METHOD FOR REGULATING PLANT GROWTH
20180030468 ยท 2018-02-01
Assignee
Inventors
- Takeshi Nakano (Wako-shi, JP)
- Tadao ASAMI (Wako-shi, JP)
- Ayumi YAMAGAMI (Wako-shi, JP)
- Hiroyuki OSADA (Wako-shi, JP)
Cpc classification
C12N15/8261
CHEMISTRY; METALLURGY
Y02A40/146
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
International classification
Abstract
An object of the present invention is to elucidate the mechanism of plant growth regulation by brassinosteroid and the mechanism of transfer of the BIL1 protein that is the master transcription factor of brassinosteroid signaling into the nucleus, discover new factors involved in the mechanisms, and using the factors for plant growth regulation, thereby increasing production of plant biomass or crop.
According to the present invention, a transgenic plant, wherein expression of the BSS1 gene having activity to bind to a BIL1 protein to inhibit the transfer of the BIL1 protein into the nucleus so as to down-regulate brassinosteroid signaling is suppressed or promoted, and a method for regulating plant growth, wherein expression of the BSS1 gene in a plant body is suppressed or promoted, are provided.
Claims
1. A transgenic plant, in which expression of the BSS1 gene is suppressed or promoted.
2. A transgenic plant, in which expression of any one of the following genes (a) to (f) is suppressed or promoted: (a) a gene comprising DNA that consists of the nucleotide sequence shown in SEQ ID NO: 2 or 5; (b) a gene comprising DNA that hybridizes under stringent conditions to DNA consisting of a nucleotide sequence complementary to DNA consisting of the nucleotide sequence shown in SEQ ID NO: 2 or 5, and encodes a protein having activity to bind to a brassinosteroid master transcription factor BIL1 protein to inhibit the transfer of the BIL1 protein into the nucleus, thereby down-regulating brassinosteroid signaling; (c) a gene comprising DNA that consists of a nucleotide sequence having 60% or higher sequence identity with the nucleotide sequence shown in SEQ ID NO: 2 or 5, and encodes a protein having activity to bind to a brassinosteroid master transcription factor BIL1 protein to inhibit the transfer of the BIL1 protein into the nucleus, thereby down-regulating brassinosteroid signaling; (d) a gene encoding a protein that consists of the amino acid sequence shown in SEQ ID NO: 3 or 6; (e) a gene encoding a protein that consists of an amino acid sequence derived from the amino acid sequence shown in SEQ ID NO: 3 or 6 by deletion, substitution, or addition of 1 or several amino acids, and has activity to bind to a brassinosteroid master transcription factor BIL1 protein to inhibit the transfer of the BIL1 protein into the nucleus, thereby down-regulating brassinosteroid signaling; and (f) a gene encoding a protein that consists of an amino acid sequence having 60% or higher sequence identity with the amino acid sequence shown in SEQ ID NO: 3 or 6, and has activity to bind to a brassinosteroid master transcription factor BIL1 protein to inhibit the transfer of the BIL1 protein into the nucleus, thereby down-regulating brassinosteroid signaling.
3. The transgenic plant according to claim 1, wherein the plant is in the form of a plant body, a plant organ, a plant tissue, or a cultured plant cells.
4. The transgenic plant according to claim 1, wherein the plant is a monocotyledonous plant or a dicotyledonous plant.
5. A method for regulating plant growth, which comprises suppressing or promoting expression of the BSS1 gene in a plant body.
6. A method for regulating plant growth, which comprises suppressing or promoting expression of any one of the following genes (a) to (f) in a plant body: (a) a gene comprising DNA that consists of the nucleotide sequence shown in SEQ ID NO: 2 or 5; (b) a gene comprising DNA that hybridizes under stringent conditions to DNA consisting of a nucleotide sequence complementary to DNA consisting of the nucleotide sequence shown in SEQ ID NO: 2 or 5, and encodes a protein having activity to bind to a brassinosteroid master transcription factor BIL1 protein to inhibit the transfer of the BIL1 protein into the nucleus, thereby down-regulating brassinosteroid signaling; (c) a gene comprising DNA that consists of a nucleotide sequence having 60% or higher sequence identity with the nucleotide sequence shown in SEQ ID NO: 2 or 5, and encodes a protein having activity to bind to a brassinosteroid master transcription factor BIL1 protein to inhibit the transfer of the BIL1 protein into the nucleus, thereby down-regulating brassinosteroid signaling; (d) a gene encoding a protein that consists of the amino acid sequence shown in SEQ ID NO: 3 or 6; (e) a gene encoding a protein that consists of an amino acid sequence derived from the amino acid sequence shown in SEQ ID NO: 3 or 6 by deletion, substitution, or addition of 1 or several amino acids, and has activity to bind to a brassinosteroid master transcription factor BIL1 protein to inhibit the transfer of the BIL1 protein into the nucleus, thereby down-regulating brassinosteroid signaling; and (f) a gene encoding a protein that consists of an amino acid sequence having 60% or higher sequence identity with the amino acid sequence shown in SEQ ID NO: 3 or 6, and has activity to bind to a brassinosteroid master transcription factor BIL1 protein to inhibit the transfer of the BIL1 protein into the nucleus, thereby down-regulating brassinosteroid signaling.
7. A method for producing a growth-regulated plant, which comprises suppressing or promoting expression of the BSS1 gene in a plant body.
8. A method for producing a growth-regulated plant, which comprises suppressing or promoting expression of any one of the following genes (a) to (f) in a plant body: (a) a gene comprising DNA that consists of the nucleotide sequence shown in SEQ ID NO: 2 or 5; (b) a gene comprising DNA that hybridizes under stringent conditions to DNA consisting of a nucleotide sequence complementary to DNA consisting of the nucleotide sequence shown in SEQ ID NO: 2 or 5, and encodes a protein having activity to bind to a brassinosteroid master transcription factor BIL1 protein to inhibit the transfer of the BIL1 protein into the nucleus, thereby down-regulating brassinosteroid signaling; (c) a gene comprising DNA that consists of a nucleotide sequence having 60% or higher sequence identity with the nucleotide sequence shown in SEQ ID NO: 2 or 5, and encodes a protein having activity to bind to a brassinosteroid master transcription factor BIL1 protein to inhibit the transfer of the BIL1 protein into the nucleus, thereby down-regulating brassinosteroid signaling; (d) a gene encoding a protein that consists of the amino acid sequence shown in SEQ ID NO: 3 or 6; (e) a gene encoding a protein that consists of an amino acid sequence derived from the amino acid sequence shown in SEQ ID NO: 3 or 6 by deletion, substitution, or addition of 1 or several amino acids, and has activity to bind to a brassinosteroid master transcription factor BIL1 protein to inhibit the transfer of the BIL1 protein into the nucleus, thereby down-regulating brassinosteroid signaling; and (f) a gene encoding a protein that consists of an amino acid sequence having 60% or higher sequence identity with the amino acid sequence shown in SEQ ID NO: 3 or 6, and has activity to bind to a brassinosteroid master transcription factor BIL1 protein to inhibit the transfer of the BIL1 protein into the nucleus, thereby down-regulating brassinosteroid signaling.
9. The method according to claim 5, wherein the plant is in the form of a plant body, a plant organ, a plant tissue, or cultured plant cells.
10. The method according to claim 5, wherein the plant is a monocotyledonous plant or a dicotyledonous plant.
11. A method for increasing biomass of a plant, which comprises suppressing expression of any one of the following genes (a) to (f): (a) a gene comprising DNA that consists of the nucleotide sequence shown in SEQ ID NO: 2 or 5; (b) a gene comprising DNA that hybridizes under stringent conditions to DNA consisting of a nucleotide sequence complementary to DNA consisting of the nucleotide sequence shown in SEQ ID NO: 2 or 5, and encodes a protein having activity to bind to a brassinosteroid master transcription factor BIL1 protein to inhibit the transfer of the BIL1 protein into the nucleus, thereby down-regulating brassinosteroid signaling; (c) a gene comprising DNA that consists of a nucleotide sequence having 60% or higher sequence identity with the nucleotide sequence shown in SEQ ID NO: 2 or 5, and encodes a protein having activity to bind to a brassinosteroid master transcription factor BIL1 protein to inhibit the transfer of the BIL1 protein into the nucleus, thereby down-regulating brassinosteroid signaling; (d) a gene encoding a protein that consists of the amino acid sequence shown in SEQ ID NO: 3 or 6; (e) a gene encoding a protein that consists of an amino acid sequence derived from the amino acid sequence shown in SEQ ID NO: 3 or 6 by deletion, substitution, or addition of 1 or several amino acids, and has activity to bind to a brassinosteroid master transcription factor BIL1 protein to inhibit the transfer of the BIL1 protein into the nucleus, thereby down-regulating brassinosteroid signaling; and (f) a gene encoding a protein that consists of an amino acid sequence having 60% or higher sequence identity with the amino acid sequence shown in SEQ ID NO: 3 or 6, and has activity to bind to a brassinosteroid master transcription factor BIL1 protein to inhibit the transfer of the BIL1 protein into the nucleus, thereby down-regulating brassinosteroid signaling.
