RECOMBINANT SELF-ASSEMBLING PROTEIN COMPRISING TARGET-ORIENTED PEPTIDE AND USE THEREOF

20180028833 ยท 2018-02-01

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to a recombinant self-assembled protein comprising a target-oriented peptide and a use thereof The recombinant self-assembled protein according to the present invention, comprising a target-oriented peptide, does not require an additional process for providing target-orientedness, and is thus capable of delivering a desired drug to a target tissue or target cell without using additives, such as chemical binders or stabilizers; therefore, the protein can be used for photothermal therapy, drug delivery, imaging, or the like. In particular, according to the present invention, it is possible to prepare gold-protein nanoparticle fusions in which uniform high-density gold nanoparticles having target-orientedness are bound to protein surfaces, without an additional process of surface stabilization or process for providing target-orientedness. Compared with conventional gold nanoparticles, the gold-protein nanoparticle fusions according to the present invention show structural stability against pH variation and concentration variation, and also have excellent target-orientedness; therefore, the fusions can bring a dramatic enhancement to the utilization of gold nanoparticles in photothermal therapy.

Claims

1. A recombinant self-assembled protein, comprising a target-oriented peptide fused to a self-assembled protein.

2. The recombinant self-assembled protein of claim 1, wherein the self-assembled protein is ferritin or hepatitis B virus (HBV) capsid protein.

3. The recombinant self-assembled protein of claim 1, wherein the target-oriented peptide is a cancer-targeting peptide ligand.

4. A recombinant self-assembled protein nanoparticle, comprising the recombinant self-assembled protein of claim 1.

5. The recombinant self-assembled protein nanoparticle of claim 4, wherein the target-oriented peptide is exposed on a surface of the recombinant self-assembled protein nanoparticle.

6. The recombinant self-assembled protein nanoparticle of claim 5, wherein the target-oriented peptide is a cancer-targeting peptide ligand.

Description

BRIEF DESCRIPTION OF DRAWINGS

[0062] FIGS. 1A and 1B show schematic views of expression vectors for preparing a gold-protein nanoparticle fusion.

[0063] FIGS. 2A through 2C show images of protein nanoparticles, and gold-protein nanoparticle fusions separated and purified after expression in E. coli, as analyzed by TEM (A) and EDX (Energy-dispersive X-ray spectroscopy) (B).

[0064] FIG. 3 is a graph in which temperatures are plotted against laser irradiation time (15 min) according to the concentration of the gold-protein nanoparticle fusion.

[0065] FIG. 4 shows results of targeting experiments in which gold-protein nanoparticle fusions with or without a biodiagnostic peptide (EGFR affibody) specific for breast cancer cells therein are allowed to target a target cancer cell line (MDA MB468).

[0066] FIG. 5A shows cancer cell viability vs. the concentration of the gold-protein nanoparticle fusion. FIG. 5B shows results of photothermal therapy in which gold-protein nanoparticle fusions with or without a biodiagnostic peptide (EGFR affibody) specific for breast cancer cells are allowed to target an object cancer cell line (MDA MB468), followed by irradiating layer for 10 min. FIG. 5C shows distributions of viable and dead cells immediately after the gold-protein nanoparticle fusion containing a peptide specific for breast cancer cells was introduced into cells and after necrosis was induced by subsequent irradiation of a laser, as analyzed by double staining.

[0067] FIG. 6A compares targeting effects of the gold-protein nanoparticle fusions with or without a biodiagnostic peptide (EGFR affibody) specific for breast cancer cells on the object cancer cell line (MDA MB468), showing changes in the distribution of the particles with time after the gold-protein fusions were injected via a tail vein into mice in which the cancer cells had been sufficiently developed. FIG. 6B is a graph in which maximum fluorescent intensities from cancer cells are plotted against time after injection, based on the imaging data of FIG. 6A.

[0068] FIGS. 7A through 7E show histological images of cancer cells from mice in which cancer cells had sufficiently been developed after no treatments were performed on the mice, after the gold-protein nanoparticle fusion was injected into the mice, after a laser was irradiated into the mice without injecting the gold-protein nanoparticle fusion, and after the gold-protein nanoparticle fusion was injected into the mice, followed by irradiating a laser for 10 min and for 50 min.

[0069] FIGS. 8A through 8D show histological analysis results of cancer cells from cancer-developed mice to which the gold-protein nanoparticle fusion was injected via a tail vein (A) and allowed to target the cancer cells for 9 hrs (A), followed by irradiating a laser for 50 min (B), and cancer cell size results compared between the groups that were only irradiated with a laser and which were injected with the gold-protein nanoparticle fusion and irradiated with a laser, 5 days after the irradiation.

