A METHOD TO AMPLIFY A NUCLEIC ACID

20230086471 · 2023-03-23

Assignee

Inventors

Cpc classification

International classification

Abstract

This invention relates to methods and compositions for amplifying nucleic acids, e.g., genomic DNA, using nicking agents. The method of amplifying nucleic acids comprising: (a) forming a reaction mixture comprising: (i) a first nucleic acid template comprising a strand having a first nicking agent recognition sequence; (ii) a second nucleic acid template comprising a strand having a second nicking agent recognition sequence; (iii) at least one primer for a target region on the first or second nucleic acid template; (iv) at least one protein having DNA polymerase domain function, wherein the domain function comprises a first domain function capable of strand displacement activity and a second domain function capable of high processivity activity, or at least one protein having DNA polymerase domain function capable of strand displacement activity and at least one protein having DNA polymerase domain function capable of high processivity activity; (v) at least one deoxynucleoside triphosphate; and (vi) a first nicking agent for recognizing the first nicking agent recognition sequence and a second nicking agent for recognizing the second nicking agent recognition sequence; (b) incubating the reaction mixture under conditions that amplifies the nucleic acid templates, wherein the domain functions capable of strand displacement activity and high processivity activity are separate from each other and capable of carrying out their activities simultaneously. In specific embodiments, the nicking agent is NB.BsrDI and the proteins having DNA polymerase domain functions are Bst 3.0 polymerase and Pfu polymerase.

Claims

1. A method to amplify nucleic acid, the method comprising: (a) forming a reaction mixture comprising: (i) a first nucleic acid template comprising a strand having a first nicking agent recognition sequence; (ii) a second nucleic acid template comprising a strand having a second nicking agent recognition sequence; (iii) at least one primer for a target region on the first or second nucleic acid template; (iv) at least one protein having DNA polymerase domain function, wherein the domain function comprises a first domain function capable of strand displacement activity and a second domain function capable of high processivity activity, or at least one protein having DNA polymerase domain function capable of strand displacement activity and at least one protein having DNA polymerase domain function capable of high processivity activity; (v) at least one deoxynucleoside triphosphate; and (vi) a first nicking agent for recognizing the first nicking agent recognition sequence and a second nicking agent for recognizing the second nicking agent recognition sequence; (b) incubating the reaction mixture under conditions that amplifies the nucleic acid templates, wherein the domain functions capable of strand displacement activity and high processivity activity are separate from each other and capable of carrying out their activities simultaneously.

2. The method according to claim 1, wherein the first and second domains are separated by a linker to form a chimeric protein.

3. The method according to any one of the preceding claims, wherein the protein having DNA polymerase domain function is selected from the group consisting of exo.sup.− Vent, exo.sup.− Deep Vent, exo.sup.− Bst, exo.sup.− Pfu, exo.sup.− Bca, the Klenow fragment of DNA polymerase I, T5 DNA polymerase, Phi29 DNA polymerase, phage M2 DNA polymerase, phage PhiPRD1 DNA polymerase, Sequenase, PRD1 DNA polymerase, 9° Nm™ DNA polymerase, T4 DNA polymerase, strand displacing Taq polymerase, and combinations thereof.

4. The method according to any one of the preceding claims, wherein the second template further comprises a region that is not substantially complementary to the at least one primer, and incubating the reaction mixture under conditions to amplify: (a) a first single-stranded nucleic acid molecule using the first template nucleic acid as a template; and (b) a second single-stranded nucleic acid molecule using the second template nucleic acid as a template.

5. The method according to any one of the preceding claims, wherein the reaction mixture further comprises a third nucleic acid template comprising: (a) a third nicking agent recognition sequence; (b) a first region that is substantially identical or complementary to the at least one primer; and (c) a second region that is not substantially identical or complementary to the at least one primer.

6. The method according to claim 5, wherein the first, second and third nicking agent recognition sequences are identical.

7. The method according to any one of the preceding claims, wherein the nicking agent is a nicking endonuclease selected from the group consisting of Nb.BbvCI, Nb.Bsml, Nb.BsrDI, Nb.BssSI, Nb.Btsl, Nt.Alwl, Nt.BbvCI, Nt.BsmAl, Nt.BspQI, Nt.BstNBl, Nt.CviPII, Zinc Finger nickase, TALE nickase, Cas nickase, and combinations thereof.

