PUMA, A PRO-APOPTOTIC GENE, AS A NOVEL MOLECULAR BIOMARKER FOR TNFALPHA-INDUCED HUMAN ISLET DAMAGE
20180030537 ยท 2018-02-01
Inventors
Cpc classification
C12Q1/6883
CHEMISTRY; METALLURGY
International classification
Abstract
p53-upregulated modulator of apoptosis (PUMA) is a biomarker associated with islet cell health. If PUMA is low, islet cells are typically healthy. If PUMA is high, islet cells are typically unhealthy or dying. PUMA may be measured by either measuring its nucleic or amino acid. PUMA mRNA may be induced by TNF- stimulation in a time- and dose-dependent manner and cell apoptosis is induced through a mitochondrial pathway. TNF- significantly inhibited glucose-induced preproinsulin precursor mRNA synthesis. Such cell stress signaling in human islets indicates overall state of islet health and, ultimately, the risk of onset and/or degree of severity of both type 1 and type 2 diabetes mellitus.
Claims
1. A method for measuring the health of an islet cell, comprising measuring the level of p53 upregulated modulator of apoptosis (PUMA), wherein the level of PUMA is inversely proportional to the health of the islet cell.
2. The method of claim 1, wherein the level of PUMA is measured by quantifying the amount of nucleic acid encoding PUMA expressed by the islet cell.
3. The method of claim 2, wherein the nucleic acid is PUMA mRNA and wherein the level of BBC3 mRNA is also quantified.
4. The method of claim 1, wherein tumor necrosis factor- level is positively correlated to the level of PUMA in the islet cell.
5. The method of claim 1, wherein the level of PUMA is measured by stimulating islet cells with TNF- alone or in combination with interferon gamma.
6. The method of claim 1, wherein a high level of PUMA indicates an increased risk or severity of diabetes in a subject that produced the islet cell.
7. The method of claim 6, wherein the diabetes is type 1 diabetes mellitus or type 2 diabetes mellitus.
8. The method of claim 1, wherein a low level of PUMA indicates a healthy islet cell.
9. The method of claim 1, wherein the level of PUMA is a factor in determining whether the islet cell is a candidate for transplant.
10. The method of claim 1, further comprising testing the level of one or more proinflammatory cytokines, wherein a low PUMA level combined with a low or undetectable level of one or more of tumor necrosis factor-, interleukin-1, interferon-, oxygen free radicals, or nitric oxide indicates good islet cell health.
11. A method protecting an islet cell from apoptosis comprising administering a JAK inhibitor to the islet cell.
12. The method of claim 11, wherein the method further comprises administering a tyrosine kinase inhibitor to the islet cell.
13. The method of claim 12, wherein the tyrosine kinase inhibitor is Imatinib.
14. A screen for a compound that protects islet cell health, comprising: (a) administering the compound to an islet cell; (b) after a time sufficient for the compound to affect the level of PUMA in the islet cell, taking a measurement of the level of PUMA in the islet cell and comparing that measurement to either a first measurement taken before the administration of the compound or a known PUMA level; wherein, if the level of PUMA in the cell has decreased after administration of the compound, then the compound protects islet cell health.
15. The screen of claim 14, wherein the level of PUMA is measured after both the compound and TNF- are administered to the islet cell, and wherein, if the level of PUMA does not increase, the compound protect the islet cells from TNF- mediated islet damage.
16. The screen of claim 14, wherein the PUMA nucleic acid or amino acid is measured.
17. The screen of claim 14, further comprising administering the compound to the islet cell more than once and taking additional PUMA measurements over time to develop a time and dosing course for the compound.
18. The screen of claim 14, wherein a compound found to protect islet health is administered in a pharmaceutically effective carrier and dose to a patient for the treatment of diabetes.
19. The screen of claim 14, wherein the compound is a TNF- receptor blocker.
20. The screen of claim 19, wherein the compound is Etanercept.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
DETAILED DESCRIPTION
[0033] PUMA levels are inversely proportional to the health of an islet cell and pancreatic health in general. Suppressing or silencing PUMA reduces or stops islet cell apoptosis. The expression of PUMA in human islets is examined in response to TNF- stimulation. Accordingly, measuring PUMA as a biomarker allows a determination of the state of islet health and controlling PUMA expression allows for management of islet health and insulin production.
[0034] In a present embodiment, using a newly developed method to assess gene expressions using a set of single human islets, a pro-apoptotic gene, PUMA/BBC3 (p53-upregulated modulator of apoptosis/Bcl-2 binding component 3), is up-regulated in human islets stimulated by recombinant TNF- alone or in combination with interferon (IFN)- in time and dose dependent manner. The up-regulation of PUMA is associated with an activation of nuclear factor-B (NF-B) and induced cell apoptosis through a mitochondrial pathway and is enhanced by IFN-. Up-regulation of PUMA by TNF- is associated with increased cleaved caspase-9 and cleaved caspase-3, but undetectable with cleaved caspase-8, indicating that TNF- induced PUMA expression leads to islet cell apoptosis through an intrinsic pathway.
[0035] PUMA up-regulation is also associated with the abrogation of glucose-stimulated preproinsulin mRNA synthesis in the islet. Silencing PUMA by transfecting small interfering PUMA RNA into a P cell line reduced cell death induced by TNF- and IFN-. Furthermore, PUMA expression levels in islets negatively correlated with in vivo islet function following transplantation into STZ-diabetic NODscid mice. Results show that the increased PUMA expression levels negatively impact cell function in vitro and in vivo, which can be used as an early biomarker to detect TNF- induced cell stress and may contribute to the discovery and characterization of islet-protecting compounds for the treatment of diabetes.
