RECOMBINANT SELF-ASSEMBLING PROTEIN COMPRISING TARGET-ORIENTED PEPTIDE AND USE THEREOF
20180028833 ยท 2018-02-01
Assignee
Inventors
Cpc classification
C07K14/78
CHEMISTRY; METALLURGY
C07K2319/20
CHEMISTRY; METALLURGY
C12N2730/10122
CHEMISTRY; METALLURGY
A61N5/062
HUMAN NECESSITIES
C07K2319/33
CHEMISTRY; METALLURGY
A61K49/0428
HUMAN NECESSITIES
A61K41/0052
HUMAN NECESSITIES
A61K47/62
HUMAN NECESSITIES
C07K2319/735
CHEMISTRY; METALLURGY
C12N2810/855
CHEMISTRY; METALLURGY
C12N2730/10142
CHEMISTRY; METALLURGY
C12N2730/10133
CHEMISTRY; METALLURGY
C07K2319/32
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to a recombinant self-assembled protein comprising a target-oriented peptide and a use thereof The recombinant self-assembled protein according to the present invention, comprising a target-oriented peptide, does not require an additional process for providing target-orientedness, and is thus capable of delivering a desired drug to a target tissue or target cell without using additives, such as chemical binders or stabilizers; therefore, the protein can be used for photothermal therapy, drug delivery, imaging, or the like. In particular, according to the present invention, it is possible to prepare gold-protein nanoparticle fusions in which uniform high-density gold nanoparticles having target-orientedness are bound to protein surfaces, without an additional process of surface stabilization or process for providing target-orientedness. Compared with conventional gold nanoparticles, the gold-protein nanoparticle fusions according to the present invention show structural stability against pH variation and concentration variation, and also have excellent target-orientedness; therefore, the fusions can bring a dramatic enhancement to the utilization of gold nanoparticles in photothermal therapy.
Claims
1. A recombinant self-assembled protein, comprising a target-oriented peptide fused to a self-assembled protein.
2. The recombinant self-assembled protein of claim 1, wherein the self-assembled protein is ferritin or hepatitis B virus (HBV) capsid protein.
3. The recombinant self-assembled protein of claim 1, wherein the target-oriented peptide is a cancer-targeting peptide ligand.
4. A recombinant self-assembled protein nanoparticle, comprising the recombinant self-assembled protein of claim 1.
5. The recombinant self-assembled protein nanoparticle of claim 4, wherein the target-oriented peptide is exposed on a surface of the recombinant self-assembled protein nanoparticle.
6. The recombinant self-assembled protein nanoparticle of claim 5, wherein the target-oriented peptide is a cancer-targeting peptide ligand.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
DETAILED DESCRIPTION
[0074] Advantages and characteristics of the present invention, and a method of achieving them will become clear with reference to the following Examples as mentioned below in detail. However, the present invention is not limited to the following Examples, and various types of the present invention will be implemented in various manners. The Examples are disclosed merely to provide a complete description of the present invention and to provide complete understanding of the present invention to those skilled in the art to which the present invention belongs, and the present invention is only defined by the appended claims.
EXAMPLES
Example 1
Construction of Expression Vector for Biosynthesis of HBV Capsid-Derived Chimeric Nanoparticle
[0075] Two gene clones respectively encoding N-NdeI-H6(hexahistidine)-BP(Biotinylated peptides)-Y6(hexatyrosine)-HBVcAg(1-78)-XhoI-C (SEQ ID NO: 2) and N-BamHI-HBVcAg(81-149)-ClaI-C (SEQ ID NO: 3), both derived from an HBV core protein gene (HBVcAg), were acquired by extension PCR using an HBV capsid gene sequence (SEQ ID NO: 1, a 1901-2452 sequence of the NCBI Nucleotide accession number: AF286594) as a template in the presence of primers 1-5, and primer 6 as listed in Table 1, below. In order to substitute P79A80 of HBVcAg with EGFR affibody (Epidermal Growth Factor Receptor 1), 5-XhoI-EGFR affibody-BamHI-3(SEQ ID NO: 4) was obtained by PCR. These gene clones were ligated in serial to plasmid pT7-7 to construct a recombinant plasmid expression vector pT7-7-N-H6-BP-Y6-HBVcAg(1-78)-EGFR affibody-HBVcAg(81-149)-C (
[0076] Information on primer sequences and templates relevant to the preparation of HBV capsid-derived chimeric nanoparticles will be described in detail, below (Table 1).