8. The method according to any one of the preceding claims, wherein the 3′ terminus of the first nucleic acid template or the second nucleic acid template is blocked.

9. The method according to any one of the preceding claims, wherein first nucleic acid template and the second nucleic acid template are immobilized.

10. The method according to any one of the preceding claims, wherein first nucleic acid template or the second nucleic acid template comprises nucleic acid modifications.

11. The method according to any one of the preceding claims, wherein first nucleic acid template or the second nucleic acid template is about 6 to 20,000 nucleotides in length.

12. The method according to any one of the preceding claims, further comprising the step of characterizing the amplified nucleic acid.

13. The method according to claim 12, wherein the characterizing step is performed by a technique selected from the group consisting of luminescence spectroscopy or spectrometry, fluorescence spectroscopy or spectrometry, mass spectrometry, liquid chromatography, fluorescence polarization, electrophoresis, mass spectrometry, SYBR I fluorescence, SYBR II fluorescence, SYBR Gold, Pico Green, Evagreen, TOTO-3, intercalating dye detection, FRET, molecular beacon detection, scorpion probe detection, surface capture, capillary electrophoresis, incorporation of labeled nucleotides to allow detection by capture, fluorescence polarization, lateral flow capture, and combinations thereof.

14. The method according to any one of the preceding claims, wherein the reaction mixture further comprises a template conjugate for linking the first and second nucleic acid templates.

15. The method according to claim 14, wherein the 3′ terminus of the first oligonucleotide template is linked to the 5′ terminus of the second oligonucleotide template via the conjugate.

16. The method according to claim 14, wherein the 3′ terminus of the first oligonucleotide template is linked to the 3′ terminus of the second oligonucleotide template via the conjugate.

17. The method according to any one of the preceding claims, wherein the first nucleic acid template is identical to the second nucleic acid template.

18. The method according to any one of the preceding claims, wherein the first nicking agent recognition sequence is identical to the second nicking agent recognition sequence.

19. The method according to any one of the preceding claims, wherein the nucleic acid template further comprises a detectable label.

20. The method according to claim 19, wherein the detectable label is a fluorescent moiety.

21. The method according to any one of the preceding claims, wherein the amplification has the kinetic that fits the equation σ˜σ.sub.0 e.sup.βt, where σ.sub.0 is an initial concentration of the oligonucleotide, σ is the concentration of the oligonucleotide after the reaction is performed for a period of t, and β is a constant.

22. The method according to any one of the preceding claims, wherein the incubation step is performed under isothermal conditions.

23. A kit to amplify nucleic acid, the kit comprising: (a) at least one primer for a target region on the first or second nucleic acid template; (b) at least one protein having DNA polymerase domain function, wherein the domain function comprises a first domain function capable of strand displacement activity and a second domain function capable of high processivity activity, or at least one protein having DNA polymerase domain function capable of strand displacement activity and at least one protein having DNA polymerase domain function capable of high processivity activity, wherein the domain functions capable of strand displacement activity and high processivity activity are separate from each other and capable of carrying out their activities simultaneously; (c) at least one deoxynucleoside triphosphate; and (d) at least one nicking agent, and instructions for using the kit.

24. The kit according to claim 23, wherein the first and second domains are separated by a linker to form a chimeric protein.

25. The kit according to any one of claim 23 or 24, wherein the protein having DNA polymerase domain function is selected from the group consisting of exo.sup.− Vent, exo.sup.− Deep Vent, exo.sup.− Bst, exo.sup.− Pfu, exo.sup.− Bca, the Klenow fragment of DNA polymerase I, T5 DNA polymerase, Phi29 DNA polymerase, phage M2 DNA polymerase, phage PhiPRD1 DNA polymerase, Sequenase, PRD1 DNA polymerase, 9° Nm™ DNA polymerase, T4 DNA polymerase, strand displacing Taq polymerase, and combinations thereof.

26. The kit according to any one of claims 23 to 25, further comprising a reverse transcriptase.

Description

IN THE FIGURES

[0096] FIG. 1 shows an amplification according to the present invention (SENANG) compared with other known amplifications (e.g. EXPAR) for 21 bp long target oligonucleotides. It shows that SENANG can achieve 10.sup.6 fold or more within 10 minutes. Each “cycle” shown is 1 minute.