[0036] The present experiments further demonstrate that PUMA is a marker for TNF--induced cellular damages in human islets. In addition to the pathway involving Bid, a bcl-2 family gene important in death receptor-induced mouse cell death, multiple pathways may be involved in the PUMA expression mediated by TNF- and IFN. The inhibition of NFB by islet pre-incubation with BAY 11-7082 did not inhibit PUMA expression. Since IFN- further augmented TNF- induced PUMA and PUMA expression, the IFN- mediated cell death pathway. As explained herein, the JAK/STAT pathway may also be involved.
[0037] In addition to TNF-, the expression of PUMA was examined following stimulation with IL-10. IL-10 alone stimulation induced PUMA, IL-8, TNF and IL1B mRNA within 4 hours. However, unlike TNF--induced PUMA, IL-1-induced PUMA expression returned to the normal level by 16 hours. IL-1-induced PUMA expression can also be explained through the NFB pathway. See
[0038] TNF- may decrease glucose-induced insulin secretion in a P cell line before a measurable change in cell viability can be detected because a decrease in cell function occurs before a decrease in cell viability. TNF- also abolishes glucose stimulated preproinsulin mRNA synthesis. This inhibition was inversely related to the up regulation of PUMA by TNF- and/or IFN (
[0039] A recent experiment reported a pilot randomized trial of Etanercept treatment in children with new onset of T1DM resulted in lowering HbA.sub.1C levels and increased levels of endogenous insulin production, suggesting the preservation of cell function. Imatinib, a tyrosine kinase inhibitor that suppresses NF-B activation, is shown to protect islets from combined cytokines in vitro and prevents the spontaneous onset of diabetes in NOD mice. JAK inhibitor also suppressed PUMA expression caused by TNF- stimulation. JAK inhibitor is effective for prevention of islet cell death and development of diabetes in animal models. These lines of evidence support the usefulness of PUMA, IL-8, and TNF- mRNA expression analysis along with preproinsulin mRNA synthesis to confirm the effectiveness of drugs for protecting human islets from apoptosis before conducting clinical trials. These markers also can be used in the discovery of compounds that protect islets from TNF- damage. See
[0040] Compositions containing anti-PUMA molecules or PUMA antagonists are contemplated for the reduction of PUMA and/or PUMA expression, which in turn, increases islet cell health. Such compositions comprising an anti-PUMA molecule as described herein preferably contain a pharmaceutically acceptable excipient, diluent or carrier.
[0041] A pharmaceutically acceptable carrier includes any material which, when combined with an active ingredient of a composition, allows the ingredient to retain biological activity and without causing disruptive physiological reactions, such as an unintended immune reaction. Pharmaceutically acceptable carriers include water, phosphate buffered saline, emulsions such as oil/water emulsion, and wetting agents. Compositions comprising such carriers are formulated by well known conventional methods such as those set forth in Remington's Pharmaceutical Sciences, current Ed., Mack Publishing Co., Easton Pa. 18042, USA; A. Gennaro (2000) Remington: The Science and Practice of Pharmacy, 20th edition, Lippincott, Williams, & Wilkins; Pharmaceutical Dosage Forms and Drug Delivery Systems (1999) H. C. Ansel et al., 7th ed., Lippincott, Williams, & Wilkins; and Handbook of Pharmaceutical Excipients (2000) A. H. Kibbe et al., 3rd ed. Amer. Pharmaceutical Assoc. Such carriers can be formulated by conventional methods and can be administered to the subject at a suitable dose. Administration of the suitable compositions may be effected by different ways, e.g. by intravenous, intraperitoneal, subcutaneous, intramuscular, topical or intradermal administration. The route of administration, of course, depends, inter alia, on the kind of compound contained in the pharmaceutical composition. The dosage regimen will be determined by the attending physician and other clinical factors. As is well known in the medical arts, dosages for any one patient depends on many factors, including the patient's size, body surface area, age, sex, the particular compound to be administered, time and route of administration, the kind and stage of condition or disease, general health and other drugs being administered concurrently.
[0042] There may also be situations in which it is desirable to harm or kill islet cells, such as when the cells are already unhealthy or have over-proliferated. In such instances PUMA itself or a PUMA agonist may be administered to the cells as an apoptotic agent. Care must be taken to target only the islet cells that are desired to be killed and so highly targeted approaches are preferred for in vivo administration. Because of this fact, assays and methods of administering PUMA to islet cells for its apoptotic properties may be better suited to in vitro applications.
[0043] PUMA levels may be measured by any accurate means including the means disclosed in the following experimental examples, in vitro, or in vivo using either biological samples or non-invasive techniques, such as functional MRI. Methods of multivariate analysis of the data that may be used in for analysis in the present assays and methods include but are not limited to: multivariate analysis of variance, principal component analysis, factor analysis, canonical correlation analysis, redundancy analysis, correspondence analysis, multidimensional scaling, discriminant function, linear discriminant analysis, clustering systems, and artificial neural networks. Base levels of PUMA expression are only a guide as individual cells and organs may vary.
Methods
[0044] The following reagents and antibodies were used in the present experiments: Reverse Transcriptase: Promega (San Luis Obispo, Calif.), SYBER Green Mix: Bio-Rad (Hercules, Calif.), Recombinant human TNF-, recombinant human IFN, recombinant rat TNF-, and recombinant rat IFN: R&D Systems (Minneapolis, Minn.), Antibodies for Phospho p65 (Ser536) and 3 actin: Cell Signaling Technology (Danvers, Mass.), PUMA antibody: Abcam (Cambridge, Mass.), BAY11-7082: Calbiochem (San Diego, Calif.), Guinea pig anti-human insulin primary antibody: DAKO (Carpinteria, Calif.), Cy5-conjugated secondary antibody: Jackson Immuno-Research (West Grove, Pa.), 4-6-Diamidino-2-phenylindole (DAPI) and streptozotocin: Sigma-Aldrich (St. Louis, Mo.), ON-TARGETplus siRNA Reagents: Dharmacon, Inc. (Lafayette, Colo.), TRI Reagent: Molecular Research Center Inc. (Cincinnati, Ohio), tetramethylrhodamine, ethyl ester, perchlorate (TMRE): Invitrogen (Carlsbad, Calif.), APC Annexin V: BD Biosciences (San Jose, Calif.), Caspase-9, Cleaved caspase-8, Cleaved caspase-3, -actin, anti-rabbit IgG HRP-linked Antibody, LumiGLO chemiluminescent substrate: Cell Signaling Technology (Danvers, Mass.), western blot Cytochrome c oxidase subunit IV: Cox IV, PUMA: Cell Signaling Technology.
