METHODS FOR GENERATING NEW GENES IN ORGANISM AND USE THEREOF

20220348950 · 2022-11-03

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to the technical fields of genetic engineering and bioinformatics, in particular, to a method for creating a new gene in an organism in the absence of an artificial DNA template, and a use thereof. The method comprises simultaneously generating DNA breaks at two or more different specific sites in the organism's genome, wherein the specific sites are genomic sites capable of separating different genetic elements or different protein domains, and the DNA breaks are ligated to each other through non-homologous end joining (NHEJ) or homologous repair to generate a new combination of the different gene elements or different protein domains that is different from the original genome sequence, thereby creating a new gene. The new gene of the invention can change the growth, development, resistance, yield and other traits of the organism, and has great value in application.

    Claims

    1. A method for creating a new gene in an organism, characterized by comprising the following steps: simultaneously generating DNA breaks at two or more different specific sites in the organism's genome, wherein the specific sites are genomic sites capable of separating different genetic elements or different protein domains, and the DNA breaks are ligated to each other by a non-homologous end joining (NHEJ) or homologous repair, generating a new combination of the different genetic elements or different protein domains different from the original genomic sequence, thereby creating the new gene.

    2.-4. (canceled)

    5. The method according to claim 1, characterized in that said DNA breaks are achieved by delivering a nuclease with targeting property into a cell of the organism to contact with the specific sites of the genomic DNA.

    6. The method according to claim 5, characterized in that said nuclease with targeting property is selected from the group consisting of Meganuclease, Zinc finger nuclease, TALEN, and CRISPR/Cas system.

    7.-8. (canceled)

    9. The method according to claim 5, characterized in that the nucleases with targeting property are delivered into the cell by: 1) a PEG-mediated cell transfection method; 2) a liposome-mediated cell transfection method; 3) an electric shock transformation method; 4) a microinjection; 5) a gene gun bombardment; or 6) an Agrobacterium-mediated transformation method.

    10. The method according to claim 1, characterized in that said gene elements are selected from the group consisting of a promoter, a 5′ untranslated region, a coding region or non-coding RNA region, a 3′ untranslated region, a terminator of the gene, or any combination thereof.

    11.-17. (canceled)

    18. The method according to claim 1, characterized in that the protein domain is a DNA fragment corresponding to a specific functional domain of a protein; including but not being limited to a nuclear localization signal, a chloroplast leading peptide, a mitochondrial leading peptide, a phosphorylation site, a methylation site, a transmembrane domain, a DNA binding domain, a transcription activation domain, a receptor activation domain, or an enzyme catalytic center.

    19.-23. (canceled)

    24. The method according to claim 1, characterized in that the combination of gene elements and protein domains are a combination of protein domains and adjacent promoters, 5′UTR, 3′UTR or terminators of the same gene.

    25.-35. (canceled)

    36. A composition, which comprises: (a) a promoter of one of two genes with different expression patterns and a coding region or non-coding RNA region of the other gene; (b) a promoter to a 5′ untranslated region of one of two genes with different expression patterns and a coding region or non-coding RNA region of the other gene; (c) adjacent gene elements within the same gene; (d) a localization signal region of one of the two protein coding genes with different subcellular localizations and a mature protein coding region of the other gene; (e) two protein domains with different biological functions; (f) adjacent protein domains in the same gene; or, (g) a protein domain and an adjacent promoter, 5′ untranslated region, 3′ non-coding region or terminator in the same gene.

    37.-42. (canceled)

    43. An editing method for increasing the gene expression level of a target endogenous gene in an organism, which is independent of an exogenous DNA donor fragment, which comprises the following steps: simultaneously generating DNA breaks separately at selected sites between the promoter and the coding region of each of the target endogenous gene and an optional endogenous highly-expressing gene; ligating the DNA breaks to each other by means of non-homologous end joining (NHEJ) or homologous repair, thereby generating an in vivo fusion of the coding region of the target endogenous gene and the optional strong endogenous promoter to form a new highly-expressing endogenous gene, wherein the target endogenous gene and the optional endogenous highly-expressing gene are located on the same chromosome, or different chromosomes.

    44.-45. (canceled)

    46. An editing method for knocking up the expression of an endogenous HPPD, EPSPS or PPO gene in a plant, characterized in that it comprises fusing the coding region of the HPPD, EPSPS or PPO gene with a strong endogenous promoter of a plant in vivo to form a new highly-expressing plant endogenous HPPD, EPSPS or PPO gene, respectively; wherein the method comprises the following steps: simultaneously generating DNA breaks respectively in selected specific sites between the promoter and the coding region of each of the HPPD, EPSPS or PPO gene and an optional endogenous highly-expressing gene, ligating the DNA breaks to each other through an intracellular repair pathway, generating in vivo a fusion of the coding region of the HPPD, EPSPS or PPO gene and the optional strong endogenous promoter to form a new highly-expressing HPPD, EPSPS or PPO gene, respectively.

    47.-49. (canceled)

    50. A highly-expressing rice endogenous HPPD gene, which has a sequence selected from the group consisting of: (1) the nucleic acid sequence as shown in SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 18 or SEQ ID NO: 19 or a portion thereof or a complementary sequence thereof; (2) a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% to any one of the sequences as defined in (1); or (3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.

    51.-54. (canceled)

    55. A highly-expressing rice endogenous EPSPS gene, which has a sequence selected from the group consisting of: (1) the nucleic acid sequence as shown in SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13 or SEQ ID NO: 14 or a portion thereof or a complementary sequence thereof; (2) a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% to any one of the sequences as defined in (1); or (3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.

    56.-59. (canceled)

    60. A highly-expressing rice endogenous PPO gene, which has a sequence selected from the following: (1) the nucleic acid sequence as shown in SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, or SEQ ID NO: 26 or a portion thereof or a complementary sequence thereof; (2) a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% to any one of the sequences as defined in (1); or (3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.

    61.-72. (canceled)

    73. The method according to claim 1, characterized in that said two or more different specific sites locate on the same chromosome or on different chromosomes, or may be specific sites on at least two different genes, or may be at least two different specific sites on the same gene, wherein said at least two different genes may have the same or different transcription directions.

    74. The method according to claim 5, characterized in that the nuclease with targeting property” is in the form of DNA, or exists in the form of mRNA or protein, but not DNA.

    75. The method according to claim 1, characterized in that the combination of different gene elements is a combination of the promoter of one of the two genes with different expression patterns and the coding region or the non-coding RNA region of the other gene, a combination of the region from the promoter to 5′UTR of one of the two genes with different expression patterns and the CDS or non-coding RNA region of the other gene, or a combination of adjacent gene elements of the same gene.

    76. The method of claim 75, characterized in that, in the combination of different gene elements, one element is a strong endogenous promoter of the organism, and the other is the coding region of HPPD, EPSPS, PPO or GH1 gene.

    77. The method according to claim 75, characterized in that the different expression patterns are different levels of gene expression, different tissue-specificities of gene expression, or different developmental stage-specificities of gene expression.

    78. The method according to claim 1, characterized in that the combination of different protein domains is a combination of the localization signal region of one of two proteins with different subcellular localizations and the mature protein coding region of the other gene, a combination of two protein domains with different biological functions, or a combination of adjacent protein domains of the same gene.

    79. The method of claim 78, characterized in that the different subcellular locations are selected from the group consisting of nuclear location, cytoplasmic location, cell membrane location, chloroplast location, mitochondrial location, and endoplasmic reticulum membrane location, or the different biological functions are selected from the group consisting of recognition of specific DNA or RNA conserved sequence, activation of gene expression, binding to a protein ligand, binding to small molecular signal, binding to an ion, specific enzymatic reaction, and any combination thereof.

    80. A new gene obtainable by the method according to claim 1, characterized in that compared with the original gene, the new gene either has a different promoter and therefore is expressed with a different spatial-temporal characteristics or a different intensity characteristics or a different developmental stage characteristics, or has a new amino acid sequence; the “new amino acid sequence” may either be an integral fusion of two or more gene coding regions, or a partial fusion of coding regions or a doubling of a part of protein coding region of the same gene.

    81. The editing method according to claim 46, characterized in that it comprises fusing the coding region of the HPPD gene with a strong endogenous promoter of a rice, wherein the strong promoter is a promoter of ubiquitin2 gene, it comprises fusing the coding region of the EPSPS gene with a strong endogenous promoter of a rice, wherein the strong promoter is a promoter of TKT gene, or it comprises fusing the coding region of the PPO gene with a strong endogenous promoter of a rice or an Arabidopsis, wherein in rice, the strong promoter is a promoter of CP12 gene, and in Arabidopsis, the strong promoter is a promoter of ubiquitin10 gene.

    82. A highly-expressing plant endogenous HPPD, EPSPS or PPO gene obtainable by the editing method according to claim 46.

    83. A method for producing a plant with an increased resistance or tolerance to an herbicide, which comprises regenerating the plant host cell into a plant and a progeny derived therefrom, wherein the plant host cell comprises the expression cassette comprising the gene according to claim 82.

    84. A method for controlling a weed in a cultivation site of a plant, wherein the plant is selected from the group consisting of a plant prepared by the method according to claim 83, wherein the method comprises applying to the cultivation site one or more of HPPD, EPSPS or PPO inhibitory herbicides in an amount for effectively controlling the weed.

    Description

    BRIEF DESCRIPTION OF DRAWINGS

    [0152] FIG. 1 shows a schematic diagram of creating a new HPPD gene in rice.

    [0153] FIG. 2 shows a schematic diagram of creating a new EPSPS gene in rice.

    [0154] FIG. 3 shows a schematic diagram of creating a new PPDX gene in Arabidopsis thaliana.

    [0155] FIG. 4 shows a schematic diagram of creating a new PPDX gene in rice.

    [0156] FIG. 5 shows the sequencing results for the HPPD-duplication Scheme tested with rice protoplast.

    [0157] FIG. 6 shows the map of the Agrobacterium transformation vector pQY2091 for rice.

    [0158] FIG. 7 shows the electrophoresis results of the PCR products for the detection of new gene fragments in pQY2091 transformed hygromycin resistant rice callus. The arrow indicates the PCR band of the new gene created by the fusion of the promoter of the UBI2 gene with the coding region of the HPPD. The numbers are the numbers of the different callus samples. M represents DNA Marker, and the band sizes are 100 bp, 250 bp, 500 bp, 750 bp, 1000 bp, 2000 bp, 2500 bp, 5000 bp, 7500 bp in order.

    [0159] FIG. 8 shows the electrophoresis results of the PCR products for the detection of new gene fragments in pQY2091 transformed rice T0 seedlings. The arrow indicates the PCR band of the new gene created by the fusion of the promoter of the UBI2 gene with the coding region of the HPPD. The numbers are the serial numbers of the different T0 seedlings. M represents DNA Marker, and the band sizes are sequentially 100 bp, 250 bp, 500 bp, 750 bp, 1000 bp, 2000 bp, 2500 bp, 5000 bp, 7500 bp.

    [0160] FIG. 9 shows the test results for the resistance to Shuangzuocaotong of the QY2091 T0 generation of the HPPD gene doubling strain. In the same flowerpot, the wild-type Jinjing 818 is on the left, and the HPPD doubling strain is on the right.

    [0161] FIG. 10 shows the relative expression levels of the HPPD and UBI2 genes in the QY2091 T0 generation of the HPPD gene doubling strain. 818CK1 and 818CK3 represent two control plants of the wild-type Jinjing 818; 13M and 20M represent the primary tiller leaf samples of the QY2091-13 and the QY2091-20 T0 plants; 13L and 20L represent the secondary tiller leaf samples of the QY2091-13 and the QY2091-20 T0 plants used in the herbicide resistance test.

    [0162] FIG. 11 shows a schematic diagram of the possible genotypes of QY2091 T1 generation and the binding sites of the molecular detection primers.

    [0163] FIG. 12 shows the comparison of the sequencing results detecting the HPPD doubling and the predicted doubled sequences for QY2091-13 and QY2091-20.