[0077] 1) A first segment was obtained by extension PCR using an HBV capsid protein gene (SEQ ID NO: 1, a 1901-2452 sequence of NCBI Nucleotide accession number: AF286594) as a template in the presence of primers 1 to 5 containing the restriction recognition site NdeI, and primer 6 containing the restriction recognition site XhoI. As a result, a 5-NdeI-H6-BP-Y6-HBV capsid protein (amino acid sequence 1-78)-XhoI-3 sequence (SEQ ID NO: 2) was obtained as a PCR product.
[0078] 2) For a second segment, PCR was performed on an HBV capsid protein gene as a template in the presence of primers 7 and 8 containing the restriction recognition sites BamHI and ClaI, respectively. As a result, a 5-BamHI-HBV capsid protein (amino acid sequence 81-149)-ClaI-3 sequence (SEQ ID NO: 3) was obtained as a PCR product.
[0079] 3) A third segment was obtained by performing PCR on an EGFR affibody nucleotide sequence as a template in the presence of primers 9 and 10 containing the restriction recognition sites XhoI and BamHII, respectively. As a result, a 5-XhoI-EGFR affibody-BamHI-3 sequence (SEQ ID NO: 4) was acquired as a PCR product.
[0080] The PCR products obtained above were sequentially inserted into a pT7-7 vector to construct a recombinant expression vector pT7-7-N-H6-BP-Y6-HBVcAg(1-78)-EGFR affibody-HBVcAg(81-149)-C, which can express an HBV capsid-derived functional moiety (hexatyrosine) capable of inducing the reduction of gold ions, and an EGFR affibody binding specifically to human breast cancer cells (
[0081] 4) Comparison was made of the affinity of EGFR affibodies for cancer cells. For this, extension PCR was performed using primers 1 to 5, and primer 8 containing ClaI. The PCR product thus obtained was inserted into a pT7-7 vector to construct a recombinant expression vector carrying a gene that encodes an HBV capsid-derived functional group (hexatyrosine) capable of inducing the reduction of gold ions. The recombinant expression vector was used as a control for EGFR affibody (
TABLE-US-00001 TABLE1 Primer1 5 NdeI-H6- CATATGCATCACCATCACCATCACATGGCGTCT (SEQIDNO:6) BP-Y6- AGTCTGCGT HBcAg1(1) Primer2 5 NdeI-H6- ATGGCGTCTAGTCTGCGTCAGATTCTGGATTCTC (SEQIDNO:7) BP-Y6- AGAAAATGGAATGGCG HBcAg1(2) Primer3 5 NdeI-H6- CAGAAAATGGAATGGCGTTCTAATGCG (SEQIDNO:8) BP-Y6- GGTGGCTCTGGTGGCGGAAGTGGG HBcAg1(3) Primer4 5 NdeI-H6- GGTGGCGGAAGTGGGGGAGGCACTGGAGGTGG (SEQIDNO:9) BP-Y6- CGGCGGTGGGTACTATTAC HBcAg1(4) Primer5 5 NdeI-H6- GGCGGTGGGTACTATTACTATTACTAT (SEQIDNO: BP-Y6- GACATTGACCCGTATAAAGAA 10) HBcAg1(5) Primer6 3 XhoI- CTCGAGGTCTTCCAAATTACTTCCCA (SEQIDNO: HBcAg78 11) Primer7 5 BamHI- GGATCCTCCAGGGAATTAGTAGTCAGC (SEQIDNO: HBcAg81 12) Primer8 3 ClaI- ATCGATTTAAACAACAGTAGTTTCCGGAAGTGT (SEQIDNO: HBcAg149 13) Primer9 5 XhoI-EGFR CTCGAGGTGGATAACAAATTTAACAAA (SEQIDNO: AFFIBODY 14) Primer10 3 BamHI- GGATCCTTTCGGCGCCTGCGCATCGTTCAGTTTT (SEQIDNO: EGFR TTCGCTTC 15) AFFIBODY
Example 2
Biosynthesis of HBV Capsid-Derived Chimeric Nanoparticle
[0082] The E. coli strain BL21(DE3)[F-ompThsdSB(rB-mB-)] was transformed with each of the recombinant expression vectors, followed by selecting ampicillin-resistant transformant. The transformant was cultured in 50 mL of Luria-Bertani (LB) medium (containing 100 mg L-1 ampicillin) in a flask (250 mL Erlenmeyer flask, 37 C., 150 rpm). When absorbance (O.D600) reached about 0.4-0.5, IPTG (Isopropyl--D-thiogalactopyranosid) (1.0 mM) was added to induce the expression of the protein. In this regard, the expression was conducted in the presence of biotin (100 M) to regulate to the excessive growth of gold nanopaticles that would be reduced at the N-terminus of the protein. For a control, the recombinant gene was expressed in the absence of biotin (100 M). After incubation at 20 C. for 1618 hrs, the medium was centrifuged at 4,500 rpm for 10 min to harvest cell mass. The cell mass was then suspended in 5 ml of a lysis buffer (10 mM Tris-HCl buffer, pH 7.5, 10 mM EDTA), and lyzed using an ultrasonicator (Branson Ultrasonics Corp., Danbury, Conn., USA). Centrifugation at 13,000 rpm for 10 min separated a supernatant and a precipitate. The supernatant was purified according to the procedure of Example 3, below.
