CRISPR-BASED ASSAY FOR DETECTING TB IN BODILY FLUIDS

20230087018 · 2023-03-23

    Inventors

    Cpc classification

    International classification

    Abstract

    The present disclosure describes a method for detecting the presence of Mycobacterium tuberculosis in a bodily fluid sample. The method utilizes CRISPR effector proteins along with a guide RNA and a reporter molecule, such that when the guide RNA hybridizes with a target nucleotide fragment, the CRISPR effector protein cleaves the reporter molecule, resulting in a detectable signal.

    Claims

    1. A method of detecting Mycobacterium tuberculosis (MTB) in a bodily fluid sample, comprising the steps of: a) amplifying an MTB target nucleic acid sequence from a bodily fluid sample; and b) detecting presence of the MTB target nucleic acid sequence using a CRISPR-mediated system; wherein said CRISPR-mediated system comprises a CRISPR effector protein, a guide RNA (gRNA) that hybridizes with the MTB target nucleic acid fragment, and a reporter molecule that is detectable on cleavage by said CRISPR effector protein.

    2. The method of claim 1, further comprises, prior to step a), the following step: a-1) extracting nucleic acids from the bodily fluid sample.

    3. The method of claim 1, wherein the target nucleic acid fragment is DNA.

    4. The method of claim 2, wherein in step a-1) the extracting step further comprising: a-2) depleting human DNA using anti-human DNA antibodies.

    5. The method of claim 2, wherein in step a-1) the extracting step further comprising: a-3) enriching MTB bacterial DNA by using anti-MTB antibodies.

    6. The method of claim 2, wherein in step a-1) the extracting step further comprising: a-4) isolating extracellular vesicles by at least one of: ultracentrifugation, size exclusion chromatography, polymer precipitation, membrane filtration or membrane affinity isolation.

    7. The method of claim 3, wherein step a) is carried out using polymerase chain reaction (PCR), recombinase polymerase amplification (RPA), nucleic acid sequence-based amplification (NASBA), rolling circle amplification (RCA), or loop-mediated isothermal amplification (LAMP).

    8. The method of claim 7, wherein step a) is carried out using PCR.

    9. The method of claim 8, wherein a hybridization enhancer is used in the PCR, and the hybridization enhancer is transferred into the detecting step b).

    10. The method of claim 1, wherein in step b) the CRISPR effector protein is selected from a group consisting of Cas12a, Cas9 and Cas13.

    11. The method of claim 1, wherein the reporter molecule is a single-stranded DNA or a single-stranded RNA labeled with fluorescence and quencher, gold nanoparticles, or biotin-FAM.

    12. The method of claim 11, wherein the reporter molecule is 5′-6-FAM-TTTTTTTTTTTT-BHQ1.

    13. The method of claim 1, wherein said bodily fluid sample is obtained from serum, plasma, or urine.

    14. The method of claim 2, wherein in step a) is carried out in room temperature.

    15. The method of claim 2, wherein the target DNA sequence is a portion of IS6110, IS986, esxB, gryB, rpoB, katG, inhA, rpsL, rrs, gyrA, gyrB, embB, eis and pncA.

    16. The method of claim 2, wherein a pair of primers are used in step b) for the DNA amplification, wherein the primers are SEQ ID NOs. 1 and 2.

    17. The method of claim 2, wherein a pair of primers are used in step b) for the DNA amplification, wherein the primers are SEQ ID NOs. 3 and 4.

    18. The method of claim 2, wherein a pair of primers are used in step b) for the DNA amplification, wherein the primers are SEQ ID NOs. 5 and 6.

    19. The method of claim 1, wherein in step c) the gRNA has at least one of the following sequences: SEQ ID NO. 7, SEQ ID NO. 8, or SEQ ID NO. 9.

    20. The method of claim 1, wherein the target nucleic acid fragment

    21. A method of detecting Mycobacterium tuberculosis (MTB) in a serum sample, comprising the steps of: a) extracting DNA from a serum sample to produce a DNA sample; b) amplifying an MTB target DNA sequence from said DNA sample using PCR or RPA to produce an amplified DNA, wherein a pair of primers are used, and wherein the primers are SEQ ID NOs. 1&2, 3&4 or 5&6; and c) detecting presence of the MTB target DNA fragment in said amplified DNA using a CRISPR-mediated system; wherein said CRISPR-mediated system comprises Cas12a, a guide RNA (gRNA), and a reporter molecule that is detectable on cleavage by Cas12a, wherein the gRNA is SEQ ID NO. 7, 8 or 9.