    [0164] FIG. 13 shows the results of the herbicide resistance test for the T1 generation of the QY2091 HPPD doubling strain at the seedling stage.

    [0165] FIG. 14 shows a schematic diagram of the types of the possible editing event of rice PPO1 gene chromosome fragment inversion and the binding sites of molecular detection primers.

    [0166] FIG. 15 shows the sequencing results of the EPSPS-inversion detection.

    [0167] FIG. 16 shows the map of the rice Agrobacterium transformation vector pQY2234.

    [0168] FIG. 17 shows the electrophoresis results of the PCR products for the detection of new gene fragments of hygromycin resistant rice callus transformed with pQY2234. The arrow indicates the PCR band of the new gene created by the fusion of the promoter of the CP12 gene with the coding region of the PPO1. The numbers are the serial numbers of different callus samples. M represents DNA Marker, and the band sizes are sequentially 100 bp, 250 bp, 500 bp, 750 bp, 1000 bp, 2000 bp, 2500 bp, 5000 bp, 7500 bp.

    [0169] FIG. 18 shows the resistance test results of the PPO1 gene inversion strain 2081 of the QY2234 T0 generation. Under the same treatment dose, the left flowerpot is the wild-type Huaidao No. 5 control, and the right is the PPO1 inversion strain.

    [0170] FIG. 19 shows the relative expression levels of PPO1 and CP12 genes in the QY2234 T0 generation PPO1 inversion strain. H5CK1 and H5CK2 represent two wild-type Huaidao No. 5 control plants; 252M, 304M and 329M represent the primary tiller leaf samples of QY2234-252, QY2234-304 and QY2234-329 T0 plants; 252L, 304L and 329L represent secondary tiller leaf samples.

    [0171] FIG. 20 shows the comparison of the sequencing result of the PPO1 inversion with the predicted inversion sequence in the Huaidao 5 background.

    [0172] FIG. 21 shows the comparison of the sequencing result of the PPO1 inversion with the predicted inversion sequence in the Jinjing 818 background.

    [0173] FIG. 22 shows the herbicide resistance test results for the T1 generation of the QY2234 PPO1 inversion strain at seedling stage.

    SPECIFIC MODELS FOR CARRYING OUT THE INVENTION

    [0174] The present invention is further described in conjunction with the examples as follows. The following description is just illustrative, and the protection scope of the present invention should not be limited to this.

    [0175] EXAMPLE 1: AN EDITING METHOD FOR KNOCKING UP THE EXPRESSION OF THE ENDOGENOUS HPPD GENE BY INDUCING DOUBLING OF CHROMOSOME FRAGMENT IN PLANT—RICE PROTOPLAST TEST

    [0176] HPPD was a key enzyme in the pathway of chlorophyll synthesis in plants, and the inhibition of the activity of the HPPD would eventually lead to albino chlorosis and death of plants. Many herbicides, such as mesotrione and topramezone, were inhibitors with the HPPD as the target protein, and thus increasing the expression level of the endogenous HPPD gene in plants could improve the tolerance of the plants to these herbicides. The rice HPPD gene (as shown in SEQ ID NO: 6, in which 1-1067 bp is the promoter, and the rest is the expression region) locates on rice chromosome 2. Through bioinformatic analysis, it was found that rice Ubiquitin2 (hereinafter referred to as UBI2) gene (as shown in SEQ ID NO: 5, in which 1-2107 bp was the promoter, and the rest was the expression region) locates about 338 kb downstream of HPPD gene, and the UBI2 gene and the HPPD gene were in the same direction on the chromosome. According to the rice gene expression profile data provided by the International Rice Genome Sequencing Project (http://rice.plantbiology.msu.edu/index.shtml), the expression intensity of the UBI2 gene in rice leaves was 3 to 10 times higher than that of the HPPD gene, and the UBI2 gene promoter was a strong constitutively expressed promoter.

    [0177] As shown in FIG. 1, Scheme 1 shows that double-strand breaks were simultaneously generated at the sites between the promoters and the CDS region of the HPPD and UBI2 genes respectively, the event of doubling the region between the two breaks were obtained after screening and identification, and a new gene could be formed by fusing the promoter of UBI2 and the coding region of HPPD together. In addition, according to Scheme 2 as shown in FIG. 1, a new gene in which the promoter of UBI2 and the coding region of HPPD were fused could also be formed by two consecutive inversions. First, the schemes as shown in FIG. 1 were tested in the rice protoplast system as follows:

    [0178] 1. Firstly, the genomic DNA sequences of the rice HPPD and UBI2 genes were input into the CRISPOR online tool (http://crispor.tefor.net/) to search for available editing target sites. After online scoring, the following target sites between the promoters and the CDS regions of HPPD and UBI2 genes were selected for testing:

    TABLE-US-00001 OsHPPD-guide RNA1 GTGCTGGTTGCCTTGGCTGC OsHPPD-guide RNA2 CACAAATTCACCAGCAGCCA OsHPPD-guide RNA3 TAAGAACTAGCACAAGATTA OsHPPD-guide RNA4 GAAATAATCACCAAACAGAT

    [0179] The guide RNA1 and guide RNA2 located between the promoter and the CDS region of the HPPD gene, close to the start codon of the HPPD protein, and the guide RNA3 and guide RNA4 located between the promoter and CDS region of the UBI2 gene, close to the UBI2 protein initiation codon.

    [0180] pHUE411 vector (https://www.addgene.org/62203/) is used as the backbone, and the following primers were designed for the above-mentioned target sites to perform vector construction as described in “Xing H L, Dong L, Wang Z P, Zhang H Y, Han C Y, Liu B, Wang X C, Chen Q J. A CRISPR/Cas9 Toolkit for multiplex genome editing in plants. BMC Plant Biol. 2014 Nov. 29; 14(1): 327”.

    TABLE-US-00002 Primer No. DNA sequence (5′ to 3′) OsHPPD-sgRNA1-F ATATGGTCTCGGGCG GTGCTGGTTGCCTTG GCTGCGTTTTAGAGC TAGAAATAGCAAG OsHPPD-sgRNA2-F ATATGGTCTCGGGCG CACAAATTCACCAGC AGCCAGTTTTAGAGC TAGAAATAGCAAG OsHPPD-sgRNA3-R TATTGGTCTCTAAAC TAATCTTGTGCTAGT TCTTAGCTTCTTGGT GCCGCGC OsHPPD-sgRNA4-R TATTGGTCTCTAAAC ATCTGTTTGGTGATT ATTTCGCTTCTTGGT GCCGCGC

    [0181] gene editing vectors for the following dual-target combination were constructed following the method provided in the above-mentioned literature. Specifically, with the pCBC-MT1T2 plasmid (https://www.addgene.org/50593/) as the template, sgRNA1+3, sgRNA1+4, sgRNA2+3 and sgRNA2+4 double target fragments were amplified respectively for constructing the sgRNA expression cassettes. The vector backbone of pHUE411 was digested with Bsal, and recovered from the gel, and the target fragment was digested and directly used for the ligation reaction. T4 DNA ligase was used to ligate the vector backbone and the target fragment, and the ligation product was transformed into Trans5a competent cells. Different monoclones were picked and sequenced The Sparkjade High Purity Plasmid Mini Extraction Kit was used to extract plasmids from the clones with correct sequences, thereby obtaining recombinant plasmids, respectively named as pQY002065, pQY002066, pQY002067, and pQY002068, as follows:

    [0182] pQY002065 pHUE411-HPPD-sgRNA1+3 combination of OsHPPD-guide RNA1, guide RNA3

    [0183] pQY002066 pHUE411-HPPD-sgRNA1+4 combination of OsHPPD-guide RNA1, guide RNA4

    [0184] pQY002067 pHUE411-HPPD-sgRNA2+3 combination of OsHPPD-guide RNA2, guide RNA3

    [0185] pQY002068 pHUE411-HPPD-sgRNA2+4 combination of OsHPPD-guide RNA2, guide RNA4

    [0186] 2. Plasmids of high-purity and high-concentration were prepared for the above-mentioned pQY002065-002068 vectors as follows:

    [0187] Plasmids were extracted with the Promega Medium Plasmid Extraction Kit (Midipreps DNA Purification System, Promega, A7640) according to the instructions. The specific steps were:

    [0188] (1) Adding 5 ml of Escherichia coli to 300 ml of liquid LB medium containing kanamycin, and shaking at 200 rpm, 37° C. for 12 to 16 hours;

    [0189] (2) Placing the above bacteria solution in a 500 ml centrifuge tube, and centrifuging at 5,000 g for 10 minutes, discarding the supernatant;

    [0190] (3) Adding 3 ml of Cell Resuspension Solution (CRS) to resuspend the cell pellet and vortexing for thorough mixing;

    [0191] (4) Adding 3 ml of Cell Lysis Solution (CLS) and mixing up and down slowly for no more than 5 minutes;

    [0192] (5) Adding 3 ml of Neutralization Solution and mixed well by overturning until the color become clear and transparent;

    [0193] (6) Centrifuging at 14,000g for 15 minutes, and further centrifuging for 15 minutes if precipitate was not formed compact;

    [0194] (7) Transferring the supernatant to a new 50 ml centrifuge tube, avoiding to suck in white precipitate into the centrifuge tube;

    [0195] (8) Adding 10 ml of DNA purification resin (Purification Resin, shaken vigorously before use) and mixing well;

    [0196] (9) Pouring the Resin/DNA mixture was poured into a filter column, and treating by the vacuum pump negative pressure method (0.05 MPa);

    [0197] (10) Adding 15 ml of Column Wash Solution (CWS) to the filter column, and vacuuming.

    [0198] (11) Adding 15 ml of CWS, and repeating vacuuming once; vacuuming was extended for 30 s after the whole solution passed through the filter column;

    [0199] (12) Cutting off the filter column, transferring to a 1.5 ml centrifuge tube, centrifuging at 12,000 g for 2 minutes, removing residual liquid, and transferring the filter column to a new 1.5 ml centrifuge tube;

    [0200] (13) Adding 200 μL of sterilized water preheated to 70° C., and keeping rest for 2 minutes;

    [0201] (14) Centrifuging at 12,000 g for 2 minutes to elute the plasmid DNA; and the concentration was generally about 1 μg/μL.

    [0202] 3. Preparing rice protoplasts and performing PEG-mediated transformation:

    [0203] First, rice seedlings for protoplasts were prepared, which is of the variety Nipponbare. The seeds were provided by the Weeds Department of the School of Plant Protection, China Agricultural University, and expanded in house. The rice seeds were hulled first, and the hulled seeds were rinsed with 75% ethanol for 1 minute, treated with 5% (v/v) sodium hypochlorite for 20 minutes, then washed with sterile water for more than 5 times. After blow-drying in an ultra-clean table, they were placed in a tissue culture bottle containing ½ MS medium, 20 seeds for each bottle. Protoplasts were prepared by incubating at 26° C. for about 10 days with 12 hours light.

    [0204] The methods for rice protoplast preparation and PEG-mediated transformation were conducted according to “Lin et al., 2018 Application of protoplast technology to CRISPR/Cas9 mutagenesis: from single-cell mutation detection to mutant plant regeneration. Plant Biotechnology Journal https://doi.org/10.1111/pbi.12870”. The steps were as follows:

    [0205] (1) the leaf sheath of the seedlings was selected, cut into pieces of about 1 mm with a sharp Geely razor blade, and placed in 0.6 M mannitol and MES culture medium (formulation: 0.6 M mannitol, 0.4 M MES, pH 5.7) for later use. All materials were cut and transferred to 20 ml of enzymatic hydrolysis solution (formulation: 1.5% Cellulase R10/RS (YaKult Honsha), 0.5% Mecerozyme R10 (YaKult Honsha), 0.5M mannitol, 20 mM KCl, 20 mM MES, pH 5.7, 10 mM CaCl.sub.2, 0.1% BSA, 5 mM β-mercaptoethanol), wrapped in tin foil and placed in a 28° C. shaker, enzymatically hydrolyzed at 50 rpm in the dark for about 4 hours, and the speed was increased to 100 rpm in the last 2 minutes;

    [0206] (2) after the enzymatic lysis, an equal volume of W5 solution (formulation: 154 mM NaCl, 125 mM CaCl.sub.2, 5mM KCl, 15 mM MES) was added, shaken horizontally for 10 seconds to release the protoplasts. The cells after enzymatic lysis were filtered through a 300-mesh sieve and centrifuged at 150 g for 5 minutes to collect protoplasts;

    [0207] (3) the cells were rinsed twice with the W5 solution, and the protoplasts were collected by centrifugation at 150 g for 5 minutes;

    [0208] (4) the protoplasts were resuspended with an appropriate amount of MMG solution (formulation: 3.05 g/L MgCl.sub.2, 1 g/L MES, 91.2 g/L mannitol), and the concentration of the protoplasts was about 2×10.sup.6 cells/mL.