12. The method according to claim 11, wherein increasing biomass means promotion of plant length or stem length elongation, promotion of vascular bundle differentiation, petiole elongation, or leaf epinasty.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
EMBODIMENTS FOR CARRYING OUT THE INVENTION
[0051] The present invention is described in detail below.
1. BSS Gene
[0052] The present invention concerns the use of the BSS gene, which is a causative gene of the Arabidopsis bss1 (brz-sensitive short hypocotyl 1) mutant. According to the present invention, a method for regulating plant growth by regulating expression of the BSS gene is provided.
[0053] BSS genes have been widely preserved not only experimental Arabidopsis plants but also rice, maize, sugar cane, and the like beyond the plant species and a BSS gene derived from any plant can also be used. Examples of plants from which plant BSS genes are derived include, but are not limited to, monocotyledon plants such as rice, barley, wheat, corn, sugar cane, lawn grass, sorghum, millet, and Japanese millet and dicotyledon plants such as soybean, rapeseed, tomato, and potato.
[0054] For example, the BSS gene of Arabidopsis (AtBSS gene) has the genomic DNA sequence shown in SEQ ID NO: 1 and the cDNA sequence shown in SEQ ID NO: 2. The open reading frame (ORF) of the BSS gene consists of a region between the base at position 278 and the base at position 826 (549 bases) of the nucleotide sequence shown in SEQ ID NO: 1 and encodes a protein comprising the amino acid sequence (182 amino acids) shown in SEQ ID NO: 3. The BSS gene of rice (OsBSS gene) has the genomic DNA sequence shown in SEQ ID NO: 4 and the cDNA sequence shown in SEQ ID NO: 5. The open reading frame (ORF) of the BSS gene consists of a region between the base at position 1 and the base at position 528 and a region between the base at position 1497 and the base at position 2453 (1485 bases) of the nucleotide sequence shown in SEQ ID NO: 4 and encodes a protein comprising the amino acid sequence (494 amino acids) shown in SEQ ID NO: 6.
[0055] As the BSS gene used in the present invention, it is possible to use a homolog BSS gene consisting of a nucleotide sequence similar to the nucleotide sequence shown in SEQ ID NO: 2 or 5 as well as the AtBSS gene consisting of the sequence shown in SEQ ID NO: 2 and the OsBSS gene shown in SEQ ID NO: 5, as long as they have the function comparable to that of the BSS gene. Such homolog BSS gene may be a naturally occurring gene or an artificially prepared gene. For example, it may be homologs (including orthologs and paralogs) of the nucleotide sequences shown in the above sequence identification numbers or artificially mutated genes.
[0056] Therefore, the BSS gene used in the present invention includes the following genes:
[0057] (a) a gene comprising DNA that consists of the nucleotide sequence shown in SEQ ID NO: 2 or 5;
[0058] (b) a gene comprising DNA that hybridizes under stringent conditions to DNA consisting of a nucleotide sequence complementary to DNA consisting of the nucleotide sequence shown in SEQ ID NO: 2 or 5, and encodes a protein having activity to bind to a brassinosteroid master transcription factor BIL1 protein to inhibit the transfer of the BIL1 protein into the nucleus, thereby down-regulating brassinosteroid signaling;
[0059] (c) a gene comprising DNA that consists of a nucleotide sequence having 60% or higher sequence identity with the nucleotide sequence shown in SEQ ID NO: 2 or 5, and encodes a protein having activity to bind to a brassinosteroid master transcription factor BIL1 protein to inhibit the transfer of the BIL1 protein into the nucleus, thereby down-regulating brassinosteroid signaling;
[0060] (d) a gene encoding a protein that consists of the amino acid sequence shown in SEQ ID NO: 3 or 6;
[0061] (e) a gene encoding a protein that consists of an amino acid sequence derived from the amino acid sequence shown in SEQ ID NO: 3 or 6 by deletion, substitution, or addition of 1 or several amino acids, and has activity to bind to a brassinosteroid master transcription factor BIL1 protein to inhibit the transfer of the BIL1 protein into the nucleus, thereby down-regulating brassinosteroid signaling; and
[0062] (f) a gene encoding a protein that consists of an amino acid sequence having 60% or higher sequence identity with the amino acid sequence shown in SEQ ID NO: 3 or 6, and has activity to bind to a brassinosteroid master transcription factor BIL1 protein to inhibit the transfer of the BIL1 protein into the nucleus, thereby down-regulating brassinosteroid signaling.
[0063] The term stringent conditions as used herein refers to the conditions under which so-called specific hybrids are formed but non-specific hybrids are not formed. A person skilled in the art can adequately select the stringent hybridization conditions by referring to Sambrook et al., Molecular Cloning, A Laboratory Manual, 3rd Ed., Cold Spring Harbor Laboratory (2001). For example, hybridization is carried out by performing pre-hybridization in a hybridization solution containing 25% formamide, or 50% formamide for more stringent conditions, 4SSC, 50 mM HEPES (pH 7.0), 10 Denhart's solution, and 20 g/ml denatured salmon sperm DNA at 42 C. overnight, adding a labeled probe thereto, and incubating the resultant at 42 C. overnight. In the subsequent step of washing, the washing solution and temperature conditions are approximately 1SSC, 0.1% SDS, 37 C., approximately 0.5SSC, 0.1% SDS, 42 C. for more stringent conditions, and approximately 0.2SSC, 0.1% SDS, 65 C. for even more stringent conditions. The degree of stringency is increased as the temperature becomes higher and the salt concentration becomes lower. This enables isolation of a gene with higher identity.
[0064] It should be noted that the combinations of SSC, SDS, and temperature conditions described above are examples. A person skilled in the art can adequately combine the above or other factors that determine the hybridization stringency (e.g., probe concentration, probe length, and hybridization reaction duration) to realize stringency similar to that described above.
[0065] DNA obtained by hybridization carried out under the above stringent conditions usually has high identity to DNA represented by the nucleotide sequence shown in SEQ ID NO: 2 or 5. The term high identity as used herein refers to the sequence identity of at least 60% or higher, preferably 70% or higher, 80% or higher, or 85% or higher, more preferably 90% or higher, further preferably 95% or higher, and most preferably 97% or higher (e.g., 98% to 99%) to any of the nucleotide sequences shown in the above sequence identification numbers.
[0066] In relation to the expression amino acid sequence derived by deletion, substitution, or addition of 1 or several amino acids, the number of amino acids that may be deleted, substituted, or added is the number of amino acids that can be deleted, substituted, or added in accordance with a known method for preparing mutant proteins, such as site-directed mutagenesis. The number is not limited as long as activity to bind to a brassinosteroid master transcription factor BIL1 protein to inhibit the transfer of the BIL1 protein into the nucleus, thereby down-regulating brassinosteroid signaling is maintained. Usually, the number is for example, 1 to 20, preferably 1 to 10, more preferably 1 to 7, and further preferably 1 to 5. Here, examples of substitution with other amino acids include substitution between hydrophobic amino acids (Ala, Ile, Leu, Met, Phe, Pro, Trp, Thr, and Val), hydrophilic amino acids (Arg, Asp, Asn, Cys, Glu, Gln, Gly, His, Lys, Ser, and Thr), amino acids having an aliphatic side chain (Gly, Ala, Val, Leu, Ile, and Pro), and amino acids having a hydroxyl-group-containing side chain (Ser, Thr, and Tyr). The term mutation used herein primarily means a mutation that is artificially introduced in accordance with a known method for preparing mutant proteins, although a naturally occurring similar mutation may be employed. It has been known that a polypeptide having an amino acid sequence derived from a given amino acid sequence by deletion or addition of 1 or several amino acid residues and/or substitution with a different amino acid maintains its biological activity.
[0067] The term 60% or higher identity used in relation to the amino acid sequence refers to sequence identity of preferably 70% or higher, preferably 80% or higher, or 85% or higher, more preferably 90% or higher, further preferably 95% or higher, and most preferably 97% or higher (e.g., 98% to 99%).