[0045] Human Islet and Acinar Cell Culture:
[0046] Human islets and acinar cells isolated for research use were obtained from the Southern California Islet Cell Resources (SC-ICR) Center, Beckman Research Institute of the City of Hope (Duarte, Calif.) 1 to 3 days after isolation. The donor age ranged from 18 to 67 (4814) years and included both sexes. Islet preparations with >70% purity and >90% viability were used. The use of human islets and acinar cells in this study was approved by the Institutional Review Board of the City of Hope. For mRNA experiments, islets between 150 m to 300 m in diameter (medium size islet) were handpicked in hexuplicate by experienced personnel under a dissection microscope without staining. Each handpicked islet was cultured individually in a non-tissue culture treated 96 well plate (Sarstedt, Newton, N.C.) with a CMRL (Mediatech Inc., Holly Hill, Fla.) based serum-free medium, which is used to culture human islets for clinical transplantation. Islets were treated with or without recombinant human TNF- (0, 1, 5, 50 ng/mL) and/or recombinant human IFN (0, 10, 100, 1000 U/mL) for up to 16 hours. For other islet experiments, 500 to 1000 islet equivalent (IEQ) were cultured (500 IEQ/mL of medium) in a Petri dish for up to 24 hours in the same condition described above unless otherwise specified. For acinar cell experiments, acinar cells were kept in islet culture medium at 4 C. immediately after the isolation and used within 24 hours. Aliquots of 5-10 acinar cell clusters in triplicates were cultured with islet culture medium with or without TNF- for up to 16 hours. For drug compound screening experiments, islets were pre-incubated with Etanercept, FK506, Cyclosporine (CsA), Rapamycin, Imatinib mesylate, Janus Kinase (JAK) inhibitor or p38 inhibitor, SB203580, for 1 hour, and then 5 ng/mL TNF- was added to the islet culture for 4 hours. All the compounds except Etanercept (0.1 g/mL) were dissolved in dimethyl sulfoxide (DMSO) and used at a concentration of 10 M (all compounds are gifts from Hitachi Chemical Research Center).
[0047] Quantification of mRNA from a Single Islet:
[0048] RNA purification and PCR was performed as described previously (32). Briefly, following culture, islets were transferred to a 96-well filter plate (Hitachi Chemical Research Center-HCR, Irvine, Calif.)(44) and 50 L of Lysis Buffer (HCR) containing a cocktail of specific reverse primers was applied to each well. Poly(A)+mRNA isolation was performed using the Hem(A)+ System (Hitachi Chemical Research Center, Irvine, Calif.). The resultant cell lysates were transferred to oligo(dT)-immobilized microplates (GenePlate, HCR) for poly(A).sup.+ mRNA purification (45). The cDNA was directly synthesized with 30 L of solution in each well: specific primer-primed cDNA in the liquid phase and oligo(dT)-primed cDNA in the solid phase (44). The cDNA in the solution was diluted by adding 30 L nuclease-free water, with 4 L of the diluted cDNA used for SYBR Green PCR (BioRad, Hercules, Calif.) (46). Each gene was amplified individually. The cycle threshold (Ct) was determined using analytical software (SDS, Applied Biosystems, Foster City, Calif.). Differences in Ct between the target and control mRNA (Ct) are used to quantify the relative amount of each target, calculated as 2.sup.Ct. Primers used for the gene expression assays are described previously (32, 36, 47, 48).
[0049] Measurement of Preproinsulin mRNA (or Precursor mRNA) Synthesis and Total Insulin Release:
[0050] Hand picked human islets were cultured with 100 uL of RPMI 1640 medium containing 5% fetal bovine serum and either low-glucose (3.3 mmol/L) or high-glucose (17 mmol/L) for 16 hours. Preproinsulin mRNA synthesis was measured from the islets by the methods described above. Pre-spliced preproinsulin mRNA (preproinsulin precursor mRNA) was normalized by pre- and post-spliced preproinsulin mRNA as described previously (32). Specifically, primer pairs used to perform qRT-PCR of pre-spliced preproinsulin mRNA are as follows: AGGTGGGCTCAGGATTCCA (SEQ ID NO. 1) (In1 upstream) and TCACCCCCACATGCTTCAC (SEQ ID NO. 2) (In1 downstream); ACTCGCCCCTCAAACAAATG (SEQ ID NO. 3) (In2 upstream) and TGAATCTGCGGTCATCAAATG (SEQ ID NO. 4) (In2 downstream); CTCTGCCTCGCCGCTGTTC (SEQ ID NO. 5) (In2Ex3 upstream) and TCCACAATGCCACGCTTCTG (SEQ ID NO. 6) (In2Ex3 downstream); GCAGCCTTTGTGAACCAACA (SEQ ID NO. 7) (Ex2a upstream) and TTCCCCGCACACTAGGTAGAGA (SEQ ID NO. 8) (Ex2a downstream); GGGAACGAGGCTTCTTCTACAC (SEQ ID NO. 9) (Ex2b upstream) and CCACAATGCCACGCTTCTG (SEQ ID NO. 10) (Ex2b downstream); and CATTGTGGAACAATGCTGTACCA (SEQ ID NO. 11) (Ex3 upstream) and GCCTGCGGGCTGCGTCTA (SEQ ID NO. 12) (Ex3 downstream). The culture supernatant was collected from each well after 16 hour-culture to measure insulin contents using an Enzyme-Linked ImmunoSorbent Assay (ELISA) kit for human insulin (Mercodia Inc., Winston Salem, N.C.) following the manufacturer's protocol.