    22. The method of claim 21, wherein in step a) the extracting step further comprising at least one of: a-1) depleting human DNA from said serum sample or said DNA sample using anti-human DNA antibodies, a-2) enriching MTB bacterial DNA from said serum sample or said DNA sample by using anti-MTB antibodies, or a-3) isolating extracellular vesicles by at least one of: ultracentrifugation, size exclusion chromatography, polymer precipitation, membrane filtration or membrane affinity isolation.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0051] FIG. 1. Illustration of the method of this disclosure.

    [0052] FIG. 2. Fluorescent results of the serum samples.

    DETAILED DESCRIPTION

    [0053] The disclosure provides novel method of detecting MTB DNA in a serum sample. The method comprises the steps of: a) extracting nucleic acids from a serum sample; b) amplifying a target nucleic acid sequence, and c) detecting presence of the target nucleic acid sequence using a CRISPR-mediated system, wherein the CRISPR-mediated system comprises a CRISPR effector protein, a guide RNA that hybridizes with the target nucleic acid sequence, and a reporter molecule.

    [0054] Primers used in the DNA amplification step are designed to amplify only the MTB gene sequences that are conserved across Mycobacterium species or have been reported for certain drug resistance. For example, IS6110 is an MTB-specific insertion sequence. Other MTB-specific genes can also be amplified, such as esxB, rpoB, katG, inhA, rpsL, rrs, gyrA, gyrB, embB, eis and pncA.

    [0055] The DNA sequence of M tuberculosis IS6110 can be found at Accession Number X17348.1. The DNA sequence of M. tuberculosis esxB from strain H37Rv can be found at AL123456.3 (4352274-4352576). The DNA sequence of M tuberculosis gryB from strain H37Rv can be found at AL123456.3 (5240-7267). In designing the primers, the focus is on amplifying the PAM recognizable by the CRISPR effector protein.

    [0056] The gRNA sequences were designed in accordance with the target fragments and the primers used in the DNA amplification step. In other words, the gRNA sequences are portions of the IS6110, IS986, esxB, gryB, rpoB, katG, inhA, rpsL, rrs, gyrA, gyrB, embB, eis or pncA. These genes are listed in Table 1.

    TABLE-US-00002 TABLE 1 Candidate gene information for TB detection No. Target Gene Function Reference 1 IS6110 IS6110 is an insertion element of ncbi.nlm.nih.gov/nuccore/X17348.1?report= the M. tuberculosis complex fasta 2 IS986 IS986 belongs to the IS3-like ncbi.nlm.nih.gov/pmc/articles/PMC268102/ family of insertion sequences of M. tuberculosis 3 exsB Coding gene of ESAT-6 and ncbi.nlm.nih.gov/gene?Db=gene&Cmd=ShowD CFP-10 etailView&TermToSearch=886194&itool=Entre zSystem2.PEntrez.Gene.Gene_ResultsPanel.Gen e_RVDocSum 4 rpoB Rifampin resistance relates gene ncbi.nlm.nih.gov/pubmed/8031050 of M. tuberculosis 5 katG Isoniazid resistance relates gene ncbi.nlm.nih.gov/pmc/articles/PMC500838/ of M. tuberculosis 6 inhA Isoniazid and ethionamide ncbi.nlm.nih.gov/pubmed/8284673 resistance relate gene of M. tuberculosis 7 rpsL Streptomycin resistance relates ncbi.nlm.nih.gov/pubmed/7968530 gene of M. tuberculosis 8 rrs Streptomycin and Kanamycin ncbi.nlm.nih.gov/pmc/articles/PMC88513/ resistance relate gene of M. tuberculosis 9 gryA Fluoroquinolone resistance ncbi.nlm.nih.gov/pubmed/22552454 relates gene of M. tuberculosis 10 gryB Fluoroquinolone resistance ncbi.nlm.nih.gov/pubmed/22552454 relates gene of M. tuberculosis 11 embB Ethambutol resistance relates aac.asm.org/content/53/3/1061 gene of M. tuberculosis 12 eis Kanamycin resistance relates ncbi.nlm.nih.gov/pubmed/22593564 gene of M. tuberculosis 13 pncA Pyrazinamide resistance relates ncbi.nlm.nih.gov/pmc/articles/PMC2346646/ gene of M. tuberculosis

    [0057] The present invention is exemplified with respect to IS6110, esxB, gryB as the target fragment. However, these targets are exemplary only, and the invention can be broadly applied to other conserved regions among Mycobacterium species. The following examples are intended to be illustrative only, and not unduly limit the scope of the appended claims.

