BVDV vaccine

Abstract

The present invention relates to BVD virus and to its uses, to vaccines and combination vaccines comprising such a virus, their use as a medicament, their use in the treatment of Bovine Viral Diarrhea and to methods for the preparation of such vaccines.

Claims

1. A combination vaccine for the protection against Bovine Viral Diarrhea Virus (BVDV) that comprises a first live attenuated BVDV, a second live attenuated BVDV, and a pharmaceutically acceptable carrier; wherein the first BVDV and the second BVDV are either both Type 1 BVDVs or both Type 2 BVDVs; wherein the first BVDV and the second BVDV each comprise a BVDV E2 gene; and wherein when the first BVDV and the second BVDV are both Type 1 BVDVs, the E2 gene of the second BVDV is replaced by a BVDV E2 gene of a Type 2 BVDV; and wherein when the first BVDV and the second BVDV are both Type 2 BVDVs, the E2 gene of the second BVDV is replaced by a BVDV E2 gene of a Type 1 BVDV.

2. A combination vaccine for the protection against Bovine Viral Diarrhea Virus (BVDV) that comprises a first live attenuated BVDV, a second live attenuated BVDV, and a pharmaceutically acceptable carrier; wherein the first BVDV and the second BVDV are either both Type 1 BVDVs or both Type 2 BVDVs; wherein the first BVDV and the second BVDV each comprise a BVDV E1 gene and a BVDV E2 gene; and wherein when the first BVDV and the second BVDV are both Type 1 BVDVs, both the BVDV E2 gene and the BVDV E1 gene of the second BVDV are replaced by a BVDV E2 gene and a BVDV E1 gene of a Type 2 BVDV; and wherein when the first BVDV and the second BVDV are both Type 2 BVDVs, both the E2 and the E1 gene of the second BVDV is replaced by a BVDV E2 and BVDV E1 gene of a Type 1 BVDV.

3. The combination vaccine according to claim 1, wherein the backbone of the first and second BVDV belongs to a Type 1 BVDV and the BVDV E2 gene of the second BVDV belongs to a Type 2 BVDV.

4. The combination vaccine according to claim 1, wherein the backbone of the first and second BVDV belongs to a Type 2 BVDV and the BVDV E2 gene of the second BVDV belongs to a Type 1 BVDV.

5. The combination vaccine according to claim 1, characterised in that said first BVDV and said second BVDV have the same backbone.

6. The combination vaccine according to claim 5, characterised in that said backbone is BNDV a Type 1 BVDV.

7. The combination vaccine according to claim 1, wherein said first BVDV or said second BVDV comprises a deletion in a gene selected from the group consisting of the N.sup.pro gene and the E.sup.rns gene.

8. The combination vaccine according to claim 1, characterized in that said vaccine or combination vaccine comprises an additional antigen of a virus or micro-organism pathogenic to ruminants, an antibody against said antigen or genetic information encoding an immunogenic polypeptide of said virus or micro-organism.

9. The combination vaccine according to claim 8, characterized in that said virus or micro-organism pathogenic to ruminants is selected from the group of Bovine Rotavirus, Bovine Herpesvirus, Parainfluenza Type 3 virus, Bovine Paramyxovirus, Bluetongue virus, Foot and Mouth Disease virus, Pasteurella haemolytica and Bovine Respiratory Syncytial Virus.

10. The combination vaccine according to claim 1, characterised in that it is in a freeze-dried form.

11. A method for making a combination vaccine according to claim 1, comprising the step of mixing a live attenuated Type 1 BVDV that comprises a Type 1 BVDV E2 gene, a live attenuated Type 1 BVDV that comprises a Type 2 BVDV E2 gene in place of a Type 1 BVDV E2 gene, and a pharmaceutically acceptable carrier.

12. The combination vaccine according to claim 2, wherein the backbone of the first and second BVD virus belongs to a Type 1 BVDV and the BVDV E2 gene of the second BVD virus belongs to a Type 2 BVDV.

13. The combination vaccine according to claim 12, wherein said first BVDV and said second BVDV have the same backbone.

14. The combination vaccine according to claim 13, wherein said first BVDV or said second BVDV comprises a deletion in a gene selected from the group consisting of the N.sup.pro gene and the E.sup.rns gene.