    [0209] The transformation of protoplasts was carried out as follows:

    [0210] (1) to 200 μL of the aforementioned MMG resuspended protoplasts, endotoxin-free plasmid DNA of high quality (10-20 μg) was added and tapped to mix well;

    [0211] (2) an equal volume of 40% (w/v) PEG solution (formulation: 40% (w/v) PEG, 0.5M mannitol, 100 mM CaCl.sub.2) was added, tapped to mix well, and kept rest at 28° C. in the dark for 15 minutes;

    [0212] (3) after the induction of transformation, 1.5 ml of W5 solution was added slowly, tapped to mix the cells well. The cells were collected by centrifugation at 150 g for 3 minutes. This step was repeated once;

    [0213] (4) 1.5 ml of W5 solution was added to resuspend the cells, and placed in a 28° C. incubator and cultured in the dark for 12-16 hours. For extracting protoplast genomic DNA, the cultivation should be carried out for 48-60 hours.

    [0214] 4. Genome targeting and detecting new gene:

    [0215] (1) First, protoplast DNAs were extracted by the CTAB method with some modifications. The specific method was as follows: the protoplasts were centrifuged, then the supernatant was discarded. 500 μL of DNA extracting solution (formulation: CTAB 20 g/L, NaCl 81.82 g/L, 100 mM Tris-HCl (pH 8.0), 20 mM EDTA, 0.2% β-mercaptoethanol) was added, shaken to mix well, and incubated in a 65° C. water bath for 1 hour; when the incubated sample was cooled, 500 μL of chloroform was added and mixed upside down and centrifuged at 10,000 rpm for 10 minutes; 400 μL of the supernatant was transferred to a new 1.5 ml centrifuge tube, 1 ml of 70% (v/v) ethanol was added and the mixture was kept at −20° C. for precipitating for 20 minutes; the mixture was centrifuged at 12,000 rpm for 15 minutes to precipitate the DNA; after the precipitate was air dried, 50 μL of ultrapure water was added and stored at −20° C. for later use.

    [0216] (2) The detection primers in the following table were used to amplify the fragments containing the target sites on both sides or the predicted fragments resulting from the fusion of the UBI2 promoter and the HPPD coding region. The lengths of the PCR products were between 300-1000 bp, in which the primer8-F+primer6-R combination was used to detect the fusion fragment at the middle joint after the doubling of the chromosome fragment, and the product length was expected to be 630 bp.

    TABLE-US-00003 Primer Sequence (5′ to 3′) OsHPPDduplicated-primer1-F CACTACCATCCATCCATTTGC OsHPPDduplicated-primer6-R GAGTTCCCCGTGGAGAGGT OsHPPDduplicated-primer3-F TCCATTACTACTCTCCCCGATT OsHPPDduplicated-primer7-R GTGTGGGGGAGTGGATGAC OsHPPDduplicated-primer5-F TGTAGCTTGTGCGTTTCGAT OsHPPDduplicated-primer2-R GGGATGCCCTCTTTGTCC OsHPPDduplicated-primer8-F TCTGTGTGAAGATTATTGCCACT OsHPPDduplicated-primer4-R GGGATGCCCTCCTTATCTTG

    [0217] The PCR reaction system was as follows:

    TABLE-US-00004 Components Volume 2 × I5 buffer solution 5 μL Forward primer (10 μM) 2 μL Reverse primer (10 μM) 2 μL Template DNA 2 μL Ultrapure water Added to 50 μL

    [0218] (3) A PCR reaction was conducted under the following general reaction conditions:

    TABLE-US-00005 Step Temperature Time Denaturation 98° C. 30 s 98° C. 15 s Amplification for 58° C. 15 s 30-35 cycles 72° C. 30 s Final extension 72° C. 3 min Finished 16° C. 5 min

    [0219] (4) The PCR reaction products were detected by 1% agarose gel electrophoresis. The results showed that the 630 bp positive band for the predicted fusion fragment of the UBI2 promoter and the HPPD coding region could be detected in the pQY002066 and pQY002068 transformed samples.

    [0220] 5. The positive samples of the fusion fragment of the UBI2 promoter and the HPPD coding region were sequenced for verification, and the OsHPPDduplicated-primer8-F and OsHPPDduplicated-primer6-R primers were used to sequence from both ends. As shown in FIG. 5, the promoter of the UBI2 gene and the expression region of the HPPD gene could be directly ligated, and the editing event of the fusion of the promoter of rice UBI2 gene and the expression region of the HPPD gene could be detected in the protoplast genomic DNA of the rice transformed with pQY002066 and pQY002068 plasmids, indicating that the scheme of doubling the chromosome fragments to form a new HPPD gene was feasible, a new HPPD gene which expression was driven by a strong promoter could be created, and this was defined as an HPPD doubling event. The sequencing result of the pQY002066 vector transformed protoplast for testing HPPD doubling event was shown in SEQ ID NO: 9; and the sequencing result of the pQY002068 vector transformed protoplast for testing HPPD doubling event was shown in SEQ ID NO: 10.

    EXAMPLE 2: CREATION OF HERBICIDE-RESISTANT RICE WITH KNOCK-UP EXPRESSION OF ENDOGENOUS HPPD GENE BY CHROMOSOME FRAGMENT DOUBLING THROUGH AGROBACTERIUM-MEDIATED TRANSFORMATION

    [0221] 1. Construction of knock-up editing vector: Based on the results of the protoplast test in Example 1, the dual-target combination OsHPPD-guide RNA1: 5′GTGCTGGTTGCCTTGGCTGC3′ and OsHPPD-guide RNA4: 5′GAAATAATCACCAAACAGAT3′ with a high editing efficiency was selected. The Agrobacterium transformation vector pQY2091 was constructed according to Example 1. pHUE411 was used as the vector backbone and subjected to rice codon optimization. The map of the vector was shown in FIG. 6.

    [0222] 2. Agrobacterium transformation of rice callus:

    [0223] 1) Agrobacterium transformation: 1 μg of the rice knock-up editing vector pQY2091 plasmid was added to 10 μl of Agrobacterium EHA105 heat-shock competent cells (Angyu Biotech, Catalog No. G6040), placed on ice for 5 minutes, immersed in liquid nitrogen for quick freezing for 5 minutes, then removed and heated at 37° C. for 5 minutes, and finally placed on ice for 5 minutes. 500 μl of YEB liquid medium (formulation: yeast extract 1 g/L, peptone 5 g/L, beef extract 5 g/L, sucrose 5 g/L, magnesium sulfate 0.5 g/L) was added. The mixture was placed in a shaker and incubated at 28° C., 200 rpm for 2-3 hours; the bacteria were collected by centrifugation at 3500 rpm for 30 seconds, the collected bacteria were spread on YEB (kanamycin 50 mg/L +rifampicin 25 mg/L) plate, and incubated for 2 days in an incubator at 28° C.; the single colonies were picked and placed into liquid culture medium, and the bacteria were stored at −80° C.

    [0224] 2) Cultivation of Agrobacterium: The single colonies of the transformed Agrobacterium on the YEB plate was picked, added into 20 ml of YEB liquid medium (kanamycin 50 mg/L+rifampicin 25 mg/L), and cultured while stirring at 28° C. until the OD600 was 0.5, then the bacteria cells were collected by centrifugation at 5000 rpm for 10 minutes, 20-40 ml of AAM (Solarbio, lot number LA8580) liquid medium was added to resuspend the bacterial cells to reach OD600 of 0.2-0.3, and then acetosyringone (Solarbio, article number A8110) was added to reach the final concentration of 200μM for infecting the callus.

    [0225] 3) Induction of rice callus: The varieties of the transformation recipient rice were Huaidao 5 and Jinjing 818, purchased from the seed market in Huai'an, Jiangsu, and expanded in house. 800-2000 clean rice seeds were hulled, then washed with sterile water until the water was clear after washing. Then the seeds were disinfected with 70% alcohol for 30 seconds, then 30 ml of 5% sodium hypochlorite was added and the mixture was placed on a horizontal shaker and shaken at 50 rpm for 20 minutes, then washed with sterile water for 5 times. The seeds were placed on sterile absorbent paper, air-dried to remove the water on the surface of the seeds, inoculated on an induction medium and cultivated at 28° C. to obtain callus.

    [0226] The formulation of the induction medium: 4.1 g/L N6 powder+0.3 g/L hydrolyzed casein+2.878 g/L proline+2 mg/L 2,4-D+3% sucrose+0.1 g/L inositol+0.5 g glutamine+0.45% phytagel, pH 5.8.

    [0227] 4) Infection of rice callus with Agrobacterium: The callus of Huaidao No. 5 or Jinjing 818 subcultured for 10 days with a diameter of 3 mm was selected and collected into a 50 ml centrifuge tube; the resuspension solution of the Agrobacterium AAM with the OD600 adjusted to 0.2-0.3 was poured into the centrifuge tube containing the callus, placed in a shaker at 28° C. at a speed of 200 rpm to perform infection for 20 minutes; when the infection was completed, the bacteria solution was discarded, the callus was placed on sterile filter paper and air-dried for about 20 minutes, then placed on a plate containing co-cultivation medium to perform co-cultivation, on which the plate was covered with a sterile filter paper soaked with AAM liquid medium containing 100 μM acetosyringone; after 3 days of co-cultivation, the Agrobacterium was removed by washing (firstly washing with sterile water for 5 times, then washing with 500 mg/L cephalosporin antibiotic for 20 minutes), and selective cultured on 50 mg/L hygromycin selection medium.

    [0228] The formulation of the co-cultivation medium: 4.1 g/L N6 powder+0.3 g/L hydrolyzed casein+0.5 g/L proline+2 mg/L 2,4-D+200 μM AS+10 g/L glucose+3% Sucrose+0.45% phytagel, pH 5.5.

    [0229] 3. Molecular identification and differentiation into seedlings of hygromycin resistant callus:

    [0230] Different from the selection process of conventional rice transformation, with specific primers of the fusion fragments generated after the chromosome fragment doubling, hygromycin resistant callus could be molecularly identified during the callus selection and culture stage in the present invention, positive doubling events could be determined, and callus containing new genes resulting from fusion of different genetic elements was selected for differentiation cultivation and induced to emerge seedlings. The specific steps were as follows:

    [0231] 1) The co-cultured callus was transferred to the selection medium for the first round of selection (2 weeks). The formulation of the selection medium is: 4.1 g/L N6 powder+0.3 g/L hydrolyzed casein+2.878 g/L proline+2 mg/L 2,4-D+3% sucrose+0.5 g glutamine+30 mg/L hygromycin (HYG)+500 mg/L cephalosporin (cef)+0.1 g/L inositol+0.45% phytagel, pH 5.8.

    [0232] 2) After the first round of selection was completed, the newly grown callus was transferred into a new selection medium for the second round of selection (2 weeks). At this stage, the newly grown callus with a diameter greater than 3 mm was clamped by tweezers to take a small amount of sample, the DNA thereof was extracted with the CTAB method described in Example 1 for the first round of molecular identification. In this example, the primer pair of OsHPPDduplicated-primer8-F (8F) and OsHPPDduplicated-primer6-R (6R) was selected to perform PCR identification for the callus transformed with the pQY2091 vector, in which the reaction system and reaction conditions were similar to those of Example 1. Among the total of 350 calli tested, no positive sample was detected in the calli of Huaidao 5, while 28 positive samples were detected in the calli of Jinjing 818. The PCR detection results of some calli were shown in FIG. 7.