[0097] Disclosed are materials, compositions, and components that can be used for, can be used in conjunction with, can be used in preparation for, or are products of the disclosed methods and compositions. These and other materials are disclosed herein, and it is understood that when combinations, subsets, interactions, groups, etc. of these materials are disclosed that while specific reference of each various individual and collective combinations and permutation may not be explicitly disclosed, each is specifically contemplated and described herein. For example, if a method is disclosed and discussed and a number of modifications that can be made to the method steps are discussed, each and every combination and permutation of the method steps, and the modifications that are possible are specifically contemplated unless specifically indicated to the contrary. Likewise, any subset or combination of these is also specifically contemplated and disclosed. This concept applies to all aspects of this disclosure. Thus, if there are a variety of additional steps that can be performed it is understood that each of these additional steps can be performed with any specific method steps or combination of method steps of the disclosed methods, and that each such combination or subset of combinations is specifically contemplated and should be considered disclosed.

[0098] This invention provides for a new class of isothermal amplification reaction method for amplifying DNA from RNA and DNA. These reactions synthesize specific oligonucleotides specified by a designed template. The target nucleotide can be amplified 10.sup.6 fold or more within 10 minutes.

[0099] The stochastic use of enzymes can be applied to many other enzymatic reactions not related to isothermal amplification.

[0100] This invention provides the following advantages: [0101] 1) The method of this invention is not limited to short nucleotides (8-16 bases). [0102] 2) The method is not limited to a target nucleotide sequence between 20 and 40 in length. [0103] 3) The target nucleotide can be amplified 10.sup.6 fold or more within 10 minutes. [0104] 4) Functional domains from multiple families of polymerase, endonuclease and reverse transcriptase are utilized for this amplification.

[0105] Advantageously, the amplification is extremely rapid and can be designed to operate at a range of temperatures. It is important to isolate some parts the reactions. Antibodies can be designed to block the action of respective proteins before the desired reaction temperature is reached.

[0106] In addition, as the reaction proceeds extremely rapidly, some commercial plate readers and fluorescence may be too slow to accurate compare the readouts between the first and the last well of a read. Faster readers will allow ‘real-time’ comparisons, and slower readers do so with a lower throughput (e.g. 8 wells instead of 96 or 384 wells). Nonetheless, the method is generic and can also be implemented with an end-point readout.

[0107] In addition, certain chemical compositions that allow unspecific amplification may be modified and used. ‘Novel proteins’ can be re-classified by splicing functional domains of various polymerases, reverse transcriptases and endonucleases. Also included in this application is the use of specific functional domains of DNA polymerases, instead of just focusing on the whole protein itself.

[0108] The present invention (also known as “SENANG”) is a new class of isothermal amplification reaction method for amplifying DNA from DNA and/or RNA that can yield 106 fold or more amplicons longer than 16 base pairs within 10 minutes (see FIG. 1). Currently, only two other isothermal amplification methods are able to match SENANG in speed: (1) Exponential Amplification Reaction (EXPAR) and (2) Nicking Enzyme Amplification Reaction (NEAR). However, both methods are limited to amplifying only an 8-16 base pair (bp) target sequence. NEAR's application, is limited, and is differentiated from EXPAR simply by adding another nicking enzyme recognition sequence to a conventional EXPAR template. As such, most of the focus of the comparison would be between SENANG and EXPAR.

[0109] Working Principle of SENANG

[0110] In general, both EXPAR and NEAR reactions require the use of a nicking enzyme, DNA polymerase with strand displacement activity and, optionally, a reverse transcriptase. The SENANG approach overcomes the 8-16 bp amplification limitation of EXPAR and NEAR by utilizing a protein with a DNA polymerase functional domain that is not strictly a polymerase with strand displacement activity. Specifically, a DNA polymerase domain without strand displacement activity can be used to overcome the 8-16 bp amplification limit by both conventional and engineered polymerases with strand displacement activity. This is done by a stochastic polymerization of DNA by a protein with a DNA polymerase domain that does not necessarily display strand displacement activity, unlike the requirements by EXPAR and NEAR.

[0111] Applications of SENANG

[0112] The applications in which SENANG can be applied to include all common applications of PCR and isothermal PCR, as well as library preparation for next-generation sequencing (NGS). SENANG's rapid amplification and increased limit of amplified oligonucleotide length additionally allows it to be used for applications beyond biotechnology, including for data storage processes. It is possible, for example, to use unique SENANG amplified oligo repeats to represent 64-bit information. This has exciting potential for data storage applications due to SENANG's relatively long, rapid and accurate ‘write’ mechanism.