Example 3
Purification of HBV Capsid-Derived Chimeric Nanoparticle
[0083] In order to purify a self-assembled EGFR affibody-protein fused protein nanoparticle among the expressed recombinant proteins, the following three-step purification was carried out: 1) Ni2+-NTA affinity chromatography was conducted to separate the recombinant protein on the basis of the binding of the histidine residues fused to the recombinant protein to nickel ions, 2) an ultracentrifugal filter (Amicon Ultra 100K, Millipore, Billerica, Mass.) was used to change the medium of the recombinant protein into a self-assembled buffer (500 mM NaCl 0.50 mM Tris-HCl pH 7.0) for improving the self assembling efficiency of the recombinant protein, with the concomitant concentration of the protein, and 3) sucrose density gradient ultracentrifugation was performed to isolate the self-assembled protein nanoparticle alone. Specification of each step is as follows.
[0084] 1) Ni2+-NTA Affinity Chromatography
[0085] For the purification of the recombinant protein, the transformed E. coli was harvested as described above, and the cell pellet was resuspended in 5 mL of a lysis buffer (pH 8.0, 50 mMsodium phosphate, 300 mM NaCl, 20 mM imidazole), and lyzed using a sonicator. After centrifugation of the cell lysate at 13,000 rpm for 10 min, each of the recombinant proteins was separated from the supernatant using an Ni2+-NTA column (Qiagen, Hilden, Germany) (wash buffer: pH 8.0, 50 mM sodium phosphate, 300 mM NaCl, 80 mM imidazole/elution buffer: pH 8.0, 50 mM sodium phosphate, 300 mM NaCl, 200 mM imidazole).
[0086] 2) Buffer Change for Promoting Self-Assembling, and Concentration
[0087] After 3 ml of the recombinant protein eluted by Ni2+-NTA affinity chromatography was loaded to an ultracentrifugal filter (Amicon Ultra 100K, Millipore, Billerica, Mass.), and centrifuged at 5,000 g for 10 min, the column was fully filled with a buffer for self-assembly (500 mM NaCl 0.50 mM Tris-HCl pH 7.0). Again, centrifugation at 5,000 g was conducted until 500 l of the solution remained in the column. This procedure was three times repeated to adjust a final volume into 1 mL.
[0088] 3) Sucrose-Gradient Ultracentrifugation
[0089] Sucrose was added in various amounts to the buffer for self-assembly to give solutions having sucrose concentrations of 60%, 50%, 40%, 30%, 20%, and 10%. Each of the sucrose solutions (6020%) was added in an amount of 2 mL in a descending order of the sucrose concentration to an ultracentrifugation tube (ultraclear 13.2 ml tube, Beckman), and then 0.5 ml of the 10% sucrose solution was placed on the layered sucrose solutions. After 1 ml of the recombinant protein in the buffer for self-assembly was loaded onto the 10% sucrose solution, centrifugation at 24,000 rpm for 6 hrs at 4 C. was conducted (Ultracentrifuge L-90k, Beckman). Subsequently, the upper layers (1040% sucrose) were carefully removed using a pipette and the remainder including 5060% sucrose solutions was subjected to buffer change into the buffer for self-assembly using the ultracentrifugal filter as described in 2).