[0070] FIG. 9 is a schematic view of an expression vector, containing EDB as a target-oriented peptide, for the preparation of a gold-protein nanoparticle fusion.

[0071] FIG. 10 provides TEM images showing that the recombinant HBV capsid protein containing both EDB and a gold ion reducing peptide forms a stable structure.

[0072] FIGS. 11A and 11B show in vivo toxicities compared between a 40-nm gold nanoparticle and the gold-protein nanoparticle fusion of the present invention, with deionized water serving as a control.

[0073] FIG. 12 shows X-ray CT images of mice after intratumoral injection of the gold-protein nanoparticle fusion.

DETAILED DESCRIPTION

[0074] Advantages and characteristics of the present invention, and a method of achieving them will become clear with reference to the following Examples as mentioned below in detail. However, the present invention is not limited to the following Examples, and various types of the present invention will be implemented in various manners. The Examples are disclosed merely to provide a complete description of the present invention and to provide complete understanding of the present invention to those skilled in the art to which the present invention belongs, and the present invention is only defined by the appended claims.

EXAMPLES

Example 1

Construction of Expression Vector for Biosynthesis of HBV Capsid-Derived Chimeric Nanoparticle

[0075] Two gene clones respectively encoding N-NdeI-H6(hexahistidine)-BP(Biotinylated peptides)-Y6(hexatyrosine)-HBVcAg(1-78)-XhoI-C (SEQ ID NO: 2) and N-BamHI-HBVcAg(81-149)-ClaI-C (SEQ ID NO: 3), both derived from an HBV core protein gene (HBVcAg), were acquired by extension PCR using an HBV capsid gene sequence (SEQ ID NO: 1, a 1901-2452 sequence of the NCBI Nucleotide accession number: AF286594) as a template in the presence of primers 1-5, and primer 6 as listed in Table 1, below. In order to substitute P79A80 of HBVcAg with EGFR affibody (Epidermal Growth Factor Receptor 1), 5-XhoI-EGFR affibody-BamHI-3(SEQ ID NO: 4) was obtained by PCR. These gene clones were ligated in serial to plasmid pT7-7 to construct a recombinant plasmid expression vector pT7-7-N-H6-BP-Y6-HBVcAg(1-78)-EGFR affibody-HBVcAg(81-149)-C (FIG. 1), which codes the gene N-H6-BP-Y6-HBVcAg(1-78)-EGFR affibody-HBVcAg(81-149)-C (SEQ ID NO: 5). The sequences for all the recombinant constructed plasmid expression vector were identified by complete DNA sequencing after agarose-gel isolation.

[0076] Information on primer sequences and templates relevant to the preparation of HBV capsid-derived chimeric nanoparticles will be described in detail, below (Table 1).

[0077] 1) A first segment was obtained by extension PCR using an HBV capsid protein gene (SEQ ID NO: 1, a 1901-2452 sequence of NCBI Nucleotide accession number: AF286594) as a template in the presence of primers 1 to 5 containing the restriction recognition site NdeI, and primer 6 containing the restriction recognition site XhoI. As a result, a 5-NdeI-H6-BP-Y6-HBV capsid protein (amino acid sequence 1-78)-XhoI-3 sequence (SEQ ID NO: 2) was obtained as a PCR product.

[0078] 2) For a second segment, PCR was performed on an HBV capsid protein gene as a template in the presence of primers 7 and 8 containing the restriction recognition sites BamHI and ClaI, respectively. As a result, a 5-BamHI-HBV capsid protein (amino acid sequence 81-149)-ClaI-3 sequence (SEQ ID NO: 3) was obtained as a PCR product.

[0079] 3) A third segment was obtained by performing PCR on an EGFR affibody nucleotide sequence as a template in the presence of primers 9 and 10 containing the restriction recognition sites XhoI and BamHII, respectively. As a result, a 5-XhoI-EGFR affibody-BamHI-3 sequence (SEQ ID NO: 4) was acquired as a PCR product.

[0080] The PCR products obtained above were sequentially inserted into a pT7-7 vector to construct a recombinant expression vector pT7-7-N-H6-BP-Y6-HBVcAg(1-78)-EGFR affibody-HBVcAg(81-149)-C, which can express an HBV capsid-derived functional moiety (hexatyrosine) capable of inducing the reduction of gold ions, and an EGFR affibody binding specifically to human breast cancer cells (FIG. 1A).