[0113] Features

[0114] The method of the present invention employs the addition of at least one DNA polymerase functional domain to overcome the existing limitation of up to 16 base pairs amplification in the prior art (WO2004067726). Furthermore, the method is not limited to simply applying a second order repeat of the first exponential amplification cycle as detailed in WO2009012246A2.

[0115] Both documents WO2004067726 and WO2009012246 are incorporated by reference in their entireties.

Example 1—Amplification cDNA of Sars-Cov-2 S Gene Using to a Method of the Invention

[0116] A portion of a synthetic cDNA of the S gene of SARS-CoV-2 was amplified at 57° C. over 60 cycles of 55 seconds each with the following amplification profile. There were 6 reaction set ups in this example and the amplification results are plotted and shown in FIG. 2.

[0117] The SENANG enhancer template in this reaction is a 48-mer oligonucleotide.

[0118] The 6 reactions in this setup can be assembled as follows:

[0119] Reaction 1

[0120] +NB.BsrDI+ Bst 3.0 Polymerase+Reverse Transcriptase+Pfu Polymerase (denoted by “circles” in FIG. 2)

TABLE-US-00001 dNTPs 0.5 mM Forward Primer 50 nM Reverse Primer 50 nM MgCl.sub.2 2.5 mM Promega GoScript Reaction Buffer 1× NEB NB. BsrDI 0.4 u/μL NEB Bst 3.0 Polymerase 0.05 u/μL SENANG enhancer template to 0.1 μM enable exponential amplification 100× SYBR Green I 5× SARS-CoV-2 cDNA Template 1 pM SARS-CoV-2 RNA Template 0 Pfu Polymerase 2.5 u Taq Polymerase 0 Reverse Transcriptase 2.5 u Nuclease-free water up to 10 μL

[0121] Reaction 2

[0122] +NB.BsrDI+Bst 3.0 Polymerase+Reverse Transcriptase+Taq Polymerase (denoted by “triangles” in FIG. 2)

TABLE-US-00002 dNTPs 0.5 mM Forward Primer 50 nM Reverse Primer 50 nM MgCl.sub.2 2.5 mM Promega GoScript Reaction Buffer 1× NEB NB. BsrDI 0.4 u/μL NEB Bst 3.0 Polymerase 0.05 u/μL SENANG enhancer template 0.1 μM 100× SYBR Green I 5× SARS-CoV-2 cDNA Template 1 pM SARS-CoV-2 RNA Template 0 Pfu Polymerase 0 Taq Polymerase 2.5 u Reverse Transcriptase 2.5 u Nuclease-free water up to 10 μL

[0123] Reaction 3

[0124] +NB.BsrDI+Bst 3.0 Polymerase+Reverse Transcriptase (denoted by “crosses” in FIG. 2)

TABLE-US-00003 dNTPs 0.5 mM Forward Primer 50 nM Reverse Primer 50 nM MgCl.sub.2 2.5 mM Promega GoScript Reaction Buffer 1× NEB NB. BsrDI 0.4 u/μL NEB Bst 3.0 Polymerase 0.05 u/μL SENANG enhancer template 0.1 μM 100× SYBR Green I 5× SARS-CoV-2 cDNA Template 1 pM SARS-CoV-2 RNA Template 0 Pfu Polymerase 0 Taq Polymerase 0 Reverse Transcriptase 2.5 u Nuclease-free water up to 10 μL

[0125] Reaction 4

[0126] +NB.BsrDI+Bst 3.0 Polymerase+Pfu Polymerase (denoted by “squares” in FIG. 2)

TABLE-US-00004 dNTPs 0.5 mM Forward Primer 50 nM Reverse Primer 50 nM MgCl.sub.2 2.5 mM Promega GoScript Reaction Buffer 1× NEB NB. BsrDI 0.4 u/μL NEB Bst 3.0 Polymerase 0.05 u/μL SENANG enhancer template 0.1 μM 100× SYBR Green I 5× SARS-CoV-2 cDNA Template 1 pM SARS-CoV-2 RNA Template 0 Pfu Polymerase 2.5 u Taq Polymerase 0 Reverse Transcriptase 0 Nuclease-free water up to 10 μL

[0127] Reaction 5

[0128] +NB.BsrDI+Bst 3.0 Polymerase+Taq Polymerase (denoted by “diamonds” in FIG. 2)