Example 4
Reduction of Gold Ions on HBV Capsid-Derived Chimeric Nanoparticle
[0090] The HBV capsid-derived chimeric nanoparticle obtained in Example 3 had a hexatyrosine sequence that was linked at the N terminus to a biotynylated peptide. The HBV capsid-derived chimeric nanoparticle in a recombinant protein buffer, pH 7.0 was reacted with AuClP(CH.sub.3).sub.3 chloro(trimethylphosphine) gold (I) for 16 hrs, followed by centrifugation at 13,000 rpm for 10 min at 4 C. The supernatant was withdrawn, and reacted with a 10-fold concentration of the reducing agent NaBH4 for 10 min to afford gold-protein particle fusions in which the size of the gold nanoparticles was regulated by biotin (
Example 5
Structural Analysis of HBV Capsid-Derived Chimeric Nanoparticle
[0091] The recombinant protein nanoparticles purified through the above procedure were structurally analyzed by transmission electron microscopy (TEM). To this end, first, a purified protein sample was placed on carbon-coated copper electron microscope grids, and allowed to dry naturally. The dried sample on the electron microscope grids was incubated at room temperature for 10 min with a 2% (w/v) aqueous uranyl acetate solution, and then washed 3-4 times with distilled water. The protein nanoparticles were found to be spherical nanoparticles with a size of 30-35 nm as observed by a Philips Technai 120 kV electron microscope. The results are shown in
Example 6
Temperature Increasing Tendency with Concentration of HBV Capsid-Derived Chimeric Gold-Protein Nanoparticle Fusion-In Vitro
[0092] Examination was made to see whether the gold-protein particle fusion increased in temperature to a point applicable to the photothermal therapy of cancer. In this regard, the gold-protein particle fusion was plated in an amount of 100 l/well into 96-well plates, and irradiated for 15 min with a laser (655 nm, 200 W) while its absorbance at 530 nm was increased. Temperatures of the gold-protein particle fusion are plotted against time (15 min) according to absorbance in
Example 7
Specific Target Directionality of HBV Capsid-Derived Chimeric Gold-Protein Nanoparticle Fusion Toward Cancer Cell-In Vitro
[0093] Examination was made to see whether the exposed, targeting peptide EGFR affibody of the gold-protein particle fusion specifically targeted cancer cells. For this, the human breast cancer cell line (MDA MB-468 cell line) was grown on 35- plates. Separately, the gold-protein particle fusions obtained in Example 1, which contained the EGFR affibody or did not contain the EGFR affibody, was labeled with Cy5.5 (ex=675 nm/em=694 nm) at the N terminus. The human breast cancer cells were incubated for 10 min with the gold-protein particle fusion to monitor the endocytosis of the particle into the cells. Only in the cell group treated with the fusion having the EGFR affibody, Cy5.5 fluorescence was observed. In order to examine whether the EGFR affibody directly targeted an EGF receptor, human breast cancer cells were incubated with cetuximab, which is an anticancer agent functioning as an antibody specific for the EGFR receptor, for 72 hours before the treatment of the breast cancer cells with the gold-protein nanoparticle fusion having the EGFR affibody for 10 min. No Cy5.5 fluorescence was observed in the cells, indicating that the EGFR affibody directly targets the EGF receptor of human breast cancer cells (
Example 8
Necrosis of Cancer Cell by Laser Irradiation
[0094] The gold-protein particle fusion of the present invention was analyzed for photothermal therapy performance by measuring the temperature elevation and the consequent necrosis of cancer cells when the cancer cells that engulfed or did not engulf the gold-protein particle fusion of the present invention as described in Example 7 were irradiated with a laser(655 nm, 200 W). In this regard, the cells grown on 35- plates were irradiated with laser, and measured for viability using a CCK-8 kit (Dojindo, Japan). Irradiation of a laser into the gold-protein nanoparticle fusion for 40 min generated heat in a higher quantity when a greater concentration of the fusion was used, with the consequent reduced survival of the cancer cells (
Example 9
In Vivo Assay of HBV Capsid-Derived Chimeric Gold-Protein Nanoparticle Fusion for Specifically Targeting Cancer Cell
[0095] The HBV capsid-derived chimeric gold-protein nanoparticle fusion of the present invention was in vivo assayed for target directionality toward cancer cells. To mice in which a target cancer cell line (MDA MB468 cell line) had been sufficiently developed, EGFR affibody-containing or deficient gold-protein nanoparticle fusions were injected via the tail vein. The gold-protein nanoparticle fusions was monitored for distribution around the cancer cells from 1 to 24 hrs after injection (
Example 10
Assay for Photothermal Therapeutic Effect of HBV Capsid-Derived Chimeric Gold-Protein Nanoparticle Fusion in Response to Laser Irradiation after Intratumoral Injection
[0096] After intratumoral injection of the HBV capsid-derived chimeric gold-protein nanoparticle fusion into a target cancer cell line MDA MB468 cell line), photothermal therapeutic effects were observed in response to laser irradiation.