[0081] 4) Comparison was made of the affinity of EGFR affibodies for cancer cells. For this, extension PCR was performed using primers 1 to 5, and primer 8 containing ClaI. The PCR product thus obtained was inserted into a pT7-7 vector to construct a recombinant expression vector carrying a gene that encodes an HBV capsid-derived functional group (hexatyrosine) capable of inducing the reduction of gold ions. The recombinant expression vector was used as a control for EGFR affibody (FIG. 1B).

TABLE-US-00001 TABLE1 Primer1 5 NdeI-H6- CATATGCATCACCATCACCATCACATGGCGTCT (SEQIDNO:6) BP-Y6- AGTCTGCGT HBcAg1(1) Primer2 5 NdeI-H6- ATGGCGTCTAGTCTGCGTCAGATTCTGGATTCTC (SEQIDNO:7) BP-Y6- AGAAAATGGAATGGCG HBcAg1(2) Primer3 5 NdeI-H6- CAGAAAATGGAATGGCGTTCTAATGCG (SEQIDNO:8) BP-Y6- GGTGGCTCTGGTGGCGGAAGTGGG HBcAg1(3) Primer4 5 NdeI-H6- GGTGGCGGAAGTGGGGGAGGCACTGGAGGTGG (SEQIDNO:9) BP-Y6- CGGCGGTGGGTACTATTAC HBcAg1(4) Primer5 5 NdeI-H6- GGCGGTGGGTACTATTACTATTACTAT (SEQIDNO: BP-Y6- GACATTGACCCGTATAAAGAA 10) HBcAg1(5) Primer6 3 XhoI- CTCGAGGTCTTCCAAATTACTTCCCA (SEQIDNO: HBcAg78 11) Primer7 5 BamHI- GGATCCTCCAGGGAATTAGTAGTCAGC (SEQIDNO: HBcAg81 12) Primer8 3 ClaI- ATCGATTTAAACAACAGTAGTTTCCGGAAGTGT (SEQIDNO: HBcAg149 13) Primer9 5 XhoI-EGFR CTCGAGGTGGATAACAAATTTAACAAA (SEQIDNO: AFFIBODY 14) Primer10 3 BamHI- GGATCCTTTCGGCGCCTGCGCATCGTTCAGTTTT (SEQIDNO: EGFR TTCGCTTC 15) AFFIBODY

Example 2

Biosynthesis of HBV Capsid-Derived Chimeric Nanoparticle

[0082] The E. coli strain BL21(DE3)[F-ompThsdSB(rB-mB-)] was transformed with each of the recombinant expression vectors, followed by selecting ampicillin-resistant transformant. The transformant was cultured in 50 mL of Luria-Bertani (LB) medium (containing 100 mg L-1 ampicillin) in a flask (250 mL Erlenmeyer flask, 37 C., 150 rpm). When absorbance (O.D600) reached about 0.4-0.5, IPTG (Isopropyl--D-thiogalactopyranosid) (1.0 mM) was added to induce the expression of the protein. In this regard, the expression was conducted in the presence of biotin (100 M) to regulate to the excessive growth of gold nanopaticles that would be reduced at the N-terminus of the protein. For a control, the recombinant gene was expressed in the absence of biotin (100 M). After incubation at 20 C. for 1618 hrs, the medium was centrifuged at 4,500 rpm for 10 min to harvest cell mass. The cell mass was then suspended in 5 ml of a lysis buffer (10 mM Tris-HCl buffer, pH 7.5, 10 mM EDTA), and lyzed using an ultrasonicator (Branson Ultrasonics Corp., Danbury, Conn., USA). Centrifugation at 13,000 rpm for 10 min separated a supernatant and a precipitate. The supernatant was purified according to the procedure of Example 3, below.

Example 3

Purification of HBV Capsid-Derived Chimeric Nanoparticle

[0083] In order to purify a self-assembled EGFR affibody-protein fused protein nanoparticle among the expressed recombinant proteins, the following three-step purification was carried out: 1) Ni2+-NTA affinity chromatography was conducted to separate the recombinant protein on the basis of the binding of the histidine residues fused to the recombinant protein to nickel ions, 2) an ultracentrifugal filter (Amicon Ultra 100K, Millipore, Billerica, Mass.) was used to change the medium of the recombinant protein into a self-assembled buffer (500 mM NaCl 0.50 mM Tris-HCl pH 7.0) for improving the self assembling efficiency of the recombinant protein, with the concomitant concentration of the protein, and 3) sucrose density gradient ultracentrifugation was performed to isolate the self-assembled protein nanoparticle alone. Specification of each step is as follows.