    Example 1

    [0058] Four samples were collected/prepared as follows. The method of this disclosure was performed on all four samples.

    TABLE-US-00003 Sample No. Information TB Status 1 Healthy human serum spiked with 100 Positive copies of IS6110/esxB/gryB fragments 2 Healthy human serum spiked 10 ng of Positive genomic DNA of MTB-H37RV 3 Healthy human serum 1 Negative 4 Healthy human serum 2 Negative 5 Healthy human serum 3 Negative 6 Healthy human serum 4 Negative 7 Healthy human serum 5 Negative 8 Healthy human serum 6 Negative 9 Healthy human serum 7 Negative 10 Clinical TB-positive sample 1 Positive 11 Clinical TB-positive sample 2 Positive 12 Clinical TB-positive sample 3 Positive 13 Clinical TB-positive sample 4 Positive 14 Clinical TB-positive sample 5 Positive

    1. Extracting DNA

    [0059] To extract DNA from a serum sample, the following materials were used: Quick-cfDNA™ Serum & Plasma Kit (D4076) that contains S&P 5× Digestion Buffer, Proteinase K, S&P DNA Binding Buffer, Zymo-Spin™ III-S Column Assembly, S&P DNA Prep Wash Buffer, S&P DNA Wash Buffer, DNA Elution Buffer (10 nM Tris-HCL, pH 8.5, 0.1 mM EDTA), and 1.5 mL Tube.

    [0060] If the serum sample is stored in −80° C., first place the sample at room temperature to thaw for 30 minutes. 100 μl of the thawed serum was mixed with 25 μl of S&P 5×Digestion Buffer and 10 μl of Proteinase K in a DNA Low Binding Tube.

    [0061] Subsequently, the mixture was incubated at 55° C. for 30 minutes for digestion, followed by the addition of two volumes of S&P DNA Binding Buffer to the digested samples and mixed thoroughly.

    [0062] The entire mixture was then transferred into Zymo-Spin™ III-S Column Assembly in a 1.5 ml tube, and centrifuged at 1000 g for 2 minutes. The flow-through was discarded.

    [0063] 400 μl of S&P DNA Prep Buffer was added to the column and centrifuged at ≥10000 g for 30 seconds, and the flow-through was discarded. The column was washed twice with 400 μl of S&P Wash Buffer, each centrifuged at ≥10000 g for 1 minute.

    [0064] The column was then transferred into a 1.5 ml DNase-free tube. 40 μl of DNA Elution Buffer was added directly to the column matrix and incubated at room temperature for 3 minutes, followed by centrifugation at maximum speed for 30 seconds. The collected DNA was then stored at −20° C. until further use.

    2. Amplifying DNA

    [0065] PCR was performed as an example of DNA amplification, and as discussed above, other DNA amplification techniques can be used. To perform PCR, the following materials were used: DEPC-Treated Water (1907041), Primer F and Primer R (List in the following table), 10×DNA Polymerase PCR Buffer, AccuPrime™ Taq DNA Polymerase System.

    [0066] Three pairs of primers were designed to amplify IS6110, esxB and gryB of MTB genome. The reason for choosing IS6110, as discussed above, is because the MTB genome has multiple copies thereof that could increase sensitivity. Primers against esxB was designed because of esxB is conserved across different Mycobacterium species. Primers against gryB was designed specifically to detect whether the MTB is fluoroquinolone-resistant. The designed primers used in this step is listed below:

    TABLE-US-00004 TABLE 2 PCR PRIMERS Target  Gene Name Sequence (5′-3′) IS6110 SEQ ID   GGTCGGAAGCTCCTATGACAATGCACTAGCC NO. 1(F) SEQ ID   TTGAGCGTAGTAGGCAGCCTCGAGTTCGAC NO. 2(R) esxB SEQ ID   TAAAGAGAGAAAGTAGTCCAGCATGGCAGAG NO. 3(F) SEQ ID   TCTCGTCGAGTTCCTGCTTCTGCTTATTGG NO. 4(R) gryB SEQ ID   CTGTTGTTGACGTTGTTGTTCCGGTTCATGC NO. 5(F) SEQ ID   CTGAATGCCGTCTTCCTTGTTGATCTTCTTC NO. 6(R)