[0068] The term sequence identity used herein refers to a value calculated by aligning at least two sequences to be compared, determining identical residues present in each sequence, determining the number of matching sites, dividing the number of the matching sites by the total number of residues in the sequence regions to be compared, and multiplying the obtained value by 100. Identity of sequence can be determined using the BLASTN (at the nucleic acid level) or BLASTX (at the amino acid level) program.
[0069] The BSS gene used in the present invention can be prepared using a known technique. For example, total mRNA may be prepared from an Arabidopsis thaliana or rice tissue extract, primers may be designed based on the nucleotide sequence shown in SEQ ID NO: 2 or 5, and full-length cDNA of the nucleotide sequence shown in the above sequence identification number can be obtained by performing the RACE method or the like. Alternatively, a cDNA library may be prepared from an Arabidopsis thaliana or rice tissue extract, a probe may be designed based on the nucleotide sequence shown in the above sequence identification number, and the gene can be obtained using the hybridization method. Further, the gene may be artificially synthesized based on the nucleotide sequence shown in the above sequence identification number.
[0070] A person skilled in the art can readily obtain a homolog of the BSS gene by referring to, for example, Molecular Cloning (Sambrook, J. et al., Molecular Cloning: A Laboratory Manual 3rd ed., Cold Spring Harbor Laboratory Press, 10 Skyline Drive Plainview, N.Y., (2001)).
[0071] For example, deletion, addition, and substitution of amino acids can be carried out by introducing a mutation into a gene encoding the above protein using a technique known in the art. Mutation can be introduced into a gene by a known technique such as the Kunkel method or the Gapped duplex method, or a method in accordance therewith. For example, a kit for introducing mutation that utilizes the site-directed mutagenesis method (e.g., Mutant-K (TAKARA) or Mutant-G (TAKARA)), or the kit of LA PCR in vitro Mutagenesis series (TAKARA)) can be used. Alternatively, a sequence having a mutation being introduced into the nucleotide sequence shown in the above sequence identification number may be synthesized using a commercially available nucleic acid synthesis apparatus.
2. Transgenic Plant and Method for Producing the Same
[0072] The transgenic plant of the present invention can be produced via transformation of a plant of interest by suppressing or promoting expression of the BSS gene in the plant body. Suppression of expression of the BSS gene includes suppression of transcription of the BSS gene and suppression of translation of the BSS gene into a protein. Suppression of the expression also includes reduction of the expression as well as complete silencing of the expression. On the other hand, promotion of expression of the BSS gene includes promotion of transcription of the BSS gene and promotion of translation of the BSS gene into a protein. Promotion of the expression also includes an increase of the expression as well as overexpression.
[0073] Transgenic plants in which expression of the BSS gene is suppressed can be produced by suppressing expression of the BSS gene present in a plant body. Examples of a method for suppressing expression of the BSS gene include the antisense method, the RNAi method, the ribozyme method, and the co-suppression method. These methods are conducted by introducing DNA that suppresses expression of the endogenous BSS gene. The term endogenous BSS gene used herein refers to the BSS gene originally present in a plant to be transformed.
[0074] In the antisense method, DNA that suppresses expression of the BSS gene, which is used herein, is antisense DNA that encodes RNA (antisense RNA) having a sequence complementary to a whole or a part of mRNA transcribed from the gene. Antisense DNA binds to its complementary strand, i.e., mRNA that is a transcription product of the BSS gene, thereby making it possible to inhibit translation of the BSS gene and suppress expression of the gene. The nucleotide sequence length of antisense DNA encoding antisense RNA is not necessarily the full length of the nucleotide sequence of mRNA of the BSS gene and it may be a partial length thereof as long as expression of the BSS gene can be suppressed. Such partial length is a length corresponding to 30%, preferably 50%, more preferably 80%, and further preferably 90% of the full-length nucleotide sequence of mRNA of the BSS gene.
[0075] Antisense DNA is ligated in the antisense direction to the recombinant vector. Ligation may be established directly or via a linker. Antisense DNA is ligated to the vector in a manner such that when antisense DNA is transcribed in a host, antisense RNA that hybridizes to mRNA of the BSS gene is generated, and then, the vector is introduced into plant cells. In order to ligate antisense DNA to the vector such that antisense RNA is generated, antisense DNA is ligated downstream of the DNA fragment having a promoter sequence in the antisense direction (opposite direction) such that it is transcribed into RNA by the operation of the promoter.
[0076] In the RNAi method, it is also possible to use, as DNA that suppresses expression of the BSS gene, DNA encoding RNA that suppresses expression of the BSS gene via RNA interference (RNAi), i.e., DNA in which an inverted repeat sequence identical or similar to the sequence of the BSS gene is arranged. The term RNA interference refers to a phenomenon in which when DNA, in which an inverted repeat sequence identical or similar to the sequence of the target gene is arranged, is introduced into a host via transformation, double-stranded RNA from the introduced DNA is expressed and expression of the target gene is suppressed. RNA interference is believed to proceed by the following steps: (i) a step in which mRNA of the target gene and double-stranded RNA from the introduced sequence (double-strand RNA, dsRNA) form a complex referred to as RNA-induced silencing complex (RISC) and complementary RNA is synthesized using the associated sequence as a primer; (ii) a step in which the complex is fragmented by the endogenous RNase; and (iii) a step in which double-stranded RNA (small interfering RNA, siRNA) that has been fragmented into 20 to 30 base pairs serves as the signal of secondary RNA interference, thereby re-degrading mRNA of the target gene. The length of DNA used for the RNAi method may be the full length of the target gene; however, it may be a length of at least 20 bases, preferably 30 bases or more, and more preferably 50 bases or more.
[0077] The vector that expresses dsRNA capable of causing RNAi as hairpin dsRNA is preferably utilized for plant RNAi. This is a system for arranging the DNA sequence corresponding to a dsRNA formation part to form an inverted repeat (IR) at both ends of a linker (spacer) sequence having several or more bases, and transcribing hairpin dsRNA by a promoter that is highly expressed in a plant body, thereby producing siRNA within cells. In addition to the above hairpin-type system, there is also a tandem-type siRNA expression system. In the tandem-type system, sense RNA and antisense RNA are transcribed from two promoters and hybridize with each other within cells, thereby producing siRNA. Such RNAi vector can be readily constructed in accordance with a known method in the art or using a commercially available RNAi vector or system (e.g., psiRNA (Invitrogen) or pSUPER RNAi System (OligoEngine)).
[0078] In the ribozyme method, as a DNA that suppresses expression of the BSS gene, a DNA encoding a ribozyme that is designed to specifically cleave mRNA which is a transcription product of the BSS gene is used. Some ribozymes having an active domain of approximately 40 nucleotides are called hammerhead or hairpin ribozymes, any of which can be used in the present invention. When DNA encoding such ribozyme is used, it may be linked to a promoter and a transcription termination sequence within the recombinant vector so that it is transcribed in plant cells. It is also possible to dispose another trimming ribozyme acting on cis elements for trimming in plant cells on the 5 side and 3 side of the ribozyme portion. Thus, it is possible to precisely cut out only a ribozyme portion from RNA containing the transcribed ribozyme.
[0079] In the co-suppression method, as DNA that suppresses expression of the BSS gene, DNA encoding RNA that suppresses expression of the BSS gene by co-suppression effects, i.e., DNA having a sequence identical or similar to the sequence of the BSS gene is used. The term co-suppression refers to a phenomenon in which when DNA having a sequence identical or similar to the sequence of the target gene is introduced into a host via transformation, expression of both the introduced exogenous gene and the target gene is suppressed. The gene to be used for co-suppression does not need to be completely identical to the BSS gene as a target; however, it has at least 70%, preferably 80% or more, and more preferably 90% or more sequence identity.
[0080] Further, transgenic plants in which expression of the BSS gene is suppressed can be produced by disrupting the BSS gene present in a plant or inhibiting activity of the BSS gene. Examples of the method for disrupting the BSS gene or inhibiting activity of the BSS gene include insertion of T-DNA, insertion of transposon, fast neutron irradiation, ion beam irradiation, treatment with mutagens [alkylating agent (N-ethyl-N-nitrosourea (ENU), N-methyl-N-nitro-N-nitrosoguanidine (NTG), ethyl methanesulfonate (EMS), etc.); base analogs (BrdU, etc.); polycyclic aromatic hydrocarbons (benzopyrene, chrysene, etc.); DNA intercalators (ethidium bromide, etc.); and DNA crosslinking agents (cisplatin, mitomycin C, etc.)], insertion of a gene having a dominant negative trait, and introducing a mutation or deletion into the BSS gene via treatment using a site-specific DNA degrading enzyme (e.g., Zinc Finger Nuclease (ZFN), Transciprion Acriator Like Effector Nucease (TALEN)). In the site-directed mutagenesis method, the mutation (e.g., substitution) introducing site may be any site where the activity of the BSS protein encoded by the gene is inhibited after mutagenesis, and it is preferably a site where the activity of BSS protein encoded by the gene disappears after mutagenesis. Examples of mutation to be introduced include frameshift mutation, nonsense mutation, and missense mutation. Of these, frameshift mutation or nonsense mutation is preferred.