[0084] 1) Ni2+-NTA Affinity Chromatography

[0085] For the purification of the recombinant protein, the transformed E. coli was harvested as described above, and the cell pellet was resuspended in 5 mL of a lysis buffer (pH 8.0, 50 mMsodium phosphate, 300 mM NaCl, 20 mM imidazole), and lyzed using a sonicator. After centrifugation of the cell lysate at 13,000 rpm for 10 min, each of the recombinant proteins was separated from the supernatant using an Ni2+-NTA column (Qiagen, Hilden, Germany) (wash buffer: pH 8.0, 50 mM sodium phosphate, 300 mM NaCl, 80 mM imidazole/elution buffer: pH 8.0, 50 mM sodium phosphate, 300 mM NaCl, 200 mM imidazole).

[0086] 2) Buffer Change for Promoting Self-Assembling, and Concentration

[0087] After 3 ml of the recombinant protein eluted by Ni2+-NTA affinity chromatography was loaded to an ultracentrifugal filter (Amicon Ultra 100K, Millipore, Billerica, Mass.), and centrifuged at 5,000 g for 10 min, the column was fully filled with a buffer for self-assembly (500 mM NaCl 0.50 mM Tris-HCl pH 7.0). Again, centrifugation at 5,000 g was conducted until 500 l of the solution remained in the column. This procedure was three times repeated to adjust a final volume into 1 mL.

[0088] 3) Sucrose-Gradient Ultracentrifugation

[0089] Sucrose was added in various amounts to the buffer for self-assembly to give solutions having sucrose concentrations of 60%, 50%, 40%, 30%, 20%, and 10%. Each of the sucrose solutions (6020%) was added in an amount of 2 mL in a descending order of the sucrose concentration to an ultracentrifugation tube (ultraclear 13.2 ml tube, Beckman), and then 0.5 ml of the 10% sucrose solution was placed on the layered sucrose solutions. After 1 ml of the recombinant protein in the buffer for self-assembly was loaded onto the 10% sucrose solution, centrifugation at 24,000 rpm for 6 hrs at 4 C. was conducted (Ultracentrifuge L-90k, Beckman). Subsequently, the upper layers (1040% sucrose) were carefully removed using a pipette and the remainder including 5060% sucrose solutions was subjected to buffer change into the buffer for self-assembly using the ultracentrifugal filter as described in 2).

Example 4

Reduction of Gold Ions on HBV Capsid-Derived Chimeric Nanoparticle

[0090] The HBV capsid-derived chimeric nanoparticle obtained in Example 3 had a hexatyrosine sequence that was linked at the N terminus to a biotynylated peptide. The HBV capsid-derived chimeric nanoparticle in a recombinant protein buffer, pH 7.0 was reacted with AuClP(CH.sub.3).sub.3 chloro(trimethylphosphine) gold (I) for 16 hrs, followed by centrifugation at 13,000 rpm for 10 min at 4 C. The supernatant was withdrawn, and reacted with a 10-fold concentration of the reducing agent NaBH4 for 10 min to afford gold-protein particle fusions in which the size of the gold nanoparticles was regulated by biotin (FIG. 2A) and were not regulated (FIG. 2B).

Example 5

Structural Analysis of HBV Capsid-Derived Chimeric Nanoparticle

[0091] The recombinant protein nanoparticles purified through the above procedure were structurally analyzed by transmission electron microscopy (TEM). To this end, first, a purified protein sample was placed on carbon-coated copper electron microscope grids, and allowed to dry naturally. The dried sample on the electron microscope grids was incubated at room temperature for 10 min with a 2% (w/v) aqueous uranyl acetate solution, and then washed 3-4 times with distilled water. The protein nanoparticles were found to be spherical nanoparticles with a size of 30-35 nm as observed by a Philips Technai 120 kV electron microscope. The results are shown in FIGS. 3A and 3B. Also, EDX (Energy-dispersive X-ray spectroscopy) showed that the metal bound onto the surface of the fusion was gold.

Example 6

Temperature Increasing Tendency with Concentration of HBV Capsid-Derived Chimeric Gold-Protein Nanoparticle Fusion-In Vitro

[0092] Examination was made to see whether the gold-protein particle fusion increased in temperature to a point applicable to the photothermal therapy of cancer. In this regard, the gold-protein particle fusion was plated in an amount of 100 l/well into 96-well plates, and irradiated for 15 min with a laser (655 nm, 200 W) while its absorbance at 530 nm was increased. Temperatures of the gold-protein particle fusion are plotted against time (15 min) according to absorbance in FIG. 3.