[0097] Mice in which the target cancer cells (MDA MB468 cell line) had been sufficiently developed were treated as follows: 1) neither was the gold-protein nanoparticle fusion injected, nor was a laser irradiated (control) (
[0098]
[0099]
[0100] Briefly, it was found that the treatments of 1), 2), or 3) do not bring about significant damage on cancer cells, irradiation of a laser for 10 min induces cancer cells to undergo necrosis, and most cancer cells are necrotized after irradiation of a laser for 50 min, as shown in 4). Through these experiments, photothermal therapy utilizing the gold-protein nanoparticle fusion was sufficiently effective.
Example 11
Effect of Targeting of HBV Capsid-Derived Chimeric Gold-Protein Nanoparticle Fusion on Photothermal Therapy against Target Cancer Cell Line (MDA MB468) Upon Laser Irradiation after In Vivo Injection
[0101] After the HBV capsid-derived chimeric gold-protein nanoparticle fusion was injected through the tail vein into mice in which the target cancer cell line (MDA MB468) had been sufficiently developed, the mice were left for a sufficient time before laser irradiation in order for the fusion to target the cancer cell line. Then, an effect of targeting on photothermal therapy was examined.
[0102] Mice where the target cancer cell line (MDA MB468) had sufficiently been developed were prepared, and the gold-protein nanoparticle fusion was injected via the tail vein to the mice. It took 9-12 hours for the fusion to target the cancer cell line to the maximum extent as shown in Example 9. Hence, after the mice were left for 9 hrs, their tumor tissues were analyzed (
[0103]
[0104]
[0105] As can be seen, the gold-protein nanoparticle fusion did not induce necrosis in cancer cells by targeting alonein vivo, and thus the gold-protein nanoparticle fusion itself was not toxic to the cancer cells. Only when a laser was irradiated for 50 min after introduction of the gold-protein nanoparticle fusion, the tumor underwent general necrosis, with concomitant vasodilation in the tumor core. In addition, hemorrhage was observed as some cancer cells were necrotized.
[0106]
[0107]
[0108] From the data, it is apparent that the gold-protein nanoparticle fusion of the present invention can be used for photothermal therapy using an NIR laser against cancer after the gold-protein nanoparticle fusion is allowed to target tumor cells. Compared to conventional gold nanoparticles, the gold-protein nanoparticle fusion used in this experiment is a very effective material for photothermal therapy because it has higher structural stability against pH changes in vivo and exhibits higher target directability.
Example 12
Construction of Expression Vector for Biosynthesis of HBV Capsid-Derived Chimeric Nanoparticle
[0109] Instead of the target-oriented peptide for the EGFR, which takes an alpha helical structure, a target-oriented peptide for EDB, which takes a linear structure, was used for the synthesis of an HBV capsid-derived chimeric nanoparticle.
[0110] Two gene clones respectively encoding N-NdeI-H6(hexahistidine)-BP(Biotinylated peptides)-Y6(hexatyrosine)-HBVcAg(1-78)-XhoI-C (SEQ ID NO: 2) and N-BamHI-HBVcAg(81-149)-ClaI-C (SEQ ID NO: 3), both derived from an HBV core protein gene (HBVcAg), were acquired by extension PCR using an HBV capsid gene sequence (SEQ ID NO: 1, a 1901-2452 sequence of the NCBI Nucleotide accession number: AF286594) as a template in the presence of primers 1-5, and primer 6 as listed in Table 1, below. In order to substitute P79A80 of HBVcAg with EDB (human fibronectin extradomain B), 5-XhoI-EDB-BamHI-3(SEQ ID NO: 16) was obtained by PCR. These gene clones were ligated in serial to plasmid pT7-7 to construct a recombinant plasmid expression vector pT7-7-N-H6-BP-Y6-HBVcAg(1-78)-EDB-HBVcAg(81-149)-C carrying the gene N-H6-BP-Y6-HBVcAg(1-78)-EDB-HBVcAg(81-149)-C(SEQ ID NO: 17) (
[0111] Information on primer sequences and templates relevant to the preparation of HBV capsid-derived chimeric nanoparticles will be described in detail, below (Table 2).