[0081] Meanwhile, transgenic plants in which expression of the BSS gene is promoted can be produced by introducing the BSS gene in the sense direction. Therefore, a method for suppressing expression of the BSS gene or a method for promoting expression of the BSS gene may be selected and carried out in accordance with the trait of interest.
[0082] Basically, vectors used in the above method for suppressing or promoting expression of the BSS gene may be general recombinant vectors for plant transformation. Examples of vectors that can be preferably used include pBI, pPZP, pSMA, and pCAMBIA vectors which can introduce the BSS gene or DNA that suppress expression of the BSS gene (referred to as target genes) into a plant via Agrobacterium. Use of pBI binary vectors or intermediate vectors is particularly preferable, and examples thereof include pBI121, pBI101, pBI101.2, and pBI101.3. The term binary vector refers to a shuttle vector replicable in Escherichia coli and Agrobacterium. When a plant is infected with Agrobacterium that harbors a binary vector, DNA located in a region defined by the border sequences (LB sequence and RB sequence) on the vector can be integrated into plant nuclear DNA. On the other hand, pUC vectors are capable of directly introducing a gene into a plant, and examples thereof include pUC18, pUC19 and pUC9. Further, plant virus vectors, such as cauliflower mosaic virus (CaMV), bean golden mosaic virus (BGMV), and tobacco mosaic virus (TMV) vectors, can also be used.
[0083] When a binary vector plasmid is used, a target gene is inserted into a site between border sequences (LB and RB sequences) of the binary vector, and the recombinant vector is amplified in Escherichia coli. Subsequently, the amplified recombinant vector is introduced into, for example, Agrobacterium tumefaciens GV3101, C58, LBA4404, EHA101 or EHA105, or Agrobacterium rhizogenes LBA1334, by the electroporation method or the like, and the Agrobacterium is used for plant transduction.
[0084] For inserting a target gene into a vector, one may employ a method in which purified DNA is first cleaved with an adequate restriction enzyme and the cleaved fragment is then inserted into a restriction enzyme site or multicloning site of adequate vector DNA to connect the fragment to the vector.
[0085] In addition, a promoter, an enhancer, a terminator, a replication origin that allows the use of a binary vector (e.g., a replication origin derived from Ti or Ri plasmid), a selection marker gene, and the like can be connected to a site upstream, inside, or downstream of the target gene in the recombinant vector.
[0086] A promoter may not be derived from a plant, provided that it is DNA that can function in a plant cell and bring about expression in a given tissue or at a given growth stage of a plant. Specific examples include cauliflower mosaic virus (CaMV) 35S promoter, nopaline synthase gene promoter (Pnos), maize-derived ubiquitin promoter, rice-derived actin promoter, and tobacco-derived PR protein promoter. When a target gene is to be expressed specifically in a given organ, a promoter that is expressed in a tissue-specific manner can be used. For example, the plant growth-regulating effect of the target gene of the present invention can be efficiently attained by using a vascular bundle-specific gene promoter.
[0087] An enhancer is used, for example, for increasing the expression efficiency of a target gene. Examples thereof include an enhancer region that comprises an upstream sequence in the CaMV 35S promoter.
[0088] Any sequence may be used as a terminator, provided that it can terminate transcription of a gene transcribed by a promoter. Examples thereof include terminators of the nopaline synthase (NOS) gene, the octopine synthase (OCS) gene, and the CaMV 35S RNA gene.
[0089] Examples of selection marker genes include ampicillin-resistant gene, neomycin-resistant gene, hygromycin-resistant gene, bialaphos-resistant gene, and dihydrofolate reductase gene.
[0090] The selection marker gene may be connected to a single plasmid together with a target gene to prepare a recombinant vector. Alternatively, a recombinant vector obtained by connecting the selection marker gene to a plasmid and a recombinant vector obtained by connecting a target gene may be separately prepared. When the vectors are separately prepared, the vectors are co-transfected (co-introduced) into a host.
[0091] The transgenic plant of the present invention can be produced by introducing the target gene into a target plant. In the present invention, the term introduction of a gene means that a target gene is introduced into cells of the above host plant in a manner that allows the gene to express using, for example, a known genetic engineering technique. The introduced gene may be integrated into the genomic DNA of a host plant or may be present being comprised in a foreign vector.
[0092] As a method for introducing the target gene into a plant as described above, one of a variety of methods that have been reported and established can be adequately utilized. Examples thereof include the Agrobacterium method, the PEG-calcium phosphate method, the electroporation method, the liposome method, the particle gun method, and the microinjection method. When the Agrobacterium method is employed, a protoplast, a tissue section, or a plant body as it is (i.e., the in planta method) may be used. When a protoplast is used, the introduction can be carried out using a method in which the protoplast is co-cultured with Agrobacterium harboring a Ti plasmid or an Ri plasmid (for Agrobacterium tumefaciens or Agrobacterium rhizogenes, respectively), or the protoplast is fused to Agrobacterium which has been converted to a spheroplast (the spheroplast method). When a tissue section is used, the introduction can be carried out using a method in which an aseptically cultured leaf disc of a target plant or a callus (cultured undifferentiated cell) is infected. When the in planta method using a seed or a plant body is employed (i.e., in a system that does not involve tissue culture with the addition of plant hormones), the introduction can be carried out by direct treatment of an imbibed seed, a young seedling (germ), a potted plant, or the like with Agrobacterium. These plant transformation methods can be carried out in accordance with the descriptions of general textbooks such as Shinban, Model shokubutsu no jikken protocol, Idengakuteki shuhou kara genome kaiseki made (New edition, Experimental protocols for model plants, From genetic engineering technique to genome analysis), 2001, supervised by Isao Shimamoto & Kiyotaka Okada, Shujunsha.
[0093] One can confirm whether or not a target gene has been incorporated into a plant using the PCR method, the Southern hybridization method, the Northern hybridization method, the Western blotting method or the like. For example, DNA is prepared from a transgenic plant, primers specific for the target gene are designed, and PCR is then carried out. After PCR has been carried out, the amplification product is subjected to agarose gel electrophoresis, polyacrylamide gel electrophoresis, capillary electrophoresis or the like, and stained with ethidium bromide, a SYBR Green solution or the like. Transformation can be confirmed based on detection of the amplification product as a single band. Alternatively, the amplification product can be detected by carrying out PCR with the use of primers that have been labeled with a fluorescent dye or the like beforehand. Further, one may use a method in which the amplification product is bound to a solid phase such as a microplate, and confirmed using fluorescence, an enzymatic reaction or the like. Further, one may confirm that a target gene introduced into a plant cell is expressed (that is, the plant is transformed) by extracting proteins from the plant cell, fractionating the proteins by two-dimensional electrophoresis, and detecting a band of the protein encoded by the target gene.
[0094] Alternatively, a vector in which one of a variety of reporter genes (e.g., a gene for -glucuronidase (GUS), luciferase (LUC), green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT) or -galactosidase (LacZ)) is connected downstream of a target gene is prepared. Agrobacterium into which the aforementioned vector has been introduced is used to transform a plant in a manner similar to that as described above. Then, expression of the reporter gene is measured. Thereby, transformation of the plant can be confirmed.
[0095] The plant used for transformation in the present invention may be a monocotyledonous plant or a dicotyledonous plant. Examples of plants used for transformation in the present invention include plants belonging to the family Brassicaceae, the family Gramineae, the family Solanaceae, the family Leguminosae, the family Compositae, the family Arecaceae, the family Anacardiaceae, the family Cucurbitaceae, the family Rosaceae, the family Caryophyllaceae, the family Salicaceae, the family Myrtaceae, and the family Liliaceae, for example (see below).
[0096] The family Brassicaceae: Arabidopsis thaliana, rapeseed (Aburana) (Brassica rapa, Brassica napus), cabbage (Brassica oleracea var. capitata), rapeseed (Natane) (Brassica rapa, Brassica napus), rape blossoms (Brassica rapa, Brassica napus), Chinese cabbage (Brassica rapa var. pekinensis), qing-geng-cai (Brassica rapa var. chinensis), turnip (Brassica rapa var. rapa), nozawana (Brassica rapa var. hakabura), potherb mustard (Brassica rapa var. lancinifolia), komatsuna (Brassica rapa var. peruviridis), Chinese cabbage (Paku Choi) (Brassica rapa var. chinensis), radish (Brassica Raphanus sativus), wasabi (Wasabia japonica), etc.