[0051] Western Blot:
[0052] Five hundred IEQ samples were harvested before and 24 hours after culture with or without TNF- and/or IFN, washed twice with ice cold phosphate buffered saline (PBS), and stored at 80 C. until use. In some experiments, islets were pre-incubated with 10 M NFB inhibitor; BAY11-7082 for 1 hour before cytokine stimulation. Islet cell lysis and western blot was performed as previously described (49).
[0053] Cell Apoptosis Analyzed by Laser Scanning Cytometry (LSC):
[0054] Islet paraffin sections were stained for terminal uridine deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) using the Apop Tag plus Fluorescein In Situ Apoptosis Detection Kit (Chemicon, Temecula, Calif.) followed by immunostaining for insulin using a guinea pig anti-human insulin primary antibody and a Cy5-conjugated secondary antibody. All sections were counterstained for DNA with DAPI. To evaluate cell apoptosis, slides were scanned using the iCys laser scanning cytometer and the iCys 3.2.5 software (Compucyte, Cambridge, Mass.) as previously described (50). Cells co-staining for insulin and TUNEL were designated as apoptotic cells and their percentage was obtained from the histogram. The percentage of apoptotic cells was calculated by dividing the insulin/TUNEL double-positive cell number by the total number of insulin-positive cells.
[0055] siRNA Transfection and Flow Cytometry Analysis:
[0056] PUMA siRNA containing 4 individual siRNA targeting PUMA and negative control siRNA were transfected into INS-1 cells at a 20 nM concentration. Transfection was performed using ON-TARGETplus siRNA reagents according to the manufacturer's instructions. INS-1 cells were cultured in RPMI 1640 medium containing 5% fetal bovine serum and 15 mM HEPES. Recombinant rat TNF- (50 ng/ml) and/or recombinant rat IFN (1000 U/ml) were added in the culture media 24 hours after the transfection and cultured for additional up to 48 hours. Cultured cells were harvested using TRYPLE (Invitrogen, Carlsbad, Calif.) for flow cytometric (FCM) analysis performed on a CYAN ADP Analyzer (Beckman Coulter, Fullerton, Calif.). The transfection rate as confirmed by a transfection indicator labeled with 6-FAM was more than 75%. To assess mitochondrial membrane permeability, cell were incubated with 100 nM TMRE in culture media for 30 minutes and then washed with PBS twice before the analysis. Cell death was analyzed by staining with 1 g/ml of DAPI.
[0057] Assessment of In Vivo Islet Function in Diabetic NODscid Mice:
[0058] Male NODscid mice, ages 10-12 weeks, were obtained from the Animal Resources Center of Beckman Research Institute of the City of Hope and used as human islet recipients. Mice were rendered diabetic by intraperitoneal injection of 50 mg/kg streptozotocin (STZ) on three consecutive days. Those that exhibited hyperglycemia (>350 mg/dL) for two consecutive days were used as recipients. 1200 IEQ islets were transplanted under the left kidney capsule of diabetic mice. Blood glucose levels were measured 2-3 times weekly. Recipient mice that maintained a blood glucose <200 mg/dL were considered to have reversed diabetes. At the end of each experiment, a left nephrectomy was performed to confirm graft dependence. In separate experiments, islets were isolated from male Lewis rats weighing 250-350 g (Charles River Laboratories) using our standard procedure (39) and 250 hand-picked islets transfected with either PUMA siRNA or Control siRNA were transplanted into the liver of diabetic NODscid mice via the portal vein. All the animal procedures followed protocols approved by the Institutional Animal Care and Use Committee of the City of Hope/Beckman Research Institute.
[0059] Statistical Analysis:
[0060] Data are presented as a meanstandard error. Paired two-tailed Student's t-test was used to compare the difference between the two groups. The Correlation and Analysis of variance procedures were applied to assess the strength of linear dependence between two variables (correlation coefficient: r). P value of less than 0.05 was considered significant.
Results
[0061] Human islets express PUMA mRNA by TNF- stimulation: The expression of TNFRSF in human islets was previously. TNFRSF gene expression was examined in isolated human islet and acinar cells. Both islet and acinar cells have a similar pattern of TNFRSF expression (
[0062] In order to examine whether TNF- stimulation of human islets interacts with the intrinsic pathway and induces cell death, islets were stimulated with recombinant human TNF- protein (50 ng/mL) for 16 hours and apoptosis-related Bcl-2 family genes were examined. As shown in
[0063] PUMA expression was elevated as early as one hour after the exposure to TNF-, increasing during the next 4 hours, and maintained at a similar level for 16 hours (
[0064] To examine whether the PUMA up regulation in response to TNF- was islet specific, acinar cells isolated from human pancreata were also stimulated with TNF-. The expression of PUMA, IL-8 and TNF was increased in acinar cells, however, the expression reached peak levels by 4 hours and decreased to basal levels by 16 hours (
[0065] Pancreatic tissues, including islets and acinar cells, are known to contain passenger leukocytes, which may be the source of the PUMA, IL-8 and TNF expression detected above. To show that this expression was not due to passenger leukocytes, TNF--mediated PUMA expression was examined in blood leukocytes. TNF- alone, even with higher doses than that used in islets (200 ng/mL), did not induce PUMA in leukocytes. In contrast, leukocytes did express a high level of IL-8 following TNF- stimulation. These results show that passenger leukocytes in islets did not contribute to the TNF--mediated PUMA expression by islets (
[0066] PUMA is known to be up regulated by p53, either dependent or independent manner. To test the involvement of p53 in the PUMA expression by pancreatic cells, the expression of p21/CDKN1A (cyclin-dependent kinase inhibitor 1A), the major transcriptional target of the p53 tumor suppressor protein, was examined in both islets and acinar cells. Up regulation of CDKN1A was not detected in either islets or acinar cells, which indicates that the PUMA induction in islets and acinar cells by TNF- stimulation was possibly p53 independent, or at least independent of p21.