15. The combination vaccine according to claim 2, characterised in wherein the backbone of the first and second BVD virus belongs to a Type 2 BVDV and the BVDV E2 gene and E1 gene of the second BVD virus belongs to a Type 1 BVDV.

16. A method for making a combination vaccine according to claim 1, comprising the step of mixing a live attenuated Type 2 BVDV that comprises a Type 2 BVDV E2 gene, a live attenuated Type 2 BVDV that comprises a Type 1 BVDV E2 gene in place of a Type 2 BVDV E2 gene, and a pharmaceutically acceptable carrier.

Description

LEGEND TO THE FIGURES

(1) FIG. 1: Schematic representation of the BVDV genome and the construction of pBVDV-1b_synth_N.sup.pro.

(2) FIG. 2: Schematic representation of the BVDV genome and the construction of full-length pBVDV-1 b_synth.

(3) FIG. 3: Schematic representation of the BVDV genome and the construction of chimeric E2/E1E2 constructs on the basis of pBVDV-1b_synth.

(4) FIG. 4: IF analysis of bovine cells (KOP-R) transfected with in vitro-transcribed RNA of the synthetic cDNA constructs.

(5) FIG. 5: BVDV NS3 blocking ELISA

(6) FIG. 6: BVDV neutralization assay

(7) FIG. 7: Scheme of the experimental design of animal trial 1 on the CP7 Npro vaccination-challenge trial.

(8) FIG. 8: Scheme of the experimental design of the animal trial on NCP7 Npro trialtransplacental infection.

(9) FIG. 9: Time scale, sampling periods and experimental design of animal trial 1 on the cp7Npro/v890FLNpro/v890FLC vaccination-challenge trial.

(10) FIG. 10: Time scale, sampling periods and experimental design of animal trial 2 on the cp7Npro/v890FLNpro sequential vaccination-challenge trial.

(11) FIG. 11: Time scale, sampling periods and experimental design of animal trial 3 on the BVDV-1/2 chimera (cp7Npro_E2CS8644) vaccination-challenge trial.

REFERENCES

(12) Meyers, G., Tautz, N., Becher, P., Thiel, H. J., und Kmmerer, B. M. (1996). Recovery of cytopathogenic and noncytopathogenic bovine viral diarrhoea viruses from cDNA constructs. J. Virol. 70, 8606-8613. Geiser, M., Cebe, R., Drewello, D. and Schmitz, R. (2001). Integration of PCR fragments at any specific site within cloning vectors without the use of restriction enzymes and DNA ligase. Biotechniques 31, 88-90, 92. Wolfmeyer, A., Wolf, G., Beer, M., Strube, W., Hehnen, H. R., Schmeer, N. and Kaaden, O. R. (1997). Genomic (5UTR) and serological differences among German BVDV field isolates. Arch. Virol. 142, 2049-2057.

EXAMPLES

Example 1

(13) Construction of Synthetic BVDV Clones

(14) 1. Introduction

(15) A BVDV type 1b virus was synthesized completely based on a synthetic construct. The sequence is similar to the published sequence of the BVDV 1b prototype strain CP7 and the published full-length plasmid sequence pA/BVDV CP7 (Meyers et al. 1996; Genbank Accession no U63479), however, essential changes and adaptations were included. Furthermore, two recombinant viruses were constructed on the basis of the synthetic clone: a Npro deleted virus as well as a chimeric virus expressing BVDV type 2 E2 instead of the original BVDV 1b E2.

(16) Data for Construction of pBVDV-1b_synth_N.sup.pro

(17) Plasmids were amplified in Escherichia coli DH10B cells (Invitrogen). Plasmid DNA was purified by using Qiagen Plasmid Mini or Midi Kit. Restriction enzyme digestion and cloning procedures were performed according to standard protocols. Sequencing was carried out using a Big Dye Terminator v1.1 Cycle sequencing Kit (Applied Biosystems). Nucleotide sequences were read with an automatic sequencer (3130 Genetic Analyzer, Applied Biosystems) and analyzed using the Genetics Computer Group software version 11.1 (Accelrys Inc., San Diego, USA). Site-directed mutagenesis was done by using QuickChange II XL Site-Directed Mutagenesis Kit (Stratagene) and Phusion PCR (Geiser et al., 2001), respectively.