Example 7

Specific Target Directionality of HBV Capsid-Derived Chimeric Gold-Protein Nanoparticle Fusion Toward Cancer Cell-In Vitro

[0093] Examination was made to see whether the exposed, targeting peptide EGFR affibody of the gold-protein particle fusion specifically targeted cancer cells. For this, the human breast cancer cell line (MDA MB-468 cell line) was grown on 35- plates. Separately, the gold-protein particle fusions obtained in Example 1, which contained the EGFR affibody or did not contain the EGFR affibody, was labeled with Cy5.5 (ex=675 nm/em=694 nm) at the N terminus. The human breast cancer cells were incubated for 10 min with the gold-protein particle fusion to monitor the endocytosis of the particle into the cells. Only in the cell group treated with the fusion having the EGFR affibody, Cy5.5 fluorescence was observed. In order to examine whether the EGFR affibody directly targeted an EGF receptor, human breast cancer cells were incubated with cetuximab, which is an anticancer agent functioning as an antibody specific for the EGFR receptor, for 72 hours before the treatment of the breast cancer cells with the gold-protein nanoparticle fusion having the EGFR affibody for 10 min. No Cy5.5 fluorescence was observed in the cells, indicating that the EGFR affibody directly targets the EGF receptor of human breast cancer cells (FIG. 4).

Example 8

Necrosis of Cancer Cell by Laser Irradiation

[0094] The gold-protein particle fusion of the present invention was analyzed for photothermal therapy performance by measuring the temperature elevation and the consequent necrosis of cancer cells when the cancer cells that engulfed or did not engulf the gold-protein particle fusion of the present invention as described in Example 7 were irradiated with a laser(655 nm, 200 W). In this regard, the cells grown on 35- plates were irradiated with laser, and measured for viability using a CCK-8 kit (Dojindo, Japan). Irradiation of a laser into the gold-protein nanoparticle fusion for 40 min generated heat in a higher quantity when a greater concentration of the fusion was used, with the consequent reduced survival of the cancer cells (FIG. 5A). The group treated with the EGFR affibody-conjugated particle fusion was observed to further to be reduced in cell density when irradiated with laser, compared to that treated with EGFR affibody-deficient particle fusion (FIG. 5B). Double staining with calcein AM (live cells stained, green fluorescent) and PI (dead cells stained, red fluorescent) showed that laser irradiation for 40 min in the presence of 25 nM of the gold-protein particle fusion of the present invention induced most of the cancer cells to undergo necrosis, appearing red fluorescent (FIG. 5C).

Example 9

In Vivo Assay of HBV Capsid-Derived Chimeric Gold-Protein Nanoparticle Fusion for Specifically Targeting Cancer Cell

[0095] The HBV capsid-derived chimeric gold-protein nanoparticle fusion of the present invention was in vivo assayed for target directionality toward cancer cells. To mice in which a target cancer cell line (MDA MB468 cell line) had been sufficiently developed, EGFR affibody-containing or deficient gold-protein nanoparticle fusions were injected via the tail vein. The gold-protein nanoparticle fusions was monitored for distribution around the cancer cells from 1 to 24 hrs after injection (FIG. 6A). Maximum fluorescent intensities from cancer cells were tracked for 1 to 24 hrs after injection, and are plotted (FIG. 6B). The group injected with the gold-protein nanoparticle fusion containing the EGFR affibody specific for breast cancer cells exhibited two, on average, to up to three times higher fluorescent intensities, compared to that injected with the EGFR-deficient fusion. These data indicated that the presence of the breast cancer cell-specific peptide (EGFR affibody) allows the fusion to direct toward the target cancer cell line (MDA MB468 cell line) to a higher extent.

Example 10

Assay for Photothermal Therapeutic Effect of HBV Capsid-Derived Chimeric Gold-Protein Nanoparticle Fusion in Response to Laser Irradiation after Intratumoral Injection

[0096] After intratumoral injection of the HBV capsid-derived chimeric gold-protein nanoparticle fusion into a target cancer cell line MDA MB468 cell line), photothermal therapeutic effects were observed in response to laser irradiation.

