. 13 and Table 20, the groups treated with the 250-fold, 500-fold, and 1,000-fold diluted solutions of JCK-1398 20% SC showed in 26.13 cm, 21.75 cm, and 15.88 cm in aerial part length, respectively, indicating that the more the concentration, the longer the aerial part. The 4,000-fold diluted solution of fosthiazate 30% SL used as the control group showed the largest aerial part length, 32 cm, and the untreated group showed the smallest aerial part length, 16.83 cm. Therefore, the treatment of the tomato tree with the cultures of the JCK-1398 strain is expected to be useful in the control of Aculops lycopersici by effectively inducing resistance.

INDUSTRIAL APPLICABILITY

[0136] The present invention relates to a Bacillus subtilis JCK-1398 strain inducing resistance in pine and various plants, and a composition and a method for controlling plant diseases by using the same.

[0137] [Accession Number]

[0138] Depository institution name: Korean Collection for Type Cultures

[0139] Accession number: KCTC14084BP

[0140] Deposit date: 20191219

[0141] This application contains references to amino acid sequences and/or nucleic acid sequences which have been submitted concurrently herewith as the sequence listing text file entitled “000320usnp_SequenceListing.TXT”, file size 7 kilobytes (KB), created on 12 Aug. 2022. The aforementioned sequence listing is hereby incorporated by reference in its entirety pursuant to 37 C.F.R. § 1.52(e)(5).