(18) Primers for mutagenesis were synthesized by MWG-Biotech and biomers.net GmbH and are listed in table 1.

(19) TABLE-US-00001 TABLE1 Nucleotidesequenceofprimersusedforsitedirectedmutagenesisand Phusion-PCR Primer Sequence5 .fwdarw. 3.sup.a Genomicregion Mut_2009_F ACAGGGGCGCAAGGATATCCAGACTGCAAA 2430-2462.sup.b(+sense) CCC Mut_2009_R GGGTTTGCAGTCTGGATATCCTTGCGCCCCT 2462-2430.sup.b(sense) GT Ph_10375_F cggaagcaggaattaggttggaaaaattacc 10363-10393.sup.b(+sense) Ph_10551R CGTCACTGTAGGTGTGTCTTAGGC 10551-10528.sup.b(sense) CP711973F Gcaagaactagcccagtcacg 11973-11993.sup.b(+sense) CP7_3C_R CTAGTGGATCCCCCGGGCTGTTAAAGGTCTT 11843-11824.sup.c(sense) CCC Ph_E2CS_F GCTCATAACAGGGGCGCAAGGGATTCCCTGA 2423-2444.sup.b(+sense) ATGCAAAGAGGG Ph_E2CS_R cacctgccccatactggacacctatagctacttgctctgac 3585-3567.sup.b(sense) Ph_E1CS_F catggtttggggcatatgcagcaagtccatactgtgatgtg 1840-1859.sup.b(+sense) .sup.anucleotides, different from BVDV-1 CP7 sequence (Accession No. U63479) are underlined; sequences of BVDV-2 CS8644 (unpublished) are in italics .sup.bnucleotide position corresponding to BVDV CP7 sequence .sup.cnucleotide position corresponding to pBVDV-lb_synth_N.sup.pro

(20) pBVDV-1b_synth_N.sup.pro was constituted from five plasmids harboring the synthetic sequence fragments (1. fragment_pGA15, 2. fragment_pMA, 3. fragment_pMK, 4. fragment_pMA, Syn_BsaI_fragment_pMK_RQ) which were all in vitro synthesized by the GENEART AG (Regensburg, Germany). By using this synthetic fragments and their unique restriction sites, one full-length plasmid construct was generated. Restriction enzyme digestions and cloning procedures were performed according to standard protocols. The synthetic sequence fragments are described below. The construction of the infectious cDNA clone pBVDV-1b_synth_N.sup.pro is shown in FIG. 1. Location of restriction sites and nucleotide positions corresponding to the BVDV genome (most similar strain is CP7) are indicated by arrows.

(21) 1. fragment_pGA15 contains nucleotides 1 to 3357 (Acc65I site) corresponding to BVDV1bN.sup.pro. At the 5 NTR the sequence of the T7 promoter was added to enable in vitro transcription as well as SnaBI and NheI sites. A second Ace65I.sup.2007 site was removed by a silent mutation of GGTACC to ATATCC.
2. fragment_pMA contains nucleotides 3357 to 6228 (BlpI site).
3. fragment-pMK contains nucleotides 6288 to 7956 (BstBI site).
4. fragment_pMA contains nucleotides 7956 to 11816 (SmaI site). A second BstBI.sup.7965 site was removed by a silent mutation of TTCGAA to TTCGAG.

(22) Syn_BsaI fragment_pMK_RQ contains nucleotides 11244 to 11816 (SmaI site) with the 3 NTR and a SmaI site for linearization of plasmid DNA prior in vitro transcription.

(23) For generation of pBVDV-1b_synth_N.sup.pro a carrier plasmid was digested with SmaI and dephosphorylated and eluted after agarose gel electrophoresis.