[0067] PUMA expression by human islets stimulated by recombinant human IFN- alone or in combination with TNF- was compared. As shown in
[0068] PUMA is Translationally Up Regulated in Human Islets Through NFB Activation:
[0069] Translation of PUMA induced by TNF- alone or in combination with IFN- into PUMA protein was examined. Islets were stimulated in culture for 16 hours with TNF- alone or together with IFN-, lysed and analyzed by western blot. The expression of PUMA was significantly increased by TNF- alone at a concentration of 50 ng/mL (p<0.05) and the combination of TNF- and IFN- (p<0.005), but not by IFN- (1000 U/mL) alone (
[0070] The p65 component of NF directly binds to the KB site of the PUMA promoter region driving transcriptional activation in response to TNF- stimulation. The up regulation of PUMA in human islets is regulated by NFB activation. Increased phosphorylation of p65 protein was detected in the islets stimulated by TNF- but not IFN-. The expression of p65 is further increased by stimulation with both TNF- and IFN- (
[0071] Treatment of human islets with TNF- and IFN- together induced mitochondrial clustering and increased PUMA protein in beta-cell cytoplasm: Confocal microscopy was used to examine PUMA expression in human islets treated with TNF-+IFN- for 24 hours. Paraffin sections of the islets were stained for PUMA, Cox IV (marker for mitochondria) and insulin. PUMA expression was up-regulated in TNF-+IFN- treated islets (
[0072] PUMA Induces Islet Cell Death Through Mitochondrial Pathway:
[0073] To examine whether islet apoptosis induced by such treatments is regulated by the extrinsic or intrinsic pathway, Caspase-8, Caspase-9 and Caspase-3 activation was determined in treated islets by western blot analysis. Caspase-9 and Caspase-3 were induced in islets treated with TNF- alone and further increased by co-treatment with IFN- (
[0074] cell apoptosis mediated by TNF- or combined with IFN- was verified as follows: immunohistochemically stained human islets were prepared following 24-hour culture with TNF- alone, or in combination with IFN- and analyzed by Laser Scanning Cytometry (LSC). Apoptotic cells were detected by co-staining with terminal uridine deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) and insulin. The percentage of apoptotic cells was calculated as described in Methods. TNF- treatment alone did not induce cell apoptosis (
[0075] To further confirm that PUMA plays a role in TNF- induced cell death, PUMA siRNA was used to silence PUMA. PUMA siRNA transfection (transfection rate >80%) suppressed PUMA mRNA expression to 22.28.6% of the control. PUMA siRNA was transfected into the rat insulinoma cell line, INS-1, to avoid potential problems associated with transfection of human islets due to the multi-cellular structure. Silencing PUMA significantly reduced INS-1 cell death caused by TNF- and IFN- during the 48-hour culture assessed by flow cytometric (FCM) analysis (57.73.6% in siControl group vs. 27.14.9% in siPUMA group, p<0.01) (
[0076] TNF- Inhibits Preproinsulin Precursor mRNA Synthesis in Human Islets:
[0077] The effect of TNF- and/or IFN- on cell function was examined by analyzing the ability of human islets to synthesize and release insulin. The addition of 50 ng/mL TNF- to either low or high glucose medium did not change insulin release levels during the 16-hour culture period (
[0078] PUMA Expression Level in the Islet Reflects the In Vivo Function to Reverse Hyperglycemia:
[0079] To examine whether the PUMA expression in isolated human islets correlates with islet function in vivo, human islets were transplanted into STZ induced diabetic NODscid mice using the standard procedure for in vivo islet quality assessment. Blood glucose levels were measured 30 days after transplantation of 1200 IEQ into the space beneath the renal capsule of diabetic NODscid mice. The level of PUMA mRNA in human islets shortly after isolation was variable between islet lots (
[0080] PUMA mRNA can be used as a molecular biomarker for screening compounds that protect islet from TNF- induced damage. PUMA mRNA was induced in human islets within 4 hours following TNF- stimulation in a dose dependent manner. IL-8 and TNF expression accompany the up regulation of PUMA by TNF-. Therefore, PUMA mRNA, along with IL-8 and TNF, may be used a marker to screen the effect of compounds on islets. To test such possibilities, randomly selected compounds were screened using our single islet assay system to test either increase or decrease of PUMA expression induced by 5 ng/mL TNF-. Pre-incubation with Etanercept, a recombinant protein of human soluble TNFR2 coupled to Fc portion of human IgG that binds to TNF- and inhibits its attachment to endogenous TNF cell surface receptors, prevented TNF- induced up regulation of PUMA (
[0081] Measuring mRNA expression of tumor necrosis factor receptor super family (TNFRSF) 1A and 1B on human islets and acinar cell clusters revealed that human islet expresses abundant TNFRSF1A (TNFR1). RT-PCR was performed in triplicate samples of either 10 islets or 10 acinar cell clusters prepared from two different pancreases and the results are shown in
[0082] In summary, the present discovery demonstrates for the first time TNF- induced PUMA expression in human islets via the activation of NFB, which leads cells to apoptosis through an intrinsic pathway. PUMA mRNA expression mediated by TNF-stimulation can be used as a biomarker to evaluate various compounds/drugs to assess their effect on cell function and survival. Tyrosine kinase inhibitor or JAK inhibitors may be used alone or in conjunction with other anti-PUMA technology, such as PUMA siRNA to protect islets. Furthermore the assay system using single human islet would facilitate the development of a high-throughput system for the discovery of new drugs that protect islet cell death, leading to discovery of new drugs for prevention and treatment of T1DM as well as T2DM. The significance of PUMA as a biomarker and manipulation of PUMA levels as an indicator islet health and a therapy is described.
