CERTAIN PLANTS WITH "NO SATURATE" OR REDUCED SATURATE LEVELS OF FATTY ACIDS IN SEEDS, AND OIL DERIVED FROM THE SEEDS

20180030463 ยท 2018-02-01

    Inventors

    Cpc classification

    International classification

    Abstract

    The subject invention provides no sat canola oil. The subject invention also provides seeds that can be used to produce such oils. Plants that produce these seeds are also included within the subject invention. All of this was surprisingly achieved by using a delta-9 desaturase gene in canola. This technology can be applied to other plants as disclosed herein. Oils of the subject invention have particularly advantageous characteristics and fatty acid profiles, which were not heretofore attained. The subject invention still further provides a plant-optimized delta-9 desaturase gene. The subject invention still further provides a plant-optimized delta-9 desaturase gene. In some preferred embodiments, a preferred plant comprises at least two copies of a delta-9 desaturase gene of the subject invention. Seeds produced by such plants surprisingly do not exhibit effects of gene silencing but rather have further surprising reductions in levels of total saturates.

    Claims

    1. A canola plant that produces seed having an oil fraction comprising less than 3.5% total saturates and less than 80% oleic acid.

    2. The plant of claim 1 wherein said oil fraction comprises 70% to 78% oleic acid.

    3. The plant of claim 1 wherein said oil fraction comprises no more than 3% linolenic acid.

    4. The plant of claim 1 wherein said oil fraction comprises 70% to 78% oleic acid and no more than 3.5% linolenic acid.

    5. Seed produced by the canola plant of claim 1.

    6. Canola seed oil comprising less than 3.5% total saturates, less than 80% oleic acid, and no more than 3.5% linolenic acid, said oil is produced from seeds of a canola plant expressing a delta-9 desaturase protein having at least 85% identity with SEQ ID NO: 5, wherein said total saturates comprise C16:0, C18:0, C20:0, C22:0 and C24:0 fatty acids, wherein each of said C16:0, C18:0, C20:0, C22:0, and C24:0 fatty acids is present in the less than 3.5% total saturates.

    7. A fried food composition comprising potato material and canola oil according to claim 6.

    8. The canola plant of claim 1 wherein said oil fraction has no more than 2.7% total saturates.

    9. The canola seed of claim 5 having an oil fraction comprising no more than 2.7% total saturates.

    10. The canola seed oil of claim 6 having an oil fraction comprising no more than 2.7% total saturates.

    11. A method of producing a fried food composition wherein said method comprises frying potato material in canola oil according to claim 6.

    12. A canola plant comprising at least one polynucleotide, stably incorporated in a genome of said plant, that encodes a delta-9 desaturase protein wherein the full complement of a nucleic acid molecule that encodes a protein of SEQ ID NO:5 maintains hybridization, after wash, with said polynucleotide, wherein said wash conditions are 2SSC (Standard Saline Citrate) and 0.1% SDS (Sodium Dodecyl Sulfate) for 15 minutes at room temperature.

    13. The plant of claim 12 wherein said nucleic acid molecule comprises SEQ ID NO: 1.

    14. The plant of claim 12 wherein said wash conditions are 0.1SSC and 0.1% SDS for 15 minutes at room temperature.

    15. The plant of claim 12 wherein said wash conditions are 0.1SSC and 0.1% SDS for 30 minutes at 55 C.

    16. The plant of claim 12 wherein said genome comprises two of said polynucleotides.

    17. The plant of claim 12 wherein said genome comprises three of said polynucleotides.

    18. The plant of claim 12 wherein said polynucleotide is operably linked to a seed-specific promoter.

    19. A plant produced by the seed of claim 5.

    20. A method of reducing saturated fat in the oil fraction of at least one seed of a transgenic canola plant, as compared to a wild-type oil fraction of seeds of a corresponding wild-type canola plant, wherein said method comprises producing a canola plant that expresses a polynucleotide that encodes a delta-9 desaturase protein wherein a nucleotide molecule that encodes said protein hybridizes with the molecule of SEQ ID NO: 1.

    21. The method of claim 20 wherein the oil fraction comprises less than 80% oleic acid.

    22. The method of claim 20 wherein said protein causes a reduction in palmitic acid (16:0), a reduction in behenic acid (22:0), and an increase in palmitoleic acid (16:1) in the oil fraction of said seed of said transgenic canola plant relative to said corresponding wild-type canola plant.

    23. The method of claim 20 wherein said saturated fat is reduced by at least 60%.

    24. A polynucleotide comprising a sequence of nucleotides shown in SEQ ID NO:1.

    25. The plant of claim 1 wherein said plant is at least 100 cm in height with an average seed weight above 3 mg.

    26. The canola seed oil of claim 6 wherein said oil comprises 70% to 78% oleic acid.

    27. The canola seed oil of claim 6 wherein said oil comprises no more than 3% linolenic acid.

    28. The canola seed oil of claim 6 wherein said total saturates comprise at least about 2.0% C16:0, at least about 0.26% C18:0, at least about 0.11% C20:0, at least about 0.03% C22:0, and at least about 0.02% C24:0 fatty acids.

    29. The canola seed oil of claim 6 wherein said total saturates comprise from about 2.0% to about 2.44% C16:0, from about 0.26% to about 0.51% C18:0, from about 0.11% to about 0.28% C20:0, from about 0.03% to about 0.13% C22:0, and from about 0.02% to about 0.10% C24:0 fatty acids.

    30. The canola seed oil of claim 29 wherein said total saturates comprise from about 2.14% to about 2.44% C16:0, from about 0.28% to about 0.51% C18:0, from about 0.16% to about 0.28% C20:0, from about 0.06% to about 0.13% C22:0, and from about 0.04% to about 0.10% C24:0 fatty acids.

    31. ) The canola seed oil of claim 6 said oil is produced by crushing said seeds.

    32. The canola seed oil of claim 6 wherein said canola seed oil is produced from at least 8 canola seeds.

    Description

    BRIEF DESCRIPTION OF THE FIGURES

    [0032] FIG. 1 shows that a greater than 60% reduction of saturated fatty acids was achieved in Arabidopsis. This graph summarizes T2, and T3 seed data for a single Arabidopsis event.

    [0033] FIG. 2 shows a reduction in sats of up to 60-70% in T2 Arabidopsis seeds from 18 additional transformants. Data illustrated in this graph was a combination of the numerical data shown in Table 8 and earlier numerical data.

    [0034] FIG. 3 shows that saturated fats were reduced by over 43% in Westar canola (and a 50% reduction was achieved when 24:0 was included).

    [0035] FIG. 4A shows a bar graph comparing total saturates of seeds from various canola plants comprising Event 36-11.19 compared to a control. FIGS. 4B and 4C present numerical data illustrated by the bar graph.

    [0036] FIG. 5A shows a bar graph comparing total saturates of seeds from various canola plants comprising Event 218-11.30 compared to a control. FIGS. 5B and 5C present numerical data illustrated by the bar graph.

    [0037] FIGS. 6A-F show half-seed data from the T3 field trials. FIGS. 6A and 6B clearly show the reductions in C16:0 and increases in C16:1 in the transgenic events as compared to the nulls (events in which the transgene segregated out of the plant) and wild-type controls (non-transformed lines). FIGS. 6C and 6D clearly show the reductions in C18:0 and increases in C18:1 in the transgenic events as compared to the nulls and wild-type controls. FIGS. 6E and 6F clearly show the reductions in C20:0 and C22:0, respectively, in the transgenic events as compared to the nulls and wild-type controls.

    [0038] FIGS. 6G and 6H clearly show shifts and reductions in C16:0, and shifts and increases in C16:1 in the transgenic events, as compared to the nulls and wild-type controls. FIGS. 6I and 6J clearly show shifts and reductions in C18:0, and shifts and increases in C18:1 in the transgenic events, as compared to the nulls and wild-type controls. FIGS. 6K and 6L show similar bar graphs for C18:2 and C18:3. FIG. 6M further illustrates reductions in total saturates, as compared to already very good Nex 710 lines. FIG. 6N shows distributions for 1000 seeds.

    [0039] FIGS. 7A and 7B illustrate data obtained using the protocol of Example 16.

    [0040] FIGS. 8 and 9 are pictures of two gels run with DNA from F3 plants, as discussed in Example 19.

    BRIEF DESCRIPTION OF THE SEQUENCES

    [0041] SEQ ID NO:1 shows the nucleic acid sequence of the open reading frame for the plank optimized, delta-9 desaturase gene used herein.

    [0042] SEQ ID NO:2 shows the sequence of the ORF of SEQ ID NO:1 preceded by a Kozak sequence and a BamHI cloning site (residues 1-10), plus a translational terminator at the end of the ORF (residues 1379-1381).

    [0043] SEQ ID NO:3shows the nucleic acid sequence of the delta-9 forward B primer used to amplify the delta-9 gene.

    [0044] SEQ ID NO:4 shows the nucleic acid sequence of the delta-9 reverse B primer used to amplify the delta-9 gene.

    [0045] SEQ ID NO:5 shows the amino acid sequence encoded by SEQ ID NO:1.

    DETAILED DESCRIPTION OF THE INVENTION

    [0046] The subject invention provides no sat canola oil. The invention also relates in part to methods for reducing saturated fatty acids in certain plant seeds. These results were surprisingly achieved through the use of a delta-9 desaturase gene to surprisingly produce no sat levels of fatty acids in plants, preferably oil plants, and still more preferably canola (Brassica). The subject invention includes such plants and also provides seeds and oils from said plants wherein the oils have particularly advantageous characteristics and fatty acid profiles, which were not heretofore attained.

    [0047] Th3 Aspergillus nidulans microsomal delta-9-CoA desaturase gene is exemplified herein. This delta-9 desaturase is a membrane-bound enzyme and catalyzes the reaction of 16:0-CoA and 18:0-CoA to 16:1-CoA and 18:1-CoA (adding a double bond at the delta-9 location). The subject invention was further surprising in that the levels of other saturates, such as C20:0, C22:0, and C24:0, were also very surprisingly and advantageously reduced, while C16:1 and C18:1 unsaturates were increased (with little or no increases in C18:2 and C18:3, or even reductions of these relatively less stable polyunstaturates in some cases). Heretofore, it was unclear whether this would be a good enzyme (including whether the gene could be sufficiently expressed) in Brassica and other good oil seed plants, which already have a desirable (yet not optimal) fatty acid profile. (For example, it yielded only a 10% decrease in saturates in corn.)

    [0048] As mentioned in the Background section, given the complex fatty acid profiles and metabolic pathways of different organisms and plants, and the different physical cell machinery thereof, even if this gene and enzyme could have an effect in Brassica, the effects could not be expected to be beneficial. As discussed in the Background section, increases in one or more types of desirable fatty acids often resulted in decreases of other desirable fatty acids, increases in undesirable fatty acids, and agronomic penalties (i.e., other outright adverse effects on the modified plants). It was also surprising that the subject invention can be practiced without corresponding adverse effects to other valuable agronomic characteristics such as pod size, seed yield, seed size, oil yield, and the like. There were no adverse effects in plants homozygous for a simple transgenic insert. Some double homozygous stacks (made by crossing two transgenic events) exhibited decrease in pod number and seed set; the cause is yet unknown. However, Table 27 contains stacks (that is, apparently increased copy number events) having seed yields similar to non-transgenic controls and also no sat composition.

    [0049] Yet another reason for unpredictably arises because of differences between desaturases, and even between yeast, fungal, plant, and animal delta-9 desaturases. Differences in the desaturases can be attributed in part to differences in cell structures of the source organisms for the various desaturases. A yeast desaturase from U.S. Pat. No. 5,777,201 is discussed above in the Background section. It is longer than the Apergillus desaturase exemplified herein (510 amino acids vs. 455 amino acids). In addition, it has only about 52% identity over about 400 amino acids (as determined by both BLAST and BestFit, a Smith-Waterman program; both done in EMBOSS). Tables 1a and 1b of Example 7 ofthatpatent show that tlie reductions in saturates achieved using the yeast desaturase were much weaker than those achieved according to the subject invention with the exemplified Aspergillus desaturase in canola. There are various factors that can be possible explanations for the relatively weaker performance of the yeast desaturase. For example, that protein might be inherently instable in plants (while the subject desaturase is quite apparently very stable in canola). These can also be different in other enzyme properties, such as catalytic efficiencies, substrate affinities, cofactor affinities, and the like.

    [0050] Compared to the safflower desaturase of U.S. Pat. Nos. 5,723,595 and 6,706,950, the safflower desaturase is shorter (396 amino acids) than the presently exemplified Aspergillus desaturase (455 amino acids). The safflower desaturase is also found in the plastid, while the subject Aspergillus desaturase is found in the ER/microsomes/cytoplasmic compartment. Furthermore, the safflower desaturase uses acyl-ACP substrates found in the plastid, while the Aspergillus desaturase uses acyl-CoA substrates found in the cytoplasmic compartment. Thus, for the subject invention, it was not known if a substantial portion of the pool of acyl-CoA substrates would be available to the Aspergillus desaturase.

    [0051] Thus, it was with great surprise that the subject delta-9 desaturase was found to be able to yield canola plants, seeds, and oil therefrom having excellent properties, particularly for improving food qualities of the oil. Very surprisingly, a greater than 60% reduction of saturated fatty acids was achieved in Arabidopsis, and a greater than 43% reduction of saturated fatty acids was achieved in canola. Again, it is important to note that this was achieved in a plant that already yielded one of the best fatty acid profiles of any suitable plant. This invention was also used to achieve surprising and advantageous fatty acid profiles and ratios, as shown and discussed in more detail below. Although stearic acid is considered to be a saturated fatty acid, it has been found to have cholesterol-lowering effects. Thus, relatively higher levels of stearic acid can be beneficial. Similarly, relatively higher levels of arachidonic acid can be desirable. As shown in data herein, oil from seeds of the subject invention have advantageous profiles of these two fatty acids, together with desirable levels of vaccenic acid, for example. Also shown herein is that advantageous levels of these fatty acids and/or total saturates are present in combination with desirable plant height, yield, and other beneficial characteristics in the commercial-quality plants of the subject invention (as opposed to dwarf plants, for example). Again, exemplary data for such plants ofthe subject invention are presented herein.

    [0052] It should be noted that the subj ect invention is not limited to the exemplified desaturase. Various desaturases and delta-9 desaturases are available in GENBANK, and sequence alignments can be performed, using standard procedures, to observe and compare differences in the sequences of the enzymes. Enzymes similar to that exemplified herein can be used according to the subject invention.

    [0053] For example, the subject Aspergillus desaturase has two domains. The first domain (approximately the amino-terminal two-thirds of the molecule) is the desaturase domain, and the second domain (roughly the C-terminal third ofthe molecule) is a cytochrome b5 domain. Residues 62-279, for example, of SEQ ID NO:5 can be aligned with residues 4-233 of fatty acid desaturase gnl|CDD|25523 pfam00487, for example. Residues 332-407 of SEQ ID NO:5 can be aligned with residues 1-74 of gnl|CDD|22935 pfam00173 (cytochrome b5 domain). Residues 17-305 of SEQ ID NO:5 can be aligned with residues 3-288 of the lipid metabolism domain of fatty acid desaturase gnl|CDD|11113 COG1398 (OLE1). Residues 301-449 of SEQ ID NO:5 can be aligned with residues 11-163 of CYB5 (cytochrome b involved in lipid metabolism) of gnl|CDD|14396 COG5274. The desaturase domain of SEQ ID NO:5 lacking the cytochrome b5 could be functional, as this is the general structure of plant plastidial desaturases. There is also a published presumed microsomal pine desaturase (LOCUS AF438199) which uses acyl-CoA substrates found in the cytoplasmic compartment, and it lacks the cytb5 domain. It might also be possible to swap the Aspergillus cytochrome b5 domain with that of another organism, even one from a plant cytoplasmic desaturase: These domains, or segments encoding either or both of these domains, can be used as probes to define molecules of the subject invention, as discussed in more detail below.

    [0054] Thus, the genes and proteins useful according to the subject invention include not only the specifically exemplified full-length sequences, but also portions, segments and/or fragments (including internal and/or terminal deletions compared to the full-length molecules) of these sequences, variants, mutants, chimerics, and fusions thereof. Proteins used in the subject, invention can have substituted amino acids so long as they retain the characteristic enzymatic activity of the proteins specifically exemplified herein. Variant genes have nucleotide sequences that encode the same proteins or equivalent proteins having functionality equivalent to an exemplified protein. The terms Variant proteins and equivalent proteins refer to proteins having the same or essentially the same biological/functional activity as the exemplified proteins. As used herein, reference to an equivalent sequence refers to sequences having amino acid substitutions, deletions, additions, or insertions that improve or do not adversely affect functionality. Fragments retaining functionality are also included in this definition. Fragments and other equivalents that retain the same or similar function, as a corresponding fragment of an exemplified protein are within the scope of the subject invention. Changes, such as amino acid substitutions or additions, can be made for a variety of purposes, such as increasing (or decreasing) protease stability of the protein (without materially/substantially decreasing the functionality of the protein).

    [0055] Variations of genes may be readily constructed using standard techniques for making point mutations, for example. In addition, U.S. Pat. No. 5,605,793, for example, describes methods for generating additional molecular diversity by using DNA reassembly after random fragmentation. Variant genes can be used to produce variant proteins; recombinant hosts can be used to produce the variant proteins. Using these gene shuffling techniques, equivalent genes and proteins can be constructed that comprise any 5,10,15,20,25,30,35,40,45,50,55,60 (for example) contiguous residues (amino acid or nucleotide) of any sequence exemplified herein.

    [0056] Fragments of full-length genes can be made using commercially available exonucleases or endonucleases according to standard procedures. For example, enzymes such as BaI31 or site-directed mutagenesis can be used to systematically cut off nucleotides from the ends of these genes. Also, genes that encode active fragments may be obtained using a variety of restriction enzymes. Proteases may be used to directly obtain active fragments of these proteins.

    [0057] It is within the scope of the invention as disclosed herein that the subject proteins maybe truncated and still retain functional activity. By truncated protein it is meant that a portion of a protein may be cleaved and yet still exhibit enzymatic activity after cleavage. Furthermore, effectively cleaved proteins can be produced using molecular biology techniques wherein the DNA bases encoding said protein are removed either through digestion, with restriction endonucleases or other techniques available to the skilled artisan. After truncation, said proteins can be expressed in heterologous systems such as Escherichia coli, baculoviruses, plant-based viral systems, yeast and the like and then placed in insect assays as disclosed herein to determine activity. It is well-known in the art that truncated proteins can be successfully produced so that they retain functional activity while having less than the entire, full-length sequence. It is well known in the art that B.t. toxins can be used in a truncated (core toxin) form. See, e.g., Adang et al., Gene 36:289-300 (1985), Characterized full-length and truncated plasmid clones of the crystal protein of Bacillus thuringiensis subsp kurstala HD-73 and their toxicity to Manduca sexta. There are other examples of truncated proteins that retain insecticidal activity, including the insect juvenile hormone esterase (U.S. Pat. No. 5,674,485 to the Regents of the University of California). As used herein, the term toxin is also meant to include functionally active truncations.

    [0058] Proteins and genes for use according to the subject invention can be defined, identified, and/or obtained by using oligonucleotide probes, for example. These probes are detectable nucleotide sequences which may be detectable by virtue of an appropriate label or may be made inherently fluorescent as described in International Application No. WO 93/16094. The probes (and the polynucleotides of the subject invention) may be DNA, RNA, or PNA. In addition to adenine (A), cytosine (C), guanine (G), thymine (T), and uracil (U; for RNA molecules), synthetic probes (and polynucleotides) of the subject invention can also have inosine (a neutral base capable of pairing with all four bases; sometimes used in place of a mixture of all four bases in synthetic probes). Thus, where a synthetic, degenerate oligonucleotide is referred to herein, and N or n is used generically, N or ri can be G, A, T, C, or inosine. Ambiguity codes as used herein are in accordance with standard IUPAC naming conventions as of the filing of the subject application (for example, R means A or G, Y means C or T, etc.).

    [0059] As is well known in the art, if a probe molecule hybridizes with a nucleic acid sample, it can be reasonably assumed that the probe and sample have substantial homology/similarity/identity. Preferably, hybridization of the polynucleotide is first conducted followed by washes under conditions of low, moderate, or high stringency by techniques well-known in the art, as described in; for example, Keller, G. H., M. M. Manak (1987) DNA Probes, Stockton Press, New York, N.Y., pp. 169-170. For example, as stated therein, low stringency conditions can be achieved by first washing with 2SSC (Standard Saline Citrate)/0.1% SDS (Sodium Dodecyl Sulfate) for 15 minutes at room temperature. Two washes are typically performed. Higher stringency can then be achieved by lowering the salt concentration and/or by raising the temperature. For example, the wash described above can be followed by two washings with 0.1SSC/0.1% SDS for 15 minutes each at room temperature followed by subsequent washes with 0.1SSC/0.1% SDS for 30 minutes each at 55 C. These temperatures can be used with other hybridization and wash protocols set forth herein and as would be known to one skilled in the art (SSPE can be used as the salt instead of SSC, for example). The 2SSC/0.1% SDS can be prepared by adding 50 ml of 20 SSC and 5 ml of 10% SDS to 445 ml of water. 20SSC can be prepared by combining NaCl (175.3 g/0.150 M), sodium citrate (88.2 g/0.015 M), and water, adjusting pH to 7.0 with 10 N NaOH, then adjusting the volume to 1 liter 10% SDS can be prepared by dissolving 10 g of SDS in 50 ml of autoclaved water, then diluting to 100 ml.

    [0060] Detection of the probe provides a means for determining in a known manner whether hybridization has been maintained. Such a probe analysis provides a rapid method for identifying toxin-encoding genes of the subject invention. The nucleotide segments Which are used as probes according to the invention can be synthesized using a DNA synthesizer and standard procedures. These nucleotide sequences can also be used as PCR primers to amplify genes of the subj ect invention.

    [0061] Hybridization with a given polynucleotide is a technique that canbe used to identify, find, and/or define proteins and genes of the subject invention. As used herein, stringent conditions for hybridization refers to conditions which achieve the same, or about the same, degree of specificity of hybridization as the conditions described herein. Hybridization of immobilized DNA on Southern blots with 32P-labeled gene-specific probes can be performed by standard methods (see, e.g., Maniatis, T., E. F. Fritsch, J. Sambrook [1982] Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.). In general, hybridization and subsequent washes are carried out under conditions that allowed for detection of target sequences. For double-stranded DNA gene probes, hybridization can be carried out overnight at 20-25 C. below the melting temperature (Tm) of the DNA hybrid in 6SSPE, 5 Denhardt's solution, 0.1% SDS, 0.1 mg/ml denatured DNA. The melting temperature is described by the following formula (Beltz, G. A., K. A. Jacobs, T. H. Eickbush, P. T. Cherbas, and F. C. Kafatos [1983] Methods of Enzymology, R. Wu, L. Grossman and K. Moldave [eds.] Academic Press, New York 100:266-285):

    [0062] Tm=81.5 C.+16.6 Log[Na+]0.41(% G+C)0.61(% formamide)600/length of duplex in base pairs. Washes are typically carried out as follows:

    [0063] 1) Twice at room temperature for 15 minutes in 1SSPE, 0.1% SDS (low stringency wash).

    [0064] 2) Once at Tm-20 C. for 15 minutes in 0.2SSPE, 0.1% SDS (moderate stringency wash).