[0097] Mice in which the target cancer cells (MDA MB468 cell line) had been sufficiently developed were treated as follows: 1) neither was the gold-protein nanoparticle fusion injected, nor was a laser irradiated (control) (FIG. 7A); 2) the gold-protein nanoparticle fusion was not injected, but a laser was irradiated (FIG. 7B); 3) the gold-protein nanoparticle fusion was injected, but a laser was not irradiated; 4) the gold-protein nanoparticle fusion was injected, and a laser was irradiated for 10 min (FIG. 7D) and 50 min (FIG. 7E). In this experiment, the necrotic effect of the gold-protein nanoparticle in the presence of a laser on cancer cells was examined by histological analysis while the first three experiments were designed to examine effects of the gold-protein nanoparticle or the laser alone on tissue injury.

[0098] FIG. 7A shows images of a control to which neither was the gold-protein nanoparticle fusion injected nor was a laser irradiated, so as to present the histological morphology of the cancer cells themselves. FIG. 7B provides images of an experimental group into which a laser was irradiated without injection of the gold-protein nanoparticle fusion, showing whether laser-induced tissue necrosis occurred. In light of the histological image of FIG. 7A, the laser irradiation was observed to not cause necrosis. FIG. 7C shows an image of an experimental group to which the gold-protein nanoparticle fusion was injected, without irradiating a laser, showing whether the gold-protein nanoparticle fusion itself had toxicity. When comparing with the histological image of FIG. 7A, no necrosis occurred in the tissue of this experimental group, indicating that the gold-protein nanoparticle fusion itself was not toxic.

[0099] FIGS. 7D and 7E are images of experimental groups to which a laser was irradiated, respectively, for 10 min and 50 min after the injection of the gold-protein nanoparticle fusion, showing the photothermal therapeutic effect of the gold-protein nanoparticle fusion. When a laser was irradiated for 10 min into the experimental group, the tissue started to necrotize as indicated by arrows in FIG. 7D. Sufficient irradiation of a laser for 50 min caused general damage across the tumor as shown in the low-magnification image (left panel) of FIG. 7E. In circle portions of the high-magnification image (right panel) of FIG. 7E, the tumor tissue underwent severe necrosis.

[0100] Briefly, it was found that the treatments of 1), 2), or 3) do not bring about significant damage on cancer cells, irradiation of a laser for 10 min induces cancer cells to undergo necrosis, and most cancer cells are necrotized after irradiation of a laser for 50 min, as shown in 4). Through these experiments, photothermal therapy utilizing the gold-protein nanoparticle fusion was sufficiently effective.

Example 11

Effect of Targeting of HBV Capsid-Derived Chimeric Gold-Protein Nanoparticle Fusion on Photothermal Therapy against Target Cancer Cell Line (MDA MB468) Upon Laser Irradiation after In Vivo Injection

[0101] After the HBV capsid-derived chimeric gold-protein nanoparticle fusion was injected through the tail vein into mice in which the target cancer cell line (MDA MB468) had been sufficiently developed, the mice were left for a sufficient time before laser irradiation in order for the fusion to target the cancer cell line. Then, an effect of targeting on photothermal therapy was examined.

[0102] Mice where the target cancer cell line (MDA MB468) had sufficiently been developed were prepared, and the gold-protein nanoparticle fusion was injected via the tail vein to the mice. It took 9-12 hours for the fusion to target the cancer cell line to the maximum extent as shown in Example 9. Hence, after the mice were left for 9 hrs, their tumor tissues were analyzed (FIG. 8A) or irradiated with a laser for 50 min (FIG. 8B). In addition, 5 days later, tumor sizes were compared between mice that were only irradiated with a laser and those that were injected with the gold-protein nanoparticle fusion and irradiated with a laser (FIGS. 8C and 8D).

[0103] FIG. 8A shows histological images of cancer cells from an experimental group into which the gold-protein nanoparticle fusion was injected via the tail vein and then left for 9 hrs so as to target the cancer cells, and is adapted to examine whether the gold-protein nanoparticle fusion itself necrotizes tumors and has toxicity in vivo. As is apparent from the result of the histological analysis, the gold-protein nanoparticle fusion itself did not cause necrosis. Because the gold-protein nanoparticle fusion was demonstrated to target the tumor tissue, the fusion itself has no toxicity.

[0104] FIG. 8B shows histological images of cancer cells from an experimental group into which the gold-protein nanoparticle fusion was injected via the tail vein and then left for 9 hrs so as to target the cancer cells before laser irradiation for 50 min to implement photothermal therapy. Comparing the result of FIG. 8A, necrosis occurred across the cancer cells, and intensively in the tumor core, with concomitant vasodilation and hemorrhage in the tumor.