    [0233] 3) The calli identified as positive by PCR were transferred to a new selection medium for the third round of selection and expanding cultivation; after the diameter of the calli was greater than 5 mm, the callus in the expanding cultivation was subjected to the second round of molecular identification using 8F+6R primer pair, the yellow-white callus at good growth status that was identified as positive in the second round was transferred to a differentiation medium to perform differentiation, and the seedlings of about 1 cm could be obtained after 3 to 4 weeks; the differentiated seedlings were transferred to a rooting medium for rooting cultivation; after the seedlings of the rooting cultivation were subjected to hardening off, they were transferred to a flowerpot with soil and placed in a greenhouse for cultivation. The formulation of the differentiation medium is: 4.42 g/L MS powder+0.5 g/L hydrolyzed casein+0.2 mg/L NAA+2 mg/L KT+3% sucrose+3% sorbitol+30 mg/L hygromycin+0.1 g/L inositol+0.45% phytagel, pH 5.8. The formulation of the rooting medium is: 2.3 g/L MS powder+3% sucrose+0.45% phytagel.

    [0234] 4. Molecular detection of HPPD doubling seedlings (T0 generation):

    [0235] After the second round of molecular identification, 29 doubling event-positive calli were co-differentiated to obtain 403 seedlings of T0 generation, and the 8F+6R primer pair was used for the third round of molecular identification of the 403 seedlings, among which 56 had positive bands. The positive seedlings were moved into a greenhouse for cultivation. The PCR detection results of some T0 seedlings were shown in FIG. 8.

    [0236] 5. HPPD inhibitory herbicide resistance test for HPPD doubled seedlings (T0 generation):

    [0237] The transformation seedlings of T0 generation identified as doubling event positive were transplanted into large plastic buckets in the greenhouse for expanding propagation to obtain seeds of T1 generation. After the seedlings began to tiller, the tillers were taken from vigorously growing strains, and planted in the same pots with the tillers of the wild-type control varieties at the same growth period. After the plant height reached about 20 cm, the herbicide resistance test was conducted. The herbicide used was Shuangzuocaotong (CAS No. 1622908-18-2) produced by our company, and its field dosage was usually 4 grams of active ingredients per mu (4 g a.i./mu). In this experiment, Shuangzuocaotong was applied at a dosage gradient of 2 g a.i./mu, 4 g a.i./mu, 8 g a.i./mu and 32 g a.i./mu with a walk-in spray tower.

    [0238] The resistance test results were shown in FIG. 9. After 5-7 days of the application, the wild-type control rice seedlings began to show albino, while the strains of the HPPD doubling events all remained normally green. After 4 weeks of the application, the wild-type rice seedlings were close to death, while the strains of the doubling events all continued to remain green and grew normally. The test results showed that the HPPD gene-doubled strains had a significantly improved tolerance to Shuangzuocaotong.

    [0239] 6. Quantitative detection of the relative expression of the HPPD gene in the HPPD doubled seedlings (T0 generation):

    [0240] It was speculated that the improved resistance of the HPPD gene doubled strain to Shuangzuocaotong was due to the fusion of the strong promoter of UBI2 and the HPPD gene CDS that increased the expression of HPPD, so the T0 generation strains QY2091-13 and QY2091-20 were used to take samples from the primary tillers and the secondary tillers used for herbicide resistance test to detect the expression levels of the HPPD and UBI2 genes, respectively, with the wild-type Jinjing 818 as the control. The specific steps were as follows:

    [0241] 1) Extraction of total RNA (Trizol method):

    [0242] 0.1-0.3 g of fresh leaves were taken and ground into powder in liquid nitrogen. 1 ml of Trizol reagent was added for every 50-100 mg of tissue for lysis; the Trizol lysate of the above tissue was transferred into a 1.5 ml centrifuge tube, stood at room temperature (15-30° C.) for 5 minutes; chloroform was added in an amount of 0.2 ml per 1 ml of Trizol; the centrifuge tube was capped, shaken vigorously in hand for 15 seconds, stood at room temperature (15-30° C.) for 2-3 minutes, then centrifuged at 12000 g (4° C.) for 15 minutes; the upper aqueous phase was removed and placed in a new centrifuge tube, isopropanol was added in an amount of 0.5 ml per 1 ml of Trizol, the mixture was kept at room temperature (15-30° C.) for 10 minutes, then centrifuged at 12000 g (2-8° C.) for 10 minutes; the supernatant was discarded, and 75% ethanol was added to the pellet in an amount of 1 ml per 1 ml of Trizol for washing. The mixture was vortexed, and centrifuged at 7500 g (2-8° C.) for 5 minutes. The supernatant was discarded; the precipitated RNA was dried naturally at room temperature for 30 minutes; the RNA precipitate was dissolved by 50 μl of RNase-free water, and stored in the refrigerator at −80° C. after electrophoresis analysis and concentration determination.

    [0243] 2) RNA electrophoresis analysis:

    [0244] An agarose gel at a concentration of 1% was prepared, then 1 μl of the RNA was taken and mixed with 1 μl of 2× Loading Buffer. The mixture was loaded on the gel. The voltage was set to 180V and the time for electrophoresis was 12 minutes. After the electrophoresis was completed, the agarose gel was taken out, and the locations and brightness of fragments were observed with a UV gel imaging system.

    [0245] 3) RNA purity detection:

    [0246] The RNA concentration was measured with a microprotein nucleic acid analyzer. RNA with a good purity had an OD260/OD280 value between 1.8-2.1. The value lower than 1.8 indicated serious protein contamination, and higher than 2.1 indicated serious RNA degradation.

    [0247] 4) Real-time fluorescence quantitative PCR

    [0248] The extracted total RNA was reverse transcribed into cDNA with a special reverse transcription kit. The main procedure comprised: first determining the concentration of the extracted total RNA, and a portion of 1-4 μg of RNA was used for synthesizing cDNA by reverse transcriptase synthesis. The resulting cDNA was stored at −20° C.

    [0249] {circle around (1)} A solution of the RNA template was prepared on ice as set forth in the following table and subjected to denaturation and annealing reaction in a PCR instrument. This process was conducive to the denaturation of the RNA template and the specific annealing of primers and templates, thereby improving the efficiency of reverse transcription.

    TABLE-US-00006 TABLE 1 Reverse transcription, denaturation and annealing reaction system Component Amounts (μl) Oligo dT primer (50 μM) 1 μl dNTP mixture (10 mM each) 1 μl RNA Template 1-4 μg RNase free water Added to 10 μL Reaction conditions for denaturation and annealing: 65° C. 5 min  4° C. 5 min

    [0250] {circle around (2)} The reverse transcription reaction system was prepared as set forth in Table 2 for synthesizing cDNA:

    TABLE-US-00007 TABLE 2 Reverse transcription reaction system Component Amount (μl) Reaction solution after the  10 μl above denaturation and annealing 5× RTase Plus Reaction Buffer   4 μl RNase Inhibitor 0.5 μl Evo M-MLV Plus RTase (200 U/μl )   1 μl RNase free water Added to 20 μL Reaction conditions for cDNA synthesis: 42° C. 60 min 95° C.  5 min

    [0251] {circle around (3)} The UBQ5 gene of rice was selected as the internal reference gene, and the synthesized cDNA was used as the template to perform fluorescence quantitative PCR. The primers listed in Table 3 were used to prepare the reaction solution according to Table 4.

    TABLE-US-00008 TABLE 3 Sequence 5′-3′ of the primer for Fluorescence quantitative PCR UBQ5-F ACCACTTCGACCGCCACTACT UBQ5-R ACGCCTAAGCCTGCTGGTT RT-OsHPPD-F CAGATCTTCACCAAGCCAGTAG RT-OsHPPD-R GAGAAGTTGCCCTTCCCAAA RT-OsUbi2-F CCTCCGTGGTGGTCAGTAAT RT-OsUbi2-R GAACAGAGGCTCGGGACG

    TABLE-US-00009 TABLE 4 Reaction solution for real-time quantitative PCR (Real Time PCR) Component of mixture Amount (μl) SYBR Premix ExTaq II   5 μl Forward primer (10 μM) 0.2 μl Reverse primer (10 μM) 0.2 μl cDNA   1 μl Rox II 0.2 μl Ultrapure water 3.4 μl In total  10 μl

    [0252] {circle around (4)} The reaction was performed following the real-time quantitative PCR reaction steps in Table 5. The reaction was conducted for 40 cycles.

    TABLE-US-00010 TABLE 5 Real-time quantitative PCR reaction steps Temperature (° C.) Time 50° C.  2 min 95° C. 10 min 95° C. 15 s 60° C. 20 s 95° C. 15 s 60° C. 20 s 95° C. 15 s

    [0253] 5) Data processing and experimental results

    [0254] As shown in Table 6, UBQ5 was used as an internal reference, ΔCt was calculated by subtracting the Ct value of UBQ5 from the Ct value of the target gene, and then 2.sup.−ΔCt was calculated, which represented the relative expression level of the target gene. The 818CK1 and 818CK3 were two wild-type Jinjing 818 control plants; 13M and 20M represented the primary tiller leaf samples of QY2091-13 and QY2091-20 T0 plants; 13L and 20L represented the secondary tiller leaf samples of QY2091-13 and QY2091-20 T0 plants used for herbicide resistance testing.

    TABLE-US-00011 TABLE 6 Ct values and relative expression folds of different genes UBQ5 Mean UBI2 ΔCt 2.sup.−ΔCt Mean HPPD ΔCt 2.sup.−ΔCt Mean 23.27 17.56 −5.88 58.95 20.81 −2.63 6.20 23.55 17.71 −5.73 53.09 21.01 −2.43 5.40 818CK1 23.51 23.44 17.66 −5.78 55.06 55.70 20.98 −2.47 5.52 5.71 23.45 17.88 −5.50 45.20 20.93 −2.44 5.43 23.19 17.94 −5.44 43.41 21.13 −2.24 4.74 818CK3 23.49 23.37 17.72 −5.65 50.26 46.29 21.14 −2.24 4.72 4.96 24.61 19.56 −4.92 30.32 20.23 −4.25 19.07 24.27 19.52 −4.96 31.05 20.29 −4.19 18.28 13M 24.56 24.48 19.16 −5.32 39.97 33.78 20.48 −4.00 15.99 17.78 23.98 18.76 −5.20 36.70 19.02 −4.94 30.64 23.89 18.52 −5.43 43.19 19.07 −4.89 29.56 13L 24.00 23.96 18.81 −5.14 35.34 38.41 19.07 −4.88 29.45 29.88 24.34 19.01 −5.40 42.30 19.37 −5.04 32.98 24.41 19.07 −5.34 40.64 19.33 −5.09 34.05 20M 24.49 24.41 19.29 −5.13 35.00 39.32 19.26 −5.16 35.65 34.22 24.63 19.46 −5.11 34.52 19.88 −4.69 25.83 24.67 19.38 −5.19 36.48 19.91 −4.66 25.31 20L 24.41 24.57 19.42 −5.15 35.61 35.54 19.86 −4.71 26.16 25.77

    [0255] The results were shown in FIG. 10. The rice UBQ5 was used as an internal reference gene to calculate the relative expression levels of the OsHPPD and UBI2 genes. The results showed that the HPPD expression level of the HPPD doubled strain was significantly higher than that of the wild type, indicating that the fused UBI2 strong promoter did increase the expression level of HPPD, thereby creating a highly-expressing HPPD gene, with the HPPD gene knocked up. The slight decrease in the expression level of UBI2 could be due to the small-scale mutations resulting from the edition of the promoter region, and we had indeed detected base insertions, deletions or small fragment deletions at the UBI2 target site. Compared with the wild type, the expression levels of UBI2 and HPPD significantly tended to be consistent and met the theoretical expectations; among them, the HPPD expression level of the 20M sample was about 6 times higher than that of the wild type CK3 group.