(24) 1.Fragment_pMA was digested with SnaBI and SmaI, and the virus specific fragment was isolated. Both fragments were ligated resulting in plasmid pAFr1. Afterwards, plasmid pA_Fr1 was linearised by using Acc65I and BlpI and the Acc65I.sup.3357-BlpI.sup.6228 fragment isolated from plasmid. 2.fragment_pMA was inserted resulting in plasmid pA_Fr1/2. Plasmid pMA_Fr3/4 was generated by ligation of NheI and BstBI.sup.7956 digested plasmid 4.fragment_pMA, and a BlpI.sup.6628/BstBI.sup.7956 fragment was isolated from plasmid 3.fragment_pMK. This plasmid was subsequently digested with BlpI.sup.6628/SmaI.sup.11816, and the resulting BlpI.sup.6628/SmaI.sup.11816 fragment was ligated into BlpI.sup.6628/SmaI plasmid pA_Fr1/2. Within the resulting plasmid pAFr1/2/3/4 the BsaI fragment was substituted with the BsaI fragment isolated from plasmid Syn_BsaI fragment_pMK_RQ leading to the full-length cDNA construct pAFr1/2/3/4/5. For the generation of infectious virus progeny two mutations, G.sup.2011T and G.sup.9948T were inserted by site directed mutagenesis resulting in the infectious full length cDNA construct pBVDV-1b_synth_N.sup.pro.
Construction of pBVDV-1b_synth

(25) The BVDV full-length cDNA clone pBVDV-1b_synth was constructed on the basis of pBVDV-1b_synth_N.sup.pro by insertion of an Acc65I/.sup.3793 XhoI.sup.208-fragment of the plasmid pBVDV-1b_deltaNS (nucleotides 1-4597), into pBVDV-1b_synth_N.sup.pro (FIG. 2). To this end the plasmid pBVDV-1b_synth_N.sup.pro was digested with Acc65I.sup.3357 and XhoI.sup.231 and ligated with the Acc65I/.sup.3793 XhoI.sup.208-fragment of pBVDV-1 bdeltaNS.

(26) Construction of pBVDV-1b_synth_N.sup.pro_BVDV-2_E2

(27) The BVDV full-length cDNA clone pBVDV-1b_synth_N.sup.pro_BVDV-2_E2 is a BVDV-1b/BVDV-2 chimeric construct which was generated by substitution of the genomic region encoding for E2 of pBVDV-1b_synth_N.sup.pro (nucleotides 2009-3130) with the genomic region encoding for E2 of BVDV-2 (isolate CS8644; Wolfmeyer et al., 1997).

(28) The chimeric pestivirus clone pBVDV-1b_synth_N.sup.pro_BVDV-2_E2 was constructed by Phusion PCR (FIG. 3a). In a first step an E2-megaprimer was generated by PCR using primers Ph-E2CS_F and Ph_E2CS_R. As template for PCR plasmid pGEM_E1E2_CS, which contains the E1 and E2 encoding genomic region of BVDV-2 isolate CS8644, was utilized. In a second PCR, the Phusion-PCR, E2-CS8644 sequences were introduced into the full-length plasmid pBVDV-1b_synth_N.sup.pro by using the E2-megaprimer and pBVDV-1b_synth_N.sup.pro as template.

(29) Construction of pBVDV-1b_synth_N.sup.pro_BVDV-2_E1-E2

(30) The BVDV full-length cDNA clone pBVDV-1b_synth_N.sup.pro_BVDV-2_E1-E2 is a BVDV-1b/BVDV-2 chimeric construct which was generated by substitution of the genomic region encoding for E1 and E2 of pBVDV-1b_synth_N.sup.pro (nucleotides 1424-3130) with the genomic region encoding for E1 and E2 of BVDV-2 (isolate CS8644; Wolfmeyer et al., 1997).

(31) The chimeric pestivirus clone pBVDV-1b_synth_N.sup.pro_BVDV-2_E1-E2 was constructed by Phusion PCR (FIG. 3b). In a first step an E1-E2-megaprimer was generated by PCR using primers Ph-EICS_F and Ph_E2CS_R. As template for PCR the plasmid pGEM_E1E2_CS was used. By Phusion-PCR, E1 and E2-CS8644 sequences were introduced into the full-length plasmid pBVDV-1b_synth_N.sup.pro by using the E1-E2-megaprimer and pBVDV-1b_synth_N.sup.pro as template.