[0097] The family Gramineae: corn (Zea mays), rice (Oryza sativa), barley (Hordeum vulgare), wheat (Triticum aestivum), bamboo (Phyllostachys), sugarcane (Saccharum officinarum), napier grass (Pennisetum pupureum), Erianthus (Erianthus ravenae), Japanese silver grass (Miscanthus virgatum), Sorghum (Sorghum), switchgrass (Panicum), etc.
[0098] The family Solanaceae: tobacco (Nicotiana tabacum), eggplant (Solanum melongena), potato (Solaneum tuberosum), tomato (Lycopersicon lycopersicum), pepper (Capsicum annuum), petunia (Petunia), etc.
[0099] The family Leguminosae: soybean (Glycine max), pea (Pisum sativum), fava bean (Vicia faba), Japanese wisteria (Wisteria floribunda), peanut (Arachis. hypogaea), Lotus japonicus (Lotus corniculatus var. japonicus), common bean (Phaseolus vulgaris), azuki (Vigna angularis), acacia (Acacia), etc.
[0100] The family Compositae: Chrysanthemum (Chrysanthemum morifolium), sunflower (Helianthus annuus), etc.
[0101] The family Arecaceae: oil palm (Elaeis guineensis, Elaeis oleifera), coconut (Cocos nucifera), Date Palm (Phoenix dactylifera), wax palm (Copernicia)
[0102] The family Anacardiaceae: hazenoki (Rhus succedanea), cashew (Anacardium occidentale), poison oak (Toxicodendron vernicifluum), mango (Mangifera indica), pistachio (Pistacia vera), etc.
[0103] The family Cucurbitaceae: pumpkin (Cucurbita maxima, Cucurbita moschata, Cucurbita pepo), cucumber (Cucumis sativus), Trichosanthes (karasu uri) (Trichosanthes cucumeroides), gourd (Lagenaria siceraria var. gourda), etc.
[0104] The family Rosaceae: almond (Amygdalus communis), rose (Rosa), strawberry (Fragaria), cherry (Prunus), apple (Malus pumila var. domestica), etc.
[0105] The family Caryophyllaceae: carnation (Dianthus caryophyllus), etc.
[0106] The family Salicaceae: poplar (Populus trichocarpa, Populus nigra, Populus tremula), etc.
[0107] The family Myrtaceae: eucalyptus (Eucalyptus camaldulensis, Eucalyptus grandis), etc.
[0108] The family Liliaceae: tulip (Tulipa), lily (Lilium), etc.
[0109] Examples of plant materials to be subjected to transformation in the present invention include: plant organs such as stems, leaves, seeds, embryos, ovules, ovaries, and shoot apices; plant tissues such as anthers and pollens, and the sections thereof; undifferentiated calluses; and cultured plant cells such as protoplasts which are prepared by removing cell walls from the above by enzyme treatment. When the in planta method is employed, an imbibed seed or a whole plant body can be utilized.
[0110] According to the present invention, the term transgenic plant means any one of a whole plant body, a plant organ (e.g., leaf, petal, stem, root, grain, or seed), a plant tissue (e.g., epidermis, phloem, parenchyma, xylem, or vascular bundle), or a cultured plant cell (e.g., callus).
[0111] When a cultured plant cell is to be used, an organ or an individual may be regenerated according to a known tissue culture method in order to regenerate a transformant from a resulting transformed cell. A person skilled in the art can readily carry out such a procedure using a method that is commonly known as a method of regenerating a plant body from a plant cell. For example, a plant body can be regenerated from a plant cell in the following manner.
[0112] At the outset, when a plant tissue or a protoplast is used as a plant material to be subjected to transformation, it is cultured in a medium for callus formation that has been sterilized after adding, for example, inorganic elements, vitamins, carbon sources, saccharides as energy sources or plant growth regulators (plant hormones, such as auxin, cytokinin, gibberellin, abscisic acid, ethylene, or brassinosteroid) to form a dedifferentiated callus which proliferates in an unstructured manner (hereinafter, this process is referred to as callus induction). The thus formed callus is transferred to a fresh medium containing plant growth regulators such as auxin, and then further proliferated (or subcultured).
[0113] Callus induction is carried out on a solid medium such as agar, and subculture is carried out, for example, in a liquid medium. Thereby, the cultivation can be carried out efficiently and in large quantities in the respective cases. Subsequently, the callus proliferated by the aforementioned subculture is cultured under adequate conditions to induce redifferentiation of an organ (hereinafter referred to as induction of redifferentiation), and a complete plant body is regenerated in the end. The induction of redifferentiation can be carried out by adequately setting the types and quantities of respective ingredients such as plant growth regulators (e.g., auxin) and carbon sources in the medium, light, temperature and the like. Such induction of redifferentiation results in formation of adventitious embryo, adventitious root, adventitious bud, adventitious shoot and the like, which further leads to growth into a complete plant body. Alternatively, storage may be conducted in a state prior to the formation of a complete plant body (e.g., encapsulated artificial seed, dry embryo, or freeze-dried cell or tissue).
[0114] The transgenic plants of the present invention also include plant bodies of progenies (T2 and T3 generations) obtained by sexual or asexual reproduction of plant bodies having a gene of interest being introduced (including plant bodies regenerated from transformed cells or calluses), and portions of tissues or organs of the progeny plants (seeds, protoplasts, and the like). The transgenic plant of the present invention can be produced in large quantities by obtaining a reproductive material such as a seed or a protoplast, from a plant body transformed by introduction of the target gene, and then cultivating or culturing the same.
[0115] Among transgenic plants obtained in the manner described above, down regulation of brassinosteroid signaling caused by BSS1 is cancelled in transgenic plants in which expression of the BSS1 gene is suppressed. This results in promotion of plant growth, thereby increasing biomass per plant. In the present invention, the term biomass refers to the amount of a plant body or a part thereof existing within an arbitrary space at a given time. The term is used to encompass substances, foods, materials, fuels, resources, and the like derived from said plant or parts thereof. Specifically, increased biomass refers to hypertrophy of a subterranean stem (rhizom, corm, tuber, bulb), a terrestrial stem, a flowering stem or a vine, hypertrophy of a seed, acceleration of elongation of stem length, plant length, culm length, or ear length, or enlargement of a source organ such as a leaf. Biomass increased by the present invention is characterized in that the height of a plant body increases 1.2 fold or more, preferably 1.5 fold or more, more preferably 2 fold or more over a control wild-type plant.
[0116] In addition, among transgenic plants obtained in the manner described above, down regulation of brassinosteroid signaling caused by BSS1 is induced, resulting in dwarfing of transgenic plants in which expression of the BSS1 gene is promoted. The term dwarfing typically refers to suppression of plant length elongation. Dwarfing is characterized in that the plant length of a plant body decreases 1.2 fold or more, preferably 1.5 fold or more, more preferably 2 fold or more over a control wild-type plant. The phenotype trait of having a short plant length means that a plant is resistant to wind damage due to a typhoon or the like and is unlikely to fall down even with an increase in the number of grains. In the case of rice, for example, it is possible to increase the number of rows for planting seedlings and to increase the density of planted seedlings per unit area. When a fruit tree (e.g., banana or mango) or a palm tree (e.g., date palm or coconut palm) with a height that may be several meters is imparted with such trait, it is advantageous in that harvesting of fruits can be easily carried out, and yield per unit resource (water, a fertilizer, etc.) increases, for example.
EXAMPLES
[0117] The present invention is hereafter described in greater detail with reference to the following examples, although the present invention is not limited thereto.
[0118] The materials and methods used in the Examples are described below.
[Materials and Methods]
(1) Plant Materials and Growth Conditions
[0119] Arabidopsis thaliana ecotype Columbia (Col-0) was used as the wild-type plant. The seeds were germinated on Murashige and Skoog (MS) medium (Duchefa) with 0.8% phytoagar (Duchefa) and 1.5% sucrose and were subsequently transferred to soil. The plants were grown at 22 C. under white light (a 16-h light/8-h dark cycle for long-day conditions).