    [0065] For oligonucleotide probes, hybridization canbe carried out overnight at 10-20 C. below the melting temperature (Tm) of the hybrid in 6SSPE, 5 Denhardt's solution, 0.1% SDS, 0.1 mg/ml denatured DNA. Tm for oligonucleotide probes was determined by the following formula: Tm ( C.)=2(number T/A base pairs)+4(number G/C base pairs) (Suggs, S. V., T. Miyalce, E. H. Kawashime, M. J. Johnson, K. Itakura, and R. B. Wallace [1981]ICN-UCLA Symp. Dev. Biol. Using Purified Genes, D. D. Brown [ed.], Academic Press, New York, 23:683-693).

    [0066] Washes can be carried out as follows:

    [0067] 1) Twice at room temperature for 15 minutes 1SSPE, 0.1% SDS (low stringency wash).

    [0068] 2) Once at the hybridization temperature for 15 minutes in 1SSPE, 0.1% SDS (moderate stringency wash).

    [0069] In general, salt and/or temperature can be altered to change stringency. With a labeled DNA fragment >70 or so bases in length, the following conditions can be used: [0070] Low: 1 or 2SSPE, room temperature [0071] Low: 1 or 2SSPE, 42 C. [0072] Moderate: 0.2 or 1SSPE, 65 C. [0073] High: 0.1SSPE, 65 C.

    [0074] Duplex formation and stability depend on substantial complementarity between the two strands of a hybrid, and, as noted above, a certain degree of mismatch can be tolerated. Therefore, the probe sequences of the subject invention include mutations (both single and multiple), deletions, insertions of the described sequences, and combinations thereof, wherein said mutations, insertions and deletions permit formation of stable hybrids with the target polynucleotide of interest. Mutations, insertions, and deletions can be produced in a given polynucleotide sequence in many ways, and these methods are known to ah ordinarily skilled artisan. Other methods may become known in the future.

    [0075] Because of the degeneracy/redundancy of the genetic code, a variety of different DNA sequences can encode the amino acid sequences disclosed herein. It is well within the skill of a person trained in the art to create alternative DNA sequences that encode the same, or essentially the same, enzymes. These variant DNA sequences are within the scope of the subject invention.

    [0076] The subject invention include, for example:

    [0077] 1) proteins obtained from wild type organisms;

    [0078] 2) variants arising from mutations;

    [0079] 3) variants designed by making conservative amino acid substitutions; and

    [0080] 4) variants produced by random fragmentation and reassembly of a plurality of different sequences that encode the subject TC proteins (DNA shuffling). See e.g. U.S. Pat. No. 5,605,793.

    [0081] The DNA sequences encoding the subject proteins can be wild type sequences, mutant sequences, or synthetic sequences designed to express a predetermined protein. DNA sequences designed to be highly expressed in plants by, for example, avoiding polyadenylation signals, and using plant preferred codons, are particularly useful.

    [0082] Certain proteins and genes have been specifically exemplified herein. As these proteins and genes are merely exemplary, it should be readily apparent that the subject invention comprises use of variant or equivalent proteins (and nucleotide sequences coding for equivalents thereof) having the same or similar functionality as the exemplified proteins. Equivalent proteins will have amino acid similarity (and/or homology) with an exemplified enzyme (or active fragment thereof). Preferred polynucleotides and proteins of the subject invention can be defined in terms of narrower identity and/or similarity ranges. For example, the identity and/or similarity of the enzymatic protein can be 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% as compared to a sequence exemplified or suggested herein. Any number listed above can be used to define the upper and lower limits. For example, a protein of the subject invention can be defined as haying 50-90% identity, for example, with an exemplified protein.

    [0083] Unless otherwise specified, as used herein, percent sequence identity and/or similarity of two nucleic acids is determined using the algorithm of Karlin and Altschul (1990), Proc. Natl Acad. Sci. USA 87:2264-2268, modified as in Karlin and Altschul (1993), Proc. Natl. Acad. Set USA 90:5873-5877. Such an algorithm is incorporated into the NBLAST and XBLAST programs of Altschul et al. (1990), J. Mol Biol. 215:402-410. BLAST nucleotide searches, are performed with the NBLAST program, score=100, wordlength'12. Gapped BLAST can be used as described in Altschul et al. (1997), Nucl. Acids Res. 25:3389-3402. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (NBLAST and XBLAST) are used. See NCBI/NIH website.

    [0084] To obtain gapped alignments for comparison purposes, the AlignX function of Vector NTI Suite 8 (InforMax, Inc., North Bethesda, Md., U.S.A:), can be used employing the default parameters. Typically these would be a Gap opening penalty of 15, a Gap extension penalty of 6.66, and a Gap separation penalty range of 8. Two or more sequences can be aligned and compared in this manner or using other techniques that are well-known in the art. By analyzing such alignments, relatively conserved and non-conserved areas of the subject polypeptides can be identified. This can be useful for, for example, assessing whether changing a polypeptide sequence by modifying or substituting one or more amino acid residues can be expected to be tolerated.

    [0085] The amino acid homology/similarity/identity will typically (but not necessarily) be highest in regions of the protein that account for its activity or that are involved in the determination of three-dimensional configurations that are ultimately responsible for the activity. In this regard, certain amino acid substitutions are acceptable and can be expected to be tolerated. For example, these substitutions can be in regions of the protein that are not critical to activity. Analyzing the crystal structure of a protein, and software-based protein structure modeling, can be used to identify regions of a protein that can be modified (using site-directed mutagenesis, shuffling, etc.) to actually change the properties and/or increase the functionality of the protein.

    [0086] Various properties and three-dimensional features of the protein can also be changed without adversely affecting the activity/functionality of the protein. Conservative amino acid substitutions can be expected to be tolerated/to not adversely affect the three-dimensional configuration of the molecule. Amino acids can be placed in the following classes: non-polar, uncharged polar, basic, and acidic. Conservative substitutions whereby an amino acid of one class is replaced with another amino acid of the same type fall within the scope of the subj ect invention so long as the substitution is not adverse to the biological activity of the compound. The following list provides examples of amino acids belonging to each class.

    TABLE-US-00001 Class of Amino Acid Examples of Amino Acids Nonpolar Ala, Val, Leu, Ile, Pro, Met, Phe, Trp Uncharged Polar Gly, Ser, Thr, Cys, Tyr, Asn, Gln Acidic Asp, Glu Basic Lys, Arg, His

    [0087] In some instances, non-conservative substitutions can also be made. The critical factor is that these substitutions must not significantly detract from the functional/biological/enzymatic activity of the protein.

    [0088] To obtain high expression of heterologous genes in plants, for example, it may be preferred to reengineer said genes so that they are more efficiently expressed in plant cells. Sequences can be designed for optimized expression in plants, generally, or they can be desigened for optimized expression in a specific type of plant Canola is one such plant where it may be preferred to re-design the heterologous gene(s) prior to transformation to increase the expression level thereof in said plant. Therefore, an additional step in the design of genes encoding a fungal protein, for example, is reengineering of a heterologous gene for optimal expression in a different type of organism. Guidance regarding theproduction of synthetic genes that are optimized for plant expression can be found in, for example, U.S. Pat. No. 5,380,831. A sequence optimized for expression in plants is exemplified herein as SEQ ID NO:1 (which encodes the exemplified protein, as shown in SEQ ID NO:5).

    [0089] As used herein, reference to isolated polynucleotides and/or proteins, and purified proteins refers to these molecules when they are not associated with the other molecules with which they would be found in nature. Thus, reference to isolated and/or purified signifies the involvement of the hand of man as described herein. For example a fungal polynucleotide (or gene) of the subject invention put into a plant for expression is an isolated polynucleotide. Likewise, a protein of the subject invention when produced by a plant is an isolated protein.

    [0090] A recombinant molecule refers to a molecule that has been recombined. When made in reference to a nucleic acid molecule, the term refers to a molecule that is comprised of nucleic acid sequences that are joined together by means of molecular biological techniques. The term recombinant when made in reference to a protein or a polypeptide refers to a protein molecule that is produced using one or more recombinant nucleic acid molecules.

    [0091] The term heterologous when made in reference to a nucleic acid sequence refers to a nucleotide sequence that is ligated to, or is manipulated to become ligated to, a nucleic acid sequence to which it is not joined in nature, or to which it is joined at a different location in nature. The term heterologous therefore indicates that the nucleic acid molecule has been manipulated using genetic engineering, i.e. by human intervention. Thus, a gene of the subject invention can be operably linked to a heterologous promoter (or a transcriptional regulatory region which means a nucleotide sequence capable of mediating or modulating transcription of a nucleotide sequence of interest, when the transcriptional regulatory region is operably linked to the sequence of interest). Preferred heterologous promoters can be plant promoters. A promoter and/or a transcriptional regulatory region and a sequence of interest are operably linked when the sequences are functionally connected so as to permit transcription of the sequence of interest to be mediated or modulated by the transcriptional regulatory region. In some embodiments, to be operably linked, a transcriptional regulatory region may be located on the same strand as the sequence of interest. The transcriptional regulatory region may in some embodiments be located 5 of the sequence of interest. In such embo diments, the transcriptional regulatory rejgion may be directly 5 of the sequence of interest or there may be intervening sequences between these regions. The operable linkage of the transcriptional regulatory region and the sequence of interest may require appropriate molecules (such as transgenic activator proteins) to be bound to the transcriptional regulatory region, the invention therefore encompasses embodiments in which such molecules are provided, either in vitro or in vivo.

    [0092] There are a number of methods for obtaining the proteins for use according to the subject invention. For example, antibodies to the proteins disclosed herein can be used to identify and isolate other proteins from a mixture. Specifically, antibodies maybe raised to the portions of the proteins that are most constant and most distinct from other proteins. These antibodies can then be Used to specifically identify equivalent proteins with the characteristic activity by . immunoprecipitation, enzyme linked immunosorbent assay (ELISA), or immuno-blotting. Antibodies to the proteins disclosed herein, or to equivalent proteins, or to fragments of these proteins, can be readily prepared using standard procedures. Such antibodies are an aspect ofthe subject invention.

    [0093] A protein from or obtainable from any of the subj ect isolates referred to or suggested herein means that the protein (or a similar protein) can be obtained from the exemplified isolate or some other source, such as another fungal or bacterial strain, or a plant (for example, a plant engineered to produce the protein). Derived from also has this connotation, and includes polynucleotides (and proteins) obtainable from a given type of fungus or bacterium, for example, wherein the polynucleotide is modified for expression in a plant, for example. One skilled in the art will readily recognize that, given the disclosure of a fungal gene and protein, a plant can be engineered to produce the protein. Antibody preparations, nucleic acid probes (DNA and RNA, for example), and the like may be prepared using the polynucleotide and/or amino acid sequences disclosed herein and used to screen and recover other protein genes from other (natural) sources.

    [0094] Oils of the subject invention retain a high degree of oxidative stability but contain lower levels of saturated fatty acids and higher levels of unsaturated fatty acids. Preferred oils of the subject invention have less than 3.5% total saturated fatty acid content, oleic content of at least 75% (and preferably and surprisingly less than 80%), and a poly unsaturated fatty acid content of less than 20% (and more preferably less than 15%, still more preferably less than 10%, and even more preferably less than 9%). The subject invention can also be used to achieve canola seed having total saturated fatty acid content (C:14, C:16, C:18, C:20, C:22, and C:24) of not more than (and preferably less than) 2.5% of the total fatty acid content, preferably with the oleic acid ranges as mentioned above). 18:2 and 18:3 levels, which contribute to oil instability, are not increased or are preferably reduced (for food applications). End points for ranges for any of these particular fatty acids, any combinations thereof, and particularly for either one or both of the C18 polyunsaturates, can be obtained from any of the FIGS. and Tables provided herein. The subject invention can be used to provide agronomically elite canola seed that results in a refined/deodorized oil with less than 3.5% total saturates. Oil derived from these plants can be used to formulate various end products, or they can be used as stand-alone frying oil for no sat (or low sat) products.

    [0095] Unless indicated otherwise, the saturated fatty acid content of a given collection of canola seeds can be determined by standard procedures wherein the oil is removed from the seeds by crushing the seeds and is extracted as fatty acid methyl esters following reaction with methanol and sodium hydroxide. The resulting ester is then analyzed for fatty acid content by gas liquid chromatography using a capillary column which allows separation on the basis of the degree of unsaturation and chain length. This analysis procedure is described in, for example, J. K. Daun et al., J. Amer. Oil Chem. Soc. 60: 1751-1754 (1983).

    [0096] The fatty acid composition of canola seed was determined as described below for either half-seed analysis, single/whole seed analysis, or bulk seed analyses. For half-seed analyses, a portion of cotyledonary tissue from the embryo was removed and analyzed; the remaining seed was then saved, and could be germinated if desired. Although the half-seed technique can be somewhat unreliable in selecting stable genetically controlled fatty acid mutations (and subsequent breeding and crosses), the subject invention demonstrates that preferred genes can be introduced and used to create stable lines. Unlike uncharacterized mutations, it is well known in the art that a gene can be introduced and stably maintained in plants. Thus, the analysis set forth herein demonstrates the utility of the subject genes and that canola oil having the indicated characteristics can be attained. No saturates (i.e., No Sat) levels of fatty acids were reached in seeds from transgenic lines derived from commercial Nexera 710 (canola) germplasm. The No Sat level is defined as less than 3.5% combined saturates. In addition, reduced saturates were seen in both the Westar canola line, and another Crucifer (Arabidopsis) with the same transformation construct. Notably, saturate levels in single seeds were down to 2.6 to 2.7% for some seeds. The subject invention can also beused to produce seeds with 2.5% or less total saturates. This is important because oil processing can add 0.5-1% to the total saturate score, meaning that the processed oil product can still measurably reach the FDA-defined No Sat level using standard testing procedures. Having this level of tolerance not only permits for some levels of contamination (by higher saturate seeds) of testing equipment (especially if the plant operator does a poor job of keeping seed batches distinct), but also permits for some level of variation in field growth conditions (such as high temperatures, which tend to create more saturates) and cross-pollination by pollen drifting from unimproved canola in adjacent fields (which dilutes desirable genes).

    [0097] The U.S. Food and Drug Administration defines saturated fat as A statement of the number of grams of saturated fat in a serving defined as the sum of all fatty acids containing no double bonds. 21 CFR 101.9(c)(2)(i). Unless otherwise specified, this is the definition used herein for total saturates and total saturated fat. A serving of a food product is considered to have no saturated fat if the product contain[s] less than 0.5 gram of total fat in a serving. 21 CFR 101.9(c)(2)(i). Total fat is defined as A statement of the number of grams of total fact in a serving defined as total lipid fatty acids and expressed as triglycerides. 21 CFR 101.9(c)(2)(i). Serving sizes for various types of foods are defined in 21 CFR 101.12(b), which defines a serving of oil as 1 tablespoon or 15 ml. As used herein, this is understood to mean 14 grams. Thus, no sat canola oil (or canola oil comprising no saturated fat) is defined herein as canola oil having less than 0.5 grams of total saturated fat in a serving (14 grams of canola oil comprising 14 grams of fat). Stated another way, no sat canola oil comprises less than 3.57% total saturates (0.5 grams of total saturates divided by 14 grams of total fat). Unless specified otherwise, all percent fatty acids herein are percent by weight of the oil of which the fatty acid is a component.

    [0098] As shown herein, the subject invention can surprisingly be used to obtain oil from canola seeds wherein said oil comprises less than 3.57% total saturates. Oil can be obtained from the subject seeds using procedures that are well-known in the art, as mentioned in the preceding paragraphs, and the oil can be assayed for content using well-known techniques, including the techniques exemplified herein. Unless otherwise specified, analysis that was used to generate half-seed oils data and field oils data used a base-catalyzed transesterification reaction (AOCS Ce 2-66, alternative method). The protocol is similar to the saponification/acid esterification protocol described herein, except the saponification/acid esterification protocol measure total lipids, of which the majority are the same fatty acids fromtriacylglycerides detected by the base-catalyzed transesterification reaction.

    [0099] In the commercial Nexera 710 germplasm, levels of 18:3 fatty acids, those that contribute to oxidative instability, were relatively unchanged. Thus, the subject invention not only provides plants, seeds, and oils with lower saturated fat, but also plants, seeds, and oils that very surprisingly maintain other beneficial characteristics. That is the plants and genes of the subject invention can surprisingly be used without adversely affecting other advantageous characteristics of the plants.

    [0100] In preferred embodiments, the subject invention provides plants comprising more than one expressed copy of a delta-9 desaturase gene of the subject invention. Results presented herein show that expressing multiple copies of this gene surprisingly improved the fatty acid profile of canola plants (saturated fat levels were greatly reduced). This is surprising in part because the art was heretofore unpredictable regarding the expression of multiple copies ofthe same gene. Gene silencing is one known phenomenon that teaches against using multiple copies (inserted at different locations in the genome, for example) of a heterologous gene. It is also not ideal to attempt to obtain multiple transformation events. Thus, there was no motivation to produce plants comprising more than one (two, three, four, and the like) delta-9 desaturase event. There was also no expectation that such plants would actually have improved characteristics.

    [0101] Two examples of Cruciferous plants are specifically exemplified herein: Brassica napus (canola) and Arabidopsis. However, as is known in the art, other Brassica species and other Crucifers can be used for, for example, breeding and developing desired traits in canola and the like. Other such plants that can thus be used according to the subject invention include Brassica rapci, Brassica juncea, Brassica carinata, Brassica nigra, Brassica oleracea, Raphanus sativus, and Sinapis alba. Soybeans, soybean plants, and soybean oil can also.be tested for improvement according to the subject invention.

    [0102] In preferred embodiments, delta-9 desaturase genes ofthe subject invention are optimized for plant expression. Thus, the subject invention also provides a plant-optimized delta-9 desaturase gene. Optimization exemplified herein included introducing preferred codons and a Kozak translational initiator region, and removing unwanted sequences. The gene was driven by the beta-phaseolin promoter (a strong dicot seed storage protein promoter).

    [0103] Promoters for which expression coincides with oil synthesis (e.g. ACP, elongase) can be used to further reduce saturates, as expression occurs earlier than for storage proteins. (Prior tobacco constructs used the nos 3 UTR, and prior corn constructs used the constitutive maize Ubiquitin-1 promoter and nos 3 UTR.) Other dicot seed promoters can be used according to the subject invention, including vicilin, lectin, cruciferin, glycinin, and conglycinin promoters, plant seed promoters disclosed in US20030005485 A1, elongase promoters in US20030159173 A1, and the ACP promoter in U.S. Pat. No. 5,767,363. See also, for example, U.S. Pat. No. 6,100,450A (seed specific, expesses in embryo, column 8 line 8); US20030159173A1 (section 0044 seed specific promoter; examples are USP, hordein, ACP, napin, FatB3, and FatB4); WO9218634A1 (introduction discusses seed-specific promoters from other patents pages 1through 7; WO0116340A1 (page 7 line 13 provides a definition of a seed specific promoter, which typically expresses at less than 5% in other tissues; page 10 lines 19-29 discusses seed storage proteins like albumins, globulins, vicilin and legumin-like proteins, non-storage oleosins, promoters associated with fatty acid metabolism like ACP, saturases, desaturases, elongases); WO2003014347A2 (promoter definition p23-25: preferably 2 greater for seed-specific); US20030233677A1 (section 0033 provides seed promoter examples [napin, ACCase, 2S albumin, phaseolin, oleosin, zein, glutelin, starch synthase, starch branching enzyme]); WO2003092361A2 (page 15 provides a definition for promoter; the top of page 17 provides promoter examples and patent references (storage proteins only) including zeins, 7S storage proteins, Brazil nut protein, phe-free protein, albumin, beta-conglycinin, 11S, alpha-hordothionin, arcelin, lectins, glutenin); US20030148300 A1(see Claim 8, including the napin promoter, the phaseolin promoter, the soybean trypsin inhibitor promoter, the ACP prompter, stearoyl-ACP desaturase promoter, the soy 7S promoter, the oleosin promoter, the conglycinin promoter, oleosin promoters, embryogenesis-abundant protein promoters, embryo globulin promoters, arcelin 5, the napin promoter, and the acid chitinase promoter); U.S. Pat. No. 5,777,201 (column 6, lines 30-50, constitutive promoters, seed- and/or developmentally regulated promoters e.g. plant fatty acid lipid biosynthesis genes [ACPs, acyltransferases, desaturases, lipid transfer proteins] or seed promoters [napin, cruciferin, conglycinin, lectins] or inducible promoters [light, heat, wound inducers]).

    [0104] The plastids of higher plants are an attractive target for genetic engineering. Chloroplast (a type of plastid) transformation has been achieved and is advantageous. See e.g. U.S. Pat. Nos. 5,932,479; 6,004,782; and 6,642,053. See also U.S. Pat. Nos. 5,693,507 and 6,680,426. Advantages of transformation of the chloroplast genome include: potential environmental safety because transformed.chloroplasts are only maternally inherited and thus are not transmitted by pollen out crossing to other plants; the possibility of achieving high copy number of foreign genes; and reduction in plant energy costs because importation of proteins into chloroplasts, which is highly energy dependent, is reduced.

    [0105] Plant plastids (chloroplasts, amyloplasts, elaioplasts, etioplasts; chromoplasts, etc.) are the major biosynthetic centers that, in addition to. photosynthesis, are responsible for producing many industrially important compounds such as amino acids, complex carbohydrates, fatty acids, and pigments. Plastids are derived from a common precursor known as aproplastid; thus, theplastids in a given plant species all have the same genetic content.

    [0106] Plastids of most plants are maternally inherited. Consequently, unlike heterologous genes expressed in the nucleus, heterologous genes expressed in plastids are not disseminated in pollen. Therefore, a trait introduced into a plant plastid will not be transmitted to wild-type relatives. This offers an advantage for genetic engineering of plants for tolerance or resistance to natural or chemical conditions, such as herbicide tolerance, as these traits will not be transmitted to wild-type relatives.

    [0107] The plastid genome (plastome) of higher plants is a circular double-stranded DNA molecule of 120-160 kb which may be present in 1,900-50,000 copies per leaf cell (Palmer, 1991). In general, plant cells contain 500-10,000 copies of a small 120-160 kilobase circular genome, each molecule of which has a large (approximately 25 kb) inverted repeat. Thus, it is possible to engineer plant cells to contain up to 20,000 copies of a particular gene of interest; this, can potentially result in very high levels of foreign gene expression.

    [0108] Oils of the subject invention are applicable for, and can be specially tailored for;, industrial as well as various food uses. Aside: from cooking oil, itself the subject invention also includes no sat products such as potato chips and the like (see U.S. Pat. No. 6,689,409, which claims a filed food composition comprising potatoes and a canola oil; the subject invention, however, can be used to improve the compositions described in the '409 patent).

    [0109] Plants of the subject invention can be crossed with other plants to achieve various desirable combinations of characteristics and traits. Even further improvements can be made by crossing the subject plants, using known;breeding technique and other advantageous sources of germplasm such as other canola lines having additional or other beneficial traits and characteristics. Another example would be crosses with a line having a plastidial delta-9 desaturase.

    [0110] Thus, the subject invention can be used to achieve less than 3.5% total saturated fatty acids in commercial oil under variable environmental conditions (and less than 3% total saturated fatty acids in seed oil in breeder seed). This can be accomplished with no reduction in the quality and quantity of storage proteins, with no increase in indigestible fiber in canola meal, and no negative impact on seed yield (or other desirable agronomic traits) per acre.

    [0111] Following is a list of the common names of fatty acids, as used herein, together with their number of carbon atoms and double bonds. Saturated fats have zero double bonds.

    TABLE-US-00002 TABLE 1 Number of Number of Carbon Atoms Double Bonds Name Per Molecule Per Molecule Lauric 12 0 Myristic 14 0 Palmitic 16 0 Palmitoleic 16 1 Stearic 18 0 Oleic* 18 1 Vaccenic** 18 1 Linoleic 18 2 Alpha-Linolenic 18 3 Arachidonic 20 0 Eicosenoic (or 20 1 Arachidic) Behenic 22 0 Erucic 22 1 Lignoceric 24 0 Nervonic 24 1 *= double bond at delta-9 position **= double bond at delta-11 position

    [0112] All patents, patent applications, provisional applications, and publications referred to or cited herein are incorporated by reference in their entirety to the. extent they are not inconsistent with the explicit teachings of this specification.