[0083] Certain embodiments of the invention are described in detail, using specific examples, sequences, and drawings. The enumerated embodiments are not intended to limit the invention to those embodiments, as the invention is intended to cover all alternatives, modifications, and equivalents, which may be included within the scope of the present invention as defined by the claims. One skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in the practice of the present invention. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. All publications and/or patents are incorporated by reference as though fully set forth herein.
REFERENCES
[0084] 1. Eizirik, D. L., and Mandrup-Poulsen, T. 2001. A choice of deaththe signal-transduction of immune-mediated beta-cell apoptosis. Diabetologia 44:2115-2133. [0085] 2. Stephens, L. A., Thomas, H. E., Ming, L., Grell, M., Darwiche, R., Volodin, L., and Kay, T. W. 1999. Tumor necrosis factor-alpha-activated cell death pathways in NIT-1 insulinoma cells and primary pancreatic beta cells. Endocrinology 140:3219-3227. [0086] 3. Jacob, C. O., Aiso, S., Michie, S. A., McDevitt, H. O., and Acha-Orbea, H. 1990. Prevention of diabetes in nonobese diabetic mice by tumor necrosis factor (TNF): similarities between TNF-alpha and interleukin 1. Proc Natl Acad Sci USA 87:968-972. [0087] 4. Satoh, J., Seino, H., Abo, T., Tanaka, S., Shintani, S., Ohta, S., Tamura, K., Sawai, T., Nobunaga, T., Oteki, T., et al. 1989. Recombinant human tumor necrosis factor alpha suppresses autoimmune diabetes in nonobese diabetic mice. J Clin Invest 84:1345-1348. [0088] 5. Yang, X. D., Tisch, R., Singer, S. M., Cao, Z. A., Liblau, R. S., Schreiber, R. D., and McDevitt, H. O. 1994. Effect of tumor necrosis factor alpha on insulin-dependent diabetes mellitus in NOD mice. I. The early development of autoimmunity and the diabetogenic process. J Exp Med 180:995-1004. [0089] 6. Held, W., MacDonald, H. R., Weissman, I. L., Hess, M. W., and Mueller, C. 1990. Genes encoding tumor necrosis factor alpha and granzyme A are expressed during development of autoimmune diabetes. Proc Natl Acad Sci USA 87:2239-2243. [0090] 7. Mueller, C., Held, W., Imboden, M. A., and Carnaud, C. 1995. Accelerated beta-cell destruction in adoptively transferred autoimmune diabetes correlates with an increased expression of the genes coding for TNF-alpha and granzyme A in the intra-islet infiltrates. Diabetes 44:112-117. [0091] 8. Picarella, D. E., Kratz, A., Li, C. B., Ruddle, N. H., and Flavell, R. A. 1993. Transgenic tumor necrosis factor (TNF)-alpha production in pancreatic islets leads to insulitis, not diabetes. Distinct patterns of inflammation in TNF-alpha and TNF-beta transgenic mice. J Immunol 150:4136-4150. [0092] 9. Suk, K., Kim, S., Kim, Y. H., Kim, K. A., Chang, I., Yagita, H., Shong, M., and Lee, M. S. 2001. IFN-gamma/TNF-alpha synergism as the final effector in autoimmune diabetes: a key role for STAT1/IFN regulatory factor-1 pathway in pancreatic beta cell death. J Immunol 166:4481-4489. [0093] 10. Hotamisligil, G. S., Murray, D. L., Choy, L. N., and Spiegelman, B. M. 1994. Tumor necrosis factor alpha inhibits signaling from the insulin receptor. Proc Natl Acad Sci USA 91:4854-4858. [0094] 11. Uysal, K. T., Wiesbrock, S. M., Marino, M. W., and Hotamisligil, G. S. 1997. Protection from obesity-induced insulin resistance in mice lacking TNF-alpha function. Nature 389:610-614. [0095] 12. Steinberg, G. R., Michell, B. J., van Denderen, B. J., Watt, M. J., Carey, A. L., Fam, B. C., Andrikopoulos, S., Proietto, J., Gorgun, C. Z., Carling, D., et al. 2006. Tumor necrosis factor alpha-induced skeletal muscle insulin resistance involves suppression of AMP-kinase signaling. Cell Metab 4:465-474. [0096] 13. Tesz, G. J., Guilherme, A., Guntur, K. V., Hubbard, A. C., Tang, X., Chawla, A., and Czech, M. P. 2007. Tumor necrosis factor alpha (TNFalpha) stimulates Map4k4 expression through TNFalpha receptor 1 signaling to c-Jun and activating transcription factor 2. J Biol Chem 282:19302-19312. [0097] 14. Bouzakri, K., and Zierath, J. R. 2007. MAP4K4 gene silencing in human skeletal muscle prevents tumor necrosis factor-alpha-induced insulin resistance. J Biol Chem 282:7783-7789. [0098] 15. Plomgaard, P., Bouzakri, K., Krogh-Madsen, R., Mittendorfer, B., Zierath, J. R., and Pedersen, B. K. 2005. Tumor necrosis factor-alpha induces skeletal muscle insulin resistance in healthy human subjects via inhibition of Akt substrate 160 phosphorylation. Diabetes 54:2939-2945. [0099] 16. Karin, M., and Lin, A. 2002. NF-kappaB at the crossroads of life and death. Nat Immunol 3:221-227. [0100] 17. Aggarwal, B. B. 2003. Signalling pathways of the TNF