(2) Screening for the Bss1-1D Mutant
[0120] Approximately 10,000 RIKEN GSC Arabidopsis activation-tagging lines (Nakazawa et al., 2003, Activation tagging, a novel tool to dissect the functions of a gene family. Plant J. 34: 741-750) were screened on MS medium containing 3 M Brz (Asami et al., 2000, Characterization of brassinazole, a triazole-type brassinosteroid biosynthesis inhibitor, Plant Physiol. 123: 93-100). After growth for 7 days in the dark, seedlings with shorter hypocotyls than those of the controls were identified and transferred to soil. Inverse PCR was used to amplify the flanking genomic sequences of the T-DNA of pPCVICE4HPT as previously described (Bradshaw Jr., 2005, Mutations in CAX1 produce phenotypes characteristic of plants tolerant to serpentine soils, New Phytol. 167: 81-88). The total RNA was extracted from dark-grown 3-day-old seedlings of wild-type and bss1-1D plants using an RNeasy Plant Mini Kit (QIAGEN). First-strand cDNA was synthesized with PrimeScript (Takara) and used in quantitative real-time PCR (qRT-PCR). The qRT-PCR analysis was performed according to the instructions provided for the Thermal Cycler Dice (Takara) using a SYBR Premix ExTaq system (Takara). The following gene-specific primers were used for qRT-PCR analysis: (for BSS1) 5-CATGACCTAACCTCGACTTT-3 (SEQ ID NO: 7) and 5-CCCATCACCATTAGCTTC-3 (SEQ ID NO: 8); (for the constitutively expressed control gene ACT2) 5-CGCCATCCAAGCTGTTCTC-3 (SEQ ID NO: 9) and 5-TCACGTCCAGCAAGGTCAAG-3 (SEQ ID NO: 10).
(3) Generation of Transgenic Plants
[0121] To recapitulate the bss1-1D phenotype and analyze the subcellular localization, BSS1 cDNA without a stop codon was amplified from Arabidopsis Col-0 cDNA using the BSS1-Forward 5-CACCATGAGCAATACTTCGAAGAATCACTCAAA-3 (SEQ ID NO: 11) and BSS1-Reverse 5-GAAATGGTGGTGGTGGTGATGATACATC-3 (SEQ ID NO: 12) primers, cloned into pENTR/D-TOPO (Invitrogen), and subsequently cloned using the Gateway strategy (Invitrogen) into the binary vector pGWB5 (Nakagawa et al., 2007, Development of series of gateway binary vectors, pGWBs, for realizing efficient construction of fusion genes for plant transformation. J. Biosci. Bioeng, 104: 34-41) (http://shimane-u.org/nakagawa/gbv.htm) containing a CaMV 35S promoter and GFP. BSS1 cDNA was cloned between CaMV 35S promoter and GFP.
[0122] To construct the BSS1 promoter fused with GUS and BSS1 fused with GFP driven by its own promoter, a 1.0-kb fragment including the first exon and promoter region and a 3.0-kb fragment including the coding region and promoter region, respectively, were amplified from Arabidopsis Col-0 genomic DNA using the BSS1-GUS-Forward 5-CACCATATGGTCGATCCCAAACCAACAGGAGAA-3 (SEQ ID NO: 13) and BSS1-GUS-Reverse 5-AGTAAGCAACGCGAGCTGCTCGACGCCAAAGTA-3 (SEQ ID NO: 14) primers for the GUS construct and the BSS1-GFP-Forward 5-CACCATATGGTCGATCCCAAACCAACAGGAGAA-3 (SEQ ID NO: 15) and BSS1-GFP-Reverse 5-GAAATGGTGGTGGTGGTGATGATACATC-3 (SEQ ID NO: 16) primers for the GFP construct.
[0123] The amplified products were cloned into pENTR/D-TOPO (Invitrogen) and subsequently cloned into the binary vectors pGWB3 and pGWB4 using the Gateway strategy (Invitrogen). To analyze the subcellular localization of BIL1, cDNA without a stop codon was amplified using the BIL1-Forward 5-CACCATGACTTCGGATGGAGCTAC-3 (SEQ ID NO: 17) and BIL1-Reverse 5-ACCACGAGCCTTCCCATTTCC-3 (SEQ ID NO: 18) primers, cloned into pENTR/D-TOPO (Invitrogen), and subsequently cloned into the binary vector pGWB5. The resulting CaMV 35S-BSS1-GFP, CaMV 35S-BIL1-GFP, BSS1 promoter:BSS1-GFP, and BSS1 promoter: GUS fusion constructs were transformed into Col-0 via the floral dipping method (Clough and Bent., 1998). The transgenic plants were screened on MS medium containing 25 mg/L kanamycin.
(4) Quantitative Real-Time PCR (qRT-PCR)
[0124] Total RNA was extracted from plants using an RNeasy Plant Mini Kit (QIAGEN).
[0125] The first-strand cDNA was synthesized using PrimeScript (Takara) and was used in qRT-PCR. The qRT-PCR was performed according to the instructions provided for the Thermal Cycler Dice (Takara) using the SYBR Premix ExTaq system (Takara). The following primers were used: (for TCH4) TCH4-Forward 5-CGAGTCTTGGAACGCTGAT-3 (SEQ ID NO: 19) and TCH4-Reverse 5-CTTCTTGTTGAAAGCCACGG-3 (SEQ ID NO: 20) primers; (for BAS1) BAS1-Forward 5-GCCAAATTGACACTCGCTGTAA-3 (SEQ ID NO: 21) and BAS1-Reverse 5-GACGGTAGGTGCATGCTGATAA-3 (SEQ ID NO: 22) primers; (for IAA19) IAA19-Forward 5-GAAGGACTCGGGCTTGAGAT-3 (SEQ ID NO: 23) and IAA19-Reverse 5-GACGCCGCTTTCACATTG-3 (SEQ ID NO: 24) primers; and (for SAUR) SAUR-AC1-Forward 5-GAGATATGTGGTGCCGGTTT-3 (SEQ ID NO: 25) and SAUR-AC1-Reverse 5-GTATTGTTAAGCCGCCCATT-3 (SEQ ID NO: 26) primers.
(5) GUS Staining
[0126] The seedlings of the BSS1 promoter: GUS transgenic plants were used for the histochemical detection of GUS expression. The samples were stained at 37 C. overnight in GUS staining solution as previously described (Ito and Fukuda, 2002, ZEN1 is a key enzyme in the degradation of nuclear DNA during programmed cell death of tracheary elements. Plant Cell 14: 3201-3211). To test the induction of GUS expression, 3-day-old transgenic seedlings were grown on medium with 3 M Brz or dimethyl sulfoxide (DMSO) as a control.
(6) Fluorescence Microscopic Observation
[0127] The plants that were transformed with the CaMV35S-BSS1-GFP construct BSS1(-GFP)-OX and the CaMV35S-BIL1-GFP construct BIL1-GFP-OX were observed via confocal laser scanning microscopy with a BX60 fluorescence microscope (Olympus) equipped with a Model CSU10 confocal scanner (Yokogawa Electric) and LSM700 (Zeiss).
(7) BFA Treatment and FM4-64 Staining
[0128] FM4-64 (Molecular Probes) dissolved in water was applied to Arabidopsis plants at a final concentration of 4 M for 3 minutes. The plants were washed with water to remove the excessive amount of the stain and observed. A DMSO-base stock solution of Brefeldin A (BFA) (Sigma) was applied to the cells at a final concentration of 50 M for 1 hour.
(8) Analysis of Signal Intensities
[0129] The images were analyzed using ImageJ software (http://rsb.info.nih.gov/ij/). To measure the ratio of the nuclear and cytosolic signals of BIL1-GFP for each cell, the signal intensities in the nucleus and cytosol were calculated from the mean of the intensity in each area. The nuclear to cytosolic signal ratio was then calculated for each cell. The average nuclear/cytosolic signal ratio and standard error were calculated from measurements of at least 54 cells from each line (
(9) BiFC
[0130] The BSS1, BIL1, and BES1 cDNA were amplified using the BSS1-Forward and BSS1-Reverse-SC 5-CTAGAAATGGTGGTGGTGGTGATGATAC-3 (SEQ ID NO: 27) primers for BSS1, the BIL1-Forward and BIL1-Reverse primers for BIL1, and the BES1-Forward 5-CACCATGACGTCTGACGGAGCAAC-3 (SEQ ID NO: 28) and BES1-Reverse 5-ACTATGAGCTTTACCATTTCCAAG-3 (SEQ ID NO: 29) primers for BES1, cloned into pENTR/D-TOPO (Invitrogen), and subsequently cloned into the binary Gateway expression vectors nEYFP/pUGW0 and cEYFP/pUGW2 by LR recombination. The resulting vectors encoding nEYFP-BSS1 and nEYFP-BIL1 or BES1-cEYFP were used for a transient expression analysis in Arabidopsis suspension-cultured cells as previously described (Ueda et al., 2004, Functional differentiation of endosomes in Arabidopsis cells, Plant J. 40: 783-789). The protoplasts were observed using an LSM700 microscope (Zeiss).