    [0113] Unless specifically indicated or implied, the terms a, an, and the signify at least one as used herein.

    [0114] Following are examples that illustrate procedures for practicing the invention. These examples should not be construed as limiting. All percentages are by weight and all solvent mixture proportions are by volume unless otherwise noted.

    [0115] Example 1Delta-9 desaturase gene rebuilding

    [0116] A delta-9 desaturase gene of the subject invention was redesigned for plant expression through a combination of changingAspergillus iidulans sequence to plant-preferred translational codons, introducing unique restriction enzyme sites, and removing unwanted sequences and some secondary structure. The redesigned gene was synthesized by Operon, Inc. The sequence of the open reading frame for this polynucleotide is provided here as SEQ ID NO:1. The sequence of the ORF preceded by a Kozak sequence and a BamHI cloning site (caps), plus a translational terminator at the end of the ORF (caps), is provided in SEQID NO:2.

    [0117] Example 2Delta-9 desaturase plant transformation vector construction

    [0118] The BamHI-BstEII gene fragment was cloned into a vector between the Pv beta-phaseolin prompter and Pv beta-phaseolin 3 UTR (pPhas-UTR). This construct was named pOIL. The promoter-gene-UTR fragment was excised from pOIL by digestion with NotI, blunted, and cloned into the blunt Pmel site of vector pOEA1. The final vector was named pPD9-OEA1.

    [0119] Example 3Plant transformation with pPD9-OEA1

    [0120] Plasmid vector pPD9-OEA1 was, transformed into Agrobacterium tumefaciens [strain C58GV3101 (C58C1RifR) pMP90 (GmR). Koncz and Schell, Mol. Gen. Genet (1986)]. The delta 9-desaturase plants were then obtained by Agrobacterium tumefaciens mediated plant transformation

    [0121] Arabidopsis was transformed with the dip method, a procedure well known in the art. Plants were selfed, and dried seed was collected for FAME (fatty acid methyl ester) analysis.

    [0122] The protocol used for canola transformation was as described by Katavic [Katavic, Campbell, L., Friesen, L., Palmer, D., Keller, W., and Taylor, D. C. (1996), Agrobacterium-mediated genetic transformation of selected high erucic acid B. napus cultivars, 4.sup.th Canadian Plant Tissue Culture and Genetic Engineerijig Conference, Saskatoon, SK, June 1-4, 1996], with modifications for DAS's Nexera line. Hypocotyl sections were isolated from 6-day-old seedlings of B. napus, cv Westar or Nexera 710 and were cultured on callus initiation medium prior to transformation. On the day of transformation, the hypocotyls were coincubated with an Agrobacterium culture containing the plasrnid pPD9-OEA1 with the trait gene such that a fragment of plasmid DNA including the delta 9-desaturase gene was, incorporated into the cell chromosome. After a co-cultivation period, the hypocotyls were transferred to callus initiation medium containing glufosinate ammonium as the selection agent. Healthy, resistant callus tissue was obtained and repeatedly transferred to fresh selection medium for approximately 12 to 16 weeks. Plants were regenerated and transferred to Convirons growth chambers. Plants were selfed to obtain seed. If transgenic plants were sterile, they were crossed with, pollen from unmodified Nexera 710 lines. Dry seed was harvested for FAME analysis.

    [0123] Example 4Canola Event Sorting Process, and Summary of Canola Results

    [0124] Unless otherwise specified, the following procedures were used to obtain the Nex 710/Delta-9 canola seeds, the data for which is presented in subsequent Examples.

    [0125] In general, there were four main steps for developing, selecting, or sorting events: sorting initial transgenic events, sorting T1 and T2 seed, sorting T1 or T2 plants, and sorting events by field performance. Transformed callus was first regenerated to T0 plants. For the initial sorting, 107 putative transgenics were screened by agronomics and by southern blotting (simple or complex, i.e., more than 3 copies). Multiple seeds per event were screened. T1 seed saturates were determined, C16:1/C16:0 ratios were determined (to infer catalytic efficiency), and segregation of biochemical phenotypes were determined. Based on these data, and seed availability (timing, amount), a limited subset of seed was advanced.

    [0126] For sorting T1 and T2 seed (a few events were advanced by one generation), half-seed analysis was conducted, and possible homozygotes were identified. Based on this data, half-seeds from segregating populations were selected for greenhouse growth.

    [0127] The next main step was sorting T1 or T2 plants (a few events were advanced one generation). Southerns were conducted to determine transgene integration complexity. Zygosity was also determined by INVADER assays (Third Wave Technologies, Inc.). These data Were used to select seed for field trials.

    [0128] For T1 greenhouse studies, 30 seeds per event were subj ected to half-seed analysis. Nex 710 canola was used as a commercial check. All individuals within the event were zygosity sampled to determine allele copy number for Delta-9 and PAT. This was followed by PCR and indoleacetamide hydrolase (IAAH; a negative scoreable or screenable marker) analysis. All individuals within the event were leaf painted to determine the PAT segregation ratio. Southern analysis Was then conducted on those individuals approaching a no sat profile, positive IAAH, and homozygous for PAT and Delta-9.

    [0129] These were then used for T2 analysis (100 seeds from each of the above plants were half-seed analyzed). INVADER was used to verify copy number and to see if the event Was segregating for D9 and PAT. Leaf painting was used to see if lines are segregating for PAT. 10 seed bulk fatty acid data was collected from plants based on half-seed data, INVADER results, LP, and IAAH-positive.

    [0130] The fourth main step was sorting events by field performance (plant T2 or T3 seed, analyze T2 or T3 plants, then T3 or T4 seed). There was a wide sampling of transgenic events. Agronomics, Southerns, and zygosity were analyzed. Batch seed oils analysis was also conducted. Based on these data, events were selected for crossing to increase gene dosage.

    [0131] The following selection criteria was used to advance lines to field studies: 224 lines (including nulls) from 23 events (6 reps/entry) were evaluated in replicated nurseries at 3 locations. 6 T3 and 17 T2 events were planted. Selection of lines/event going to field was based on insert number and half-seed analysis followed by a 10-seed bulk fatty acid analysis of seed from each plant The percent total sat range, of selected lines was in the approximate range of 3.3-4.5%. The following T3 events were selected for further development:

    TABLE-US-00003 TABLE 2A Event Copy Number # of Lines Field Tested 218-11.30 2 D9:2 PAT 45 36-11.19 2 D9:2 PAT 7 31a-3.30.01 1 D9:1 PAT 15 146-11.19 3 D9:1 + partial PAT 23 159a-11.19 2 D9:2 PAT 19 69-11.19 2 D9:2 PAT 20

    TABLE-US-00004 TABLE 2B Event Copy Number # of Lines Field Tested 146-11.19 nd (Not determined) 6 149-11:30 nd 8 15-11.19 nd 4 224-11.30 3 D9:2.5 PAT 10 226-11.30 nd 4 230-11.30 nd 2 250-11.19 nd 5 267-11.19 nd 5 284-11.19 nd 8 309-11.30 nd 2 32-11.30 nd 3 324-11.30 nd 8 43-11.19 nd 5 43b-11.30 2 D9:2 PAT 10 57-11.30 nd 5 68-11.30 2 D9:2 PAT 8 96a-6.15 nd 2

    [0132] Field tests were conducted as follows. Agronomic assessments were taken as discussedin a subsequent example to confirm that no agronomic penalty was associated with the Delta-9 (D9). 15 INVADER leaf tissue samples were collected from 28 of the most promising T3 lines (plus sib-nulls) for further copy number verification andtodetermine if lines were segregating for PAT. The D9 lines were chosen based on having less than 3.5% total saturates.

    [0133] 10 Southern tissue samples were taken from the 3 most promising T2 lines, which were chosen based on having less than 3.5% total saturates. All tissue-sampled plants were self-pollinated. Fatty acid analysis was determined based on 10 seed bulk from selfed plants (455 samples), and 1 gram of bulk seed sample from OP rows (1445).

    [0134] The best T4 events are as follows:

    TABLE-US-00005 TABLE 3A Event Copy Number # of Lines Field Tested 218-11.30 2 D9:2 PAT 9 36-11.19 2 D9:2 PAT 2 146-11.19 3 D9:1 + partital PAT 4 159a-11.19 2 D9:1 PAT 1 69-11.19 2 D9:2 PAT 3

    [0135] The best events are as follows:

    TABLE-US-00006 TABLE 3B Event Copy Number # of Lines Field Tested 149-11.30 nd (not determined) 3 43b-11.30 2 D9:2 PAT 1 57-11.30 nd 2 284-11.19 nd 2

    [0136] Generally, no major agronomic penalty associated with Delta-9 was observed, and some lines exhibited an approximately 10% increase in seed weight. Agronomic results are discussed in more detail below in Example 18. General observations regarding distributions of individual fatty acid components are discussed below in Examples 11-13. Summaries of mean TSAT data, % changes in TSATs, and % changes for certain fatty acid components for events 218-11.30, 36-11.19, and 69-11.19 are presented in Tables 4-7. Generally, 30% to 40% reductions in TSATs were observed, relative to the sib-null and wild type. However, even further improvements are discussed in more detail below and can be made with further crosses, for example.

    TABLE-US-00007 TABLE 4 Mean TSAT For All Lines from Event 218-11.30 Across 3 Sites C16:0 C16:1 C18:0 C18:1 C18:2 C18:3 % Total Event N % Total % Total % Total % Total % Total % Total Saturates Selfs Null 94 3.75 0.38 1.67 76.57 11.65 2.50 6.62 #218-11.30 217 3.10 1.40 0.68 79.11 10.89 2.29 4.37 % Wt 86% 385% 38% 101% 105% 98% 66% % Null 83% 365% 40% 103% 93% 92% 66% Open Null 3 3.70 0.47 1.65 78.07 10.65 2.40 6.45 Pollinated Wt Control 88 3.60 0.36 1.79 78.19 10.37 2.34 6.60 #218-11.30 123 3.07 1.23 0.74 80.17 10.15 2.22 4.42 % Wt 85% 338% 41% 103% 98% 95% 67% % Null 83% 263% 45% 103% 95% 92% 68%

    TABLE-US-00008 TABLE 5 % Changes in TSATS in C16:0, C16:1, C18:0 And C18:1 VS Nulls and WT Control Nex 710 % TSAT vs % C16:0 % C16:1 % C18:0 Event Line C16:0 C16:1 C18:0 C18:1 TSAT Null WT Vs N Vs N Vs N 218-11.30(TS) 1361 2.87 1.31 0.64 80.23 4.04 39 37 22 317 61 218-11.30(TS) 1319 2.88 1.41 0.62 79.53 4.09 38 37 20 248 62 218-11.30(TS) 1304 2.95 1.33 0.60 79.16 4.10 38 36 18 230 63 218-11.30(TS) 1500 2.95 1.31 0.63 79.58 4.11 38 36 18 224 61 218-11.30(TS) 1405 3.04 1.40 0.60 80.44 4.17 37 35 16 245 63 218-11.30(TS) 1370 3.02 1.38 0.66 80.24 4.24 36 34 17 240 59 218-11.30(TS) 1369 3.03 1.30 0.65 79.44 4.25 36 34 16 220 59 218-11.30(T) 1370 2.96 1.20 0.77 80.28 4.31 31 33 18 196 56 218-11.30(T) 1405 3.01 1.19 0.71 78.65 4.31 31 33 17 193 56 218-11.30(N) 1299 3.62 0.41 1.61 78.10 6.26 218-11.30(NS) 1299 3.70 0.32 1.65 77.56 6.52 Nex 710 3.58 0.35 1.75 77.87 6.45

    TABLE-US-00009 TABLE 6 % Changes in TSATS in C16:0, C16:1, C18:0 And C18:1 VS Nulls and WT Control Nex 710 % TSAT vs % C16:0 % C16:1 % C18:0 Event Line C16:0 C16:1 C18:0 C18:1 TSAT WT Vs N Vs N Vs N 36-11.19(T) 1099 2.93 1.23 0.77 78.85 4.30 32 33 16 322 55 36-11.19(N) 1127 3.49 0.29 1.70 77.14 6.36 Nex 710 3.58 0.35 1.75 77.87 6.45

    TABLE-US-00010 TABLE 7 % Changes in TSATS in C16:0, C16:1, C18:0 And C18:1 VS Nulls and WT Control Nex 710 % TSAT vs % C16:0 % C16:1 % C18:0 Event Line C16:0 C16:1 C18:0 C18:1 TSAT WT Vs N Vs N Vs N 69-11.19(T) 1538 3.05 1.05 0.71 80.70 4.21 34 35 15 223 59 69-11.19(T) 1529 3.02 1.02 0.72 80.61 4.24 33 34 16 213 58 69-11.19(T) 1534 3.09 1.02 0.73 80.45 4.29 32 34 14 213 57 69-11.19(N) 1604 3.58 0.33 1.72 78.45 6.34 Nex 710 3.58 0.35 1.75 77.87 6.45

    [0137] Example 5Molecular characterization of plants

    [0138] Leaf samples were taken for DNA analysis to verify the presence of the transgenes by PGR and Southern analysis, and occasionally to confirm expression of P AT protein by ELISA.

    [0139] 5A. Protocol for PGR analvsis for delta-9 desaturase. The following two primers were used:

    [0140] Delta-9 forward B:

    TABLE-US-00011 (SEQIDNO:3) 5 TGAGTTCATCTCGAGTTCATG3

    [0141] Delta-9 reverse B:

    TABLE-US-00012 (SEQIDNO:4) 5 GATCCAACAATGTCTGCTCC3

    [0142] This primer pair yields a 1380 bp fragment after amplifying the delta-9 gene.

    [0143] The following cycling protocol was used in this screen with an MJ Tetrad thermal cycler:

    [0144] 1. 94 C., 2 minutes

    [0145] 2. 94 C., 1 minutes

    [0146] 3. 50 C., 2 minutes

    [0147] 4. 72 C., 3 minutes, 5 seconds/cycle extension

    [0148] 5. repeat Steps 2-4 25 times

    [0149] 6. 4 C. until ready for analysis, or at least 2 minutes

    [0150] 5B. Protocol for the extraction of plant genomic DNA for Southern analysis. The DNeasy Plant Maxi Kit from Qiagen was used. The protocol in the booklet was used with the following changes to the elutionpart Buffer AE was diluted 1:10 withDNA grade water (Fisher No. BP561-1). Two elutions were performed using 0.75 ml of the diluted AE buffer pre-warmed to 65 C. DNA was precipitated with isopropanol and washed with 70% ethanol. The DNA pellet was resuspended in 100 l of IX TE buffer. DNA concentration was quantitated. 6 g of DNA was aliquoted and adjusted to a final volume of 40 l. Samples were stored at 20 C.

    [0151] 5C. FAME analysis (Direct FAME Synthesis from Seeds with Methanolic H.sub.2SO.sub.4)

    [0152] The protocol for FAME analysis was as follows.

    [0153] GC Specs

    [0154] Gas Chromatograph: Hewlett-Packard 6890 with dual injection ports and dual flame ionization detectors.

    [0155] Data System: HP Chemstation, Leap Technologies, Carrboro, N.C. 27510, PAL System.

    [0156] Column: J&W capillary column, DB-23, 60 M0.25 mm i.d. with 0.15 microfilm thickness, maximum operating temperature 250 C. Catalog number: 122-2361.

    [0157] Temperature profile: Equilibration time: 1minute. Initial temperature: 50 C. Initial time: 3minutes. Increase rate: 40 C./minute. Final temperature: 240 C. Final time: 7.25 minute.

    [0158] FAME procedures for Arabidopsis. Add 100 l (50 g) 15:0 Standard into a clean 16125 mm glass tube (Internal Standard stock solution: 500 g/ml of C15:0 TAG in 2:1 chloroform:isopropanol). Dry Standard under nitrogen in evaporation water bath at 55 C.

    [0159] When dry add 2 ml 1N methanolic H.sub.2SO.sub.4 with 2% DMP (for 100 ml: 95.22 ml methanol, 2.772 ml H.sub.2SO.sub.4,2 ml DMP=2,2-dimethoxypropane). Heat tube to 85 C.

    [0160] Weigh 5 mg Arabidopsis seeds into clean 16125 mm glass tube and record exact weight.

    [0161] To destroy lipases, add hot meth. H.sub.2SO.sub.4 with Standard to tube with seeds, incubate for 15 minutes at 85 C.

    [0162] Cool vial down to 50 C., then crush seeds with glass pestle in mini grinder.

    [0163] Transfer sample back into tube and incubate for at least one hour under nitrogen at 85 C. Cool vial on ice. Add first 0.5 ml 0.9% NaCl, then 250 l 17:0 Standard in hexane (0.1335 mg/ml methyl ester stock solution). Vortex, centrifuge at 1000 g for 5 minutes.

    [0164] Transfer 100-200 l with Pasteur pipette into 1.5 ml vial with conical insert (0.5 ml).

    [0165] Inject 5 l into GC.

    [0166] FAME procedures for Canola. Add 100 l (50 g) 15:0 Standard into a clean 16125 mm glass tube (Internal Standard stock solution: 500 g/ml of C15:0 TAG in 2:1 chloroform:isopropanol). Dry Standard under nitrogen in evaporation water bath at 55 C.

    [0167] When dry add 2 ml 1N methanolic H.sub.2SO.sub.4 with 2% DMP (for 100 ml: 95.22 ml methanol, 2.772 ml H.sub.2SO.sub.4, 2 ml DMP2,2-dimethoxypropane). Heat tube to 85 C.

    [0168] Weigh one canola seed in clean tube and record exact weight.

    [0169] To destroy lipases, add seed sample to tube containing Standard with hot methanol H.sub.2SO.sub.4, incubate for 15 minutes at 85 C.

    [0170] Cool vials down to 50 C., then crush seeds with glass pestle.

    [0171] Incubate for at least 1 hour under N2 at 85 C.

    [0172] Cool vial on ice. Add first 0.5 ml 0.9% NaCl, then 250 l 17:0 Standard in hexane (0.1335 mg/ml methyl ester stock solution). Vortex, centrifuge at 1000 g for 5 minutes.

    [0173] Transfer 100-200 l with Pasteur pipette into 1.5 ml vial with conical insert (0.5 ml).

    [0174] Inject 5 l into GC.

    [0175] Example 6Arabidopsis Results

    [0176] Initial results are illustrated in FIG. 1, showing that a greater than 60% reduction of saturated fatty acids was achieved. Also, more 16:1 (5.9% for example) than 16:0 (4.4%) was achieved.

    [0177] No Sat Oil via 9-CoA-Desaturase Approach

    [0178] FAME analysis

    [0179] T2 seeds from approximately 18 additional transformants were analyzed. This data (see Table 8 and FIG. 2) show a reduction in sats of up to 60-70%. This is an even stronger reduction in saturated fatty acids than the initial data (see FIG. 1) indicated. It is important to note that the T2 generation is still segregating; thus, even better performing lines in following generations are expected. This point is true for all T1, T2, T3, and other initial generations (including canola lines) as reported elsewhere herein, until the trait is fixed and the line is homozygous for the transgene. (Stable lines and plants where the traits are fixed were produced and are described in subsequent Examples.)

    TABLE-US-00013 TABLE 8 16:0 16:1 18:0 18:1 18:2 18:3 20:0 20:1? ? ? ? 22:0 22:1 24:0 Tot Sats WT1 7.8 0.2 3.2 11.2 27.3 21.4 2.8 20.1 2.3 0.7 0.0 0.4 2.4 0.1 14.4 TF-21 7.2 0.3 3.3 14.4 27.9 18.0 2.5 21.4 2.1 0.5 0.0 0.4 2.0 0.0 13.3 WT1-3 7.2 0.2 3.0 12.1 26.5 21.9 2.6 20.8 2.3 0.7 0.0 0.4 2.3 0.0 13.2 WT1-2 6.9 0.2 2.9 13.7 27.5 20.9 2.5 20.2 2.1 0.6 0.0 0.4 2.2 0.0 12.7 TF-10 5.5 3.0 2.0 19.5 28.7 18.4 1.3 17.9 1.6 0.4 0.0 0.3 1.3 0.0 9.1 TF-18 6.1 1.9 1.4 18.0 29.0 19.0 0.9 19.6 1.9 0.5 0.0 0.2 1.5 0.0 8.7 TF-13 4.7 2.2 1.6 19.9 27.9 19.1 1.3 19.2 1.8 0.4 0.0 0.3 1.5 0.0 7.9 TF-22 4.6 2.6 1.6 20.2 27.9 18.6 1.3 19.4 1.7 0.4 0.0 0.3 1.5 0.0 7.8 TF-12 5.5 2.1 1.2 18.6 28.4 20.1 0.8 19.4 1.8 0.5 0.0 0.2 1.5 0.0 7.6 TF-17 3.4 1.1 1.9 19.5 27.5 17.3 1.8 22.8 2.0 0.5 0.0 0.5 1.8 0.0 7.5 TF-14 5.0 2.1 1.4 18.8 27.3 21.4 1.0 19.2 1.7 0.5 0.0 0.0 1.6 0.0 7.4 TF-8 3.2 0.9 1.6 19.0 25.3 18.7 1.8 24.7 2.0 0.5 0.0 0.0 2.2 0.0 6.6 TF-19 4.1 2.7 1.0 20.7 28.4 19.9 0.8 18.8 1.7 0.4 0.0 0.2 1.4 0.0 6.0 TF-20 4.4 2.8 0.6 20.2 28.8 19.7 0.5 19.3 1.7 0.4 0.0 0.1 1.4 0.0 5.7 TF-7 5.0 2.9 0.0 20.8 27.5 25.8 0.0 15.3 1.3 0.0 0.0 0.0 1.4 0.0 5.0 TF-6 3.4 1.6 0.7 22.4 27.9 17.9 0.7 21.4 1.9 0.4 0.0 0.0 1.7 0.0 4.8 TF-11 3.4 2.7 0.6 22.4 28.8 19.7 0.5 18.5 1.6 0.4 0.0 0.2 1.3 0.0 4.7 Values are from a single sample prep and GC run (not averages) TF-21 behaves as a wild-type (non-transformed) plant; possible explanation include gene silencing or non-transgenic escape (inadequate selection with glufosinate herbicide) ? indicates that identity of the peak on th GC chromatogram is quesstionable, or unknown

    [0180] Example 7Westar data

    [0181] Protocols similar to those described in Example 5C were applied to canola lines derived from well-known Westar canola. As illustrated in FIG. 3, the indicated saturated fats were reduced by over 43%, and a 50% reduction was achieved when 24:0 was included.

    [0182] Example 8Exemplary Nexera 710 data Protocols similar to those described elsewhere herein were applied to canola lines derived from well-known Nexera 710 commercially elite canola. Total saturates were calculated used methodology discussed herein and as specified below.

    [0183] Total saturates are derived from the sum of 16:0+18:0+20:0+22:0+24:0 fatty acids. Some notable saturate levels in single seeds are presented in Table 9. Oil profiles are presented as mol % values. The mol % value incorporates the formula weight of each specific fatty acid into the calculation. It uses the mass of a given fatty acid species (peak area, or the same value used to directly calculate % fatty acid), divided by the formula weight for that fatty acid species.