superfamily: a double-edged sword. Nat Rev Immunol 3:745-756. [0101] 18. Wajant, H., Pfizenmaier, K., and Scheurich, P. 2003. Tumor necrosis factor signaling. Cell Death Differ 10:45-65. [0102] 19. Hengartner, M. O. 2000. The biochemistry of apoptosis. Nature 407:770-776. [0103] 20. Danial, N. N., and Korsmeyer, S. J. 2004. Cell death: critical control points. Cell 116:205-219. [0104] 21. McKenzie, M. D., Carrington, E. M., Kaufmann, T., Strasser, A., Huang, D. C., Kay, T. W., Allison, J., and Thomas, H. E. 2008. Proapoptotic BH3-only protein Bid is essential for death receptor-induced apoptosis of pancreatic beta-cells. Diabetes 57:1284-1292. [0105] 22. Grunnet, L. G., Aikin, R., Tonnesen, M. F., Paraskevas, S., Blaabjerg, L., Storling, J., Rosenberg, L., Billestrup, N., Maysinger, D., and Mandrup-Poulsen, T. 2009. Proinflammatory cytokines activate the intrinsic apoptotic pathway in beta-cells. Diabetes 58:1807-1815. [0106] 23. Sun, Q., Ming, L., Thomas, S. M., Wang, Y., Chen, Z. G., Ferris, R. L., Grandis, J. R., Zhang, L., and Yu, J. 2009. PUMA mediates EGFR tyrosine kinase inhibitor-induced apoptosis in head and neck cancer cells. Oncogene 28:2348-2357. [0107] 24. Vousden, K. H. 2005. Apoptosis. p53 and PUMA: a deadly duo. Science 309:1685-1686. [0108] 25. Nakano, K., and Vousden, K. H. 2001. PUMA, a novel proapoptotic gene, is induced by p53. Mol Cell 7:683-694. [0109] 26. Yu, J., Wang, Z., Kinzler, K. W., Vogelstein, B., and Zhang, L. 2003. PUMA mediates the apoptotic response to p53 in colorectal cancer cells. Proc Natl Acad Sci USA 100:1931-1936. [0110] 27. You, H., Pellegrini, M., Tsuchihara, K., Yamamoto, K., Hacker, G., Erlacher, M., Villunger, A., and Mak, T. W. 2006. FOXO3a-dependent regulation of PUMA in response to cytokine/growth factor withdrawal. J Exp Med 203:1657-1663. [0111] 28. Reimertz, C., Kogel, D., Rami, A., Chittenden, T., and Prehn, J. H. 2003. Gene expression during ER stress-induced apoptosis in neurons: induction of the BH3-only protein Bbc3/PUMA and activation of the mitochondrial apoptosis pathway. J Cell Biol 162:587-597. [0112] 29. Wu, B., Qiu, W., Wang, P., Yu, H., Cheng, T., Zambetti, G. P., Zhang, L., and Yu, J. 2007. p53 independent induction of PUMA mediates intestinal apoptosis in response to ischaemia-reperfusion. Gut 56:645-654. [0113] 30. Toth, A., Jeffers, J. R., Nickson, P., Min, J. Y., Morgan, J. P., Zambetti, G. P., and Erhardt, P. 2006. Targeted deletion of PUMA attenuates cardiomyocyte death and improves cardiac function during ischemia-reperfusion. Am J Physiol Heart Circ Physiol 291: H52-60. [0114] 31. Wang, P., Qiu, W., Dudgeon, C., Liu, H., Huang, C., Zambetti, G. P., Yu, J., and Zhang, L. 2009. PUMA is directly activated by NF-kappaB and contributes to TNF-alpha-induced apoptosis. Cell Death Differ 16:1192-1202. [0115] 32. Omori K, M. M., Todorov I, Rawson J, Shiang K. D, Kandeel F, Mullen Y. 2010. Microassay for glucose-induced preproinsulin mRNA expression to assess islet functional potency for islet transplantation. Transplantation. [0116] 33. Ortis, F., Pirot, P., Naamane, N., Kreins, A. Y., Rasschaert, J., Moore, F., Theatre, E., Verhaeghe, C., Magnusson, N. E., Chariot, A., et al. 2008. Induction of nuclear factor-kappaB and its downstream genes by TNF-alpha and IL-1 beta has a pro-apoptotic role in pancreatic beta cells. Diabetologia 51:1213-1225. [0117] 34. Eizirik, D. L., Colli, M. L., and Ortis, F. 2009. The role of inflammation in insulitis and beta-cell loss in type 1 diabetes. Nat Rev Endocrinol 5:219-226. [0118] 35. Mitsuhashi, M., Ogura, M., Endo, K., Obara, K., Izutsu, H., Targan, S. R., Maemura, M., Tachikawa, D., and Shinagawa, A. 2008. Ex vivo induction of mRNA in human whole blood as a new platform of drug and dietary supplement development. Pharm Res 25:1116-1124. [0119] 36. Mitsuhashi, M., and Targan, S. R. 2008. Ex vivo simulation of IgG Fc and T-cell receptor functions: an application to inflammatory bowel disease. Inflamm Bowel Dis 14:1061-1067. [0120] 37. Thomas, H. E., Darwiche, R., Corbett, J. A., and Kay, T. W. 1999. Evidence that beta cell death in the nonobese diabetic mouse is Fas independent. J Immunol 163:1562-1569. [0121] 38. Hughes, K. J., Chambers, K. T., Meares, G. P., and Corbett, J. A. 2009. Nitric oxides mediates a shift from early necrosis to late apoptosis in cytokine-treated {beta}-cells that is associated with irreversible DNA damage. Am J Physiol Endocrinol Metab. [0122] 39. Kwon, G., Xu, G., Marshall, C. A., and McDaniel, M. L. 1999. Tumor necrosis factor alpha-induced pancreatic beta-cell insulin resistance is mediated by nitric oxide and prevented by 15-deoxy-Delta12,14-prostaglandin J2 and aminoguanidine. A role