[0112] 1) A first segment was obtained by extension PCR using an HBV capsid protein gene (SEQ ID NO: 1, a 1901-2452 sequence of NCBI Nucleotide accession number: AF286594) as a template in the presence of primers 1 to 5 containing the restriction recognition site NdeI, and primer 6 containing the restriction recognition site XhoI. As a result, a 5-NdeI-H6-BP-Y6-HBV capsid protein (amino acid sequence 1-78)-XhoI-3 sequence (SEQ ID NO: 2) was obtained as a PCR product.
[0113] 2) For a second segment, PCR was performed on an HBV capsid protein gene as a template in the presence of primers 7 and 8 containing the restriction recognition sites BamHI and ClaI, respectively. As a result, a 5-BamHI-HBV capsid protein (amino acid sequence 81-149)-ClaI-3 sequence (SEQ ID NO: 3) was obtained as a PCR product.
[0114] 3) A third segment was obtained by performing PCR on an EDB nucleotide sequence as a template in the presence of primers 11 and 12 containing the restriction recognition sites XhoI and BamHII, respectively. As a result, a 5-XhoI-EDB-BamHI-3 sequence (SEQ ID NO: 16) was acquired as a PCR product.
[0115] The PCR products obtained above were sequentially inserted into a pT7-7 vector to construct a recombinant expression vector pT7-7-N-H6-BP-Y6-HBVcAg(1-78)-EDB-HBVcAg(81-149)-C, which can express an HBV capsid-derived functional moiety (hexatyrosine) capable of inducing the reduction of gold ions, and an EDB binding specifically to human glioblastoma and astrocytoma cell line (U87MG) (
[0116] 3) Comparison was made of the affinity of EDB for cancer cells. For this, extension PCR was performed using primers 1 to 5, and primer 8 containing Clal. The PCR product thus obtained was inserted into a pT7-7 vector to construct a recombinant expression vector carrying a gene that encodes an HBV capsid-derived functional moiety (hexatyrosine) capable of inducing the reduction of gold ions. The recombinant expression vector was used as a control for EDB (
TABLE-US-00002 TABLE2 Primer11(SEQ 5 XhoI- CTCGAGCATAGCTGCAGC IDNO:18) EDB TCCCCGATTCAG Primer12(SEQ 3 BamHI- GGATCCCGGCTGCTGTTC IDNO:19) EDB CAGACGAATAATGCC
[0117] After the transformation of the vector pT7-7-N-H6-BP-Y6-HBVcAg(1-78)-EDB-HBVcAg(81-149)-C, the chimeric protein was biosynthesized and purified in the same manners as in Examples 2 and 3. The chimeric protein was subjected to structural analysis through TEM as described in Example 5 (
TEST EXAMPLES
Test Example 1
Comparison of In Vivo Toxicity Between Gold-Protein Nanoparticle Fusion and 40-nm Gold Nanoparticle
[0118] With regard to in vivo toxicity, the gold-protein nanoparticle fusion of the present invention was compared with a 40-nm gold nanoparticle, both similar in size, while deionized water was used as a control. One day after the injection of the samples into the body, five main organs including the liver, the lungs, the kidneys, the pancreas, and the heart was biopsied to examine the in vivo toxicity of the samples (
[0119] As can be seen, the gold nanoparticles were not discharged from the liver, but were accumulated at a high concentration for 21 days, appearing deep dark in the dark-field image whereas the livers from the mice injected with the gold-protein nanoparticle fusion exhibited normal tissue states without the detection of color changes in the anatomical images. Further, the gold-protein nanoparticle fusion was discharged from the body within a week, so that almost all gold particles disappeared 7 days after injection in the dark-field images.
[0120] As is apparent from the data obtained above, the gold-protein nanoparticle fusion of the present invention is free of the in vivo toxicity of conventional gold nanoparticles, and thus can be applied as a biocompatible material for use in vivo.
Test Example 2
Use as CT Contrast Agent after In Vivo Application (Intratumoral Injection)
[0121] Examination was made of the usefulness of the gold-protein nanoparticle fusion as an X-ray CT contrast agent by comparing two groups that were administered with the gold-protein nanoparticle fusion by intratumoral injection and were not administered, respectively (
[0122] Hence, the gold-protein nanoparticle fusion of the present invention is proven as a CT contrast agent.