    TABLE-US-00014 TABLE 9 Seeds Saturate Level Event 5 11.19 seed #6 3.1% Event 5 11.19 #8 2.7% Event 113a 11.19 #4 3.4% Event 113a 11.19 #8 3.2% Event 147 11.19 #3 3.0% Event 147 11.19 #7 2.6% Event 36a 11.19 seed 2.7% Event (9)3 11.30 3.3%

    [0184] Profiles from the seeds with the lowest total saturates were analyzed (seeds 113a 11.19 #4, 113a 11.19 #8, 5 11.19 #6 and 5 11.19 #8). Unmodified Nexera 710 germplasm values came from the same FAME analysis run. Plants were grown in the Convirons growth chamber, so actual mol % values may differ from field grown seed. In general, transgenic plants show a reduction in 16:0, 18:0 and 20:0, and increases in 16:1, 18:0 levels generally fell from an average of 1.4% (upper 2.08%, lower 0.81%) in Nexera 710 to 0.1% average (upper 0.6%, lower 0%) in select transgenic material. Also, 16:0 levels fell from an average of 4.6% (upper 5.12% to lower 4%) to 3.0% (upper 3.41% to lower 2.63%). Likewise, the 20:0 levels dropped from 0.5% average in Nexera 710 to 0% in the selected transgenics. The 16:1 levels were undetectable in Nexera 710, increasing to an average of 2.3% (upper 2.71% to lower 1.72%) in transgenics. The average 18:3 levels were slightly increased in the small transgenic population, but the range of values overlapped with the unmodified Nexera 710 samples. These results can be summarized as follows:

    TABLE-US-00015 TABLE 10 Fatty Acid Nexera 710 Select Transgenic Material 20:0 0.5% average 0% 18:0 1.4% average 0.1% average (upper 2.08%, lower 0.81%) (upper 0.6%, lower 0%) 16:0 4.6% average 3.0% average (upper 5.12% to lower 4%) (upper 3.41% to lower 2.63%) Undetectable 2.3% average (upper 2.71% to lower 1.72%)

    [0185] Example 9Further Canola Data

    [0186] Protocols similar to those described elsewhere herein were applied to additional canola lines derived from well-known Nexera 710 commercially elite canola. Total saturates and the weight percent of the individual types of fatty acids, as indicated below, were calculated using methodology discussed herein.

    [0187] FIGS. 4A-C and 5A-C show representative results, from Events 36-11.19 and 218-11.30 respectively, that demonstrate reduced saturated fatty levels that are obtainable by practicing the subject invention. By making further manipulations according to the subject invention, the saturated fat levels exemplified here can be even further reduced. All of this data were obtained from selfed transgenic canola plants as indicated.

    [0188] In summary, for Event 36-11.19, T2 half seed analysis from greenhouse-grown plants had total saturates as low as 2.57%. Total saturates for T3whole seeds, from greenhouse-grown plants, were as low as 3.66%. Results are shown graphically in FIG. 4A (numerical data are in FIGS. 4B and 4C). For Event 218-11.30 greenhouse-grown plants, T2 half seed analysis revealed total saturates to be as low as 2.71%. T3 whole seeds had total saturates as low as 3.37%. Results are shown graphically in FIG. 5A (numerical data are in FIGS. SB and 5C), For reference, NATREON has 6.5% total saturates, on average, under field conditions.

    [0189] By making further improvements according to the subject invention (such as additional rounds of selfing, crosses with other superior lines, increasing desaturase gene copy number [either by additional transformation, by further breeding crosses, and the like], changing timing of desaturase expression, and mutagenesis), even greater levels of reduction of total saturated fat levels can be achieved.

    [0190] Example 10Analysis of Further Canola Data - Percent reduction of total saturated fats

    [0191] The data presented in Example 9 can be used in various calculations to illustrate various aspects of the subject invention. For example, percent reduction of total saturated fats can be calculated by first dividing the total saturates of a given plantby the total saturates of the control line, and then subtracting from 100%. Examples of such reductions, provided by the subject invention, are illustrated below. Results can be approximated by rounding to the closest whole (non-decimal) number.

    TABLE-US-00016 TABLE 11 Event Total Control % (& generation) Sats (TS) TS Reduction 218-11.30 (72) 2.71 6.36 57.4% 36-11.19 (12) 2.57 6.44 60%

    [0192] Any number shown on any of the graphs, figures, tables, or otherwise discussed herein can be used as an endpoint to define the metes and bounds of the subject invention. Likewise, any calculations using any of these numbers, such as those shown above and those discussed in more detail below, can be used to define the metes and bounds of the subject invention. Tables 12-14 show further representative results and calculations, for Lines with Events 218-11.30, 36-11.19, and 69-11.19.

    TABLE-US-00017 TABLE 12 Event 218-11.30 HS Selections for Crossing % TSAT VS % C16:0 % C16:1 % C18:0 Line C16:0 C16:1 C18:0 C18:1 TSAT Null WT Vs N Vs N Vs N 2193HS50 2.05 1.54 0.33 81.34 2.66 54 53 43 611 75 2193HS9 2.27 1.76 0.27 75.02 2.81 51 50 37 709 79 2193HS22 2.31 1.31 0.29 81.16 2.87 50 49 36 505 78 2193HS23 2.29 1.47 0.28 77.17 2.89 50 49 36 577 79 2195(N) 3.60 0.22 1.32 76.25 5.75 Nex 710 3.33 0.18 1.51 77.39 5.61

    TABLE-US-00018 TABLE 13 Event 36-11.19 HS Selections for Crossing % TSAT VS % C16:0 % C16:1 % C18:0 Line C16:0 C16:1 C18:0 C18:1 TSAT Null WT Vs N Vs N Vs N 1099HS3 1.95 1.76 0.52 81.92 2.92 51 48 45 1018 61 1099HS8 2.19 2.05 0.40 77.81 2.97 50 47 39 1201 70 1099HS17 2.11 1.73 0.42 80.16 2.99 50 47 41 1000 69 1099HS11 2.13 1.73 0.45 79.30 3.00 49 47 40 998 66 1099HS43 2.18 1.72 0.41 77.88 3.01 49 46 39 991 69 1127(N) 3.57 0.16 1.34 74.21 5.92 Nex 710 3.33 0.18 1.51 77.39 5.61

    TABLE-US-00019 TABLE 14 Event 69-11.19 HS Selections for Crossing % TSAT VS % C16:0 % C16:1 % C18:0 Line C16:0 C16:1 C18:0 C18:1 TSAT Null WT Vs N Vs N Vs N 1538HS23 1.88 2.20 0.34 79.56 2.64 55 53 49 1101 74 1538HS26 2.18 1.60 0.29 77.55 2.81 52 50 41 776 78 1538HS4 2.20 1.71 0.35 80.17 2.90 51 48 41 831 73 1538HS36 2.17 1.49 0.37 78.24 2.93 50 48 41 713 72 1604(N) 3.70 0.18 1.29 78.12 5.88 Nex 710 3.33 0.18 1.51 77.39 5.61

    [0193] Example 11Analysis of Further Canola DataDetailed fatty acid profiles

    [0194] Again, FIGS. 4A-C and 5A-C show some representative results that show fatty acid profiles of various plants having events 218-11.30 and 36-11.19. Generally, these results demonstrate that not only are the 16:0 and 18:0 levels greatly reduced (with a resulting increase in corresponding unsaturated levels), but the 20:0, 22:0, and 24:0 levels are also advantageously, and surprisingly and unexpectedly, reduced. In some cases, 18:2 and 18:3 levels can also be reduced, which enhances the oxidative stability of the improved oil. Furthermore, any of the ratios suggested above (such as 16:0-16:1, 18:0-18:1, and, for example, 18:0-[20:0+22:0+24:0]) can be used to define advantageous results of practicing the subject invention. Combined percent reductions in total C20:0+C22:0+C24:0 are also surprisingly achieved according to the subject. invention. Thus, the; subject invention provides plants have advantageous and improved fatty acid profiles, as exemplified herein. By making further improvements according to the subject invention, even better reductions in saturates, increases in no sats, and better ratios can be achieved.

    [0195] For example, various calculations, using the following data from FIG. 5C and FIG. 4B, can be used to illustrate accomplishments of the subject invention. Sample data from FIG. 5C and FIG. 4B are presented in the following Table. The amount of each indicated fatty acid is indicated for each event and in parentheses for the relevant control plant(s).

    TABLE-US-00020 TABLE 15 Event (& C20:0 C22:0 C24:0 generation) (control) (control) (control) 218-11.30 (T2) 0.11 (0.62) 0.12 (0.32) 0.03 (0.14) 36-11.19 (T3) 0.32 (0.64) 0.15 (0.42) 0.04 (0.21)

    [0196] Looking at the 218-11.30 event, the total contribution to saturates by the C20:0, C22:0, and C24:0 components is 1.08% in the control, but these components are advantageously decreased to 0.26% in a canola line of the subject invention. This represents an over 4-fold decrease in these saturates. Likewise, each component can be considered individually. Again looking at the 218-11.30 event, the C20:0 component is 0.62% in the control/wild-type, while it is reduced about 5.6 times in the plant line of the subject invention (down to 0.11%). The C22:0 component is reduced about 2 times: 0.12% in the d-9 desaturase plant line, which is down from 0.32% in the control line that lacks the desaturase gene. C24:0 is reduced about 4 times, from 0.14% down to 0.03%.

    [0197] For Event 36 (or 36-11.19), two lines, have C20:0, C22:0, and C24:0 content of 0.32, 0.15, and 0.04, and 0.30, 0.14, and 0.07, respectively. Compared to the control having 0.64, 0.42, and 0.21 respectively, these lines have about half the C20:0, and at least about a three-fold reduction in C22:0 and C24:0. The first line mentioned above actually exhibits an over 5 reduction in C24:0.

    [0198] It will quickly become apparent that a great number of similar calculations can be made for any of the other lines of the subject invention, for any of these preferred fatty acid components. These illustrations should not be construed as limiting, and any such novel reductions and ratios can be used to define the subject invention.

    [0199] Example 12Further Half-Seed Data of Subsequent Generations

    [0200] Further half-seed FAME analysis is set forth in Table 16. This Figure shows total saturates as low as 2.64% in a T3 generation and 2.66% in a T4 generation. Table 17 shows the copy number of D-9 desaturase genes present in the respective lines (see Sample ID in Table 16 and ID column in Table 17). Effects of copy number are discussed in more detail below in Examples 14 and 19.

    TABLE-US-00021 TABLE 16 HALF-SEED FAME ANALYSIS-% of Total Oil EVENT Generation Sample ID: C12:0 C14:0 C16:0 C16:1 C18:0 C18:1 C18:2 C18:3 69-11.19 (HL) T3 03TGH01538HS23 nd 0.04 1.88 2.20 0.34 79.56 9.43 3.29 218-11.30 (HL) T4 03TGH02193HS50 nd 0.05 20.5 1.54 0.33 81.34 9.85 2.77 69-11.19 (HL) T3 03TGH01538HS26 nd 0.05 2.18 1.60 0.29 77.55 11.78 4.01 218-11.30 (HL) T4 03TGH02193HS9 nd nd 2.27 1.76 0.27 75.02 14.44 3.08 218-11.30 (HL) T4 03TGH02193HS22 0.01 0.05 2.31 1.31 0.29 81.16 10.30 2.72 218-11.30 (HL) T4 03TGH02193HS23 0.01 0.06 2.29 1.47 0.28 77.17 13.57 3.15 69-11.19 (HL) T3 03TGH01538HS4 nd 0.03 2.20 1.71 0.35 80.17 10.19 3.07 36-11.19 (HL) T3 03TGH01099HS3 nd 0.04 1.95 1.76 0.52 81.92 8.61 3.03 69-11.19 (HL) T3 03TGH01538HS36 nd 0.04 2.17 1.49 0.37 78.24 11.54 3.39 218-11.30 (HL) T4 03TGH02193HS2 nd 0.06 2.31 1.60 0.30 77.39 13.23 2.98 69-11.19 (HL) T3 03TGH01538HS40 nd 0.03 2.26 1.46 0.38 79.75 10.51 3.44 36-11.19 (HL) T3 03TGH01099HS8 nd 0.05 2.19 2.05 0.40 77.81 12.22 2.86 36-11.19 (HL) T3 03TGH01099HS17 nd 0.06 2.11 1.73 0.42 80.16 10.37 2.73 36-11.19 (HL) T3 03TGH01099HS11 nd 0.06 2.13 1.73 0.45 79.30 10.98 3.04 36-11.19 (HL) T3 03TGH01099HS43 nd 0.06 2.18 1.72 0.41 77.88 12.09 3.06 218-11.30 (HL) T4 03TGH02194HS37 nd 0.06 2.25 1.34 0.44 83.00 8.52 2.50 218-11.30 (HL) T4 03TGH02194HS27 nd 0.08 2.31 1.26 0.41 79.74 11.23 3.22 218-11.30 (HL) T4 03TGH02194HS17 nd 0.06 2.30 1.34 0.40 79.75 11.15 3.19 218-11.30 (HL) T4 03TGH02194HS2 nd 0.06 2.25 1.22 0.44 81.50 9.84 2.79 218-11.30 (HL) T4 03TGH02194HS15 nd 0.07 2.35 1.32 0.40 78.85 12.00 3.29 218-11.30 (N) T4 03TGH02195HS3 0.01 0.06 3.60 0.23 1.37 76.94 12.52 2.69 218-11.30 (N) T4 03TGH02195HS9 nd 0.05 3.33 0.17 1.35 77.76 12.01 2.86 218-11.30 (N) T4 03TGH02195HS13 nd 0.06 3.76 0.21 1.13 76.48 13.23 2.62 218-11.30 (N) T4 03TGH02195HS16 0.01 0.05 3.31 0.20 1.35 75.89 13.05 3.82 218-11.30 (N) T4 03TGH02195HS19 nd 0.06 4.02 0.27 1.43 74.20 14.43 2.90 36-11.19 (N) T3 03TGH01127HS1 nd 0.05 3.46 0.18 1.42 74.06 14.50 3.69 36-11.19 (N) T3 03TGH01127HS2 nd 0.06 3.53 0.14 1.30 73.14 15.34 3.37 36-11.19 (N) T3 03TGH01127HS4 nd 0.06 3.74 0.16 1.29 71.92 16.49 3.38 36-11.19 (N) T3 03TGH01127HS8 nd 0.04 3.59 0.14 1.28 75.09 13.69 2.67 36-11.19 (N) T3 03TGH01127HS18 nd 0.04 3.55 0.18 1.41 76.85 12.00 2.67 WT Control M94S010HS6 nd 0.06 3.36 0.17 1.45 76.60 12.52 3.36 WT Control M94S010HS12 nd 0.06 3.19 0.21 1.58 74.56 13.88 4.31 WT Control M94S010HS15 nd 0.03 3.37 0.16 1.62 78.68 10.07 3.26 WT Control M94S010HS17 nd 0.05 3.21 0.19 1.54 77.37 12.21 2.97 WT Control M94S010HS18 nd 0.07 3.54 0.18 1.37 79.73 9.91 2.35 36-11.19(N) T3 03TGH01604HS2 nd 0.06 3.77 0.15 1.19 80.15 9.04 2.60 36-11.19(N) T3 03TGH01604HS6 nd 0.05 3.74 0.24 1.22 75.57 13.27 3.23 36-11.19(N) T3 03TGH01604HS8 nd 0.05 3.66 0.11 1.35 80.52 8.74 2.64 36-11.19(N) T3 03TGH01604HS9 nd 0.04 3.88 0.21 1.32 77.33 11.40 2.67 36-11.19(N) T3 03TGH01604HS15 nd 0.05 3.48 0.21 1.37 77.05 12.00 3.38 HALF-SEED FAME ANALYSIS-% of Total Oil EVENT C20:0 C20:1 C20:2 C22:0 C22:1 C24:0 C24:1 TOTSAT Selected Leaf Paint Data 36-11.19 (HL) 0.18 0.81 0.03 0.10 nd 0.10 0.05 2.64 Selected Resistant 218-11.30 (HL) 0.19 0.82 0.04 0.04 nd nd nd 2.66 Selected Resistant 69-11.19 (HL) 0.20 0.84 0.06 0.08 nd 0.02 0.01 2.81 Selected Resistant 218-11.30 (HL) 0.18 0.78 0.10 0.05 nd 0.04 0.04 2.81 Selected Resistant 218-11.30 (HL) 0.15 0.77 0.04 0.06 nd 0.02 0.02 2.87 Selected Resistant 218-11.30 (HL) 0.17 0.73 0.06 0.06 nd 0.02 nd 2.89 Selected Resistant 69-11.19 (HL) 0.18 0.80 0.05 0.06 nd 0.09 0.05 2.90 Selected Resistant 36-11.19 (HL) 0.26 0.85 0.06 0.11 nd 0.04 nd 2.92 Selected Resistant 69-11.19 (HL) 0.19 0.85 0.08 0.12 nd 0.04 nd 2.93 Selected Resistant 218-11.30 (HL) 0.17 0.84 0.06 0.06 nd 0.05 nd 2.95 Selected Resistant 69-11.19 (HL) 0.21 0.84 0.04 0.08 nd nd 0.03 2.96 Selected Resistant 36-11.19 (HL) 0.22 0.77 0.08 0.11 nd 0.01 0.02 2.97 Selected Resistant 36-11.19 (HL) 0.23 0.83 0.08 0.13 nd 0.04 0.09 2.99 Selected Resistant 36-11.19 (HL) 0.22 0.79 0.06 0.12 nd 0.02 0.07 3.00 Selected Resistant 36-11.19 (HL) 0.21 0.82 0.10 0.13 nd 0.01 0.07 3.01 Selected Resistant 218-11.30 (HL) 0.20 0.83 0.04 0.07 nd nd nd 3.03 Selected Resistant 218-11.30 (HL) 0.18 0.77 0.04 0.06 nd 0.01 nd 3.04 Selected Resistant 218-11.30 (HL) 0.19 0.76 0.05 0.07 nd 0.02 nd 3.05 Selected Resistant 218-11.30 (HL) 0.20 0.82 0.05 0.09 nd 0.03 nd 3.06 Selected Resistant 218-11.30 (HL) 0.18 0.75 0.04 0.06 nd 0.02 nd 3.08 Selected Resistant 218-11.30 (N) 0.52 1.16 0.05 0.23 nd 0.12 nd 5.90 Selected Susceptible null 218-11.30 (N) 0.42 1.21 0.05 0.18 nd 0.07 0.03 5.39 Selected Susceptible null 218-11.30 (N) 0.42 1.21 0.06 0.22 nd 0.08 nd 5.67 Selected Susceptible null 218-11.30 (N) 0.42 1.13 0.05 0.18 nd 0.07 0.03 5.39 Selected Susceptible null 218-11.30 (N) 0.52 1.23 0.06 0.27 nd 0.11 0.03 6.40 Selected Susceptible null 36-11.19 (N) 0.47 1.17 0.07 0.23 0.01 0.07 0.05 5.71 Selected Susceptible null 36-11.19 (N) 0.53 1.36 0.09 0.29 nd 0.13 0.07 5.84 Selected Susceptible null 36-11.19 (N) 0.50 1.35 0.08 0.27 0.02 0.09 0.06 5.96 Selected Susceptible null 36-11.19 (N) 0.59 1.45 0.07 0.36 0.04 0.15 0.09 6.01 Selected Susceptible null 36-11.19 (N) 0.61 1.41 0.08 0.35 nd 0.14 0.07 6.10 Selected Susceptible null WT Control 0.45 1.13 0.05 0.18 nd 0.06 0.06 5.54 Selected Susceptible null WT Control 0.41 0.97 0.06 0.15 nd nd 0.04 5.39 Selected Susceptible null WT Control 0.51 1.09 0.07 0.22 nd 0.05 nd 5.80 Selected Susceptible null WT Control 0.46 1.17 0.07 0.18 nd 0.06 nd 5.50 Selected Susceptible null WT Control 0.52 1.31 0.05 0.29 nd 0.06 0.02 5.85 Selected Susceptible null 69-11.19(N) 0.51 1.39 0.04 0.29 nd 0.12 nd 5.93 Selected Susceptible null 69-11.19(N) 0.46 1.22 0.06 0.21 nd 0.08 0.08 5.74 Selected Susceptible null 69-11.19(N) 0.53 1.29 0.05 0.28 nd 0.09 0.10 5.96 Selected Susceptible null 69-11.19(N) 0.54 1.36 0.07 0.31 0.02 0.08 0.07 6.16 Selected Susceptible null 69-11.19(N) 0.45 1.12 0.06 0.21 nd 0.05 0.04 5.61 Selected Susceptible null

    TABLE-US-00022 TABLE 17 Gen- er- D- ID Project Event ation 9 PAT 03TGH02193HS50 TG03D9-62 218-11.30 (HL) T4 1 1.5 or 2 03TGH02193HS9 TG03D9-62 218-11.30 (HL) T4 1 1.5 or 2 03TGH02193HS22 TG03D9-62 218-11.30 (HL) T4 1 1.5 or 2 03TGH02193HS23 TG03D9-62 218-11.30 (HL) T4 1 1.5 or 2 03TGH02193HS2 TG03D9-62 218-11.30 (HL) T4 1 1.5 or 2 03TGH02194HS37 TG03D9-62 218-11.30 (HL) T4 1 1.5 or 2 03TGH02194HS27 TG03D9-62 218-11.30 (HL) T4 1 1.5 or 2 03TGH02194HS17 TG03D9-62 218-11.30 (HL) T4 1 1.5 or 2 03TGH02194HS2 TG03D9-62 218-11.30 (HL) T4 1 1.5 or 2 03TGH02194HS15 TG03D9-62 218-11.30 (HL) T4 1 1.5 or 2 03TGH02195HS9 TG03D9-62 218-11.30 (N) T4 0 0 03TGH02195HS13 TG03D9-62 218-11.30 (N) T4 0 0 03TGH02195HS16 TG03D9-62 218-11.30 (N) T4 0 0 M94S010HS15 TG03D9-62 WT Control 0 0 M94S010HS15 TG03D9-62 WT Control 0 0 03TGH01099HS3 TG03D9-62 36-11.19 (HL) T3 2 1.5 03TGH01099HS8 TG03D9-62 36-11.19 (HL) T3 2 1.5 03TGH01099HS17 TG03D9-62 36-11.19 (HL) T3 2 1.5 03TGH01099HS11 TG03D9-62 36-11.19 (HL) T3 2 1.5 03TGH01099HS43 TG03D9-62 36-11.19 (HL) T3 2 1.5 03TGH01127HS2 TG03D9-62 36-11.19 (N) T3 0 0 03TGH01127HS4 TG03D9-62 36-11.19 (N) T3 0 0 03TGH01127HS8 TG03D9-62 36-11.19 (N) T3 0 0 03TGH01538HS23 TG03D9-62 69-11.19 (HL) T3 2 1.5 03TGH01538HS26 TG03D9-62 69-11.19 (HL) T3 2 1.5 03TGH01538HS4 TG03D9-62 69-11.19 (HL) T3 2 1.5 03TGH01538HS36 TG03D9-62 69-11.19 (HL) T3 2 1.5 03TGH01538HS40 TG03D9-62 69-11.19 (HL) T3 2 1.5 03TGH01604HS6 TG03D9-62 69-11.19(N) T3 0 0 03TGH01604HS8 TG03D9-62 69-11.19(N) T3 0 0 03TGH01604HS9 TG03D9-62 69-11.19(N) T3 0 0 M94S010HS15 TG03D9-62 WT Control 0 0 M94S010HS15 TG03D9-62 WT Control 0 0

    [0201] Example 13Further Analysis of Half-Seed Data from Example 12, and Further Data Showing Fatty Acid Shifts, Increases in Unsaturates, and Decreases in Saturates

    [0202] Half-seed data from the T3 field trials was plotted to illustrate various comparisons of the fatty acid contents to the total sat data. FIGS. 6A and 6B clearly show the reductions in C16:0 and increases in C16:1 in the transgenic events as compared to the nulls (events with a non-functional insert) and wild-type controls (non-transformed lines). FIGS. 6C and 6D clearly show the reductions in C18:0 and increases in C18:1 in the transgenic events as compared to the nulls and wild-type controls. FIGS. 6E and 6F clearly show the reductions in C20:0 and C22:0, respectively, in the transgenic events as compared to the nulls and Wiid-type controls.