    [0256] The above results proved that, following the effective chromosome fragment doubling program as tested in protoplasts, calli and transformed seedlings with doubling events could be selected by multiple rounds of molecular identification during the Agrobacterium transformation and tissue culturing, and the UBI2 strong promoter in the new HPPD gene fusion generated in the transformed seedlings did increase the expression level of HPPD gene, rendering the plants to get resistance to HPPD inhibitory herbicide Shuangzuocaotong, up to 8 times the field dose, and thus a herbicide-resistant rice with knock-up endogenous HPPD gene was created. Taking this as an example, using the chromosome fragment doubling technical solution of Example 1 and Example 2, a desired promoter could also be introduced into an endogenous gene which gene expression pattern should be changed to create a new gene, and a new variety of plants with desired gene expression pattern could be created through Agrobacterium-mediated transformation.

    EXAMPLE 3: MOLECULAR DETECTION AND HERBICIDE RESISTANCE TEST OF T1 GENERATION OF HERBICIDE-RESISTANT RICE STRAIN WITH KNOCK-UP EXPRESSION OF THE ENDOGENOUS HPPD GENE CAUSED BY CHROMOSOME FRAGMENT DOUBLING

    [0257] The physical distance between the HPPD gene and the UBI2 gene in the wild-type rice genome was 338 kb, as shown in Scheme 1 in FIG. 1. The length of the chromosome was increased by 338 kb after the chromosome fragment between them was doubled by duplication, and a highly-expressing new HPPD gene was generated with a UBI2 promoter at the joint of the duplicated fragment to drive the expression of the HPPD CDS region. In order to determine whether the new gene could be inherited stably and the effect of the doubling chromosome fragment on the genetic stability, molecular detection and herbicide resistance test was conducted for the T1 generation of the HPPD doubled strains.

    [0258] First of all, it was observed that the doubling event had no significant effect on the fertility of T0 generation plants, as all positive T0 strains were able to produce normal seeds. Planting test of T1 generation seedlings were further conducted for the QY2091-13 and QY2091-20 strains.

    [0259] 1. Sample preparation:

    [0260] For QY2091-13, a total of 36 T1 seedlings were planted, among which 27 grew normally and 9 were albino. 32 were selected for DNA extraction and detection, where No. 1-24 were normal seedlings, and No. 25-32 were albino seedlings.

    [0261] For QY2091-20, a total of 44 T1 seedlings were planted, among which 33 grew normally and 11 were albino. 40 were selected for DNA extraction and detection, where No. 1-32 were normal seedlings, and No. 33-40 were albino seedlings.

    [0262] Albino seedlings were observed in the T1 generation plants. It was speculated that, since HPPD was a key enzyme in the chlorophyll synthesis pathway of plants, and the T0 generation plants resulting from the dual-target edition possibly could be chimeras of many genotypes such as doubling, deletion, inversion of chromosome fragments, or small fragment mutation at the edited target site. The albino phenotype could be generated in the plants where the HPPD gene was destroyed, for example, the HPPD CDS region was deleted. Different primer pairs were designed for PCR to determine possible genotypes.

    [0263] 2. PCR molecular identification:

    [0264] 1) Sequences of detection primers: sequence 5′-3′

    TABLE-US-00012 Primer 8F: TCTGTGTGAAGATTATTGCCACTAGTTC Primer 6R: GAGTTCCCCGTGGAGAGGT Test 141-F: CCCCTTCCCTCTAAAAATCAGAACAG Primer 4R: GGGATGCCCTCCTTATCTTGGATC Primer 3F: CCTCCATTACTACTCTCCCCGATTC Primer 7R: GTGTGGGGGAGTGGATGACAG pg-Hyg-R1: TCGTCCATCACAGTTTGCCA pg-35S-F: TGACGTAAGGGATGACGCAC

    [0265] 2) The binding sites of the above primers were shown in FIG. 11. Among them, the Primer 8F+Primer 6R were used to detect the fusion fragment of the UBI2 promoter and the HPPD CDS after the chromosome fragment doubling, and the length of the product was 630 bp; the Test 141-F+Primer 4R were used to detect chromosome fragment deletion event, and the length of the product was 222 bp; and the pg-Hyg-R1+pg-35S-F were used to detect the T-DNA fragment of the editing vector, and the length of the product was 660 bp.

    [0266] 3) PCR reaction system, reaction procedure and gel electrophoresis detection were performed according to Example 1.

    [0267] 3. Molecular detection results:

    [0268] The detection results of doubling and deletion events were shown in Table 7. It could be noted that the chromosome fragment doubling events and deletion events were observed in the T1 generation plants, with different rations among different lines. The doubling events in the QY2091-13 ( 29/32) were higher than that in the QY2091-20 ( 21/40), possibly due to the different chimeric ratios in the T0 generation plants. The test results indicated that the fusion gene generated by the doubling was heritable.

    TABLE-US-00013 TABLE 7 Detection results of doubling and deletion events QY2091−20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Doubling + − − − + + + − − − + − − − − − + + + − Deletion − − − − − + − − + − − + − − − − − − − − QY2091−20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 Doubling − + − − + − + + + − + + + − + + + + + − Deletion − − + + − + − − − + + − + − + − − − − + QY2091−13 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Doubling + − + + + + + − + + + + + + + + + + + + Deletion − + − + + + − + − − + − − − − − − − − + QY2091−13 21 22 23 24 25 26 27 28 29 30 31 32 Doubling − + + + + + + + + + + + Deletion − − + − − + − − + + − +

    [0269] The pg-Hyg-R1+pg-35S-F primers were used to detect the T-DNA fragment of the editing vector for the above T1 seedlings. The electrophoresis results of the PCR products of QY2091-20-17 and QY2091-13-7 were negative for the T-DNA fragment, indicating that it was a homozygous doubling. It could be seen that doubling-homozygous non-transgenic strains could be segregated from the T1 generation of the doubling events.

    [0270] 4. Detection of editing events by sequencing:

    [0271] The doubling fusion fragments were sequenced for the doubling-homozygous positive T1 generation samples 1, 5, 7, 11, 18 and 19 for QY2091-20 and for the doubling-homozygous positive T1 samples 1, 3, 7, 9, 10 and 12 for QY2091-13. The left target site of the HPPD gene and the right target site of the UBI2 were amplified at the same time for sequencing to detect the editing events at the target sites. Among them, the Primer 3F+Primer 7R were used to detect the editing event of the left HPPD target site, where the wild-type control product was 481 bp in length; the Primer 8F+Primer 4R were used to detect the editing event of the right UBI2 target site, where the wild-type control product was 329 bp in length.

    [0272] 1) Genotype of the doubling events:

    [0273] The sequencing result of the HPPD doubling in QY2091-13 was shown in SEQ ID NO: 18, and the sequencing result of the HPPD doubling in QY2091-20 was shown in SEQ ID NO: 19, see FIG. 12. Compared with the predicted linker sequences of the doubling, one T base was inserted at the linker in QY2091-13, 19 bases were deleted from the linker in QY2091-20, and both of the insertion and deletion occurred in the promoter region of UBI2 and had no effect on the coding region of the HPPD protein. From the detection results on the expression levels of the HPPD gene in Example 2, it can be seen that the expression levels of these new HPPD genes where the UBI2 promoters were fused to the HPPD CDS region was significantly increased.

    [0274] 2) Editing events at the original HPPD and UBI2 target sites on both sides:

    [0275] There were more types of editing events at the target sites on both sides. In two lines, three editing types occurred in the HPPD promoter region, namely insertion of single base, deletion of 17 bases, and deletion of 16 bases; and two editing types occurred in the UBI2 promoter region, namely insertion of 7 bases and deletion of 3 bases. The T1 plants used for testing and sampling were all green seedlings and grew normally, indicating that small-scale mutations in these promoter regions had no significant effect on gene function, and herbicide-resistant rice varieties could be selected from their offspring.

    [0276] 5. Herbicide resistance test on seedlings of T1 generation:

    [0277] The herbicide resistance of the T1 generation of the QY2091 HPPD doubled strain was tested at the seedling stage. After the T1 generation seeds were subjected to surface disinfection, they germinated on ½ MS medium containing 1.2 μM Shuangzuocaotong, and cultivated at 28° C., 16 hours light/8 hours dark, in which wild-type Jinjing 818 was used as a control.

    [0278] The test results of resistance were shown in FIG. 13. After 10 days of cultivation in light, the wild-type control rice seedlings showed phenotypes of albinism and were almost all albino, while the lines of the HPPD doubling events QY2091-7, 13, 20, 22 showed phenotype segregation of chlorosis and green seedlings. According to the aforementioned molecular detection results, there was genotype segregation in the T1 generation. Albino seedlings appeared in the absence of herbicide treatment, while green seedlings continued to remain green and grew normally after the addition of 1.2 μM Shuangzuocaotong. The test results indicated that the high resistance to Shuangzuocaotong of the HPPD gene-doubled lines could be stably inherited to the T1 generation.

    EXAMPLE 4: AN EDITING METHOD FOR KNOCKING UP THE EXPRESSION OF THE ENDOGENOUS PPO GENE BY INDUCING CHROMOSOME FRAGMENT INVERSION—RICE PROTOPLAST TEST

    [0279] The rice PPO1 (also known as PPDX1) gene (as shown in SEQ ID NO: 7, in which 1-1065 bp was the promoter, the rest was the coding region) was located on chromosome 1, and the calvin cycle protein CP12 gene (as shown in SEQ ID NO: ID NO: 8, in which 1-2088 bp was the promoter, and the rest was the coding region) was located 911 kb downstream of the PPO1 gene with opposite directions. According to the rice gene expression profile data provided by the International Rice Genome Sequencing Project (http://rice.plantbiology.msu.edu/index.shtml), the expression intensity of the CP12 gene in rice leaves was 50 times that of the PPO1 gene, and the CP12 gene promoter was a strong promoter highly expressing in leaves.

    [0280] As shown in Scheme 1 of FIG. 4, by simultaneously inducing double-strand breaks between the respective promoters and the CDS region of the two genes and screening, the region between the two breaks could be reversed, with the promoter of PPO1 gene replaced with the promoter of CP12 gene, increasing the expression level of the PPO1 gene and achieving the resistance to PPO inhibitory herbicides, thereby herbicide-resistant lines could be selected. In addition, as shown in Scheme 2 of FIG. 4, a new gene of PPO1 driven by the promoter of CP12 gene could also be created by first inversion and then doubling.

    [0281] 1. First, the rice PPO1 and CP12 genomic DNA sequences were input into the CRISPOR online tool (http://crispor.tefor.net/) to search for available editing target sites. After online scoring, the following target sites were selected between the promoters and the CDS regions of the PPO1 and CP12 genes for testing:

    TABLE-US-00014 Name of target sgRNA Sequence (5′ to 3) OsPPO-guide RNA1 CCATGTCCGTCGCTGACGAG OsPPO-guide RNA2 CCGCTCGTCAGCGACGGACA OsPPO-guide RNA3 GCCATGGCTGGCTGTTGATG OsPPO-guide RNA4 CGGATTTCTGCGTGTGATGT

    [0282] The guide RNA1 and guide RNA2 located between the promoter and the CDS region of the PPO1 gene, close to the PPO1 start codon, and the guide RNA3 and guide RNA4 located between the promoter and the CDS region of the CP12 gene, close to the CP12 start codon.