TABLE-US-00005 dNTPs 0.5 mM Forward Primer 50 nM Reverse Primer 50 nM MgCl.sub.2 2.5 mM Promega GoScript Reaction Buffer 1× NEB NB. BsrDI 0.4 u/μL NEB Bst 3.0 Polymerase 0.05 u/μL SENANG enhancer template 0.1 μM 100× SYBR Green I 5× SARS-CoV-2 cDNA Template 1 pM SARS-CoV-2 RNA Template 0 Pfu Polymerase 0 Taq Polymerase 2.5 u Reverse Transcriptase 0 Nuclease-free water up to 10 μL

[0129] Reaction 6

[0130] +NB.BsrDI+Bst 3.0 Polymerase (line with no denotations in FIG. 2)

TABLE-US-00006 dNTPs 0.5 mM Forward Primer 50 nM Reverse Primer 50 nM MgCl.sub.2 2.5 mM Promega GoScript Reaction Buffer 1× NEB NB. BsrDI 0.4 u/μL NEB Bst 3.0 Polymerase 0.05 u/μL SENANG enhancer template 0.1 μM 100× SYBR Green I 5× SARS-CoV-2 cDNA Template 1 pM SARS-CoV-2 RNA Template 0 Pfu Polymerase 0 Taq Polymerase 0 Reverse Transcriptase 0 Nuclease-free water up to 10 μL

[0131] In this example, the following enhancer template sequence and primer sequence are as follows:

[0132] SENANG enhancer template sequence:

TABLE-US-00007 GCACCAAGTGACATAGTGTAGCATTGCGCACCAAGTGACATAGTGTAG Forward primer:  CACGTAGTGTAGCTAGTCAATCCAT Reverse primer:  TCTGCACCAAGTGACATAGTGTAG

[0133] SARS-CoV-2 cDNA Template:

[0134] cDNA template is in vitro transcribed from RNA synthesized based on the sequence of Genbank ID: MN908947.3 of the SARS-CoV-2 Genome

[0135] SARS-CoV-2 RNA Template:

[0136] RNA template is synthetically synthesized based on the sequence of Genbank ID: MN908947.3 of the SARS-CoV-2 Genome

[0137] Based on the results shown in FIG. 2, the experiments show that Reaction 1 provides the best amplification results.

Example 2: Amplification of RNA of Sars-Cov-2 S Gene Using the Method of the Invention

[0138] A portion of in vitro transcribed RNA of the S gene of SARS-CoV-2 was amplified at 57° C. over 60 cycles of 55 seconds each with the following amplification profile. There were 6 reaction set ups in this example and the amplification results are plotted and shown in FIG. 3.

[0139] The SENANG enhancer template in this reaction is a 48-mer oligonucleotide.

[0140] The 6 reactions in this setup can be assembled as follows:

[0141] Reaction 1

[0142] +NB.BsrDL+Bst 3.0 Polymerase+Reverse Transcriptase+Pfu Polymerase (denoted by “circles” in FIG. 3)

TABLE-US-00008 dNTPs 0.5 mM Forward Primer 50 nM Reverse Primer 50 nM MgCl.sub.2 2.5 mM Promega GoScript Reaction Buffer 1× NEB NB. BsrDI 0.4 u/μL NEB Bst 3.0 Polymerase 0.05 u/μL SENANG enhancer template 0.1 μM 100× SYBR Green I 5× SARS-CoV-2 cDNA Template 0 SARS-CoV-2 RNA Template 1 pM Pfu Polymerase 2.5 u Taq Polymerase 0 Reverse Transcriptase 2.5 u Nuclease-free water up to 10 μL

[0143] Reaction 2

[0144] +NB.BsrDI+Bst 3.0 Polymerase+Reverse Transcriptase+Taq Polymerase (denoted by “triangles” in FIG. 3)

TABLE-US-00009 dNTPs 0.5 mM Forward Primer 50 nM Reverse Primer 50 nM MgCl.sub.2 2.5 mM Promega GoScript Reaction Buffer 1× NEB NB. BsrDI 0.4 u/μL NEB Bst 3.0 Polymerase 0.05 u/μL SENANG enhancer template 0.1 μM 100× SYBR Green I 5× SARS-CoV-2 cDNA Template 0 SARS-CoV-2 RNA Template 1 pM Pfu Polymerase 0 Taq Polymerase 2.5 u Reverse Transcriptase 2.5 u Nuclease-free water up to 10 μL