    [0203] Similar results, using data obtained as discussed in Example 4, are also illustrated with bar graphs. FIGS. 6G and 6H clearly show shifts and reductions in C16:0, and shifts and increases in C16:1 in the transgenic events, as compared to the nulls and wild-type controls. FIGS. 6I and 6J clearly show shifts and reductions in C18:0, and shifts and increases in C18:1 in the transgenic events, as compared to the nulls and wild-type controls. FIGS. 6K and 6L show similar bar graphs for C18:2 and C18:3.

    [0204] The plots discussed above and FIG. 6M also Clearly illustrate the very surprising reduction in total saturates, as compared to already very good Nex 710 lines. FIG. 6N shows distributions for 1000 seeds.

    [0205] Example 14Decreasing saturated fat levels with multiple Delta-9 desaturase genes

    [0206] Results from greenhouse increases and field trials suggest that there is a relationship between the reduction in total saturates and Aspergillus delta-9 desaturase copy number.

    [0207] 14A: FAME Analysis Protocol for Event Sorting and Effect of Transgene Copy Number Sample preparation

    [0208] 1. Obtain weight of individual seeds and place into plastic mother plate,

    [0209] 2. Add 2, balls to each well

    [0210] 3. Take mother plate to liquid handler Hamilton: add 400 L of hepitane with IS (C11:0) and surrogate (C15:0 FAEE) then add 100 L of sodium methoxide (0.5N)

    [0211] 4. Cap inserts with strips caps and Geno-grind for 5 minutes (1@ 500)

    [0212] 5. Replace strip cap

    [0213] 6. Add plate lid with a rubber mat (extra sealing). Tape the lid with black electrical tape and remove bottom of mother plate to expose vials

    [0214] 7. Place the plate onto vortex/heater for 15 min. at 37 C./60 rpm (the vortex wells are filled with sand)

    [0215] 8. Centrifuge plate @ 3500 rpm for 2 min.

    [0216] 9. Place the bottom lid back and remove lid/strip cap. Transfer 350 l of top layer into the daughter plate using Hamilton.

    [0217] 10. Then add 400 L of heptane with IS and surrogate to the extraction plate.

    [0218] 11. Repeat steps 5 to 10 two more times (for a total of 3 transfers)

    [0219] 12. Keep the extract plate on the Hamilton after last transfer. Transfer 50 l of extract into glass insert mounted in aluminum block containing 450 l heptane with C11

    [0220] 13. Inject on GC

    [0221] GC/FID analysis

    [0222] GC parameters:

    [0223] Injection 1 l splitless per sample

    [0224] Column

    [0225] DB23, 15 meters, 0.25 mm I.D. and 0.15 am film thickness

    [0226] GC parameters

    [0227] Oven temperature program

    [0228] 70 C. hold for 2.15 min (splitless)

    [0229] 70 C.-150 @ 25 C. min.,

    [0230] 150 C.-180 @ 5 C. min.,

    [0231] 180 C.-220 @ 25 C. min.,

    [0232] 220 C. hold for 2 min.

    [0233] Injector temp.230 C.

    [0234] Detector temp.240 C.

    [0235] Make-up gasNitrogen @ 25 mL/min.

    [0236] FID fuelair @ 400 mL/min.,

    [0237] hydrogen @ 40 mL/min

    [0238] front injector: purge time 1 min.

    [0239] purge flow 35 ml/min

    [0240] back injector: purge time 2.15 min.

    [0241] purge flow 35 ml/min.

    [0242] front inlet pressure: 1.0 mL/minconstant flow

    [0243] back inlet pressure: 1.0 mL/minconstant flow

    [0244] Run time14.95 minutes,

    [0245] Flow rateshelium constant flow @ 1 mL/min

    [0246] Acquisition sequence

    [0247] 96 samples are splited between front and back column to minimize the build on the liner. The sample list is built with 5 injection methods corresponding to the type of sample being injected. The first 5 samples injected are always:

    [0248] 1. Matrix

    [0249] 2. Matrix

    [0250] 3. Standard1

    [0251] 4. Canola Positive Control

    [0252] 5. Reagent Blank

    [0253] 6-27. Canola samples

    [0254] 33. Standard2

    [0255] 34-54. Canola samples

    [0256] 55. Standard3

    [0257] Each list comprises 3 events of 16 samples (48 samples).

    [0258] Standard contains 25 ppm FAMES total distributed as follow:

    TABLE-US-00023 TABLE 18 FAMEs Concentration (ppm) Added to calibration C14:0 0.25 Yes C16:0 1 Yes C18:0 0.75 Yes C18:1 15 Yes C18:2 3 Yes C18:3 1.25 Yes C20:0 0.75 Yes C20:1 0.25 Yes C22:0 0.75 Yes C22:1 1.25 No C24:0 0.75 Yes

    [0259] 14B: Preliminary Southern Blot Analysis to Approximate Copy Number

    [0260] The DNA preparation protocol used for these purposes was as follows. Approximately 6 micrograms of DNA was digested with HindIII, and digested DNA was run on a 0.75% agarose gel. Blotting onto positively charged nylon membrane and hybridization followed typical protocols (Maniatis, Roche Applied Science, Inc.). The probe consisted of a DIG-labeled (kit from Roche Applied Science, Inc.) PCR product derived from the Aspergillus delta-9 desaturase gene. Washes were done twice for 5 minutes in room-temperature 2SSC/0.1% SDS, then twice in 65*C 0.1SSC/0.1% SDS. Hybridized bands were visualized With the DIG-Luminescent Detection Kit according to manufacturer's guidelines (Roche Applied Science, Inc.). Hybridizing bands were counted, and transgenic samples were initially described as Simple if they displayed 1 to 3 bands, or Complex if more than 3 bands.

    [0261] 14C: Comparison of Transgene Copy Number and Reduction in Saturated Fatty Acids in Transgenic Events

    [0262] The following definitions apply to the Table:

    TABLE-US-00024 # GC/FID number of individual seeds that has been analyzed analysis # seed C16:1 number of seeds with a ratio C16:1/C16:0*100 WT ratio <10% less than 10% # seed C16:1 number of seeds with a ratio C16:1/C16:0*100 more intermediate than 10% (interpreted as hemizygote based on FAME ratio phenotype) # seed C16:1 number of seed with the highest ratio C16:1/C16:0*100 highest ratio (interpreted as homozygote based on FAME phenotype) Ratio Sat in ratio of saturated FA in the wild type seed for that WT particular event. If not available (interpreted as complex event based on FAME phenotype), the null average of 7.5% was used. WT: individual seeds whose sat:unsat ratio is <10%, which is similar to Null event seeds Ratio Sat in ratio of saturated FA in the homozygote seed for that transgenic particular event. If not available (complex event) used the average. Sat reduction (saturated FA in wild type-saturated FA in transgenic)/ (%) saturated FA in wild type of that particular event. If saturated FA in wild type is not available (complex event) used the null avaerage (7.5%). S Simple event, 1 to 3 transgene copies PS Probably a Simple event C Complex event with more than 3 transgene copies N Negative, no transgenes detected

    [0263]

    [0264] The Ratio of Saturate Reduction was used to rank events because it generally used seed from the same transgenic event. This direct comparison helps reduce variability between plants caused by tissue culture and growing plants at different times.

    [0265] The above data shows an apparent gene dosage effect; more copies of the transgene tend to cause a more effective reduction in saturated fatty acids. For example, there are 57 non-control plants represented above. These 57 plants can be divided into three groups of 19 plants. The top set of plants (exhibiting the best reductions in saturates and the lowest levels of saturates) have 11 of 19 complex events (more than 3 copies of the desaturase gene). This set contained 8 of 19 events characterized as Simple or probably Simple. The middle set of 19 plants had only 6 of 19 complex events (13 of 19 simple or probably simple events). Still further, the third set of 19 plants (showing, relatively, the least reductions in saturates) contained only 3 complex events, with 16 of the 19 events being simple or probably simple. Thus, plants with cells having more than 3 copies of the desaturase appear to show a better reduction in saturates than plants with cells having only 1 copy of the gene.

    [0266] Example 15Segregation of Oleic and Vaccenic Acids

    [0267] Vaccenic acid is a G18:1 with the double bond in the delta-11 position. Vaccenic acid is formed by elongating delta-9 C16:1 outside of the plastid. The following is important because other analytical methods discussed herein combined oleic and vaccenic acid peaks together into a single percent composition that was labeled as oleic. That is, there was no separation of the two unless otherwise indicated. By subtracting out the vaccenic acid contribution, it is presently demonstrated that the percent contribution of oleic acid is, preferably and advantageously (and surprisingly), maintained at less than 80% while still achieving a reduction (to no sat or low sat levels) of overall) total saturates; Two types of analyses were used to demonstratethis, as set forth in the following two Examples.

    [0268] Example 16Canola Delta-9 Seed Extraction and Analysis for Vaccenic Acid SOP

    [0269] FIGS. 7A and 7B illustrate data obtained using the following protocol.

    [0270] Sample preparation (same as before)

    [0271] 1. Obtain weight of individual seeds and place into plastic mother plate.

    [0272] 2. Add 2, balls to each well

    [0273] 3. Take mother plate to liquid handler Hamilton add 400 L of heptane with IS (C11:0) and surrogate (C15:0 FAEE) then add 100 L of sodium methoxide (0.5N)

    [0274] 4. Cap inserts with strips caps and Geno-grind for 5 minutes (1@500)

    [0275] 5. Replace strip cap

    [0276] 6. Add plate lid with a rubber mat (extra sealing). Tape the lid with black electrical tape and remove bottom of mother plate to expose vials

    [0277] 7. Place the plate onto vortex/heater for 15 min. at 37 C./60 rpm (the vortex wells are filled with glass beads)

    [0278] 8. Centrifuge plate @ 3500 rpm for 2 min.

    [0279] 9. Place the bottom lid back and remove lid/strip cap. Transfer 350 of top layer into the daughter plate using Hamilton.

    [0280] 10. Then add 400 L of heptane with IS and surrogate to the extraction plate.

    [0281] 11. Repeat steps 5 to 10 two more times (for a total of 3 transfers)

    [0282] 12. Keep the extract plate on the Hamilton after last transfer. Transfer 50 l of extract into glass insert mounted in aluminum block containing 450 l heptane with IS C11

    [0283] 13. Inject on GC

    [0284] GC/FID analysis (different from FAMEs profile)

    [0285] GC parameters:

    [0286] Injection 1 l splitless per sample

    [0287] Column

    [0288] BPX 70 from SGE, 15 meters, 0.25 mm I.D. and 0.25 nm film thickness

    [0289] GC parameters

    [0290] Oven temperature program

    [0291] 70 C. hold for 2.15 min (splitless)

    [0292] 70 C.-140 @ 25 C. min.,

    [0293] 140 C. hold for 14 min

    [0294] 140 C.-1800 @ 10 C. min.,

    [0295] 180 C. hold for 3 min

    [0296] 180 C.-220 @ 25 C. 5 min.,

    [0297] 220 C. hold for 3 min.

    [0298] Injector temp.230 C.

    [0299] Detector temp.240 C.

    [0300] Make-up gasNitrogen @ 25 mL/min.

    [0301] FID fuelair @ 400 mL/min.,

    [0302] hydrogen @ 40 mL/min

    [0303] front injector: purge time 1 minA

    [0304] purge flow 35 ml/min

    [0305] back injector: purge time 2.15 min.

    [0306] purge flow 35 ml/min.

    [0307] front inlet pressure: 1.0 ml/minconstant flow

    [0308] back inlet pressure: 1.0 mL/minconstant flow

    [0309] Run time30.55 minutes,

    [0310] Flow rateshelium constant flow @ 1 mL/min

    [0311] Acquisition sequence

    [0312] 96 samples are splited between front and back column to minimize the build on the liner. The sample list is built with 5 injection methods corresponding to the type of sample being injected. The first 5 samples injected are always:

    [0313] 1. Matrix

    [0314] 2. Matrix

    [0315] 3. Standard1

    [0316] 4. Reagent Blank

    [0317] 5-32. Canola samples

    [0318] 33. Standard2

    [0319] 34-54. Canola samples

    [0320] 55. Standard3

    [0321] Each list comprises 6 events of 8 samples (1 seed=1 sample) (48 samples).

    [0322] Standard contains 200 ppm FAMES total distributed as follow:

    TABLE-US-00025 TABLE 20 FAMEs Concentration (ppm) Added to calibration C14:0 2 yes C16:0 8 yes C18:0 6 yes C18:1 120 yes C18:2 24 yes C18:3 10 yes C20:0 6 yes C20:1 2 yes C22:0 6 yes C22:1 10 No C24:0 6 Yes

    [0323] Example 17Analysis of Vaccenic Acid Contribution Using Gas Chromatography/Mass Spectrometry/Time of Flight

    [0324] Table 21 shows data obtained using the following protocol. In Table 21, for the T4, percent lipid was not reduced; it was maintained at 40.8% in the transgenic line (the same as the control line).

    TABLE-US-00026 TABLE 21 EVENT Generation D-9 PAT C14:0 C16:0 C16:1 C18:0 C18:1 Vacc 18:1 C18:2 C18:3 69-11.19 (HL) T3 2 1.5 average 0* 2.3 1.6 0.4 78.6 3.1 9.2 3.4 69-11.19(N) T3 0 0 average 0.0 3.7 0.3 1.9 75.2 3.2 10.1 3.2 218-11.19 (HL) T4 1 1.5 or 2 average 0.0 2.8 1.2 0.7 78.2 2.9 9.9 3.1 218-11.19 (N) T4 0 0 average 0.0 3.9 0.3 1.8 74.4 3.1 10.8 3.3 Total % Percent Seed oil saturated EVENT Generation D-9 PAT C20:0 C20:1 C22:0 C24:0 Lipid weight mg FA 69-11.19 (HL) T3 2 1.5 average 0.2 0.8 0.1 0.1 35.1 5.3 1.9 3.2 69-11.19(N) T3 0 0 average 0.7 1.2 0.4 0.2 42.6 4.0 1.7 6.9 218-11.19 (HL) T4 1 1.5 or 2 average 0.3 0.8 0.1 0.0 40.8 4.2 1.7 4.0 218-11.19 (N) T4 0 0 average 0.7 1.2 0.4 0.2 40.8 4.0 1.6 6.9 *if less than detection limit by processing method the default was 0 Acquisition and processing using HP Chemserver package

    [0325] Instruments description

    [0326] Time Of Flight mass spectrometer Pegasus III from Leco interfaced with a gas chromatography HP 6890.

    [0327] Combi Pal autpinjector from CTC Analytics technology mounted on the HP 6890 with a 10 l syringe.

    [0328] GC method

    [0329] GC parameters:

    [0330] Injection 1 to 3 l splitless per sample

    [0331] Column

    [0332] SolGel Wax, 30 meters, 0.25 mm I.D. and 0.25 m film thickness

    [0333] GC parameters

    [0334] Oven temperature program

    [0335] 70 C.-175 @25 C. min., (splitless)

    [0336] 175 C. hold for 25 min.

    [0337] 175 C.-230 @ 50 C. min.,

    [0338] 230 C. hold for 3 min.

    [0339] Injector temp.230 .C

    [0340] Transfer line.300 C.

    [0341] back injector: purge time 30 seconds.

    [0342] purge flow 20 ml/min.

    [0343] back inlet pressure: 2 mL/minconstant flow

    [0344] Runtime33.3 minutes,

    [0345] Flow rateshelium constant flow @ 2 mL/min

    [0346] Mass spectrometer

    [0347] Mass selection:

    [0348] Collected mass from 50 to 600 amu

    [0349] Filament bias: 70 V

    [0350] Ion source: 225 C.

    [0351] Detector:

    [0352] Detector voltage: 1600 V

    [0353] Acquisition rate: 10 spectra/sec

    [0354] Solvent delay 100 seconds

    [0355] Fragmentation

    [0356] ChromaTOF Software compiling fragmentation and deconvolving co migrating peaks for better separation and interpretation,

    [0357] Identification of fatty acids is performed by retention time and fragmentation match based on Standard solution (see below) injected in the same conditions and/or good match with NIST/EPA/NIH database included in software described above.

    [0358] Vaccenoic acid methyl ester also known as cis 11-octadecenoic acid methyl ester was identified from the canola seed extract by running a standard made from Vaccenic acid from Sigma (CAS:506-17-2). The retention time is 1207 seconds and produce a 853 match with standard and 814 with library describe above.

    [0359] Composition of the standard injected:

    TABLE-US-00027 TABLE 22 FAMEs Concentration (ppm) Added to calibration C14:0 2 Yes C16:0 8 Yes C18:0 6 Yes C18:1 120 Yes C18:2 24 Yes C18:3 10 Yes C20:0 6 Yes C20:1 2 Yes C22:0 6 Yes C22:1 10 No C24:0 6 Yes

    [0360] Vaccenoate methyl ester process:

    [0361] The methylated product was obtain after methylation of 100 mg of the acid: [0362] 100 mg dissolve in 5 ml of MeOHCl 0.5 N (Supelco) in a 30 ml glass vial [0363] heated 1 hour at 70 C. under nitrogen [0364] after cooling at room temperature added 5 ml of water containing 0.9% NaCl [0365] partitioned the ester in hexane in three consecutive hexane extractions (15 ml) [0366] neutralize the acid residue by mixing the organic phase with 15 ml of water containing HNaCO3 at 2.5% [0367] evaporate the organic layer under N2 to obtain an oily transparent liquid at RT corresponding to a vaccenoate methyl ester

    [0368] Example 18Achieving No Sats While Maintaining Superior Agronomic Traits

    [0369] Agronomic measurements were made at the various field sites, comparing the transgenics and controls. The conclusion was that overall, the transgenic plants behaved like and exhibited similar traits (aside from much-improved saturate levels) the Nex 710 controls. Thus, the subject transgene(s) has no consistent negative effect on plant health. A summary of the traits and rating system is provided in Table 23. Various criteria were used at various field site locations.

    [0370] Tables 24-27 numerically illustrate some representative results. The following abbreviations are used in those figures:

    TABLE-US-00028 DTF = Days to Flower EOF = Days to End of Flower HT = Height SC = Sterile Counts DTM = Days to Maturity LSV = Late Season Vigor LOD = Lodging SD WT = Seed Weight

    [0371] Table 24 shows agronomic data for lines from Event #218-11.30. Table 25 shows agronomic data for lines from Event #36-11.19. Table 26 shows agronomic data for lines from Event 69-11.19. The foregoing demonstrates that the subject invention, Le. achieving no sat canola, can be practiced, surprisingly, without adversely affecting other important agronomic traits.

    TABLE-US-00029 TABLE 23 Field Ratings Rating Timing Scale Details Vigor/Establishment 3-4 leaf 1 to 5 1 = excellent emergence, healthy stand; 5 = very poor emergence and/or seedling health Herbicide tolerance 1 4-7 days after 0 to 100% 1-5 barely detectable, 6-10 detectable by trained eye, sraying 11-15 noticeable by a grower, 15+ likely a grower complaint, 100 = all plants in plot are dead Herbicide tolerance 2 10-14 days after 0 to 100% same as details for Herbicide tolerance 1 spraying Days to flower (DTF) rated every 2-3 days # days after seeding 10% of plants have at least 1 flower open Days to end of flower (EOF) rated every 2-3 days # days after seeding 95% of plants in pot have finished flowering Height late pod fill cm height of perfectly erect plants, gather bunch of plants from centre of plot and stretch up to measure Days to maturity (DTM) rated every 2-3 days # days after seeding 30% pod turn, or optimal time of commercial swathing. However, several pods per plot (from middle of the main raceme) should be opened to determine whether seed maturity correlates to pod colour (ie. Some varieties may appear green, but seeds are mature.) Lodging resistance at maturity 1 to 5 1 = perfectly erect, 5 = horizontal (LODGE_RES) Yield grams per plot sample and weigh system should be used to standardize yield for varying moisture content; if system is not available, samples should be dired to constant weight prior to recording yieid. A visual assessment of the general agronomic performance of the line (i.e. potential yielding ability of the line, branching pattern, silique and size) was used. A rating of 1-5 was used with 1 = best and Late Season Vigor (1-5): just before maturity 5 being the worst in agronomic appearance Sterile Counts Flowering 100% bloom counting ten plants/plot Notes throughout season note any plot or plots with poor emergence or plant stand, flooding, or any other factors that might affect accuracty of ratings.

    TABLE-US-00030 TABLE 24 Agronomic Data Summary of Best Performing Lines from Event #218-11.30 1000 SEED WT Line Event DTF EOF HT SC DTM LSV LOD SD WT % NULL % NEX 710 1361(TS) #218-11.30 45 70 100 0 90 2 2 3.20 98 93 1319(TS) #218-11.30 44 70 98 0 90 2 1 3.23 98 94 1304(TS) #218-11.30 46 72 110 0 90 2 1 3.45 105 101 1500(TS) #218-11.30 45 71 103 0 91 3 1 3.12 95 91 1405(TS) #218-11.30 45 72 109 0 91 2 1 3.05 93 89 1370(TS) #218-11.30 44 70 106 0 90 2 1 3.41 104 99 1369(TS) #218-11.30 44 70 102 0 91 2 1 3.33 102 97 1370(T) #218-11.30 44 70 106 0 90 2 1 3.41 104 99 1405(T) #218-11.30 45 72 109 0 91 2 1 3.05 93 89 1299(N) #218-11.30 43 69 98 0 90 1 1 3.28 96 Nex 710 42 67 100 0 88 2 1 3.43

    TABLE-US-00031 TABLE 25 Agronomic Data Summary of Best Performing Lines from Event 36-11.19 1000 SEED WT Line Event DTF EOF HT SC DTM LSV LOD SD WT % NULL % NEX 710 1099(T) 36-11.19 45 70 106 0 90 2 1 3.78 98 110 1127(N) 36-11.19 44 68 102 0 89 2 1 3.85 112 Nex 710 42 67 100 0 88 2 1 3.43

    TABLE-US-00032 TABLE 26 Agronomic Data Summary of Best Performing Lines from Event 69-11.19 1000 SEED WT Line Event DTF EOF HT SC DTM LSV LOD SD WT % NULL % NEX 710 1538 69-11.19 45 72 103 0 91 4 1 3.17 94 92 1529 69-11.19 45 71 112 0 91 3 1 3.41 101 99 1534 69-11.19 46 71 109 0 91 3 1 3.24 96 94 1604(N) 69-11.19 43 68 102 0 89 2 1 3.38 99 Nex 710 42 67 100 0 88 2 1 3.43

    [0372] Example 19Dose Effect: Further Lowering of Saturates by Insertion of Multiple Copies of -9 Desaturase Genes

    [0373] This Example further shows that stacking multiple copies of -9 desaturase genes has a surprising dose effect, which can be used to even farther reduce saturates in oil seed plants such as canola. The following is greenhouse data measured using FAME procedures unless otherwise indicated.

    [0374] Table 27 reports F3 10 seed bulk fatty acid data from native Nex 710, the simple events (218,36,69), and from each of the F3 seed packages tracing back to F2 plants that were selected on the basis of InVader assays. (The last two columns of Table 27 show approximate average total saturates for the respective plants, and approximate average reduction in total saturates, as compared to the Nex 710 control.) At that generation, Southern data was not used. Thus, based, on saturate expression and InVader assays, a selection of suspected stacks and suspected parental siblings as well as nulls was made to be reconfirmed by growing out F3 plants and re-testing using Southerns.