[0105] As can be seen, the gold-protein nanoparticle fusion did not induce necrosis in cancer cells by targeting alonein vivo, and thus the gold-protein nanoparticle fusion itself was not toxic to the cancer cells. Only when a laser was irradiated for 50 min after introduction of the gold-protein nanoparticle fusion, the tumor underwent general necrosis, with concomitant vasodilation in the tumor core. In addition, hemorrhage was observed as some cancer cells were necrotized.

[0106] FIG. 8C shows images comparing tumor sizes 5 days after the mice were irradiated with a laser without injection of the gold-protein nanoparticle fusion, or were injected with the gold-protein nanoparticle fusion and irradiated for 50 min with a laser. In the experimental group that was only irradiated with a laser, the tumor size increased further. In contrast, the tumor disappeared in the experimental group to which a laser was irradiated after the injection of the gold-protein nanoparticle fusion, leaving a scab on the injury.

[0107] FIG. 8D is a graph quantitatively showing the growth tendency of tumors in the two experimental groups and a change in tumor size after laser-induced photothermal therapy.

[0108] From the data, it is apparent that the gold-protein nanoparticle fusion of the present invention can be used for photothermal therapy using an NIR laser against cancer after the gold-protein nanoparticle fusion is allowed to target tumor cells. Compared to conventional gold nanoparticles, the gold-protein nanoparticle fusion used in this experiment is a very effective material for photothermal therapy because it has higher structural stability against pH changes in vivo and exhibits higher target directability.

Example 12

Construction of Expression Vector for Biosynthesis of HBV Capsid-Derived Chimeric Nanoparticle

[0109] Instead of the target-oriented peptide for the EGFR, which takes an alpha helical structure, a target-oriented peptide for EDB, which takes a linear structure, was used for the synthesis of an HBV capsid-derived chimeric nanoparticle.

[0110] Two gene clones respectively encoding N-NdeI-H6(hexahistidine)-BP(Biotinylated peptides)-Y6(hexatyrosine)-HBVcAg(1-78)-XhoI-C (SEQ ID NO: 2) and N-BamHI-HBVcAg(81-149)-ClaI-C (SEQ ID NO: 3), both derived from an HBV core protein gene (HBVcAg), were acquired by extension PCR using an HBV capsid gene sequence (SEQ ID NO: 1, a 1901-2452 sequence of the NCBI Nucleotide accession number: AF286594) as a template in the presence of primers 1-5, and primer 6 as listed in Table 1, below. In order to substitute P79A80 of HBVcAg with EDB (human fibronectin extradomain B), 5-XhoI-EDB-BamHI-3(SEQ ID NO: 16) was obtained by PCR. These gene clones were ligated in serial to plasmid pT7-7 to construct a recombinant plasmid expression vector pT7-7-N-H6-BP-Y6-HBVcAg(1-78)-EDB-HBVcAg(81-149)-C carrying the gene N-H6-BP-Y6-HBVcAg(1-78)-EDB-HBVcAg(81-149)-C(SEQ ID NO: 17) (FIG. 9). After agarose-gel isolation of the recombinant plasmid expression vector, DNA sequencing was carried out to identify the sequence.

[0111] Information on primer sequences and templates relevant to the preparation of HBV capsid-derived chimeric nanoparticles will be described in detail, below (Table 2).

[0112] 1) A first segment was obtained by extension PCR using an HBV capsid protein gene (SEQ ID NO: 1, a 1901-2452 sequence of NCBI Nucleotide accession number: AF286594) as a template in the presence of primers 1 to 5 containing the restriction recognition site NdeI, and primer 6 containing the restriction recognition site XhoI. As a result, a 5-NdeI-H6-BP-Y6-HBV capsid protein (amino acid sequence 1-78)-XhoI-3 sequence (SEQ ID NO: 2) was obtained as a PCR product.

[0113] 2) For a second segment, PCR was performed on an HBV capsid protein gene as a template in the presence of primers 7 and 8 containing the restriction recognition sites BamHI and ClaI, respectively. As a result, a 5-BamHI-HBV capsid protein (amino acid sequence 81-149)-ClaI-3 sequence (SEQ ID NO: 3) was obtained as a PCR product.

[0114] 3) A third segment was obtained by performing PCR on an EDB nucleotide sequence as a template in the presence of primers 11 and 12 containing the restriction recognition sites XhoI and BamHII, respectively. As a result, a 5-XhoI-EDB-BamHI-3 sequence (SEQ ID NO: 16) was acquired as a PCR product.