(32) FIG. 1:

(33) Schematic representation of the BVDV genome and the construction of pBVDV-1b_synth_N.sup.pro. The viral genome was synthesized in five fragments (Geneart AG), 1.fragment_pGA15, 2.fragment_pMA, 3.fragment_pMK, 4.fragment_pMA, and Syn_BsaI_fragment_pMK_RQ (light blue boxes). Plasmid 1.fragment_pGA15 harbours the N.sup.pro deletion (N.sup.pro). At the 5-NTR the sequence of the T7 promotor was added to enable in vitro transcription. For plasmid linearization a SmaI restriction site was introduce at the 3 NTR. Location of restriction sites and nucleotide positions corresponding to the BVDV 1bN.sup.pro genome (most similarity to BVDV strain CP7) are indicated by short black arrows. The full-length cDNA construct pBVDV-1b_synth_N.sup.pro was constituted exclusively from the five synthesized fragments as demonstrated by the grey arrows and dark blue boxes. No virus RNAs or cDNA were used for the construction.

(34) In vitro mutagenesis steps during the construction are indicated by stars. Shaded boxes represent the BVDV structural protein region. Lines at the left and the right ends indicate non-translated regions. N.sup.pro, autoprotease; C, capsid protein; E.sup.rns, E1, E2, envelope proteins; p7, NS2 to NS5, nonstructural proteins.

(35) FIG. 2:

(36) Schematic representation of the BVDV genome and the construction of full-length pBVDV-1b_synth. Shaded boxes represent the BVDV structural protein region. Lines at the left and the right ends indicate non-translated regions. N.sup.pro,autoprotease; C, capsid protein; E.sup.rns, E1, E2, envelope proteins; p7, NS2 to NS5, nonstructural proteins. The full-length cDNA construct pBVDV-1b_synth was constructed by insertion of an Acc65I/.sup.3793 XhoI.sup.208-fragment of the plasmid pBVDV-1bdeltaNS which contains parts of the sequence of a BVDV-1b fragment (nucleotides 1-4597) including the Npro encoding genomic region, into pBVDV-1b_synth_N.sup.pro.

(37) FIG. 3:

(38) Schematic representation of the BVDV genome and the construction of chimeric E2/E1E2 constructs on the basis of pBVDV-1b_synth. Shaded boxes represent the BVDV structural protein region. Lines at the left and the right ends indicate non-translated regions. N.sup.pro,autoprotease; C, capsid protein; E.sup.rns, E1, E2, envelope proteins; p7, NS2 to NS5, nonstructural proteins. The chimeric pestivirus clones pBVDV-1b_synth_N.sup.pro_BVDV-2_E2 (a) and pBVDV-1b_synth_N.sup.pro_BVDV-2_E1E2 (b) were constructed by using the full-length cDNA clone pBVDV-1b_synth_N.sup.pro. Genomic region encoding for E2 of pBVDV-1b_synth_N.sup.pro (nucleotides 2009-3130) and E1 and E2 of pBVDV-1b_synth_N.sup.pro (nucleotides 1424-3130), respectively, were substituted by the respective genomic region of BVDV-2 isolate CS8644 (Wolfmeyer et al., 1997) by Phusion PCR by using Primers Ph_E1_F and Ph_E2_R. As template for PCR plasmid pGEM_E1E2_CS was used, which contains the E1 and E2 encoding genomic region of BVDV-2 isolate CS8644.

(39) FIG. 4:

(40) IF-analysis of bovine cells (KOP-R) transfected with in vitro-transcribed RNA of the synthetic cDNA constructs. For the detection of BVDV proteins the monoclonal antibodies C16 (anti-NS3, Institute for Virology, TiHo Hannover), WB215 (anti-E2 BVDV-1, CVL, Weybridge), BA-2 (VMRD), and WB210 (anti-E.sup.rns, CVL, Weybridge) were used.