    [0375] For example, while not statistically analyzed, samples from the 41 stack lines have an average total saturates of 3.5%. The 21 single lines have an average total saturates of 3.84%.

    [0376] Table 28 contains a summary of the suspected F3 stacks, suspected parental siblings, and nulls that were replanted for confirmation of copy number and zygosity. Lines named TDN0400141, TDN0400142, TDN0400145, TDN0400155, TDN0400158, and TDN0400160 were suspected to be homozygous stacks. Lines TDN0400189, TDN0400143, TDN0400197, TDN0400167, and TDN0400184 were suspected to be parental siblings out ofthe stacks. Lines TDN0400198, TDN0400199 were advanced as nulls selfed out of the stacks. TDN0400202, TDN0400204, and TDN0400208 are the simple events. This material is also currently in the field or recently harvested. Thus, field data is not yet available.

    [0377] FIGS. 8 and 9 are pictures of two gels run with DNA from F3 plants. Similar issues with isolating DNA for Southern analysis were encountered at this step, so not all 9 of the plants submitted appeared in gels. Based on the gels, lines TDN0400141, TDN0400142, and possibly TDN0400158 (only 2 plants) are homozygous stacks. TDN0400145 is still segregating for event 36, and TDN0400155 is still segregating for event 69. Line TDN0400160 appears to have an odd segregation of bands which may indicate that it is segregating for all 3 simple events. Follow-up will be conducted TDN0400160. Plant #8 of from this cross has a low sat level of 2.6% which is consistent with being a triple stack of high zygosity. Additional molecular analysis could confirm this. Not all of the lines suspected to be parental siblings appear in the gels (Lines TDN0400184, TDN0400189, and TDN0400197 highlighted in the Event column of Table 29, discussed below). Based on the single plant fatty acid data, it appears that the 9 plants from TDN0400184 (suspected of being a sibbed-out simple event 218) have as low sat levels as the suspected stacks. That is, the trend in the data is that stacks consistently show a reduction in saturates compared to sibbed-out events (single transgenic events recovered from crosses of two transgenic events).

    [0378] Table 29 contains 10 seed bulk fatty acid data from Nex 710, the simple events, and each single F4 plant. Nine plants of each suspected stack, null, simple event, and the like were regrown, tissue sampled for molecular analysis, and kept through to seed set for fatty acid analysis.

    TABLE-US-00033 TABLE 27 Name Source C12:0 C14:0 C16:0 C16:1 C18:0 C18:1 C18:2 C18:3 C20:0 C20:1 C20:2 TDN0400210 NEX 710 0.0 0.0 4.1 0.3 1.4 76.5 11.5 2.9 0.6 1.5 0.1 TDN0400210 NEX 710 0.0 0.1 4.4 0.3 1.5 73.9 13.5 2.9 0.7 1.5 0.1 TDN0400210 NEX 710 0.0 0.0 4.3 0.3 1.6 76.2 11.5 2.8 0.7 1.5 0.0 TDN0400201 TDN04-123 0.0 0.0 3.0 1.5 0.5 79.3 11.0 2.8 0.3 0.9 0.0 TDN0400202 TDN04-123 0.0 0.0 3.0 1.6 0.5 79.3 10.9 2.8 0.3 0.9 0.0 TDN0400203 TDN04-123 0.0 0.0 2.8 1.6 0.4 79.3 10.8 3.1 0.2 0.8 0.0 TDN0400204 TDN04-128 0.0 0.1 2.7 1.9 0.5 78.8 11.0 3.0 0.3 0.6 0.0 TDN0400205 TDN04-128 0.0 0.0 2.7 1.9 0.5 80.3 9.8 2.8 0.3 0.8 0.0 TDN0400206 TDN04-128 0.0 0.0 2.8 1.9 0.6 79.4 10.6 2.7 0.3 0.8 0.0 TDN0400207 TDN04-132 0.0 0.1 2.6 1.8 0.5 79.4 10.8 2.7 0.3 0.9 0.0 TDN0400208 TDN04-132 0.0 0.1 2.5 1.9 0.6 79.4 10.7 2.5 0.3 1.0 0.0 TDN0400209 TDN04-132 0.0 0.1 2.7 1.9 0.6 79.7 10.6 2.4 0.3 0.9 0.0 TDN0400198 TDN04-133/P-116 0.0 0.0 4.0 0.3 1.2 75.3 12.8 3.4 0.5 1.5 0.1 TDN0400199 TDN04-134/P11 0.0 0.0 4.2 0.3 1.2 73.7 14.2 3.4 0.5 1.5 0.1 TDN0400200 TDN04-135/P125 0.0 0.0 4.0 0.3 1.5 75.6 12.6 3.1 0.6 1.5 0.1 TDN0400136 TDN04-133/P14 0.0 0.0 2.4 2.2 0.4 79.9 9.7 3.0 0.3 0.9 0.1 TDN0400137 TDN04-133/P25 0.0 0.0 2.4 2.1 0.6 79.8 9.2 3.1 0.4 1.1 0.1 TDN0400138 TDN04-133/P29 0.0 0.0 2.5 2.3 0.4 81.5 8.5 2.6 0.3 0.8 0.0 TDN0400139 TDN04-133/P37 0.0 0.0 2.3 2.4 0.4 80.1 9.9 3.0 0.6 0.8 nd TDN0400140 TDN04-133/P40 0.0 0.0 2.4 2.1 0.5 81.4 8.3 2.9 0.3 0.9 0.0 TDN0400141 TDN04-133/P70 0.0 0.0 2.2 2.4 0.3 80.3 9.3 3.2 0.3 0.9 0.0 TDN0400142 TDN04-133/P114 0.0 0.0 2.2 2.4 0.3 79.9 9.8 3.2 0.3 0.9 nd TDN0400143 TDN04-133/P121 0.0 0.0 2.8 1.7 0.6 79.6 10.7 2.5 0.3 0.9 0.0 TDN0400144 TDN04-133/P122 0.0 0.0 2.7 1.9 0.5 80.6 9.5 2.8 0.3 0.9 0.0 TDN0400145 TDN04-133/P129 0.0 0.0 2.3 2.1 0.4 81.2 9.1 2.7 0.1 0.9 nd TDN0400146 TDN04-133/P139 0.0 0.0 2.8 1.7 0.6 79.7 10.1 3.2 0.3 0.9 nd TDN0400147 TDN04-133/P1 0.0 0.0 2.7 2.0 0.5 80.8 8.8 2.7 0.4 1.0 0.0 TDN0400148 TDN04-133/P11 0.0 0.0 2.6 2.2 0.8 79.7 9.1 3.0 0.4 1.0 nd TDN0400149 TDN04-133/P54 0.0 0.0 2.5 2.0 0.5 82.2 8.0 2.5 0.3 0.9 nd TDN0400150 TDN04-133/P57 0.0 0.0 2.8 1.7 0.5 79.0 11.1 2.9 0.3 0.9 0.0 TDN0400151 TDN04-133/P67 0.0 0.0 2.1 2.2 0.4 80.4 9.4 3.0 0.3 1.0 0.0 TDN0400152 TDN04-133/P76 0.0 0.0 2.5 1.7 0.5 81.2 8.6 3.2 0.3 1.0 0.0 TDN0400153 TDN04-133/P77 0.0 0.0 2.7 1.6 0.5 81.6 8.8 2.7 0.3 1.0 0.0 TDN0400154 TDN04-134/P-27 0.0 0.0 2.5 2.1 0.4 82.0 7.9 2.7 0.3 0.9 0.0 TDN0400155 TDN04-134/P-32 0.0 0.0 2.4 2.3 0.4 79.6 10.1 3.4 0.1 0.8 nd TDN0400156 TDN04-134/P-33 0.0 0.0 2.8 2.0 0.5 80.0 9.5 3.0 0.3 0.9 nd TDN0400157 TDN04-134/P-34 0.0 0.0 2.8 1.9 0.6 80.3 9.5 2.7 0.3 0.9 0.0 TDN0400158 TDN04-134/P-38 0.0 0.0 2.2 2.4 0.3 80.1 9.4 3.4 0.3 0.8 0.0 TDN0400159 TDN04-134/P-42 0.0 0.0 2.6 2.1 0.5 79.7 10.0 3.1 0.3 0.9 0.0 TDN0400160 TDN04-134/P-48 0.0 0.0 2.2 2.3 0.3 81.9 8.5 3.0 0.0 0.8 nd TDN0400161 TDN04-134/P-52 0.0 0.0 2.5 2.2 0.4 80.6 9.2 3.1 0.0 0.8 0.0 TDN0400162 TDN04-134/P-57 0.0 0.0 2.2 2.4 0.3 80.3 9.0 3.2 0.3 0.9 0.0 TDN0400163 TDN04-134/P-77 0.0 0.0 2.6 1.8 0.5 80.0 9.8 3.2 0.3 0.9 0.0 TDN0400164 TDN04-134/P-82 0.0 0.0 2.7 1.9 0.5 79.6 9.8 3.3 0.3 0.9 0.0 TDN0400165 TDN04-134/P-98 0.0 0.0 2.8 1.9 0.6 77.2 11.2 3.7 0.4 1.0 0.1 TDN0400166 TDN04-134/P-118 0.0 0.0 2.5 2.3 0.4 80.6 9.3 2.8 0.3 0.8 nd TDN0400167 TDN04-134/P-119 0.0 0.0 2.6 1.9 0.5 80.5 9.4 2.8 0.3 0.9 nd TDN0400168 TDN04-134/P-142 0.0 0.0 2.4 2.2 0.5 80.4 9.1 3.0 0.2 0.9 nd TDN0400169 TDN04-134/P-40 0.0 0.0 3.2 1.3 0.7 79.0 10.6 2.8 0.4 1.0 0.0 TDN0400170 TDN04-134/P-41 0.0 0.0 2.5 2.0 0.4 81.0 8.9 2.9 0.3 0.9 0.0 TDN0400171 TDN04-134/P-60 0.0 0.0 2.5 2.0 0.4 80.3 9.5 3.1 0.3 0.9 0.0 TDN0400172 TDN04-134/P-66 0.0 0.1 3.1 1.2 0.7 79.8 10.1 3.0 0.3 1.0 0.0 TDN0400173 TDN04-135/P-23 0.0 0.0 2.6 2.2 0.5 80.6 9.3 2.7 0.3 0.8 0.0 TDN0400174 TDN04-135/P-24 0.0 0.0 2.5 2.5 0.5 81.2 8.9 2.7 0.0 0.7 0.0 TDN0400175 TDN04-135/P-25 0.0 0.0 2.2 2.3 0.4 82.0 8.2 2.5 0.3 0.8 0.0 TDN0400176 TDN04-135/P-36 0.0 0.1 2.3 2.3 0.4 81.2 8.6 2.7 0.3 0.9 0.0 TDN0400177 TDN04-135/P-41 0.0 0.0 2.2 2.1 0.7 83.2 7.1 2.3 0.4 0.9 0.0 TDN0400178 TDN04-135/P-45 0.0 0.0 2.4 2.2 0.6 81.8 7.8 2.7 0.4 0.9 0.0 TDN0400179 TDN04-135/P-47 0.0 0.0 2.3 2.5 0.5 81.8 8.0 2.5 0.3 0.8 0.0 TDN0400180 TDN04-135/P-48 0.0 0.0 2.3 2.3 0.6 83.2 6.8 2.2 0.4 0.9 0.0 TDN0400181 TDN04-135/P-64 0.0 0.1 2.2 2.0 0.6 81.7 8.7 2.3 0.4 0.9 0.0 TDN0400182 TDN04-135/P-86 0.0 0.1 2.3 2.4 0.5 80.2 9.5 2.7 0.3 0.8 0.0 TDN0400183 TDN04-135/P-108 0.0 0.0 2.3 2.1 0.5 82.0 8.2 2.5 0.3 0.9 0.0 TDN0400184 TDN04-135/P-112 0.0 0.1 2.4 2.3 0.4 81.3 8.9 2.7 0.3 0.8 0.0 TDN0400185 TDN04-135/P-120 0.0 0.1 2.5 1.9 0.5 81.3 9.1 2.7 0.3 0.8 0.0 TDN0400186 TDN04-135/P-123 0.0 0.1 2.8 2.1 0.7 79.8 10.1 2.3 0.4 0.8 0.0 TDN0400187 TDN04-135/P-124 0.0 0.1 2.7 2.9 0.4 80.7 8.3 2.7 0.3 0.7 nd TDN0400188 TDN04-135/P-13 0.0 0.1 2.4 1.8 0.5 80.1 9.9 2.8 0.3 0.9 0.0 TDN0400189 TDN04-135/P-31 0.0 0.0 2.7 1.6 0.6 80.3 10.1 2.8 0.3 0.9 0.0 TDN0400190 TDN04-135/P-46 0.0 0.1 2.7 2.1 0.7 78.9 9.6 2.6 0.4 1.2 0.0 TDN0400191 TDN04-135/P-51 0.0 0.0 2.1 1.5 0.8 83.1 7.9 2.1 0.4 1.0 0.1 TDN0400192 TDN04-135/P-55 0.0 0.0 2.3 1.6 0.7 82.0 8.6 2.5 0.3 0.9 0.0 TDN0400193 TDN04-135/P-56 0.0 0.1 2.7 1.6 0.6 79.5 10.9 2.6 0.3 0.9 0.0 TDN0400194 TDN04-135/P-57 0.0 0.1 2.7 1.3 0.8 80.4 10.1 2.4 0.4 1.0 0.0 TDN0400195 TDN04-135/P-74 0.0 0.0 3.0 1.5 0.6 79.7 10.2 2.8 0.3 0.8 0.0 TDN0400196 TDN04-135/P-75 0.0 0.0 2.9 1.7 0.6 80.0 10.0 2.7 0.3 0.8 0.0 TDN0400197 TDN04-135/P-88 0.0 0.1 2.7 1.6 0.5 79.1 10.8 3.1 0.3 0.9 0.0 Seed F2 Invader + Name C22:0 C22:1 C24:0 C24:1 TOTSAT Weight Southern Pedigree TDN0400210 0.4 nd 0.0 0.0 6.6 7.1 Nex 710 TDN0400211 0.4 nd 0.1 0.1 7.1 7.3 Nex 710 TDN0400212 0.4 0.0 0.1 0.0 7.2 7.7 Nex 710 6.96 TDN0400201 0.0 nd 0.1 nd 3.9 8.2 69-11.19 TDN0400202 0.0 nd 0.1 nd 3.9 7.6 69-11.19 TDN0400203 0.1 nd 0.1 nd 3.8 7.3 69-11.19 3.84 0.4005729 TDN0400204 0.1 nd 0.2 0.0 3.7 9.1 218-11.30 TDN0400205 0.0 nd 0.1 nd 3.6 9.2 218-11.30 TDN0400206 0.0 0.0 0.1 0.0 3.9 9.2 218-11.30 3.75 0.4139063 TDN0400207 0.0 0.0 0.2 nd 3.7 10.7 36-11.19 TDN0400208 0.1 nd 0.1 nd 3.7 9.8 36-11.19 TDN0400209 0.0 nd 0.2 nd 3.8 8.5 36-11.19 3.72 0.4191146 TDN0400198 0.3 nd 0.0 0.0 6.2 10.2 null 69-11.19/36- 6.16 11.19(null) TDN0400199 0.3 0.0 0.1 0.1 6.4 8.6 null 69-11.19/218- 6.43 11.30(null) TDN0400200 0.3 nd 0.1 0.0 6.5 11.3 null 218-11.30/36- 6.52 11.19(null) TDN0400136 0.0 nd 0.2 nd 3.4 5.3 stack 69-11.19/ 0.45 36-11.19 TDN0400137 0.0 nd 0.3 nd 3.7 3 stack 69-11.19/ 0.40 36-11.19 TDN0400138 0.1 0.0 0.2 nd 3.5 7.6 stack 69-11.19/ 0.43 36-11.19 TDN0400139 0.0 nd 0.2 nd 3.5 4.2 stack 69-11.19/ 0.43 36-11.19 TDN0400140 0.1 nd 0.2 nd 3.5 2.4 stack 69-11.19/ 0.43 36-11.19 TDN0400141 0.1 nd 0.2 nd 3.1 1.3 stack 69-11.19/ 0.50 36-11.19 TDN0400142 0.0 nd 0.2 nd 3.0 4.8 stack 69-11.19/ 0.51 36-11.19 TDN0400143 0.1 nd 0.2 nd 4.0 8.5 stack 69-11.19/ 0.35 36-11.19 TDN0400144 0.0 nd 0.2 nd 3.7 8.5 stack 69-11.19/ 0.40 36-11.19 TDN0400145 0.0 nd 0.2 nd 3.1 5.8 stack 69-11.19/ 0.51 36-11.19 TDN0400146 0.1 nd 0.2 nd 4.0 8.9 single 69-11.19/ 0.36 36-11.19 TDN0400147 0.1 nd 0.2 nd 3.9 6.6 single 69-11.19/ 0.37 36-11.19 TDN0400148 0.0 nd 0.3 nd 4.2 2.8 single 69-11.19/ 0.32 36-11.19 TDN0400149 0.1 nd 0.2 nd 3.6 6 single 69-11.19/ 0.43 36-11.19 TDN0400150 0.0 nd 0.2 nd 3.9 9.7 single 69-11.19/ 0.38 36-11.19 TDN0400151 0.1 nd 0.2 nd 3.2 1.7 single 69-11.19/ 0.48 36-11.19 TDN0400152 0.0 nd 0.2 nd 3.6 1.6 single 69-11.19/ 0.42 36-11.19 TDN0400153 0.0 nd 0.2 nd 3.7 6.4 single 69-11.19/ 0.40 36-11.19 TDN0400154 0.1 0.0 0.3 nd 3.5 4.1 stack 69-11.19/ 0.45 218-11.30 TDN0400155 0.0 0.0 0.2 nd 3.1 3.2 stack 69-11.19/ 0.51 218-11.30 TDN0400156 0.0 nd 0.2 nd 3.8 2.7 stack 69-11.19/ 0.40 218-11.30 TDN0400157 0.1 0.0 0.2 nd 4.0 7.7 stack 69-11.19/ 0.37 218-11.30 TDN0400158 0.1 nd 0.2 nd 3.1 1.4 stack 69-11.19/ 0.52 218-11.30 TDN0400159 0.0 nd 0.2 nd 3.6 6.4 stack 69-11.19/ 0.44 218-11.30 TDN0400160 0.0 nd 0.2 0.0 2.8 1.2 stack 69-11.19/ 0.56 218-11.30 TDN0400161 0.0 nd 0.2 nd 3.3 4.5 stack 69-11.19/ 0.49 218-11.30 TDN0400162 0.1 nd 0.3 nd 3.2 3 stack 69-11.19/ 0.49 218-11.30 TDN0400163 0.0 nd 0.2 nd 3.5 1.9 stack 69-11.19/ 0.45 218-11.30 TDN0400164 0.1 nd 0.2 nd 3.8 2.4 stack 69-11.19/ 0.40 218-11.30 TDN0400165 0.1 0.0 0.2 nd 4.1 1.1 stack 69-11.19/ 0.36 218-11.30 TDN0400166 0.0 nd 0.2 nd 3.5 6.1 stack 69-11.19/ 0.45 218-11.30 TDN0400167 0.1 nd 0.2 nd 3.8 7.2 stack 69-11.19/ 0.41 218-11.30 TDN0400168 0.0 nd 0.2 nd 3.4 1.6 stack 69-11.19/ 0.47 218-11.30 TDN0400169 0.2 nd 0.2 nd 4.6 6.7 single 69-11.19/ 0.28 218-11.30 TDN0400170 0.1 nd 0.2 nd 3.5 1.8 single 69-11.19/ 0.45 218-11.30 TDN0400171 0.0 nd 0.2 nd 3.4 5 single 69-11.19/ 0.47 218-11.30 TDN0400172 0.1 nd 0.2 nd 4.5 8.5 single 69-11.19/ 0.30 218-11.30 TDN0400173 0.0 0.0 0.2 nd 3.6 7.3 stack 218-11.30/ 0.44 36-11.19 TDN0400174 0.1 nd 0.2 nd 3.3 6.9 stack 218-11.30/ 0.49 36-11.19 TDN0400175 0.0 nd 0.2 0.0 3.2 6.1 stack 218-11.30/ 0.50 36-11.19 TDN0400176 0.0 0.0 0.2 nd 3.4 4.5 stack 218-11.30/ 0.48 36-11.19 TDN0400177 0.1 nd 0.2 0.0 3.5 5.9 stack 218-11.30/ 0.46 36-11.19 TDN0400178 0.1 nd 0.2 nd 3.7 3.8 stack 218-11.30/ 0.44 36-11.19 TDN0400179 0.0 nd 0.3 nd 3.4 4.2 stack 218-11.30/ 0.47 36-11.19 TDN0400180 0.1 nd 0.3 nd 3.7 2.8 stack 218-11.30/ 0.43 36-11.19 TDN0400181 0.0 nd 0.2 nd 3.5 6.4 stack 218-11.30/ 0.46 36-11.19 TDN0400182 0.1 nd 0.2 0.0 3.5 8.3 stack 218-11.30/ 0.47 36-11.19 TDN0400183 0.0 nd 0.2 nd 3.5 6.7 stack 218-11.30/ 0.47 36-11.19 TDN0400184 0.1 nd 0.2 nd 3.4 9 stack 218-11.30/ 0.48 36-11.19 TDN0400185 0.0 nd 0.1 nd 3.4 10.1 stack 218-11.30/ 0.47 36-11.19 TDN0400186 0.0 nd 0.1 0.0 4.0 8.3 stack 218-11.30/ 0.38 36-11.19 TDN0400187 0.0 nd 0.2 0.0 3.7 5.2 single 218-11.30/ 0.43 36-11.19 TDN0400188 0.1 nd 0.2 0.0 3.6 5.8 single 218-11.30/ 0.44 36-11.19 TDN0400189 0.0 nd 0.1 nd 3.7 8.1 single 218-11.30/ 0.43 36-11.19 TDN0400190 0.0 nd 0.2 nd 4.0 0.1 single 218-11.30/ 0.38 36-11.19 TDN0400191 0.2 nd 0.2 nd 3.7 5.4 single 218-11.30/ 0.43 36-11.19 TDN0400192 0.0 nd 0.2 0.0 3.5 6.4 single 218-11.30/ 0.46 36-11.19 TDN0400193 0.0 0.0 0.2 nd 3.8 7.6 single 218-11.30/ 0.41 36-11.19 TDN0400194 0.1 nd 0.1 0.0 4.1 7.5 single 218-11.30/ 0.36 36-11.19 TDN0400195 0.1 nd 0.1 nd 4.2 9.4 single 218-11.30/ 0.36 36-11.19 TDN0400196 0.1 nd 0.1 nd 4.1 7.3 single 218-11.30/ 0.37 36-11.19 TDN0400197 0.1 nd 0.2 0.0 3.9 8 single 218-11.30/ 0.40 36-11.19