[0115] The PCR products obtained above were sequentially inserted into a pT7-7 vector to construct a recombinant expression vector pT7-7-N-H6-BP-Y6-HBVcAg(1-78)-EDB-HBVcAg(81-149)-C, which can express an HBV capsid-derived functional moiety (hexatyrosine) capable of inducing the reduction of gold ions, and an EDB binding specifically to human glioblastoma and astrocytoma cell line (U87MG) (FIG. 9).

[0116] 3) Comparison was made of the affinity of EDB for cancer cells. For this, extension PCR was performed using primers 1 to 5, and primer 8 containing Clal. The PCR product thus obtained was inserted into a pT7-7 vector to construct a recombinant expression vector carrying a gene that encodes an HBV capsid-derived functional moiety (hexatyrosine) capable of inducing the reduction of gold ions. The recombinant expression vector was used as a control for EDB (FIG. 1B).

TABLE-US-00002 TABLE2 Primer11(SEQ 5 XhoI- CTCGAGCATAGCTGCAGC IDNO:18) EDB TCCCCGATTCAG Primer12(SEQ 3 BamHI- GGATCCCGGCTGCTGTTC IDNO:19) EDB CAGACGAATAATGCC

[0117] After the transformation of the vector pT7-7-N-H6-BP-Y6-HBVcAg(1-78)-EDB-HBVcAg(81-149)-C, the chimeric protein was biosynthesized and purified in the same manners as in Examples 2 and 3. The chimeric protein was subjected to structural analysis through TEM as described in Example 5 (FIG. 10). As can be seen in FIG. 10, a HBV capsid protein containing a target-oriented peptide and a gold ion reducing peptide was stably formed, like the HBV capsid protein using the target-oriented peptide for targeting EGFR of Example 1.

TEST EXAMPLES

Test Example 1

Comparison of In Vivo Toxicity Between Gold-Protein Nanoparticle Fusion and 40-nm Gold Nanoparticle

[0118] With regard to in vivo toxicity, the gold-protein nanoparticle fusion of the present invention was compared with a 40-nm gold nanoparticle, both similar in size, while deionized water was used as a control. One day after the injection of the samples into the body, five main organs including the liver, the lungs, the kidneys, the pancreas, and the heart was biopsied to examine the in vivo toxicity of the samples (FIG. 11A). In the group injected with the gold nanoparticle, partial hemorrhage, edema, and macrophages for digesting a toxic substance were detected, indicating that the gold nanoparticle was significantly toxic. In contrast, no noticeable changes were observed in the group injected with the same concentration of the gold-protein nanoparticle fusion, as in the group administered with the control deionized water. In order to investigate the accumulation of the two substances in vivo, the livers were anatomically analyzed and visualized at regular intervals of 7 days for 21 days by dark-field microscopy in which gold objects present in tissues scatter light and appear bright (FIG. 11B).

[0119] As can be seen, the gold nanoparticles were not discharged from the liver, but were accumulated at a high concentration for 21 days, appearing deep dark in the dark-field image whereas the livers from the mice injected with the gold-protein nanoparticle fusion exhibited normal tissue states without the detection of color changes in the anatomical images. Further, the gold-protein nanoparticle fusion was discharged from the body within a week, so that almost all gold particles disappeared 7 days after injection in the dark-field images.

[0120] As is apparent from the data obtained above, the gold-protein nanoparticle fusion of the present invention is free of the in vivo toxicity of conventional gold nanoparticles, and thus can be applied as a biocompatible material for use in vivo.

Test Example 2

Use as CT Contrast Agent after In Vivo Application (Intratumoral Injection)

[0121] Examination was made of the usefulness of the gold-protein nanoparticle fusion as an X-ray CT contrast agent by comparing two groups that were administered with the gold-protein nanoparticle fusion by intratumoral injection and were not administered, respectively (FIG. 12). Because it provides a high contrast against the background when irradiated with an X-ray, gold can be used as a contrast agent. Accordingly, the gold-protein nanoparticle fusion of the present invention, if proven as having a contrasting effect, can be used as a very effective contrast agent thanks to the in vivo target directability shown in Example 9. After intratumoral injection of the gold-protein nanoparticle, the tumor was visualized at a brightness level similar to that of neighbor bones, as analyzed by X-ray computed tomography (CT).

[0122] Hence, the gold-protein nanoparticle fusion of the present invention is proven as a CT contrast agent.