    [0283] As described in Example 1, primers were designed for the above target sites to construct dual-target vectors, with pHUE411 as the backbone:

    TABLE-US-00015 Primer No. DNA sequence (5′ to 3′) OsPP01-sgRNA1-F ATATGGTCTCGGGCG CCATGTCCGTCGCTG ACGAGGTTTTAGAGC TAGAAATAGCAAG OsPP01-sgRNA2-F ATATGGTCTCGGGCG CCGCTCGTCAGCGAC GGACAGTTTTAGAGC TAGAAATAGCAAG OsPP01-sgRNA3-R TATTGGTCTCTAAAC CATCAACAGCCAGCC ATGGCGCTTCTTGGT GCCGCGCCTC OsPP01-sgRNA4-R TATTGGTCTCTAAAC ACATCACACGCAGAA ATCCGGCTTCTTGGT GCCGCGCCTC

    [0284] Specifically, the pCBC-MT1T2 plasmid (https://www.addgene.org/50593/) was used as the template to amplify the sgRNA1+3, sgRNA1+4, sgRNA2+3, sgRNA2+4 dual-target fragments and construct sgRNA expression cassettes, respectively. The pHUE411 vector backbone was digested with Bsal and recovered from gel, and the target fragment was directly used for the ligation reaction after digestion. T4 DNA ligase was used to ligate the vector backbone and the target fragment, the ligation product was transformed into Trans5α competent cells, different monoclones were selected and sequenced. The Sparkjade High Purity Plasmid Mini Extraction Kit was used to extract plasmids with correct sequencing results, thereby obtaining recombinant plasmids, respectively named as pQY002095, pQY002096, pQY002097, pQY002098, as shown below:

    [0285] pQY002095 pHUE411-PPO-sgRNA1+3 containing OsPPO-guide RNA1, guide RNA3 combination

    [0286] pQY002096 pHUE411-PPO-sgRNA2+3 containing OsPPO-guide RNA2, guide RNA3 combination

    [0287] pQY002097 pHUE411-PPO-sgRNA1+4 containing OsPPO-guide RNA1, guide RNA4 combination

    [0288] pQY002098 pHUE411-PPO-sgRNA2+4 containing OsPPO-guide RNA2, guide RNA4 combination

    [0289] 2. Plasmids of high-purity and high-concentration were prepared for the above-mentioned pQY002095-002098 vectors as described in the step 2 of Example 1.

    [0290] 3. Rice protoplasts were prepared and subjected to PEG-mediated transformation with the above-mentioned vectors as described in step 3 of Example 1.

    [0291] 4. Genomic targeting and detection of new gene with the detection primers shown in the table below for the PCR detection as described in the step 4 of Example 1.

    TABLE-US-00016 Primer Sequence (5′ to 3′) OsPPOinversion-checkF1 (PPO-F1) GCTATGCCGTCGCTCTTTCTC OsPPOinversion-checkF2 CGGACTTATTCCCACCAGAA (PPO-F2) OsPPOinversion-checkR1 (PPO-R1) GAGAAGGGGAGCAAGAAGACGT OsPPOinversion-checkR2 (PPO-R2) AAGGCTGGAAGCTGTTGGG OsCPinversion-checkF1 CATTCCACCAAACTCCCCTCTG (CP-F1) OsCPinversion-checkF2 AGGTCTCCTTGAGCTTGTCG (CP-F2) OsCPinversion-checkR1 GTCATCTGCTCATGTTTTC (CP-R1) ACGGTC OsCPinversion-checkR2 CTGAGGAGGCGATAAGAAACGA (CP-R2)

    [0292] Among them, the combination of PPO-R2 and CP-R2 was used to amplify the CP12 promoter-driven PPO1 CDS new gene fragment that was generated on the right side after chromosome fragment inversion, and the combination of PPO-F2 and CP-F2 was used to amplify the PPO1 promoter-driven CP12 CDS new gene fragment that was generated on the left side after inversion. The possible genotypes resulting from the dual-target editing and the binding sites of the molecular detection primers were shown in FIG. 14.

    [0293] 5. The PCR and sequencing results showed that the expected new gene in which the CP12 promoter drove the expression of PPO1 was created from the transformation of rice protoplasts. The editing event where the rice CP12 gene promoter was fused to the PPO1 gene expression region could be detected in the genomic DNA of the transformed rice protoplasts. This indicated that the scheme to form a new PPO gene through chromosome fragment inversion was feasible, and a new PPO gene driven by a strong promoter could be created, which was defined as a PPO1 inversion event. The sequencing results for the chromosome fragment inversion in protoplasts transformed with the pQY002095 vector were shown in SEQ ID NO: 15; the sequencing results for the chromosome fragment deletion in protoplasts transformed with the pQY002095 vector were shown in SEQ ID NO: 16; and the sequencing results for the chromosome fragment inversion in protoplasts transformed with the pQY002098 vector were shown in SEQ ID NO: 17.

    EXAMPLE 5: CREATION OF HERBICIDE-RESISTANT RICE WITH KNOCK-UP EXPRESSION OF THE ENDOGENOUS PPO GENE CAUSED BY CHROMOSOME FRAGMENT INVERSION THROUGH AGROBACTERIUM-MEDIATED TRANSFORMATION

    [0294] 1. Construction of knock-up editing vector: Based on the results of the protoplast testing, the dual-target combination of OsPPO-guide RNA1: 5′CCATGTCCGTCGCTGACGAG3′ and OsPPO-guide RNA4: 5′CGGATTTCTGCGT-GTGATGT3′ with high editing efficiency was selected to construct the Agrobacterium transformation vector pQY2234. pHUE411 was used as the vector backbone and the rice codon optimization was performed. The vector map was shown in FIG. 16.

    [0295] 2. Agrobacterium transformed rice callus and two rounds of molecular identification:

    [0296] The pQY2234 plasmid was used to transform rice callus according to the method described in step 2 of Example 2. The recipient varieties were Huaidao No. 5 and Jinjing 818. In the callus selection stage, two rounds of molecular identification were performed on hygromycin-resistant callus, and the calli positive in inversion event were differentiated. During the molecular detection of callus, the amplification of the CP12 promoter-driven PPO1 CDS new gene fragment generated on the right side after chromosome fragment inversion by the combination of PPO-R2 and CP-R2 was deemed as the positive standard for the inversion event, while the CP12 new gene generated on the left side after inversion was considered after differentiation and seedling emergence of the callus. A total of 734 calli from Huaidao No. 5 were tested, in which 24 calli were positive for the inversion event, and 259 calli from Jinjing 818 were tested, in which 29 calli were positive for the inversion event. FIG. 17 showed the PCR detection results of Jinjing 818 calli No. 192-259.

    [0297] 3. A total of 53 inversion event-positive calli were subjected to two rounds of molecular identification and then co-differentiated, and 9 doubling event-positive calli were identified, which were subjected to two rounds of molecular identification and then co-differentiated to produce 1,875 T0 seedlings, in which 768 strains were from Huaidao No. 5 background, and 1107 strains were from Jinjing 818 background. These 1875 seedlings were further subjected to the third round of molecular identification with the PPO-R2 and CP-R2 primer pair, in which 184 lines from Huaidao No. 5 background showed inversion-positive bands, 350 strains from Jinjing 818 background showed inversion-positive bands. The positive seedlings were moved to the greenhouse for cultivation.

    [0298] 4. PPO inhibitory herbicide resistance test of PPO1 inversion seedlings (T0 generation):

    [0299] Transformation seedlings of QY2234 T0 generation identified as inversion event-positive were transplanted into large plastic buckets in the greenhouse to grow seeds of T1 generation. There were a large number of positive seedlings, so some T0 seedlings and wild-type control lines with similar growth period and status were selected. When the plant height reached about 20 cm, the herbicide resistance test was directly carried out. The herbicide used was a high-efficiency PPO inhibitory herbicide

    ##STR00001##

    produced by the company (code 2081, see Chinse Patent Application for Invention No. 202010281666.4). In this experiment, the herbicide was applied at the gradients of three levels, namely 0.18, 0.4, and 0.6 g ai/mu, by a walk-in type spray tower.

    [0300] The resistance test results were shown in FIG. 18. 3-5 days after the application, the wild-type control rice seedlings began to wither from tip of leaf, necrotic spots appeared on the leaves, and the plants gradually withered, while most of the lines of the PPO1 inversion event maintained normal growth, the leaves had no obvious phytotoxicity. In addition, some lines showed phytotoxicity, probably due to the polygenotypic mosaicism of editing events and the low expression level of PPO1 in the T0 generation lines. Two weeks after the application, the wild-type rice seedlings died, and most of the inversion event strains continued to remain green and grew normally. The test results showed that the PPO1 inversion lines could significantly improve the tolerance of plants to 2081.

    [0301] 5. Quantitative detection of relative expression level of PPO1 gene in PPO1 inversion seedlings (T0 generation):

    [0302] It was speculated that the increased resistance of the PPO1 gene inversion lines to 2081 was due to the fusion of the strong CP12 promoter and the CDS of the PPO1 gene which would increase the expression level of PPO1. Therefore, the lines of T0 generation QY2234-252, QY2234-304 and QY2234-329 from Huaidao No. 5 background were selected, their primary tillers and secondary tillers were sampled and subjected to the detection of expression levels of PPO1 and CP12 genes. The wild-type Huaidao No. 5 was used as the control. The specific protocols followed step 6 of Example 2, with the rice UBQ5 gene as the internal reference gene. the fluorescence quantitative primers were as follows: 5′-3′

    TABLE-US-00017 UBQ5-F ACCACTTCGACCGCCACTACT UBQ5-R ACGCCTAAGCCTGCTGGTT RT-OsPP01-F GCAGCAGATGCTCTGTCAATA RT-OsPP01-R CTGGAGCTCTCCGTCAATTAAG RT-OsCP12-F1 CCGGACATCTCGGACAA RT-OsCP12-R1 CTCAGCTCCTCCACCTC

    [0303] The UBQ5 was used as an internal reference. ΔCt was calculated by subtracting the Ct value of UBQ5 from the Ct value of the target gene. Then 2.sup.−ΔCt was calculated, which represented the relative expression level of the target gene. The H5CK1 and H5CK2 were two wild-type control plants of Huaidao No. 5, the 252M, 304M and 329M represented the primary tiller leaf samples of QY2234-252, QY2234-304 and QY2234-329 T0 plants, and the 252L, 304L, and 329L represented their secondary tiller leaf samples. The results were shown in Table 8 below:

    TABLE-US-00018 TABLE 8 Ct values and relative expression folds of different genes UBQ5 Mean PPO1 ΔCt 2.sup.−ΔCt Mean CP12 ΔCt 2.sup.−ΔCt Mean 28.18 25.83 −2.43 5.39 22.28 −3.98 15.77 28.37 25.98 −2.28 4.85 22.06 −4.20 18.44 H5CK1 28.23 28.26 25.93 −2.33 5.03 5.09 22.11 −4.15 17.76 17.32 28.23 25.73 −2.36 5.15 21.63 −6.47 88.58 27.98 26.02 −2.07 4.20 21.53 −6.57 94.87 H5CK2 28.07 28.09 25.92 −2.18 4.52 4.62 21.54 −6.55 93.83 92.43 25.51 25.17 −0.54 1.45 22.26 −3.45 10.95 25.82 25.22 −0.49 1.41 22.36 −3.36 10.23 252M 25.80 25.71 25.22 −0.49 1.41 1.42 22.43 −3.29 9.76 10.31 26.41 23.36 −3.14 8.84 22.30 −4.21 18.49 26.64 23.41 −3.10 8.56 21.95 −4.56 23.55 252L 26.47 26.51 23.46 −3.05 8.28 8.56 21.78 −4.73 26.47 22.84 25.74 24.55 −1.29 2.44 22.51 −3.32 10.02 25.99 24.53 −1.31 2.48 22.45 −3.39 10.47 304M 25.78 25.84 24.48 −1.36 2.57 2.50 22.56 −3.28 9.71 10.07 25.97 23.63 −2.36 5.14 21.60 −4.39 20.97 26.00 23.75 −2.25 4.74 21.43 −4.56 23.55 304L 26.00 25.99 23.56 −2.43 5.39 5.09 22.32 −3.68 12.78 19.10 26.94 23.11 −3.89 14.84 22.23 −4.76 27.16 26.99 23.25 −3.75 13.42 21.85 −5.15 35.39 329M 27.07 27.00 23.22 −3.78 13.71 13.99 21.82 −5.18 36.29 32.95 26.50 23.64 −2.63 6.19 22.00 −4.27 19.30 26.52 23.74 −2.53 5.79 21.97 −4.30 19.71 329L 25.79 26.27 23.77 −2.50 5.65 5.87 22.15 −4.12 17.42 18.81

    [0304] The relative expression levels of PPO1 and CP12 in different strains were shown in FIG. 19. As the results showed, unlike the doubling event in Example 2, the gene expression levels of these inversion event strains were significantly different. The expression levels of CP12 are very different between the two Huaidao No. 5 CK groups, possibly because of the different growth rates of the seedlings. Compared with the H5CK2 control group, the expression levels of CP12 in the experimental groups all showed a tendency of decrease, while the expression levels of PPO1 for 252L and 329M increased significantly, and the expression levels of PPO1 for 304L and 329L modestly increased, and the expression levels of PPO1 for 252M and 304M decreased. Different from the doubling of chromosome fragments which mainly increased the gene expression level, the inversion of chromosome fragments generated new genes on both sides, so various editing events might occur at the targets on both sides, and the changes in the transcription direction might also affect gene expression level at the same time. That is to say, the T0 generation plants were complex chimeras. There might also be significant differences in gene expression levels between primary and secondary tillers of the same plant. It could be seen from the results of quantitative PCR that the PPO1 inversion events showed a higher likelihood of increasing the PPO1 gene expression level, and thus herbicide-resistant strains with high expression level of PPO1 could be selected out by herbicide resistance selection for the inversion events.