    TABLE-US-00034 TABLE 28 Follow-up Gener- done to Seed Name Pedigree Source ation C16:0 C16:1 C18:0 C18:1 C18:2 C18:3 TOTSAT confirm: (g) TDN0400211 Nex 70 NEX 70 T7 4.37 0.34 1.46 73.94 13.53 2.91 7.08 TDN0400202 69-11.19 TDN04-123 T6 2.97 1.59 0.47 79.3 10.86 2.85 3.86 TDN0400204 218-11.30 TDN04-128 T6 2.66 1.9 0.49 78.85 10.98 3.01 3.73 TDN0400208 36-11.19 TDN04-132 F3 2.51 1.95 0.58 79.45 10.73 2.52 3.69 TDN0400198 69-11.19/ TDN04-133/ F3 4.05 0.29 1.2 75.27 12.77 3.42 6.16 10.2 36-11.19(null) P-116 TDN0400199 69-11.19/ TDN04-134/ F3 4.16 0.29 1.24 73.67 14.17 3.4 6.43 8.6 218-11.30(null) P11 TDN0400141 69-11.19/ TDN04-133/ F3 2.24 2.36 0.32 80.3 9.3 3.23 3.1 homo Stack 1.3 36-11.19 P70 TDN0400142 69-11.19/ TDN04-133/ F3 2.15 2.38 0.3 79.89 9.77 3.17 3.02 homo Stack 4.8 36-11.19 P114 TDN0400145 69-11.19/ TDN04-133/ F3 2.34 2.09 0.37 81.23 9.12 2.7 3.07 homo Stack 5.8 36-11.19 P129 TDN0400155 69-11.19/ TDN04-134/ F3 2.38 2.31 0.42 79.55 10.15 3.4 3.12 homo Stack 3.2 218-11.30 P-32 TDN0400158 69-11.19/ TDN04-134/ F3 2.2 2.36 0.29 80.14 9.44 3.36 3.05 homo Stack 1.4 218-11.30 P-38 TDN0400160 69-11.19/ TDN04-134/ F3 2.23 2.27 0.29 81.88 8.47 2.97 2.81 homo Stack 1.2 218-11.30 P-48 TDN0400189 218-11.30/ TDN04-135/ F3 2.69 1.65 0.55 80.3 10.07 2.78 3.7 homo 36 8.1 36-11.19 P-31 TDN0400143 69-11.19/ TDN04-133/ F3 2.82 1.66 0.62 79.6 10.65 2.46 4.04 homo 69 8.5 36-11.19 P-121 TDN0400197 218-11.30/ TDN04-135/ F3 2.75 1.64 0.54 79.11 10.78 3.06 3.89 homo 218 8.0 36-11.19 P-88 TDN0400167 69-11.19/ TDN04-134/ F3 2.64 1.94 0.51 80.54 9.4 2.83 3.8 homo 218 7.2 218-11.30 P-119 TDN0400184 218-11.30/ TDN04-135/ F3 2.4 2.26 0.42 81.28 8.89 2.7 3.4 homo 218 9.0 36-11.19 P-112