[0145] Reaction 3

[0146] +NB.BsrDI+Bst 3.0 Polymerase+Reverse Transcriptase (denoted by “crosses” in FIG. 3)

TABLE-US-00010 dNTPs 0.5 mM Forward Primer 50 nM Reverse Primer 50 nM MgCl.sub.2 2.5 mM Promega GoScript Reaction Buffer 1× NEB NB. BsrDI 0.4 u/μL NEB Bst 3.0 Polymerase 0.05 u/μL SENANG enhancer template 0.1 μM 100× SYBR Green I 5× SARS-CoV-2 cDNA Template 0 SARS-CoV-2 RNA Template 1 pM Pfu Polymerase 0 Taq Polymerase 0 Reverse Transcriptase 2.5 u Nuclease-free water up to 10 μL

[0147] Reaction 4

[0148] +NB.BsrDI+Bst 3.0 Polymerase+Pfu Polymerase (denoted by “squares” in FIG. 3)

TABLE-US-00011 dNTPs 0.5 mM Forward Primer 50 nM Reverse Primer 50 nM MgCl.sub.2 2.5 mM Promega GoScript Reaction Buffer 1× NEB NB. BsrDI 0.4 u/μL NEB Bst 3.0 Polymerase 0.05 u/μL SENANG enhancer template 0.1 μM 100× SYBR Green I 5× SARS-CoV-2 cDNA Template 0 SARS-CoV-2 RNA Template 1 pM Pfu Polymerase 2.5 u Taq Polymerase 0 Reverse Transcriptase 0 Nuclease-free water up to 10 μL

[0149] Reaction 5

[0150] +NB.BsrDI+Bst 3.0 Polymerase+Taq Polymerase (denoted by “diamonds” in FIG. 3)

TABLE-US-00012 dNTPs 0.5 mM Forward Primer 50 nM Reverse Primer 50 nM MgCl.sub.2 2.5 mM Promega GoScript Reaction Buffer 1× NEB NB. BsrDI 0.4 u/μL NEB Bst 3.0 Polymerase 0.05 u/μL SENANG enhancer template 0.1 μM 100× SYBR Green I 5× SARS-CoV-2 cDNA Template 0 SARS-CoV-2 RNA Template 1 pM Pfu Polymerase 0 Taq Polymerase 2.5 u Reverse Transcriptase 0 Nuclease-free water up to 10 μL

[0151] Reaction 6

[0152] +NB.BsrDI+Bst 3.0 Polymerase (line with no denotations in FIG. 3)

TABLE-US-00013 dNTPs 0.5 mM Forward Primer 50 nM Reverse Primer 50 nM MgCl.sub.2 2.5 mM Promega GoScript Reaction Buffer 1× NEB NB. BsrDI 0.4 u/μL NEB Bst 3.0 Polymerase 0.05 u/μL SENANG enhancer template 0.1 μM 100× SYBR Green I 5× SARS-CoV-2 cDNA Template 0 SARS-CoV-2 RNA Template 1 pM Pfu Polymerase 0 Taq Polymerase 0 Reverse Transcriptase 0 Nuclease-free water up to 10 μL

[0153] In this example, the following enhancer template sequence and primer sequence are as follows:

[0154] SENANG enhancer template sequence:

TABLE-US-00014 GCACCAAGTGACATAGTGTAGCATTGCGCACCAAGTGACATAGTGTAG Forward primer:  CACGTAGTGTAGCTAGTCAATCCAT Reverse primer:  TCTGCACCAAGTGACATAGTGTAG

[0155] SARS-CoV-2 cDNA Template:

[0156] cDNA template is in vitro transcribed from RNA synthesized based on the sequence of Genbank ID: MN908947.3 of the SARS-CoV-2 Genome

[0157] SARS-CoV-2 RNA Template:

[0158] RNA template is synthetically synthesized based on the sequence of Genbank ID: MN908947.3 of the SARS-CoV-2 Genome

[0159] Based on the results shown in FIG. 2, the experiments show that Reaction 1 provides the best amplification results.

[0160] Whilst there has been described in the foregoing description preferred embodiments of the present invention, it will be understood by those skilled in the technology concerned that many variations or modifications in details of design or construction may be made without departing from the present invention.