for peroxisome proliferator-activated receptor gamma activation and inos expression. J Biol Chem 274:18702-18708. [0123] 40. Kim, H. E., Choi, S. E., Lee, S. J., Lee, J. H., Lee, Y. J., Kang, S. S., Chun, J., and Kang, Y. 2008. Tumour necrosis factor-alpha-induced glucose-stimulated insulin secretion inhibition in INS-1 cells is ascribed to a reduction of the glucose-stimulated Ca2+ influx. J Endocrinol 198:549-560. [0124] 41. Mastrandrea, L., Yu, J., Behrens, T., Buchlis, J., Albini, C., Fourtner, S., and Quattrin, T. 2009. Etanercept treatment in children with new-onset type 1 diabetes: pilot randomized, placebo-controlled, double-blind study. Diabetes Care 32:1244-1249. [0125] 42. Louvet, C., Szot, G. L., Lang, J., Lee, M. R., Martinier, N., Bollag, G., Zhu, S., Weiss, A., and Bluestone, J. A. 2008. Tyrosine kinase inhibitors reverse type 1 diabetes in nonobese diabetic mice. Proc Natl Acad Sci USA 105:18895-18900. [0126] 43. Lv, N., Kim, E. K., Song, M. Y., Choi, H. N., Moon, W. S., Park, S. J., Park, J. W., Kwon, K. B., and Park, B. H. 2009. JANEX-1, a JAK3 inhibitor, protects pancreatic islets from cytokine toxicity through downregulation of NF-kappaB activation and the JAK/STAT pathway. Exp Cell Res 315:2064-2071. [0127] 44. Mitsuhashi, M., Tomozawa, S., Endo, K., and Shinagawa, A. 2006. Quantification of mRNA in whole blood by assessing recovery of RNA and efficiency of cDNA synthesis. Clin Chem 52:634-642. [0128] 45. Mitsuhashi, M., Keller, C., and Akitaya, T. 1992. Gene manipulation on plastic plates. Nature 357:519-520. [0129] 46. Morrison, T. B., Weis, J. J., and Wittwer, C. T. 1998. Quantification of low-copy transcripts by continuous SYBR Green I monitoring during amplification. Biotechniques 24:954-958, 960, 962. [0130] 47. Mitsuhashi, M., Endo, K., Obara, K., Izutsu, H., Ishida, T., Chikatsu, N., and Shinagawa, A. 2008. Ex vivo simulation of the action of antileukemia drugs by measuring apoptosis-related mRNA in blood. Clin Chem 54:673-681. [0131] 48. Mitsuhashi M, E. K., Obara K, Izutsu H, Ishida T, Chikatsu N, Shinagawa A. 2008. Quantification of Drug-Induced mRNA in Human Whole Blood ex vivo. Clinical Medicine: Blood Disorders 1:1-11. [0132] 49. Omori, K., Valiente, L., Orr, C., Rawson, J., Ferreri, K., Todorov, I., A I-Abdullah, I. H., Medicherla, S., Potter, A. A., Schreiner, G. F., et al. 2007. Improvement of human islet cryopreservation by a p38 MAPK inhibitor. Am J Transplant 7:1224-1232. [0133] 50. Ito, T., Omori, K., Rawson, J., Todorov, I., Asari, S., Kuroda, A., Shintaku, J., Itakura, S., Ferreri, K., Kandeel, F., et al. 2008. Improvement of canine islet yield by donor pancreas infusion with a p38MAPK inhibitor. Transplantation 86:321-329. [0134] 51. Gurzov E N, Germano C M, Cunha D A, et al. (2010) PUMA activation contributes to pancreatic beta cell apoptosis induced by pro-inflammatory cytokines and endoplasmic reticulum stress. J Biol Chem. [0135] 52. Todorov I, Nair I, Avakian-Mansoorian A, et al. (2010) Quantitative assessment of beta-cell apoptosis and cell composition of isolated, undisrupted human islets by laser scanning cytometry. Transplantation 90: 836-842. [0136] 53. Itakura S, Asari S, Rawson J, et al. (2007) Mesenchymal stem cells facilitate the induction of mixed hematopoietic chimerism and islet allograft tolerance without GVHD in the rat. Am J Transplant 7: 336-346. [0137] 54. Hanley S, Liu S, Lipsett M, et al. (2006) Tumor necrosis factor-alpha production by human islets leads to postisolation cell death. Transplantation 82: 813-818. [0138] 55. Hagerkvist R, Sandler S, Mokhtari D, Welsh N (2007) Amelioration of diabetes by imatinib mesylate (Gleevec): role of beta-cell NF-kappaB activation and anti-apoptotic preconditioning. FASEB J 21: 618-628. [0139] 56. Matsuda T, Omori K, Vuong T, et al. (2005) Inhibition of p38 pathway suppresses human islet production of pro-inflammatory cytokines and improves islet graft function. Am J Transplant 5: 484-493. [0140] 57. Omori K, Todorov I, Shintaku J, et al. (2010) P38alpha-selective mitogen-activated protein kinase inhibitor for improvement of cultured human islet recovery. Pancreas 39: 436-443. [0141] 58. De Vos K, Goossens V, Boone E, et al. (1998) The 55-kDa tumor necrosis factor receptor induces clustering of mitochondria through its membrane-proximal region. The Journal of biological chemistry 273: 9673-9680. [0142] 59. Desagher S, Martinou J C (2000) Mitochondria as the central control point of apoptosis. Trends Cell Biol 10: 369-377. [0143] 60. Niizuma K, Endo H, Nito C, Myer D J, Chan P H (2009) Potential role of PUMA in delayed death of hippocampal CA1 neurons after transient global cerebral ischemia. Stroke 40: 618-625.