    [0067] The following components were added to a sterile thin walled 0.2 ml PCR tube at room temperature:

    TABLE-US-00005 Amount Amount Components (μl) Component (μl) DEPC-treated water 15.12 Primer R 0.4 10X DNA Polymerase PCR 2 AccuPrime ™ Taq 0.08 buffer with hybridization DNA Polymerase enhancer component system Primer F 0.4 Extracted DNA 2

    [0068] The content in the tubes was mixed well, and centrifuged briefly to collect the content. The tubes were incubated in a thermal cycler at 95° C. for 2 minutes to completely denature the DNA template and activate the enzyme.

    [0069] 35 cycles of PCR amplification were then performed as follows: denature: 95° C. for 30 seconds; anneal: 60° C. for 30 seconds; extend: 72° C. for 30 seconds. After completion of 35 cycles, the temperature of the reaction mixture was maintained at 4° C. The resulting PCR products was then stored at −20° C. until next step.

    3. Crispr Detection

    [0070] After the amplification step, MTB detection with CRISPR-Cas system was performed with the following materials: DEPC-Treated Water (1907041), EnGen® Lba Cas12a (Cpf1), 10×NEBuffer™ 2.1, gRNA (list in the following table), Fluorescent Reporter (5-6-FAM-TTTTTTTTTTTT-BHQ1), and Corning® 96 Well Half-Area Microplate.

    [0071] As discussed above, the gRNA sequences were designed in accordance with the target fragments and PCR primers, and are listed below:

    TABLE-US-00006 TABLE 3 gRNA sequence Target Gene Name Sequence (5′-3′) IS6110 SEQ ID NO. 7 UAAUUUCUACUCUUGUAGAUAUCAGCUCGGUCUUGAAUAG esxB SEQ ID NO. 8 UAAUUUCUACUCUUGUAGAUGAGCGGAUCUCCGGCGACCU gryB SEQ ID NO. 9 UAAUUUCUACUCUUGUAGAUGCACAACCGCCGCUGUACAA

    [0072] To carry out the CRISPR detection step, the following components were added to a Half-area Microplate well, mixed well and incubated at room temperature for 10 minutes:

    TABLE-US-00007 Amount Amount Components (μl) Component (μl) DEPC- 1.5 1 μM EnGen ® 1 treated water Lba Cas12a 10X 3 2 μM Fluorescent 1.5 NEBuffer ™ 2.1 reporter 300 nM 3 PCR 20 μL gRNA product

    [0073] It is noted that the PCR product with the buffer solution mixture was added to the CRISPR detection mixture, as opposed to separating the PCR product from the buffer solution. This also increases the detection sensitivity.

    [0074] The system was incubated in the dark at 37° C. for 20 minutes with vibration. The fluorescent signal was measured with a plate reader. The result is shown in FIG. 2. When the sample produces signal intensity two times higher than that of the negative control, it is defined as positive. As can be seen in FIG. 2, positive samples 1, 2, and 4 show fluorescent intensity comparable to the positive control, whereas negative sample 3 shows fluorescent intensity comparable to the negative control.

    Prophetic Example 1

    [0075] To obtain best results, the ratio of (Cas12a: gRNA: reporter molecule) in the CRISPR detection step is varied, otherwise the DNA extraction, DNA amplification and CRISPR detection steps are the same as Example 1. This optimized ratio will further improve the specificity and sensitivity of this method.

    Prophetic Example 2

    [0076] To further improve the sensitivity of this method, MTB-DNA enriching and/or human-DNA depletion from the serum sample will be performed prior to the DNA amplification step. Human DNA has a specific methylation pattern that serves as the epitope of anti-human DNA antibodies. By treating the extracted DNA with the anti-human DNA antibodies to deplete human DNA in the serum sample, it is expected to further improve the sensitivity of the method of this disclosure.

    [0077] Similarly, MTB DNA has its own specific methylation patterns that are lineage-or species-specific, and can serve as epitopes for anti-MTB antibodies. Therefore, by treating the serum sample with anti-MTB antibodies to capture only MTB DNA fragments, the sensitivity of this method can be further improved.

    [0078] The following references are incorporated by reference in their entirety for all purposes.