(10) Immunoblot Analysis
[0131] Light-grown 7- and 10-day-old wild-type, bss1-1D, BSS1-OX, bop1-3 and bop1-3 bop2-1 seedlings were ground in liquid nitrogen and extracted by boiling with equal volumes/fresh weight of 1 Laemmli buffer [50 mM Tris-HCl (pH 6.8), 100 mM DTT, 2% (w/v) SDS, 0.1% (w/v) bromophenol blue, and 10% (w/v) glycerol] for immunoblot analysis of BIL1 and BSS1-GFP. The proteins were separated by SDS-PAGE (10% acrylamide gel). After electrophoresis, the proteins were electrophoretically transferred to a Hybond ECL nitrocellulose membrane (Amersham).
[0132] After blocking in TBS (20 mM Tris, 0.137 M NaCl, pH 7.4, and 0.05% polyoxyethylene sorbitol monolaurate) containing 5% non-fat milk (Morinaga milk) at room temperature, the membrane was incubated overnight at 4 C. in Western Blot Immuno Booster Solution 1 (Takara) with a polyclonal antibody (1:20000) against GFP (Molecular Probes) and BIL1 After washing in TBS containing 1% non-fat milk (Morinaga milk) at room temperature, the blots were incubated in Western Blot Immuno Booster Solution 2 (Takara) with a horseradish peroxidase-conjugated secondary antibody (1:50000) (Promega) for 1 h at room temperature, and the complexes were visualized with ECL Immobilon Western HRP substrate (Millipore). The polyclonal antibody against BIL1 was produced by immunizing rabbits with maltose-binding protein (MBP)-tagged BIL1 proteins (91-336 aa). The antibody was affinity purified using a BIL1 polypeptide. The LAS-4000 mini (Fuji Film) digital imaging system was used for detection. A non-reduction immunoblot analysis was performed essentially as previously described (Mou et al., 2003, Inducers of plant systemic acquired resistance regulate NPR1 function through redox changes, Cell 113: 935-944). The images were analyzed using ImageQuant TL software (version 7.0; GE Healthcare Life Sciences) to determine the relative signal intensity.
(11) Precipitation and Surfactant Treatment of the BSS1 Protein Complex
[0133] A total of 2 g of plant material was frozen in liquid nitrogen, extracted by grinding with a mortar and pestle and suspended in 5 ml of cold extraction buffer (50 mM Tris-HCl, pH 7.5, 20% sucrose and protease inhibitor cocktail (Sigma)). This lysate was centrifuged at 200 g for 2 min at 4 C., and the resulting supernatant was further centrifuged at 50,000 rpm (153,000g) for 2 h at 4 C. The pellets were then suspended in 300 l extraction buffer containing 0.5% surfactant (w/v for CHAPS; v/v for TritonX-100 and Nonidet P-40). The surfactant-treated pellets were centrifuged at 50,000 rpm (153,000g) for 2 h at 4 C. Each supernatant sample was loaded onto an Amicon Ultra-0.5 Centrifugal Filter (Millipore) and concentrated to a volume of 120 l. The recovered supernatants and pellets that were extracted from equal volumes of plant material were used for immunoblot analysis.
(12) Yeast Two-Hybrid Analysis
[0134] cDNA encoding BIL1 without the first 21 amino acids and cDNA encoding BES1 without the first 20 amino acids were cloned into the pDEST32 bait vector (Invitrogen). cDNA encoding full-length BSS1 was cloned into the pDEST22 prey vector (Invitrogen). The resulting plasmids were transformed into the yeast Y187 strain (Clontech). The obtained yeast cells were used for yeast two-hybrid analysis. The positive transformants that grew on the selection medium were further grown and resuspended in assay buffer (180 mM HEPES, 154 mM NaCl, 1 mM L-aspartate (hemi-Mg salt), 1% BSA, and 0.05% Tween 20, pH 7.3) containing 2.23 mM chlorophenol red--D-galactopyranoside (CPRG) as a substrate as described in the manufacturer's protocol for the ProQuest Two-hybrid System (Invitrogen). To quantify the protein-protein interaction, the -galactosidase activity was measured at OD.sub.574 using a Microplate Reader SH-9000 (CORONA electric), and the -galactosidase activity was calculated using the following formula: 1000OD.sub.574/(OD.sub.600 assay time (min)assay volume (mL)).
(13) Immunoprecipitation Analysis
[0135] Plants (5 g fresh weight) grown for 23 days on MS medium were frozen in liquid nitrogen, extracted by grinding with mortar and pestle, and added to 14 mL of cold extraction buffer (50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 5 mM EDTA, 0.1% Triton X-100, 0.2% Nonidet P-40, and protease inhibitor cocktail (Sigma)). This lysate was centrifuged twice at 10,000 g for 5 min at 4 C. The supernatant was incubated for 1 h at 4 C. with anti-FLAG M2 affinity gel (Sigma-Aldrich). The beads were collected and washed four times with ice-cold extraction buffer, and the FLAG-associated proteins were eluted with 2SDS sample loading buffer (4% SDS, 100 mM Tris-HCl (pH 6.8), 200 mM DTT, 20% glycerol and 0.003% [w/v] BPB). After incubation at 100 C. for 5 minutes, the proteins were resolved by SDS-PAGE. The immunoprecipitated proteins were detected by immunoblot analysis on Hybond ECL nitrocellulose membranes (GE Healthcare) using a monoclonal anti-Flag M2 antibody (Sigma-Aldrich) at a 1:500 dilution and an anti-GFP antibody (Molecular Probes) at a 1:2000 dilution.
(14) Accession Number
[0136] Sequence data described herein have been registered with the accession numbers shown below in the Arabidopsis Genome Initiative or GenBank/EMBL data library: BSS1(AT3G57130), BIL1(AT1G75080), BES1 (AT1G19350), BRI1 (AT4G39400), DWF4 (AT3G50660), DET2 (AT2G38050), BIN2 (AT4G18710), 14-3-3 (AT1G22230), SAUR-AC1 (AT4G38850), TCH4 (AT4G57560), CPD (AT5G05690), ACT2 (AT3G18780), AS2 (AT1G65620), AP1 (AT1G69120), Pp-BOP1 (Phypa_119190), Pp-BOP2 (Phypa_121620), NPR1 (AT1G64280), BZS (AT4G39070), LOB (AT5G63090), CUC (AT3G15170), and AHA1 (AT2G18960).
[Results]
(Example 1) Identification of the Causative Gene for the Bss1-1D Mutant
[0137] To search for novel factors involved in BR signaling, approximately 10,000 Arabidopsis thaliana activation-tagged lines (Nakazawa et al., 2003, Activation tagging, a novel tool to dissect the functions of a gene family, Plant J. 34: 741-750) were screened using Brz. As a result, Brz-sensitive-short hypocotyl 1-1D (bss1-1D) was isolated. The bss1-1D mutant had a shorter hypocotyl than that of the wild-type plant when grown in the dark on medium with Brz, although bss1-1D showed a normally elongated hypocotyl in the absence of Brz (
[0138] Light-grown bss1-1D mutants presented phenotypes similar to those of the BR biosynthesis- and signaling-defective mutants det2, bri1, and bin2 (
[0139] To identify the bss1-1D mutation, we analyzed the co-segregation of the Brz-sensitive-short hypocotyl phenotype and found a T-DNA insertion site at the end of chromosome III. The expression of the At3g57130 gene, which is located approximately 1 kb upstream of the T-DNA insertion, was increased in the bss1-1D mutant compared to that of the wild type, as determined by quantitative real time-PCR (qRT-PCR) (
[0140] BSS1 encodes a BTB-POZ domain protein with ankyrin repeats known as BLADE ON PETIOLE 1 (BOP1), which plays an important role in regulating leaf morphogenesis, leaf patterning, and floral abscission. BOP1 belongs to a family of proteins that includes the plant defense response regulator NPR1 (
(Example 2) Elucidation of the Mechanism of BR Signaling Regulation by BSS1
[0141] To determine whether the BR-deficient phenotype was due to the inhibition of BR signaling, expression of BR-responsive genes (TCH4, BAS1, IAA19, and SAUR-AC1) was analyzed by qRT-PCR. The expression of TCH4, BAS1, IAA19, and SAUR-AC1 was increased by active BR brassinolide (BL) and suppressed by Brz in wild-type (WT) plants. In BSS1-OX, expression of TCH4, BAS1, IAA19, and SAUR-AC1 was remarkably reduced under control (Mock) conditions compared to that of the wild-type plant. The suppression ratio of gene expression in BSS1-OX was enhanced in the presence of Brz (
[0142] The phosphorylation status of a downstream biochemical marker, BIL1 which is highly phosphorylated under low-BR conditions and dephosphorylated by BR treatment, was analyzed. The amounts of phosphorylated BIL1 and dephosphorylated BIL1 decreased in bss1-1D and BSS1-OX plants, respectively, compared with the levels in wild-type plants (
[0143] Single and double T-DNA insertion mutants in the promoter region, bop1-3, bop2-1, and bop1-3 bop2-1, exhibited modestly but significantly (P<0.05) longer hypocotyls than those of the wild type when grown in the dark on medium with Brz (
[0144] The BR-regulated expression of BSS1 was examined in more detail by qPCR analysis. As a result, BSS1 expression increased in response to the dose-dependent addition of Brz during early germination (
[0145] The analysis of transgenic plants with the BSS1 promoter region that was fused to the -glucuronidase gene (BSS1 pro: GUS) exhibited strong expression in light-grown seedlings but not in dark-grown seedlings. Brz caused BSS1 expression in the hypocotyls in the dark and in the cotyledons under light and dark conditions (
(Example 3) Subcellular Localization of BSS1 and Characteristics of Punctuate BSS1 Structures
[0146] The subcellular localization of BSS1 was examined. In the CaMV 35S:BSS1-GFP transformant, which had a shorter hypocotyl under Brz conditions and a shorter inflorescence compared to those of the wild-type plant, BSS1-GFP localized to both the nucleus and cytosol. Many punctuate BSS1-GFP signals with diffuse signal were observed mainly in the cytosol (
[0147] FM4-64 stains cellular membranes and endocytic structures, which are observed as punctate structures. Brefeldin A (BFA) inhibits early endosomes and the Golgi apparatus, which appear as punctate cytosolic organelles.