    [0305] The above results proved that, following the scheme of detecting effective chromosome fragment inversion in protoplasts, calli and transformed seedlings with inversion events could be selected through the multiple rounds of molecular identification during the Agrobacterium transformation and tissue culturing, and the CP12 strong promoter fused with the new PPO1 gene generated in the transformant seedlings could indeed increase the expression level of the PPO1 gene, which could confer the plants with resistance to the PPO inhibitory herbicide 2081, thereby herbicide-resistant rice with knock-up endogenous PPO gene was created. Taking this as an example, the chromosome fragment inversion protocol of Example 4 and Example 5 also applied to other endogenous genes which gene expression pattern needed to be changed by introducing and fusing with a required promoter, thereby a new gene can be created, and new varieties with a desired gene expression pattern could be created through Agrobacterium-mediated transformation in plants.

    EXAMPLE 6: MOLECULAR DETECTION AND HERBICIDE RESISTANCE TEST OF THE T1 GENERATION PLANTS OF THE HERBICIDE-RESISTANT RICE LINES WITH KNOCK-UP EXPRESSION OF THE ENDOGENOUS PPO1 GENE THROUGH CHROMOSOME FRAGMENT INVERSION

    [0306] The physical distance between the wild-type rice genome PPO1 gene and CP12 gene was 911 kb. As shown in FIG. 14, a highly-expressing PPO1 gene with a CP12 promoter-driven

    [0307] PPO1 CDS region was generated on the right side after the inversion of the chromosome fragment between the two genes. A deletion of chromosome fragment could also occur. In order to test whether the new gene could be inherited stably and the influence of the chromosome fragment inversion on genetic stability, molecular detection and herbicide resistance test was carried out on the T1 generation of the PPO1 inversion strain.

    [0308] First of all, it was observed that the inversion event had no significant effect on the fertility of the T0 generation plants, as all positive T0 strains were able to produce seeds normally. The T1 generations of QY2234/H5-851 strains with the Huaidao No. 5 background were selected for detection.

    [0309] 1. Sample preparation:

    [0310] For QY2234/H5-851, a total of 48 T1 seedlings were planted. All the plants grew normally.

    [0311] 2. PCR molecular identification:

    [0312] 1) Detection primer sequence: 5′-3′

    TABLE-US-00019 PPO-R2: AAGGCTGGAAGCTGTTGGG CP-R2: CTGAGGAGGCGATAAGAAACGA PPO-F2: CGGACTTATTTCCCACCAGAA CP-F2: AGGTCTCCTTGAGCTTGTCG pg-Hyg-R1: TCGTCCATCACAGTTTGCCA pg-35S-F: TGACGTAAGGGATGACGCAC

    [0313] 2) The binding sites of the above primers were shown in FIG. 14, wherein the PPO-R2+CP-R2 was used to detect the fusion fragment of the right CP12 promoter and the PPO1 coding region after the inversion of the chromosome fragment, and the length of the product was 507 bp; the PPO-F2+CP-F2 was used to detect the fusion fragment of the left PPO1 promoter and the CP12 coding region after the inversion of the chromosome fragment, and the length of the product was 560 bp; the PPO-F2+PPO-R2 was used to detect the left PPO target site before the inversion, and the length of the product in the wild-type control was 586 bp; the CP-F2+CP-R2 was used to detect the right CP12 target site before the inversion, and the length of the product in the wild-type control was 481 bp. The pg-Hyg-R1+pg-35S-F was used to detect the T-DNA fragment of the editing vector, and the length of the product was 660 bp.

    [0314] 3) PCR reaction system and reaction conditions:

    [0315] Reaction system (10 μL system):

    TABLE-US-00020 2*KOD buffer   5 μL 2 mM dNTPs   2 μL KOD enzyme 0.2 μL Primer F 0.2 μL Primer R 0.2 μL Water 2.1 μL Sample 0.3 μL

    [0316] Reaction conditions:

    TABLE-US-00021 94° C. 2 minutes 98° C. 20 seconds 60° C. 20 seconds {close oversize brace} 40 cycles 68° C. 20 seconds 68° C. 2 minutes 12° C. 5 minutes

    [0317] The PCR products were subjected to electrophoresis on a 1% agarose gel with a voltage of 180 V for 10 minutes.

    [0318] 3. Molecular detection results:

    [0319] The detection results were shown in Table 9. A total of 48 plants were detected, of which 12 plants (2/7/11/16/26/36/37/40/41/44/46/47) were homozygous in inversion, 21 plants (1/3/4/5/6/8/9/15/17/20/22/23/24/27/30/31/33/34/39/42/43) were heterozygous in inversion, and 15 plants (10/12/13/14/18/19/21/25/28/29/32/35/38/45/48) were homozygous in non-inversion. The ratio of homozygous inversion: heterozygous inversion: homozygous non-inversion was 1:1.75:1.25, approximately 1:2:1. So the detection results met the Mendel's law of inheritance, indicating that the new PPO1 gene generated by inversion was heritable.

    TABLE-US-00022 TABLE 9 Results of molecular detection QY2234−851 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 Right side of + + + + + + + + + − + − − − + + + − − + + + + − + + − − inversion Left side of + + + + + + + + + − + − − − + + + − − + − + + + − + + − inversion PPO WT + − + + + + − + + + − + + + + − + + + + + + + + + − + + CP12 WT + − + + + + − + + + − + + + + − + + + + + + + + + − + + QY2234−851 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 Right side of + + − + + − + + − + + + + + + − + + − inversion Left side of − + + − + + − + + − + + + + + + − + + − inversion PPO WT + + + + + + + − − + + − − + + − + − − + CP12 WT + + + + + + + − − + + − − + + − + − − +

    [0320] For the above T1 seedlings, the Pg-Hyg-R1+pg-35S-F primers were used to detect the T-DNA fragment of the editing vector. The electrophoresis results of 16 and 41 were negative for T-DNA fragment, indicating homozygous inversion. It could be seen that non-transgenic strains of homozygous inversion could be segregated from the T1 generation of the inversion event.

    [0321] 4. Sequencing detection of the editing events:

    [0322] The genotype detection of the inversion events focused on the editing events of the new PPO gene on the right side. The mutation events with the complete protein coding frame of the PPO1 gene were retained. The CP12 site editing events on the left side that did not affect the normal growth of plants through the phenotype observation in the greenhouse and field were retained. The genotypes of the editing events detected in the inversion event-positive lines were listed below, in which seamless indicated identical to the predicted fusion fragment sequence after inversion. The genotypes of the successful QY2234 inversion events in Huaidao No. 5 background were as follows:

    TABLE-US-00023 No. Genotype No. Genotype 2234/H5-295 Right side −1 bp; left side −32 bp 2234/H5-650 Right side seamless; left side +1 bp (G) 2234/H5-381 Right side +18 bp 2234/H5-263 Right side seamless; left side seamless 2234/H5-410 Right side −1 bp; left side +1 bp 2234/H5-555 Right side −23 bp 2234/H5-159 Right side −16 bp 2234/H5-645 Right side −5 bp, +20 bp, 2234/H5-232 Right side −4 bp

    [0323] Some of the sequencing peak maps and sequence comparison results were shown in FIG. 20.

    [0324] The genotypes of the successful QY2234 inversion in the Jinjing818 background were as follows:

    TABLE-US-00024 No. Right side PPO genotype No. Right side PPO genotype 2234/818-5 Right side seamless 2234/818-144 Right side +1 bp 2234/818-42 Right side −16 bp 2234/818-151 Sight side +2 bp, −26 bp, pure peak 2234/818-108 Right side −15 bp 2234/818-257 Sight side +1 bp 2234/818-134 Right side +5 bp, −15 bp

    [0325] Some of the sequencing peak maps and sequence comparison results were shown in FIG. 21.

    [0326] The sequencing results of the above different new PPO1 genes with the CP12 promoter fused to the PPO1 coding region were shown in SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, and SEQ ID NO: 26.

    [0327] 5. Herbicide resistance test of T1 generation seedlings:

    [0328] The herbicide resistance test was performed on the T1 generation of the QY2234/H5-851 PPO1 inversion lines at seedling stage. The wild-type Huaidao No. 5 was used as a control, and planted simultaneously with the T1 generation seeds of the inversion lines. When the seedlings reached a plant height of 15 cm, 2081 was applied by spraying at four levels of 0.3, 0.6, 0.9 and 1.2 g a.i./mu. The culture conditions were 28° C., with 16 hours of light and 8 hours of darkness.

    [0329] The resistance test results were shown in FIG. 22. After 5 days of the application, the wild-type control rice seedlings showed obvious phytotoxicity at a dose of 0.3 g a.i./mu. They began to wither from the tip of leaf, and necrotic spots appeared on the leaves; at a dose of 0.6 g a.i./mu, the plants died quickly. However, QY2234/H5-851 T1 seedlings could maintain normal growth at a dose of 0.3 g a.i./mu, and no obvious phytotoxicity could be observed on the leaves; at doses of 0.6 and 0.9 g ai/mu, some T1 seedlings showed dry leaf tips, but most T1 seedlings could keep green and continue to grow, while the control substantially died off. At a dose of 1.2 g a.i./mu, the control plants were all dead, while some of the T1 seedlings could keep green and continue to grow. The test results indicated that the resistance of the PPO1 gene inversionlines to 2081 could be stably inherited to their T1 generation.

    EXAMPLE 7: AN EDITING METHOD FOR KNOCKING UP THE EXPRESSION OF THE ENDOGENOUS EPSPS GENE IN PLANT

    [0330] EPSPS was a key enzyme in the pathway of aromatic amino acid synthesis in plants and the target site of the biocidal herbicide glyphosate. The high expression level of EPSPS gene could endow plants with resistance to glyphosate. The EPSPS gene (as shown in SEQ ID NO: 4, in which 1-1897 bp was the promoter, and the rest was the expression region) was located on chromosome 6 in rice. The gene upstream was transketolase (TKT, as shown in SEQ ID NO: 3, in which 1-2091 bp was the promoter, and the rest was the expression region) with an opposite direction. The expression intensity of TKT gene in leaves was 20-50 times that of the EPSPS gene. As shown in FIG. 2, by simultaneously inducing double-strand breaks between the promoter and the CDS region of the two genes respectively, the inversion (Scheme 1) or inversion doubling (Scheme 2) of the region between the two breaks could be obtained after screening. In both cases, the promoter of the EPSPS gene would be replaced with the promoter of the TKT gene, thereby increasing the expression level of the EPSPS gene and obtaining the resistance to glyphosate. In addition, the Schemes 3, 4 and 5 as shown in FIG. 2 could also create new EPSPS genes driven by the TKT gene promoter. The gene structure of EPSPS adjacent to and opposite in direction relative to TKT was conserved in monocotyledonous plants (Table 10). While in dicotyledonous plants, both genes were also adjacent yet in the same direction; therefore, this method was universal in plants.