(41) Cell Culture and Virus Propagation

(42) Cells and viruses were grown in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% BVDV-free foetal bovine serum at 37 C. in a humidified atmosphere containing 5% CO.sub.2. pBVDV-1b_synth_N.sup.pro was propagated on original MDBK cells or interferon incompetent MDBK cells (Rie728; CCLV) provided by Gunther Keil, FLI, Insel Riems. Virus titres were determined by end point titrations. Cells seeded in microtitration plates were infected with 10-fold serial dilutions of clarified supernatants. The titres expressed in TCID.sub.50 per milliliter were obtained by immunofluorescence staining of the cultures with the monoclonal antibody (mAb) C16 directed against the pestiviral protein NS3 (kindly provided by the Institute of Virology, TiHo, Hannover, Germany) and an Alexa Fluor488 conjugated F(ab).sub.2 fragment of goat anti-mouse IgG (Molecular Probes, Leiden, The Netherlands). Virus preparations were tested for the absence of N.sup.pro and mycoplasma.

(43) In Vitro Transcription and RNA Transfection

(44) In vitro transcription of the synthetic full-length cDNA constructs was performed using the T7 RiboMax Large-Scale RNA Production System (Promega) according to the manufacturer's instructions after linearising the plasmid with SmaI. The amount of RNA was estimated by ethidium bromide staining after agarose gel electrophoresis. For RNA transfection, bovine cells were detached using a trypsin solution, washed twice with phosphate buffered saline without Ca++/Mg++ (PBS) and mixed with 1-5 g of in vitro sythesized RNA. Electroporation was done by using the GenePulser transfection unit (Biorad) (two pulses at 850 V, 25 F and 156 ).

(45) Immunofluorescence Staining

(46) Cell cultures were fixed with 4% paraformaldehyde (PFA) and permeabilised with 0.01% digitonin (IF staining of NS3) or fixed/permeabilised with 80% acetone (E.sup.rns, E2), and incubated with the appropriate working dilution of the respective antibodies for 30 min. After one washing step with PBS.sup., cells were incubated with the Alexa.sup.488-conjugated secondary antibody for 30 min and finally washed. IF was analysed by using a fluorescence microscope (Olympus).

Example 2

(47) CP7 N.sup.pro Vaccination-Challenge Trial

(48) The scheme of the CP7 N.sup.pro experimental design of animal trial 1 is represented in FIG. 7.

(49) BVDV nave calves (n=4 per group) were vaccinated or mock-vaccinated and 52 days later, a challenge infection with BVDV type Ib strain SE5508 (Wolfmeyer et al., 1997) was performed.

(50) Vaccination: single application of 6.7 log.sub.10 TCID.sub.50 BVDV CP7 N.sup.pro i.m. (5 ml)

(51) Mock vaccination: uninfected cell culture supernatant i.m. (5 ml)

(52) Challenge infection: 6.5 log.sub.10 TCID.sub.50 BVDV SE5508 (Ib) i.n., nebuliser, 2 ml

(53) Results

(54) White blood cells were purified from EDTA-blood after alkaline lyses of erythrocytes. 100 l of swab fluid or 310.sup.6 leukocytes were inoculated on bovine cells in 4 parallels. After 5-6 days of co-cultivation virus replication was verified by indirect immunofluorescence testing (IIFT). One further blind passage of the supernatants was performed (6 d.fwdarw.IIFT).

(55) In 1 out of 4 calves cell bound viremia was detected. Low amounts of CP7 N.sup.pro could be re-isolated on day 4 after vaccination after the first cell culture passage.

(56) No nasal excretion of vaccine virus was recorded.

(57) After challenge infection, no nasal shedding of BVDV SE5508 was detected in the vaccinated animals. All vaccinees were completely protected against viremia, and no challenge virus was re-isolated from purified white blood cells (sterile immunity).

(58) In contrast, all control calves exhibited nasal BVDV excretion for 6-8 days, as well as cell-bound viremia during 6-8 days.

(59) After vaccination all animals immunised with CP7 N.sup.pro displayed a moderate drop of the leukocyte counts with recovery to pre-vaccination values until 7 days after inoculation.

(60) After challenge infection no significant decrease of white blood cells was observed in the immunised calves. The mean blood cell counts remained within the physiological range.

(61) In the control animals, a marked leukopaenia was observed with an onset at 3 days after challenge. The average leukocyte counts stayed low for more than 2 weeks.

(62) In comparison to the pre-vaccination temperatures, only a faint elevation of the rectal body temperatures was recorded after vaccination.

(63) After challenge infection, the immunised animals showed no alterations of the temperature curves. In regard of a temperature response, the animals were clearly protected from clinical BVD.