[0148] To determine whether the punctate BSS1-GFP fluorescence signals were from these cellular organelles or protein complex, the BSS1-GFP signal after treatment with FM4-64 (
[0149] Furthermore, punctate BSS1 could be observed in both the CaMV 35S promoter::BSS1-GFP transformant and the BSS1 promoter::BSS1-GFP transformant (
[0150] To determine whether punctate BSS1 is formed by a protein oligomer, a non-reducing immunoblot analysis was performed. Under non-reducing conditions (without DTT), two bands representing the monomeric BSS1-GFP fusion protein (molecular weight: 78,000) and a much higher-molecular-weight protein were detected (
[0151] Further biochemical analyses were performed to enable a more detailed characterization of punctate BSS1 structures. Given that large protein complexes and cellular organelles can be precipitated by ultracentrifugation, ultracentrifugation was performed using protein extracts from BSS1-GFP transformants and mitochondrial protein BIL2-GFP transformants (Davka et al., 2013), which both present punctate GFP fluorescence signals in the cytosol. Pellets from the first ultracentrifugation were treated with the surfactants CHAPS, Nonidet P-40 or TritonX-100. These surfactant treatments solubilize organelle membranes but not protein complexes (Nishikoori et al., 2006; Kinoshita et al., 2005, Binding of brassinosteroids to the extracellular domain of plant receptor kinase BRI1, Nature 433: 167-171). After a second ultracentrifugation with the surfactant-treated fractions, the BIL2-GFP signals were stronger in the pellet and weaker in the supernatant compared with buffer-treated (no surfactant) control fractions. Nevertheless, the BSS1-GFP signals were similarly strong in the pellets after treatment both with and without surfactant. The BSS1-GFP signals were very weak in all of the supernatant fractions and were increased by surfactant treatment (
(Example 4) Elucidation of the Mechanism of Transport of BIL1 from the Cytosol to the Nucleus by the BSS1 Protein Complex
[0152] To investigate the possible function of the punctate BSS1 in BR signaling, the genetic interaction between bill-1D and bss1-1D was analyzed. bss1-1D and bill-1D double mutants presented similar phenotypes to that of bill-1D (
[0153] To detect a direct interaction between BSS1 and BIL1, a yeast two-hybrid assay was performed (
[0154] The BIL1-FLAG protein was immunoprecipitated by anti-FLAG antibodies in transgenic Arabidopsis plants expressing both BSS1-GFP and BIL1-FLAG, and the resulting immunoprecipitates were analyzed by immunoblot analysis with anti-FLAG and anti-GFP antibodies. The anti-FLAG antibody immunoprecipitated BIL1-FLAG and coimmunoprecipitated BSS1-GFP, whereas no BSS1-GFP signal was detected using the immunoprecipitates of the transformants expressing BSS1-GFP alone or wild-type Arabidopsis (
[0155] Both phosphorylated BIL1-FLAG and dephosphorylated BIL1-FLAG were detected by immunoblotting, and the ratio of dephosphorylated BIL1-FLAG to phosphorylated BIL1-FLAG in the input fraction was not altered after immunoprecipitation (
[0156] To analyze the direct interaction between BSS1 and BIL1 in the plant cell and to identify the localization of the possible interaction between the two proteins, a bi-molecular fluorescence complementation (BiFC) analysis was performed. Arabidopsis protoplast cells were cotransformed with nEYFP-BSS1 and/or BIL1-cEYFP constructs. The protoplast cells were treated with medium containing DMSO, 100 nM BL, or 3 M Brz for 12 hours. The YFP fluorescence signal caused by the binding of nYFP-BSS1 and BIL1-cYFP was only observed in the cytosol and not in the nucleus of the Arabidopsis protoplasts (
[0157] After BL treatment, the YFP signal resulting from the interaction between nYFP-BSS1 and BIL1-cYFP was diffuse and spread throughout the cytosol and the nucleus (
[0158] A YFP signal caused by the dimerization with nYFP-BSS1 and BSS1-cYFP was observed in the cytosol, and these signals could in some cases be detected as puncta in the nucleus (
[0159] BIL1-GFP was reported to localize to both the cytosol and nucleus in its diffuse form (Ryu et al., 2007, Nucleocytosolic shuttling of BZR1 mediated by phosphorylation is essential in Arabidopsis brassinosteroid signaling, Plant Cell 19: 2749-2762). However, many punctate BIL1-GFP signals in the cytosol after Brz treatment (
[0160] To analyze the effect of BSS1 for the transport of BIL1 from the cytosol to the nucleus, the nuclear localization of BIL1 under BSS1-deficient and overexpression conditions was observed and measured. The nuclear-to-cytosolic ratio of the BIL1-GFP signal was higher in the bop1-3 bop2-1 background than in the wild-type background. The fluorescence ratio decreased in the wild-type background upon treatment with Brz, but the enhanced nuclear BIL1-GFP signal in the bop1-3 bop2-1 background was strongly maintained under Brz conditions. Punctate BIL1-GFP signals were observed after Brz treatment in the wild-type background but were not detected in bop1-3 bop2-1 plants treated with Brz. These results suggested that BSS1-deficiency promotes resistance to Brz in the regulation of BIL1-GFP localization and puncta formation (
(Example 5) Preparation of Rice Transformants
[0161] A vector was constructed by inserting the rice BSS1 homologous gene (OsBSS1) into pANDA, which is an RNAi vector, and then, transformation of rice was conducted. At first, cloning of the rice BSS1 homologous gene (OsBSS1) was conducted. Total RNA of the wild-type Nipponbare rice was extracted using an RNA easy plant kit (Qiagen). Next, cDNA was synthesized from the total RNA using a SuperScript III kit (Invitrogen). The resulting cDNA was used as a template to conduct PCR using the following primers, thereby amplifying OsBSS1. OsBSS1-GW-F3: caccatgagctccgaggactcgctcaaatccttgtcg (SEQ ID NO: 30) OsBSS1-GW-R3: ttatgcgaagccattggggaagtacatggcggg (SEQ ID NO: 31)
[0162] Cloning of the amplified OsBSS1 was conducted using a pENTR/D TOPO cloning kit (Invitrogen). The prepared vector was introduced into rice (variety: Nipponbare) via the Agrobacterium EHA105 strain in accordance with the high-speed transformation method (Toki et al. Plant J. 47:969-76, 2006). The obtained transformant (BSS1-RNAi strain) had an increase in the number of tiller buds and a trait of tending to have an increase in lamina joint bending (
INDUSTRIAL APPLICABILITY
[0163] The present invention can be utilized in the field of breeding of transgenic plants having controlled plant lengths.
[0164] All publications, patents, and patent applications cited herein are incorporated herein by reference in their entirety.