    TABLE-US-00025 TABLE 10 Distance between the EPSPS gene and the adjacent TKT gene in different plants Distance from Location CD region Species (chromosome) start site (kb) Direction Rice  6  4 Reverse <TKT-EPSPS> Wheat 7A 35 Reverse <TKT-EPSPS> 7D 15 Reverse <TKT-EPSPS> 4A? 50 Reverse <TKT-EPSPS> Maize  9 22 Reverse <TKT-EPSPS> Brachypodium  1  5 Reverse <TKT-EPSPS> distachyon Sorghum 10 15 Reverse <TKT-EPSPS> Millet  4  5 Reverse <TKT-EPSPS> Soybean  3  6 Forward TKT>EPSPS> Tomato  5  6 Forward TKT>EPSPS> Peanut  2  6 Forward TKT>EPSPS> 12  5 Forward TKT>EPSPS> Cotton  9 22 Forward TKT>EPSPS> Alfalfa  4  8 Forward TKT>EPSPS> Arabidopsis  2  5 Forward TKT>EPSPS> Grape 15 17 Forward TKT>EPSPS>

    [0331] To this end, pHUE411 was used as the backbone, and the following as targets:

    TABLE-US-00026 Name of target sgRNA Sequence (5′ to 3) OsEPSPS-guide RNA 1 CCACACCACTCCTCTCGCCA OsEPSPS-guide RNA2 CCATGGCGAGAGGAGTGGTG OsEPSPS-guide RNA3 ATGGTCGCCGCCATTGCCGG OsEPSPS-guide RNA4 GACCTCCACGCCGCCGGCAA OsEPSPS-guide RNA5 TAGTCATGTGACCATCCCTG OsEPSPS-guide RNA6 TTGACTCTTTGGTTCATGCT

    [0332] Several different dual-target vectors had been constructed:

    [0333] pQY002061 pHUE411-EPSPS-sgRNA1+3

    [0334] pQY002062 pHUE411-EPSPS-sgRNA2+3

    [0335] pQY002063 pHUE411-EPSPS-sgRNA1+4

    [0336] pQY002064 pHUE411-EPSPS-sgRNA2+4

    [0337] pQY002093 pHUE411-EPSPS-sgRNA2+5

    [0338] pQY002094 pHUE411-EPSPS-sgRNA2+6

    [0339] (2) With the relevant detection primers shown in the following table, the fragments containing the target sites on both sides or the predicated fragments generated by the fusion of the UBI2 promoter and the HPPD coding region were amplified, and the length of the products is between 300-1000 bp.

    TABLE-US-00027 Primer Sequence (5′ to 3′) EPSPSinversion checkF1 ATCCAAGTTACCCCCTCTGC EPSPSinversion checkR1 CACAAACACAGCCACCTCAC EPSPSinversion check- ATGTCCACGTCCACACCATA nestF2 EPSPSinversion check- AATGGAATTCACGCAAGAGG nestR2 EPSPSinversion checkF3 GTAGGGGTTCTTGGGGTTGT EPSPSinversion checkR3 CGCATGCTAACTTGAGACGA EPSPSinversion check- GGATCGTGTTCACCGACTTC nestF4 EPSPSinversion check- CCGGTACAACGCACGAGTAT nestR4 EPSPSinversion checkF5 GGCGTCATTCCATGGTTGATTGT EPSPSinversion GATAGACCCAGATGGGCATAG checknestF6 AATC EPSPSinversion TGCATGCATTGATGGTTGGTGC checkR5 EPSPSinversion CCGGCCCTTAGAATAAAGGTAG checknestR6 TAG

    [0340] After protoplast transformation, the detection results showed that the expected inversion events were obtained. As shown in FIG. 15, the sequencing result of the inversion detection of pQY002062 vector transformed protoplast was shown in SEQ ID NO: 11; the sequencing result of the deletion detection of pQY002062 vector transformed protoplast was shown in SEQ ID No: 12; the sequencing result of the inversion detection of the pQY002093 vector transformed protoplast was shown in SEQ ID NO: 13; and the sequencing result of the deletion detection of pQY002093 vector transformed protoplast was shown in SEQ ID NO: 14.

    [0341] These vectors were transferred into Agrobacterium for transforming calli of rice. Plants containing the new EPSPS gene were obtained. The herbicide bioassay results showed that the plants had obvious resistance to glyphosate herbicide.

    EXAMPLE 8: AN EDITING METHOD FOR KNOCKING UP THE EXPRESSION OF THE ENDOGENOUS PPO GENE IN ARABIDOPSIS

    [0342] Protoporphyrinogen oxidase (PPO) was one of the main targets of herbicides. By highly expressing plant endogenous PPO, the resistance to PPO inhibitory herbicides could be significantly increased. The Arabidopsis PPO gene (as shown in SEQ ID NO: 1, in which 1-2058 bp was the promoter, and the rest was the expression region) located on chromosome 4, and the ubiquitin10 gene (as shown in SEQ ID NO: 2, in which 1-2078 bp was the promoter, and the rest was the expression region) located 1.9M downstream with the same direction as the PPO gene.

    [0343] As shown in the Scheme as shown in FIG. 3, simultaneously generating double-strand breaks at the sites between the promoter and the CDS region of the PPO and the ubiquitin10 genes respectively. Doubling events of the region between the two breaks could be obtained by screening, namely a new gene generated by fusing the ubiquitin10 promoter and the PPO coding region. In addition, following Scheme 2 as shown in FIG. 1, a new gene in which the ubiquitin10 promoter and the PPO coding region were fused together could also be created.

    [0344] To this end, pHEE401E was used as the backbone (https://www.addgene.org/71287/), and the following locations were used as target sites:

    TABLE-US-00028 Name of target sgRNA Sequence (5′ to 3) AtPPO-guide RNA1 CAAACCAAAGAAAAAGTATA AtPPO-guide RNA2 GGTAATCTTCTTCAGAAGAA AtPPO-guide RNA3 ATCATCTTAATTCTCGATTA AtPPO-guide RNA4 TTGTGATTTCTATCTAGATC

    [0345] The dual-target vectors were constructed following the method described by “Wang Z P, Xing H L, Dong L, Zhang H Y, Han C Y, Wang X C, Chen Q J. Egg cell-specific promoter-controlled CRISPR/Cas9 efficiently generates homozygous mutants for multiple target genes in Arabidopsis in a single generation. Genome Biol. 2015 Jul. 21; 16:144.”:

    TABLE-US-00029 pQY002076 pHEE401E-AtPPO-sgRNA1 + 3 pQY002077 pHEE401E-AtPPO-sgRNA1 + 4 pQY002078 pHEE401E-AtPPO-sgRNA2 + 3 pQY002079 pHEE401E-AtPPO-sgRNA2 + 4

    [0346] Arabidopsis was transformed according to the method as follows:

    [0347] (1) Agrobacterium transformation

    [0348] Agrobacterium GV3101 competent cells were transformed with the recombinant plasmids to obtain recombinant Agrobacterium.

    [0349] (2) Preparation of Agrobacterium infection solution

    [0350] 1) Activated Agrobacterium was inoculated in 30 ml of YEP liquid medium (containing 25 mg/L Rif and 50 mg/L Kan), cultured at 28° C. under shaking at 200 rpm overnight until the OD600 value was about 1.0-1.5.

    [0351] 2) The bacteria were collected by centrifugation at 6000 rpm for 10 minutes, and the supernatant was discarded.

    [0352] 3) The bacteria was resuspended in the infection solution (no need to adjust the pH) to reach OD600=0.8 for later use.

    [0353] (3) Transformation of Arabidopsis

    [0354] 1) Before the plant transformation, the plants should grow well with luxuriant inflorescence and no stress response. The first transformation could be carried out as long as the plant height reached 20 cm. When the soil was dry, watering was carried out as appropriate. On the day before the transformation, the grown siliques were cut with scissors.

    [0355] 2) The inflorescence of the plant to be transformed was immersed in the above solution for 30 seconds to 1 minute with gentle stirring. The infiltrated plant should have a layer of liquid film thereon.

    [0356] 3) After transformation, the plant was cultured in the dark for 24 hours, and then removed to a normal light environment for growth.

    [0357] 4) After one week, the second transformation was carried out in the same way.

    [0358] (4) Seed harvest

    [0359] Seeds were harvested when they were mature. The harvested seeds were dried in an oven at 37° C. for about one week.

    [0360] (5) Selection of transgenic plants

    [0361] The seeds were treated with disinfectant for 5 minutes, washed with ddH.sub.2O for 5 times, and then evenly spread on MS selection medium (containing 30 μg/ml Hyg, 100 μg/ml Cef). Then the medium was placed in a light incubator (at a temperature of 22° C., 16 hours of light and 8 hours of darkness, light intensity 100-150 μmol/m.sup.2/s, and a humidity of 75%) for cultivation. The positive seedlings were selected and transplanted to the soil after one week.

    [0362] (6) Detection of T1 mutant plants

    [0363] (6.1) Genomic DNA extraction

    [0364] 1) About 200 mg of Arabidopsis leaves was cut and placed into a 2 ml centrifuge tube. Steel balls were added, and the leaves were ground with a high-throughput tissue disruptor.

    [0365] 2) After thorough grinding, 400 μL of SDS extraction buffer was added and mixed upside down. The mixture was incubated in a 65° C. water bath for 15 minutes, and mixed upside down every 5 minutes during the period.

    [0366] 3) The mixture was centrifuged at 13000 rpm for 5 minutes.

    [0367] 4) 300 μL of supernatant was removed and transferred to a new 1.5 ml centrifuge tube, an equal volume of isopropanol pre-cooled at −20° C. was added into the centrifuge tube, and then the centrifuge tube was kept at −20° C. for 1 hour or overnight.

    [0368] 5) The mixture was centrifuged at 13000 rpm for 10 minutes, and the supernatant was discarded.

    [0369] 6) 500 μL of 70% ethanol was added to the centrifuge tube to wash the precipitate, the washing solution was discarded after centrifugation (carefully not discarding the precipitate). After the precipitate was dried at room temperature, 30 μL of ddH.sub.2O was added to dissolve the DNA, and then stored at −20° C.

    [0370] (6.2) PCR amplification

    [0371] With the extracted genome of the T1 plant as template, the target fragment was amplified with the detection primers. 5 μL of the amplification product was taken and detected by 1% agarose gel electrophoresis, and then imaged by a gel imager. The remaining product was directly sequenced by a sequencing company.

    [0372] The sequencing results showed that the AtPPO1 gene doubling was successfully achieved in Arabidopsis, and the herbicide resistance test showed that the doubling plant had resistance to PPO herbicides.

    EXAMPLE 9: CREATION OF GH1 GENE WITH NEW EXPRESSION CHARACTERISTICS IN ZEBRAFISH

    [0373] The growth hormone (GH) genes in fishes controlled their growth and development speed. At present, highly expressing the GH gene in Atlantic salmons through the transgenic technology could significantly increase their growth rates. The technique was of great economical value, but only approved for marketing after decades. The GH1 gene was the growth hormone gene in zebrafish. In the present invention, suitable promoters in zebrafish (suitable in terms of continuous expression, strength, and tissue specificity) were fused together in vivo through deletion, inversion, doubling, inversion doubling, chromosome transfer, etc., to create a fast-growing fish variety.

    [0374] All publications and patent applications mentioned in the description are incorporated herein by reference, as if each publication or patent application is individually and specifically incorporated herein by reference.

    [0375] Although the foregoing invention has been described in more detail by way of examples and embodiments for clear understanding, it is obvious that certain changes and modifications can be implemented within the scope of the appended claims, such changes and modifications are all within the scope of the present invention.