    TABLE-US-00035 TABLE 29 Name Generation Source Pop Event Name QA Lab ID C12:0 C14:0 C16:0 C16:1 Nex 710 DH Polo/SVO95-09 Natreon 05-147-0001 0.0 0.1 3.5 0.2 Nex 710 DH Polo/SVO95-09 Natreon 05-147-0002 0.0 0.1 3.7 0.2 Nex 710 DH Polo/SVO95-09 Natreon 05-147-0003 0.0 0.1 3.7 0.2 Nex 710 DH Polo/SVO95-09 Natreon 05-147-0004 0.0 0.1 3.6 0.2 Nex 710 DH Polo/SVO95-09 Natreon 05-147-0005 0.0 0.1 3.7 0.2 Nex 710 DH Polo/SVO95-09 Natreon 05-147-0006 0.0 0.0 3.7 0.2 Nex 710 DH Polo/SVO95-09 Natreon 05-147-0007 0.0 0.1 3.7 0.3 Nex 710 DH Polo/SVO95-09 Natreon 05-147-0008 0.0 0.0 3.7 0.2 Nex 710 DH Polo/SVO95-09 Natreon 05-147-0009 0.0 0.1 3.8 0.2 TDN0400141-1 F4 03TGH01538/03TGH01099 69.11.19::36.11.19 05-147-0010 0.0 0.0 2.3 1.8 TDN0400141-2 F4 03TGH01538/03TGH01099 69.11.19::36.11.19 05-147-0011 0.0 0.0 2.3 2.3 TDN0400141-3 F4 03TGH01538/03TGH01099 69.11.19::36.11.19 05-147-0012 0.0 0.0 2.2 2.3 TDN0400141-4 F4 03TGH01538/03TGH01099 69.11.19::36.11.19 05-147-0013 0.0 0.1 2.2 2.2 TDN0400141-5 F4 03TGH01538/03TGH01099 69.11.19::36.11.19 05-147-0014 0.0 0.0 2.2 2.1 TDN0400141-6 F4 03TGH01538/03TGH01099 69.11.19::36.11.19 05-147-0015 0.0 0.1 2.2 2.3 TDN0400141-7 F4 03TGH01538/03TGH01099 69.11.19::36.11.19 05-147-0016 0.0 0.1 2.2 2.5 TDN0400141-8 F4 03TGH01538/03TGH01099 69.11.19::36.11.19 05-147-0017 0.0 0.0 2.1 2.3 TDN0400141-9 F4 03TGH01538/03TGH01099 69.11.19::36.11.19 05-147-0018 0.0 0.1 2.1 2.2 TDN0400142-1 F4 03TGH01538/03TGH01099 69.11.19::36.11.19 05-147-0019 0.0 0.1 2.0 2.1 TDN0400142-2 F4 03TGH01538/03TGH01099 69.11.19::36.11.19 05-147-0020 0.0 0.0 2.0 2.3 TDN0400142-3 F4 03TGH01538/03TGH01099 69.11.19::36.11.19 05-147-0021 0.0 0.0 2.1 2.0 TDN0400142-4 F4 03TGH01538/03TGH01099 69.11.19::36.11.19 05-147-0022 0.0 0.0 2.0 2.4 TDN0400142-5 F4 03TGH01538/03TGH01099 69.11.19::36.11.19 05-147-0023 0.0 0.1 2.1 2.3 TDN0400142-6 F4 03TGH01538/03TGH01099 69.11.19::36.11.19 05-147-0024 0.0 0.0 2.1 2.1 TDN0400142-7 F4 03TGH01538/03TGH01099 69.11.19::36.11.19 05-147-0025 0.0 0.0 2.0 2.1 TDN0400142-8 F4 03TGH01538/03TGH01099 69.11.19::36.11.19 05-147-0026 0.0 0.1 2.0 2.1 TDN0400142-9 F4 03TGH01538/03TGH01099 69.11.19::36.11.19 05-147-0027 0.0 0.0 2.1 2.0 TDN0400143-1 F4 03TGH01538/03TGH01099 36.11.19 (from 69.11.19::36.11.19) 05-147-0028 0.0 0.0 2.4 1.7 TDN0400143-2 F4 03TGH01538/03TGH01099 36.11.19 (from 69.11.19::36.11.19) 05-147-0029 0.0 0.1 2.3 1.5 TDN0400143-3 F4 03TGH01538/03TGH01099 36.11.19 (from 69.11.19::36.11.19) 05-147-0030 0.0 0.1 2.5 1.6 TDN0400143-4 F4 03TGH01538/03TGH01099 36.11.19 (from 69.11.19::36.11.19) 05-147-0031 0.0 0.1 2.6 1.4 TDN0400143-5 F4 03TGH01538/03TGH01099 36.11.19 (from 69.11.19::36.11.19) 05-147-0032 0.0 0.1 2.4 1.8 TDN0400143-6 F4 03TGH01538/03TGH01099 36.11.19 (from 69.11.19::36.11.19) 05-147-0033 0.0 0.0 2.3 1.7 TDN0400143-7 F4 03TGH01538/03TGH01099 36.11.19 (from 69.11.19::36.11.19) 05-147-0034 0.0 0.1 2.6 1.3 TDN0400143-8 F4 03TGH01538/03TGH01099 36.11.19 (from 69.11.19::36.11.19) 05-147-0035 0.0 0.0 2.7 1.6 TDN0400143-9 F4 03TGH01538/03TGH01099 36.11.19 (from 69.11.19::36.11.19) 05-147-0036 0.0 0.1 2.3 1.7 TDN0400145-1 F4 03TGH01538/03TGH01099 69.11.19::36.11.19 05-147-0037 0.0 0.1 2.4 1.6 TDN0400145-2 F4 03TGH01538/03TGH01099 69.11.19::36.11.19 05-147-0038 0.0 0.0 2.7 1.4 TDN0400145-3 F4 03TGH01538/03TGH01099 69.11.19::36.11.19 05-147-0039 0.0 0.1 2.3 1.7 TDN0400145-4 F4 03TGH01538/03TGH01099 69.11.19::36.11.19 05-147-0040 0.0 0.1 2.3 1.9 TDN0400145-5 F4 03TGH01538/03TGH01099 69.11.19::36.11.19 05-147-0041 0.0 0.1 2.4 1.6 TDN0400145-6 F4 03TGH01538/03TGH01099 69.11.19::36.11.19 05-147-0042 0.0 0.1 2.2 2.0 TDN0400145-7 F4 03TGH01538/03TGH01099 69.11.19::36.11.19 05-147-0043 0.0 0.0 2.3 2.0 TDN0400145-8 F4 03TGH01538/03TGH01099 69.11.19::36.11.19 05-147-0044 0.0 0.0 2.2 1.9 TDN0400145-9 F4 03TGH01538/03TGH01099 69.11.19::36.11.19 05-147-0045 0.0 0.0 2.1 2.2 TDN0400155-1 F4 03TGH01538/03TGH02193 69.11.19::218.11.19 05-147-0046 TDN0400155-2 F4 03TGH01538/03TGH02193 69.11.19::218.11.19 05-147-0047 TDN0400155-3 F4 03TGH01538/03TGH02193 69.11.19::218.11.19 05-147-0048 0.0 0.0 2.5 1.8 TDN0400155-4 F4 03TGH01538/03TGH02193 69.11.19::218.11.19 05-147-0049 0.0 0.1 2.2 2.0 TDN0400155-5 F4 03TGH01538/03TGH02193 69.11.19::218.11.19 05-147-0050 TDN0400155-6 F4 03TGH01538/03TGH02193 69.11.19::218.11.19 05-147-0051 0.0 0.0 2.4 2.0 TDN0400155-7 F4 03TGH01538/03TGH02193 69.11.19::218.11.19 05-147-0052 0.0 0.1 2.6 1.8 TDN0400155-8 F4 03TGH01538/03TGH02193 69.11.19::218.11.19 05-147-0053 0.0 0.0 2.2 2.1 TDN0400155-9 F4 03TGH01538/03TGH02193 69.11.19::218.11.19 05-147-0054 0.0 0.1 2.4 2.0 TDN0400158-1 F4 03TGH01538/03TGH02193 69.11.19::218.11.19 05-147-0055 0.0 0.0 2.2 2.1 TDN0400158-2 F4 03TGH01538/03TGH02193 69.11.19::218.11.19 05-147-0056 0.0 0.0 2.6 1.4 TDN0400158-3 F4 03TGH01538/03TGH02193 69.11.19::218.11.19 05-147-0057 0.0 0.0 2.2 1.9 TDN0400158-4 F4 03TGH01538/03TGH02193 69.11.19::218.11.19 05-147-0058 0.0 0.0 2.3 1.8 TDN0400158-5 F4 03TGH01538/03TGH02193 69.11.19::218.11.19 05-147-0059 TDN0400158-6 F4 03TGH01538/03TGH02193 69.11.19::218.11.19 05-147-0060 0.0 0.0 2.1 2.4 TDN0400158-7 F4 03TGH01538/03TGH02193 69.11.19::218.11.19 05-147-0061 TDN0400158-8 F4 03TGH01538/03TGH02193 69.11.19::218.11.19 05-147-0062 TDN0400158-9 F4 03TGH01538/03TGH02193 69.11.19::218.11.19 05-147-0063 0.0 0.0 2.1 2.5 TDN0400160-1 F4 03TGH01538/03TGH02193 69.11.19::218.11.30 05-147-0064 0.0 0.0 2.2 1.9 TDN0400160-2 F4 03TGH01538/03TGH02193 69.11.19::218.11.30 05-147-0065 0.0 0.0 2.2 2.0 TDN0400160-3 F4 03TGH01538/03TGH02193 69.11.19::218.11.30 05-147-0066 0.0 0.0 2.2 2.0 TDN0400160-4 F4 03TGH01538/03TGH02193 69.11.19::218.11.30 05-147-0067 0.0 0.0 2.6 1.6 TDN0400160-5 F4 03TGH01538/03TGH02193 69.11.19::218.11.30 05-147-0068 0.0 0.0 2.2 2.2 TDN0400160-6 F4 03TGH01538/03TGH02193 69.11.19::218.11.30 05-147-0069 0.0 0.0 2.2 2.1 TDN0400160-7 F4 03TGH01538/03TGH02193 69.11.19::218.11.30 05-147-0070 0.0 0.0 2.1 2.3 TDN0400160-8 F4 03TGH01538/03TGH02193 69.11.19::218.11.30 05-147-0071 0.0 0.1 2.1 2.2 TDN0400160-9 F4 03TGH01538/03TGH02193 69.11.19::218.11.30 05-147-0072 TDN0400167-1 F4 03TGH01538/03TGH02193 218.11.30 (from 69.11.19::218.11.30) 05-147-0073 0.0 0.0 2.5 1.7 TDN0400167-2 F4 03TGH01538/03TGH02193 218.11.30 (from 69.11.19::218.11.30) 05-147-0074 0.0 0.1 2.4 1.8 TDN0400167-3 F4 03TGH01538/03TGH02193 218.11.30 (from 69.11.19::218.11.30) 05-147-0075 0.0 0.1 2.5 1.7 TDN0400167-4 F4 03TGH01538/03TGH02193 218.11.30 (from 69.11.19::218.11.30) 05-147-0076 0.0 0.0 2.5 1.7 TDN0400167-5 F4 03TGH01538/03TGH02193 218.11.30 (from 69.11.19::218.11.30) 05-147-0077 0.0 0.0 2.5 1.7 TDN0400167-6 F4 03TGH01538/03TGH02193 218.11.30 (from 69.11.19::218.11.30) 05-147-0078 0.0 0.0 2.5 1.6 TDN0400167-7 F4 03TGH01538/03TGH02193 218.11.30 (from 69.11.19::218.11.30) 05-147-0079 0.0 0.0 2.4 1.9 TDN0400167-8 F4 03TGH01538/03TGH02193 218.11.30 (from 69.11.19::218.11.30) 05-147-0080 0.0 0.0 2.5 1.7 TDN0400167-9 F4 03TGH01538/03TGH02193 218.11.30 (from 69.11.19::218.11.30) 05-147-0081 0.0 0.1 2.5 1.7 TDN0400184-1 F4 03TGH02193/03TGH01099 218.11.30 (from 218.11.30::36-11.19) 05-147-0082 0.0 0.1 2.3 1.8 TDN0400184-2 F4 03TGH02193/03TGH01099 218.11.30 (from 218.11.30::36-11.19) 05-147-0083 0.0 0.1 2.4 1.8 TDN0400184-3 F4 03TGH02193/03TGH01099 218.11.30 (from 218.11.30::36-11.19) 05-147-0084 0.0 0.0 2.2 2.0 TDN0400184-4 F4 03TGH02193/03TGH01099 218.11.30 (from 218.11.30::36-11.19) 05-147-0085 0.0 0.1 2.1 2.2 TDN0400184-5 F4 03TGH02193/03TGH01099 218.11.30 (from 218.11.30::36-11.19) 05-147-0086 0.0 0.1 2.3 2.1 TDN0400184-6 F4 03TGH02193/03TGH01099 218.11.30 (from 218.11.30::36-11.19) 05-147-0087 0.0 0.1 2.3 2.0 TDN0400184-7 F4 03TGH02193/03TGH01099 218.11.30 (from 218.11.30::36-11.19) 05-147-0088 0.0 0.1 2.3 2.0 TDN0400184-8 F4 03TGH02193/03TGH01099 218.11.30 (from 218.11.30::36-11.19) 05-147-0089 0.0 0.1 2.2 2.1 TDN0400184-9 F4 03TGH02193/03TGH01099 218.11.30 (from 218.11.30::36-11.19) 05-147-0090 0.0 0.0 2.4 2.0 TDN0400189-1 F4 03TGH02193/03TGH01099 36-11.19 (from 218.11.30::36-11.19) 05-147-0091 0.0 0.1 2.8 1.5 TDN0400189-2 F4 03TGH02193/03TGH01099 36-11.19 (from 218.11.30::36-11.19) 05-147-0092 0.0 0.0 2.8 1.0 TDN0400189-3 F4 03TGH02193/03TGH01099 36-11.19 (from 218.11.30::36-11.19) 05-147-0093 0.0 0.1 2.5 1.6 TDN0400189-4 F4 03TGH02193/03TGH01099 36-11.19 (from 218.11.30::36-11.19) 05-147-0094 0.0 0.0 2.7 1.1 TDN0400189-5 F4 03TGH02193/03TGH01099 36-11.19 (from 218.11.30::36-11.19) 05-147-0095 0.0 0.0 2.4 1.7 TDN0400189-6 F4 03TGH02193/03TGH01099 36-11.19 (from 218.11.30::36-11.19) 05-147-0096 0.0 0.1 2.5 1.8 TDN0400189-7 F4 03TGH02193/03TGH01099 36-11.19 (from 218.11.30::36-11.19) 05-147-0097 0.0 0.0 2.7 1.5 TDN0400189-8 F4 03TGH02193/03TGH01099 36-11.19 (from 218.11.30::36-11.19) 05-147-0098 0.0 0.0 2.6 1.2 TDN0400189-9 F4 03TGH02193/03TGH01099 36-11.19 (from 218.11.30::36-11.19) 05-147-0099 0.0 0.1 2.7 1.3 TDN0400197-1 F4 03TGH02193/03TGH01099 218.11.30 (from 218.11.30::36-11.19) 05-147-0100 0.0 0.1 3.0 1.5 TDN0400197-2 F4 03TGH02193/03TGH01099 218.11.30 (from 218.11.30::36-11.19) 05-147-0101 0.0 0.1 2.5 1.9 TDN0400197-3 F4 03TGH02193/03TGH01099 218.11.30 (from 218.11.30::36-11.19) 05-147-0102 0.0 0.0 2.6 1.7 TDN0400197-4 F4 03TGH02193/03TGH01099 218.11.30 (from 218.11.30::36-11.19) 05-147-0103 0.0 0.1 2.5 1.8 TDN0400197-5 F4 03TGH02193/03TGH01099 218.11.30 (from 218.11.30::36-11.19) 05-147-0104 0.0 0.1 2.7 1.7 TDN0400197-6 F4 03TGH02193/03TGH01099 218.11.30 (from 218.11.30::36-11.19) 05-147-0105 0.0 0.1 2.8 1.5 TDN0400197-7 F4 03TGH02193/03TGH01099 218.11.30 (from 218.11.30::36-11.19) 05-147-0106 0.0 0.1 2.8 2.5 TDN0400197-8 F4 03TGH02193/03TGH01099 218.11.30 (from 218.11.30::36-11.19) 05-147-0107 0.0 0.1 2.5 1.4 TDN0400197-9 F4 03TGH02193/03TGH01099 218.11.30 (from 218.11.30::36-11.19) 05-147-0108 0.0 0.1 2.7 1.7 TDN0400198-1 F4 03TGH01538/03TGH01099 null (from 69-11.19::36-11.19) 05-147-0109 0.0 0.1 3.7 0.3 TDN0400198-2 F4 03TGH01538/03TGH01099 null (from 69-11.19::36-11.19) 05-147-0110 0.0 0.1 3.9 0.3 TDN0400198-3 F4 03TGH01538/03TGH01099 null (from 69-11.19::36-11.19) 05-147-0111 0.0 0.1 3.7 0.3 TDN0400198-4 F4 03TGH01538/03TGH01099 null (from 69-11.19::36-11.19) 05-147-0112 0.0 0.1 3.6 0.3 TDN0400198-5 F4 03TGH01538/03TGH01099 null (from 69-11.19::36-11.19) 05-147-0113 0.0 0.1 3.7 0.3 TDN0400198-6 F4 03TGH01538/03TGH01099 null (from 69-11.19::36-11.19) 05-147-0114 0.0 0.1 3.8 0.3 TDN0400198-7 F4 03TGH01538/03TGH01099 null (from 69-11.19::36-11.19) 05-147-0115 0.0 0.1 3.7 0.3 TDN0400198-8 F4 03TGH01538/03TGH01099 null (from 69-11.19::36-11.19) 05-147-0116 0.0 0.1 3.7 0.3 TDN0400198-9 F4 03TGH01538/03TGH01099 null (from 69-11.19::36-11.19) 05-147-0117 0.0 0.1 3.5 0.3 TDN0400199-1 F4 03TGH01538/03TGH02193 null (from 69-11.19/218-11.30) 05-147-0118 0.0 0.1 3.7 0.3 TDN0400199-2 F4 03TGH01538/03TGH02193 null (from 69-11.19/218-11.30) 05-147-0119 0.0 0.0 3.7 0.3 TDN0400199-3 F4 03TGH01538/03TGH02193 null (from 69-11.19/218-11.30) 05-147-0120 0.0 0.1 3.6 0.3 TDN0400199-4 F4 03TGH01538/03TGH02193 null (from 69-11.19/218-11.30) 05-147-0121 0.0 0.1 3.6 0.2 TDN0400199-5 F4 03TGH01538/03TGH02193 null (from 69-11.19/218-11.30) 05-147-0122 0.0 0.0 3.7 0.3 TDN0400199-6 F4 03TGH01538/03TGH02193 null (from 69-11.19/218-11.30) 05-147-0123 0.0 0.0 3.9 0.3 TDN0400199-7 F4 03TGH01538/03TGH02193 null (from 69-11.19/218-11.30) 05-147-0124 0.0 0.1 3.7 0.3 TDN0400199-8 F4 03TGH01538/03TGH02193 null (from 69-11.19/218-11.30) 05-147-0125 0.0 0.0 3.7 0.3 TDN0400199-9 F4 03TGH01538/03TGH02193 null (from 69-11.19/218-11.30) 05-147-0126 0.0 0.1 3.6 0.3 TDN0400202-1 T8 02TGH00038 69.11.19 05-147-0127 0.0 0.0 2.5 1.6 TDN0400202-2 T8 02TGH00038 69.11.19 05-147-0128 0.0 0.0 2.6 1.5 TDN0400202-3 T8 02TGH00038 69.11.19 05-147-0129 0.0 0.0 2.6 1.4 TDN0400202-4 T8 02TGH00038 69.11.19 05-147-0130 0.0 0.0 2.5 1.5 TDN0400202-5 T8 02TGH00038 69.11.19 05-147-0131 0.0 0.0 2.4 1.8 TDN0400202-6 T8 02TGH00038 69.11.19 05-147-0132 0.0 0.0 2.6 1.4 TDN0400202-7 T8 02TGH00038 69.11.19 05-147-0133 0.0 0.1 2.5 1.4 TDN0400202-8 T8 02TGH00038 69.11.19 05-147-0134 0.0 0.0 2.4 1.5 TDN0400202-9 T8 02TGH00038 69.11.19 05-147-0135 0.0 0.0 2.5 1.5 TDN0400204-1 T7 02TGH00032 218.11.30 05-147-0136 0.0 0.0 2.3 1.8 TDN0400204-2 T7 02TGH00032 218.11.30 05-147-0137 0.0 0.0 2.4 1.8 TDN0400204-3 T7 02TGH00032 218.11.30 05-147-0138 0.0 0.0 2.3 1.8 TDN0400204-4 T7 02TGH00032 218.11.30 05-147-0139 0.0 0.0 2.4 1.7 TDN0400204-5 T7 02TGH00032 218.11.30 05-147-0140 0.0 0.0 2.4 1.5 TDN0400204-6 T7 02TGH00032 218.11.30 05-147-0141 0.0 0.0 2.4 1.7 TDN0400204-7 T7 02TGH00032 218.11.30 05-147-0142 0.0 0.0 2.5 1.6 TDN0400204-8 T7 02TGH00032 218.11.30 05-147-0143 0.0 0.0 2.5 1.6 TDN0400204-9 T7 02TGH00032 218.11.30 05-147-0144 0.0 0.0 2.4 1.7 TDN0400208-1 T7 02TGH00037 36.11.19 05-147-0145 0.0 0.1 2.1 1.7 TDN0400208-2 T7 02TGH00037 36.11.19 05-147-0146 0.0 0.1 2.1 1.9 TDN0400208-3 T7 02TGH00037 36.11.19 05-147-0147 0.0 0.1 2.2 1.8 TDN0400208-4 T7 02TGH00037 36.11.19 05-147-0148 0.0 0.1 2.2 1.8 TDN0400208-5 T7 02TGH00037 36.11.19 05-147-0149 0.0 0.0 2.5 1.6 TDN0400208-6 T7 02TGH00037 36.11.19 05-147-0150 0.0 0.0 2.4 1.5 TDN0400208-7 T7 02TGH00037 36.11.19 05-147-0151 0.0 0.0 2.2 1.3 TDN0400208-8 T7 02TGH00037 36.11.19 05-147-0152 0.0 0.1 2.1 1.8 TDN0400208-9 T7 02TGH00037 36.11.19 05-147-0153 0.0 0.0 2.1 1.8 Seed Weight Name C18:0 C18:1 C18:2 C18:3 C20:0 C20:1 C20:2 C22:0 C22:1 C24:0 C24:1 % Sats Seed Weight Units Nex 710 1.5 78.5 9.9 2.9 0.6 1.4 0.1 0.4 0.0 0.3 0.2 6.4 10.1 G Nex 710 1.5 77.7 10.5 3.0 0.6 1.4 0.1 0.4 0.0 0.3 0.0 6.6 9.2 G Nex 710 1.3 77.6 10.7 2.9 0.6 1.5 0.1 0.4 0.0 0.3 0.2 6.4 10.2 G Nex 710 1.5 78.8 9.2 2.7 0.7 1.6 0.1 0.5 0.0 0.4 0.2 6.7 5.7 G Nex 710 1.4 78.1 10.0 2.9 0.7 1.5 0.1 0.5 0.0 0.4 0.2 6.6 10.4 G Nex 710 1.4 77.0 11.2 3.0 0.6 1.4 0.1 0.4 0.0 0.3 0.2 6.5 13.3 G Nex 710 1.6 78.2 9.8 2.6 0.7 1.5 0.1 0.5 0.0 0.4 0.3 6.9 9.5 G Nex 710 1.4 78.0 10.2 2.9 0.6 1.4 0.1 0.4 0.0 0.4 0.2 6.5 11.1 g Nex 710 1.5 77.5 10.7 2.7 0.7 1.5 0.1 0.4 0.0 0.3 0.2 6.7 11.8 g TDN0400141-1 0.5 82.9 8.0 2.3 0.2 0.8 0.0 0.1 0.0 0.3 0.0 3.4 7.3 g TDN0400141-2 0.5 81.6 7.9 2.6 0.2 0.9 0.1 0.2 0.0 0.3 0.0 3.6 6.1 g TDN0400141-3 0.4 82.3 7.8 2.6 0.2 0.9 0.0 0.1 0.0 0.3 0.0 3.2 3.4 g TDN0400141-4 0.5 81.0 8.4 2.9 0.3 0.9 0.0 0.1 0.0 0.4 0.0 3.5 4.3 g TDN0400141-5 0.4 82.3 7.8 2.7 0.2 0.9 0.0 0.1 0.0 0.3 0.0 3.3 5.7 g TDN0400141-6 0.5 79.1 9.7 3.2 0.3 1.0 0.1 0.2 0.0 0.3 0.0 3.5 1.8 g TDN0400141-7 0.5 81.9 7.4 2.6 0.3 0.9 0.0 0.1 0.0 0.4 0.0 3.5 2.2 g TDN0400141-8 0.4 82.3 7.9 2.5 0.2 0.8 0.1 0.1 0.0 0.2 0.0 3.1 5.1 g TDN0400141-9 0.5 80.8 8.9 3.1 0.2 1.0 0.1 0.1 0.0 0.1 0.0 3.1 3.1 g TDN0400142-1 0.5 81.9 8.1 2.4 0.3 1.0 0.1 0.1 0.0 0.3 0.0 3.3 7.3 g TDN0400142-2 0.4 81.3 8.8 2.8 0.2 0.9 0.0 0.1 0.0 0.3 0.0 3.0 7.8 g TDN0400142-3 0.4 82.8 7.8 2.5 0.2 0.9 0.0 0.1 0.0 0.3 0.0 3.1 7.7 g TDN0400142-4 0.4 82.1 7.7 2.8 0.2 0.9 0.1 0.1 0.0 0.2 0.0 3.0 4.9 g TDN0400142-5 0.4 80.7 9.2 2.9 0.2 0.9 0.1 0.1 0.0 0.2 0.0 3.0 5 g TDN0400141-6 0.4 81.5 9.0 2.6 0.2 0.9 0.0 0.1 0.0 0.2 0.0 3.1 9.7 g TDN0400142-7 0.4 81.6 8.8 2.6 0.2 0.9 0.1 0.1 0.0 0.3 0.0 3.0 8.6 g TDN0400142-8 0.4 81.2 9.0 2.8 0.2 0.9 0.1 0.0 0.0 0.3 0.0 2.9 7.7 g TDN0400142-9 0.4 81.0 9.2 2.6 0.2 0.9 0.1 0.1 0.0 0.3 0.0 3.3 11.2 g TDN0400143-1 0.5 81.7 9.0 2.4 0.2 0.9 0.1 0.2 0.0 0.2 0.0 3.6 8.5 g TDN0400143-2 0.6 81.2 9.6 2.6 0.3 1.0 0.1 0.1 0.0 0.2 0.0 3.6 5.7 g TDN0400143-3 0.6 81.2 9.3 2.3 0.3 0.9 0.1 0.2 0.0 0.3 0.0 3.9 10.8 g TDN0400143-4 0.6 82.4 8.5 2.4 0.3 0.9 0.0 0.2 0.0 0.2 0.0 3.9 6.2 g TDN0400143-5 0.5 81.9 8.9 2.4 0.3 0.9 0.1 0.2 0.0 0.2 0.0 3.5 9.6 g TDN0400143-6 0.5 81.7 9.1 2.4 0.3 0.9 0.0 0.2 0.0 0.2 0.0 3.6 10.2 g TDN0400143-7 0.7 81.6 9.1 2.3 0.4 1.0 0.1 0.2 0.0 0.2 0.0 4.1 10.7 g TDN0400143-8 0.5 80.1 9.9 2.9 0.2 0.9 0.1 0.1 0.0 0.2 0.0 3.8 3.6 g TDN0400143-9 0.5 82.3 8.6 2.3 0.2 0.9 0.1 0.2 0.0 0.2 0.0 3.4 8.7 g TDN0400145-1 0.6 80.7 9.9 2.5 0.3 0.9 0.1 0.2 0.0 0.2 0.0 3.7 8.9 g TDN0400145-2 0.5 80.4 10.3 2.6 0.3 0.9 0.1 0.2 0.0 0.0 0.0 3.7 7.3 g TDN0400145-3 0.5 81.8 8.9 2.7 0.2 0.9 0.1 0.1 0.0 0.2 0.0 3.4 8 g TDN0400145-4 0.5 81.9 8.4 2.5 0.2 0.9 0.0 0.1 0.0 0.4 0.0 3.5 8.7 g TDN0400145-5 0.5 83.1 7.9 2.2 0.3 0.9 0.0 0.1 0.0 0.2 0.0 3.6 8.3 g TDN0400145-6 0.4 81.8 8.6 2.7 0.2 0.9 0.1 0.1 0.0 0.3 0.0 3.3 8.9 g TDN0400145-7 0.4 82.9 7.5 2.4 0.2 0.9 0.1 0.1 0.0 0.3 0.0 3.3 7.8 g TDN0400145-8 0.5 83.2 7.5 2.6 0.2 0.9 0.0 0.1 0.0 0.2 0.0 3.2 8.4 g TDN0400145-9 0.4 82.4 7.8 2.7 0.2 0.8 0.1 0.1 0.0 0.3 0.0 3.1 8.3 g TDN0400155-1 6.4 g TDN0400155-2 0 g TDN0400155-3 0.6 81.9 8.3 2.6 0.2 0.8 0.1 0.1 0.0 0.2 0.0 3.7 11.2 g TDN0400155-4 0.5 82.5 7.8 2.7 0.2 0.8 0.0 0.1 0.0 0.3 0.0 3.3 10.2 g TDN0400155-5 0 g TDN0400155-6 0.4 81.9 8.8 2.6 0.3 0.8 0.0 0.0 0.0 0.0 0.0 3.2 7.5 g TDN0400155-7 0.5 82.3 8.4 2.4 0.3 0.8 0.0 0.1 0.0 0.0 0.0 3.6 9 g TDN0400155-8 0.5 84.2 6.4 2.3 0.3 0.8 0.0 0.1 0.0 0.2 0.0 3.3 7.5 g TDN0400155-9 0.5 82.5 8.0 2.6 0.3 0.8 0.0 0.1 0.0 0.0 0.0 3.2 10 g TDN0400158-1 0.4 83.4 7.4 2.5 0.3 0.8 0.0 0.1 0.0 0.0 0.0 3.0 9 g TDN0400158-2 0.5 83.2 8.0 2.4 0.3 0.9 0.0 0.0 0.0 0.0 0.0 3.5 7.2 g TDN0400158-3 0.5 82.5 8.0 2.7 0.3 0.8 0.0 0.1 0.0 0.0 0.0 3.1 9.7 g TDN0400158-4 0.5 83.3 7.5 2.5 0.3 0.8 0.0 0.1 0.0 0.1 0.0 3.2 8.6 g TDN0400158-5 0 g TDN0400158-6 0.4 82.8 7.2 2.8 0.2 0.8 0.0 0.1 0.0 0.0 0.0 2.8 6.4 g TDN0400158-7 0 g TDN0400158-8 0 g TDN0400158-9 0.4 82.0 7.9 2.8 0.2 0.8 0.0 0.1 0.0 0.0 0.0 2.8 3.2 g TDN0400160-1 0.4 82.4 8.1 2.8 0.3 0.8 0.0 0.1 0.0 0.1 0.0 3.1 7.8 g TDN0400160-2 0.4 82.9 7.9 2.6 0.3 0.8 0.0 0.1 0.0 0.0 0.0 3.0 8.5 g TDN0400160-3 0.4 83.3 7.4 2.6 0.3 0.8 0.0 0.1 0.0 0.0 0.0 3.0 6.5 g TDN0400160-4 0.6 81.8 8.9 2.6 0.3 0.8 0.0 0.1 0.0 0.0 0.0 3.5 12 g TDN0400160-5 0.4 82.3 7.7 2.7 0.3 0.8 0.0 0.1 0.0 0.1 0.0 3.1 4 g TDN0400160-6 0.4 82.5 8.1 2.6 0.3 0.8 0.0 0.1 0.0 0.1 0.0 3.1 9.2 g TDN0400160-7 0.4 83.0 7.3 2.6 0.3 0.8 0.0 0.0 0.0 0.1 0.0 3.0 6.5 g TDN0400160-8 0.4 82.6 8.0 2.8 0.1 0.8 0.0 0.0 0.0 0.0 0.0 2.6 2.3 g TDN0400160-9 0 g TDN0400167-1 0.6 83.2 7.9 2.3 0.3 0.8 0.0 0.1 0.0 0.0 0.0 3.5 11.1 g TDN0400167-2 0.5 82.7 8.1 2.4 0.3 0.8 0.0 0.1 0.0 0.1 0.0 3.4 9.6 g TDN0400167-3 0.6 82.4 8.5 2.4 0.3 0.8 0.0 0.1 0.0 0.0 0.0 3.5 10.1 g TDN0400167-4 0.5 82.0 8.9 2.5 0.3 0.8 0.0 0.1 0.0 0.0 0.0 3.4 9.4 g TDN0400167-5 0.6 81.8 8.9 2.4 0.3 0.8 0.0 0.1 0.0 0.1 0.0 3.7 11.9 g TDN0400167-6 0.6 82.3 8.7 2.4 0.3 0.8 0.0 0.1 0.0 0.0 0.0 3.5 10.3 g TDN0400167-7 0.5 81.8 8.7 2.6 0.3 0.9 0.0 0.1 0.0 0.0 0.0 3.3 8.5 g TDN0400167-8 0.6 82.1 8.9 2.5 0.3 0.8 0.0 0.1 0.0 0.0 0.0 3.5 9.2 g TDN0400167-9 0.5 82.7 8.3 2.4 0.3 0.8 0.0 0.1 0.0 0.0 0.0 3.5 8.7 g TDN0400184-1 0.5 82.9 8.1 2.5 0.3 0.8 0.0 0.1 0.0 0.0 0.0 3.1 10.2 g TDN0400184-2 0.5 83.1 7.9 2.4 0.3 0.8 0.0 0.0 0.0 0.0 0.0 3.3 8.7 g TDN0400184-3 0.5 83.5 7.3 2.3 0.3 0.8 0.0 0.1 0.0 0.0 0.0 3.1 8.6 g TDN0400184-4 0.5 83.7 7.1 2.2 0.3 0.8 0.0 0.1 0.0 0.1 0.0 3.1 10.3 g TDN0400184-5 0.5 83.3 7.1 2.3 0.3 0.8 0.0 0.1 0.0 0.1 0.0 3.3 6.9 g TDN0400184-6 0.5 82.4 8.1 2.6 0.3 0.8 0.0 0.1 0.0 0.0 0.0 3.2 10.5 g TDN0400184-7 0.5 84.0 6.9 2.1 0.3 0.8 0.0 0.1 0.0 0.1 0.0 3.3 9.6 g TDN0400184-8 0.5 82.2 8.2 2.6 0.1 0.8 0.0 0.1 0.0 0.1 0.0 3.0 10.1 g TDN0400184-9 0.5 82.0 8.5 2.4 0.3 0.8 0.0 0.1 0.0 0.1 0.0 3.5 8.1 g TDN0400189-1 0.8 79.9 10.6 2.4 0.3 0.8 0.0 0.2 0.0 0.0 0.0 4.2 10 g TDN0400189-2 0.7 80.9 9.8 2.6 0.3 0.9 0.0 0.2 0.0 0.0 0.0 4.1 8.5 g TDN0400189-3 0.7 83.4 7.8 2.1 0.3 0.9 0.0 0.1 0.0 0.0 0.0 3.7 10.7 g TDN0400189-4 0.6 79.5 11.0 2.9 0.3 1.0 0.0 0.1 0.0 0.0 0.0 3.8 8.8 g TDN0400189-5 0.6 82.4 8.5 2.3 0.3 0.9 0.0 0.1 0.0 0.0 0.0 3.4 10.1 g TDN0400189-6 0.6 82.2 8.5 2.5 0.3 0.8 0.0 0.1 0.0 0.0 0.0 3.5 11.6 g TDN0400189-7 0.6 81.5 9.2 2.5 0.3 0.8 0.0 0.1 0.0 0.0 0.0 3.8 10.6 g TDN0400189-8 0.7 82.2 8.8 2.3 0.3 0.9 0.0 0.2 0.0 0.0 0.0 3.8 11.2 g TDN0400189-9 0.8 81.3 9.2 2.4 0.4 1.0 0.1 0.0 0.0 0.3 0.0 4.2 8.7 g TDN0400197-1 0.7 79.6 10.3 2.6 0.3 0.9 0.0 0.1 0.0 0.1 0.0 4.3 9 g TDN0400197-2 79.1 10.5 3.0 0.3 0.9 0.0 0.0 0.0 0.1 0.0 3.5 11 g TDN0400197-3 0.5 81.5 8.8 2.7 0.3 0.9 0.0 0.1 0.0 0.3 0.0 3.8 11.6 g TDN0400197-4 0.5 81.4 8.7 2.7 0.3 0.8 0.0 0.0 0.0 0.3 0.0 3.7 12.3 g TDN0400197-5 0.5 79.3 10.6 3.0 0.3 0.9 0.1 0.1 0.0 0.2 0.0 3.8 10.6 g TDN0400197-6 0.5 79.8 10.2 2.6 0.4 1.0 0.0 0.0 0.0 0.4 0.0 4.4 12.3 g TDN0400197-7 0.7 77.2 11.3 3.3 0.3 0.9 0.0 0.0 0.0 0.3 0.0 4.0 6.9 g TDN0400197-8 0.5 80.4 9.9 2.6 0.3 1.1 0.1 0.0 0.0 0.3 0.0 3.9 9.7 g TDN0400197-9 0.7 80.2 9.8 3.1 0.3 0.8 0.0 0.0 0.0 0.2 0.0 3.8 11.1 g TDN0400198-1 0.5 77.1 11.1 3.3 0.6 1.5 0.0 0.5 0.0 0.0 0.0 6.3 11.2 g TDN0400198-2 1.4 77.4 11.3 3.0 0.6 1.6 0.1 0.1 0.0 0.0 0.0 5.9 11.6 g TDN0400198-3 1.4 77.5 11.0 3.0 0.6 1.6 0.0 0.3 0.0 0.1 0.0 6.0 11.1 g TDN0400198-4 1.3 78.0 10.2 3.1 0.6 1.5 0.0 0.3 0.0 0.6 0.0 6.5 12.8 g TDN0400198-5 1.4 77.8 10.5 3.0 0.5 1.5 0.0 0.3 0.0 0.5 0.0 6.4 12.5 g TDN0400198-6 1.3 77.3 11.1 3.1 0.6 1.5 0.0 0.4 0.0 0.2 0.0 6.3 6.7 g TDN0400198-7 1.3 78.1 10.3 3.0 0.6 1.5 0.1 0.4 0.0 0.0 0.0 6.2 11.1 g TDN0400198-8 1.4 78.5 10.1 2.9 0.6 1.6 0.0 0.2 0.0 0.0 0.0 6.0 13.8 g TDN0400198-9 1.5 76.1 12.1 3.4 0.5 1.7 0.1 0.5 0.0 0.0 0.0 5.8 7.6 g TDN0400199-1 1.2 77.6 10.7 3.1 0.6 1.5 0.0 0.1 0.0 0.1 0.0 6.0 11.3 g TDN0400199-2 1.5 78.3 10.3 2.9 0.6 1.6 0.0 0.0 0.0 0.1 0.0 5.9 11.9 g TDN0400199-3 1.4 77.5 11.0 3.0 0.6 1.6 0.0 0.2 0.0 0.0 0.0 5.9 11.2 g TDN0400199-4 1.4 79.3 9.8 2.7 0.6 1.6 0.0 0.3 0.0 0.0 0.0 5.9 8.4 g TDN0400199-5 1.4 78.9 10.1 2.7 0.6 1.7 0.0 0.0 0.0 0.0 0.0 5.9 10 g TDN0400199-6 1.5 78.4 10.2 2.7 0.7 1.6 0.0 0.3 0.0 0.0 0.0 6.4 8.2 g TDN0400199-7 1.5 77.5 10.5 3.0 0.6 1.5 0.1 0.4 0.0 0.1 0.0 6.2 12.4 g TDN0400199-8 1.4 78.8 10.0 2.7 0.6 1.5 0.1 0.2 0.0 0.1 0.0 6.1 8.6 g TDN0400199-9 1.5 78.3 10.1 2.8 0.7 1.6 0.1 0.1 0.0 0.1 0.0 5.9 10.3 g TDN0400202-1 1.4 81.9 8.3 2.7 0.3 0.9 0.0 0.1 0.0 0.2 0.0 3.6 14.3 g TDN0400202-2 0.5 83.3 7.8 2.1 0.3 0.9 0.0 0.0 0.0 0.0 0.0 3.5 10.3 g TDN0400202-3 0.6 82.3 8.6 2.6 0.2 0.8 0.0 0.0 0.0 0.0 0.0 3.3 9.5 g TDN0400202-4 0.5 81.2 9.2 2.8 0.3 0.9 0.0 0.0 0.0 0.2 0.0 3.6 8.1 g TDN0400202-5 0.5 82.9 7.8 2.5 0.3 0.9 0.0 0.0 0.0 0.0 0.0 3.1 6.5 g TDN0400202-6 0.4 82.4 8.4 2.6 0.3 0.9 0.1 0.1 0.0 0.0 0.0 3.5 11.8 g TDN0400202-7 0.5 82.5 8.4 2.6 0.2 0.9 0.0 0.0 0.0 0.1 0.0 3.4 8.2 g TDN0400202-8 0.5 82.0 8.7 2.7 0.3 0.9 0.0 0.0 0.0 0.0 0.0 3.3 8.2 g TDN0400202-9 0.5 82.5 8.3 2.5 0.3 0.9 0.0 0.0 0.0 0.2 0.0 3.5 10.6 g TDN0400204-1 0.5 82.8 7.8 2.5 0.3 0.9 0.1 0.0 0.0 0.1 0.0 3.4 10.4 g TDN0400204-2 0.5 82.4 8.0 2.5 0.3 0.9 0.0 0.1 0.0 0.1 0.0 3.5 11.6 g TDN0400204-3 0.6 82.1 8.5 2.6 0.3 0.8 0.0 0.0 0.0 0.1 0.0 3.3 11.3 g TDN0400204-4 0.5 81.8 8.9 2.6 0.3 0.8 0.0 0.0 0.0 0.0 0.0 3.2 10.1 g TDN0400204-5 0.5 82.8 8.1 2.5 0.2 0.8 0.0 0.0 0.0 0.0 0.0 3.2 11 g TDN0400204-6 0.5 82.8 7.8 2.6 0.3 0.8 0.0 0.0 0.0 0.1 0.0 3.4 9.4 g TDN0400204-7 0.6 82.1 8.7 2.5 0.3 0.8 0.0 0.0 0.0 0.0 0.0 3.4 10.3 g TDN0400204-8 0.5 82.4 8.6 2.4 0.2 0.8 0.1 0.0 0.0 0.1 0.0 3.3 7.7 g TDN0400204-9 0.5 83.1 7.7 2.4 0.3 0.8 0.0 0.0 0.1 0.0 0.0 3.4 10.5 g TDN0400208-1 0.6 82.2 8.7 2.2 0.4 1.0 0.0 0.0 0.0 0.0 0.0 3.2 10.3 g TDN0400208-2 0.7 80.9 9.5 2.5 0.3 1.0 0.0 0.1 0.0 0.1 0.0 3.3 8 g TDN0400208-3 0.6 82.4 8.3 2.2 0.4 1.0 0.1 0.0 0.0 0.0 0.0 3.3 8.6 g TDN0400208-4 0.7 82.6 8.3 2.3 0.3 1.0 0.1 0.0 0.0 0.0 0.0 3.2 8.3 g TDN0400208-5 0.6 81.1 9.5 2.4 0.3 0.9 0.0 0.0 0.0 0.1 0.0 3.6 12.6 g TDN0400208-6 0.6 80.8 10.0 2.6 0.3 0.9 0.1 0.1 0.0 0.0 0.0 3.4 10.5 g TDN0400208-7 0.6 81.6 9.6 2.2 0.3 1.0 0.0 0.1 0.0 0.0 0.0 3.4 10.1 g TDN0400208-8 0.7 82.4 8.5 2.3 0.3 1.0 0.0 0.1 0.0 0.0 0.0 3.3 8.4 g TDN0400208-9 0.7 81.8 8.6 2.4 0.4 1.0 0.1 0.0 0.0 0.0 0.0 3.2 8.2 g