(64) In all control calves, a moderate raise of the temperatures occurred at 3 days after inoculation.

(65) After more than one week, body temperatures returned to the pre-challenge levels.

(66) All animals were monitored for altered general conditions and respiratory or gastrointestinal symptoms typical for BVDV.

(67) Over the whole observation period day (4 weeks prior to immunisation until 12 weeks thereafter), mainly in the vaccinated animals, alternating mild respiratory symptoms such as nasal discharge and sporadic coughing were observed. After vaccination, no adverse clinical reactions occurred. In the vaccines, no exacerbation of the pre-vaccination scores was observed.

(68) After challenge infection, the immunised animals showed no clinical symptoms. In the control calves, mild respiratory symptoms were recorded and feed uptake was reduced for 1-2 days. The animals showed neither gastrointestinal disorders nor mucosal lesions.

(69) Serological responses of the animals were monitored using a BVDV ELISA (NS3-blocking; FIG. 5) as well as BVDV type I and type II specific neutralization assay (FIG. 6).

(70) All animals inoculated with CP7 N.sup.pro seroconverted for BVDV NS3-specific antibodies until 3 weeks after vaccination, as tested by the Ceditest BVDV ELISA (Cedi diagnostics). The control calves remained negative until 2-3 weeks after challenge infection (FIG. 5).

(71) After vaccination, all animals developed BVDV type I neutralising antibodies at moderate titres (FIG. 6). After challenge infection (c), the immunised animals showed no pronounced booster of the neutralising antibody titres. The mock vaccinated animals were tested negative until 2 weeks after challenge infection with BVDV type I strain SE5508. BVDV type II (strain US980) specific neutralising antibodies at low titres were also induced after vaccination. Neutralising antibody titres were comparable to the values of the control animals at 3 weeks after inoculation with the BVDV type I field strain SE5508.

Example 3

(72) NCP7 Npro TrialTransplacental Infection

(73) The scheme of the experimental design of this animal trial is presented in FIG. 8.

(74) BVDV nave heifers (n=4 per group) were intravenously and intranasally inoculated with NCP7N.sup.pro or with the parental virus NCP7 between d 71 and 79 of pregnancy (=first trimester).

(75) application of 6.0 log.sub.10 TCID.sub.50 BVDV NCP7: 10 ml i.v.+5 ml i.n.

(76) 6.1 log.sub.10 TCID.sub.50 BVDV NCP7 N.sup.pro: 10 ml i.v.+5 ml i.n.

(77) Results

(78) Until 2 weeks after virus inoculation, the heifers were monitored for viremia and nasal virus shedding. 100 l of swab fluid or 310.sup.6 purified blood leukocytes were inoculated on bovine cells in 4 parallels. After 5-6 days of co-culture virus replication was verified by indirect immunofluorescence testing (IIFT). One additional blind passage of the supernatants was performed (6 d.fwdarw.IIFT).

(79) Short and low titered virus shedding was observed in all NCP7-animals but could be verified only for 1 out of 4 heifers after inoculation of the N.sup.pro deletion mutant. Viremia could be detected in all infected animals with a more than 2 days longer average duration for the parental virus.

(80) In both inoculated groups a marked decrease of the leukocyte counts was observed after infection. Blood leukocyte values declined as early as one day after inoculation of NCP7N.sup.pro with recovery to pre-infection values after 7 days. Following infection with the parental virus strain CP7 a more protracted course of leukocyte reduction was evident with onset at 4 days p.i. and regression at 8 d p.i. The maximal reduction values between both groups were comparable.

(81) Compared to the body temperature means prior to infection, only a faint elevation of the rectal body temperatures was recorded for the NCP7 group but remained within a physiological range.

(82) The animals were monitored for altered general conditions and respiratory or gastrointestinal symptoms typical for BVDV. In all animals mild nasal and ocular discharge as well as coughing was sporadically observed over the whole period. After infection no adverse reactions occurred and in both groups only a mild increase of respiratory disorder was observed.

(83) Antibody development was monitored with a BVDV NS3-blocking ELISA. All inoculated animals seroconverted for NS3-specific antibodies until 2-3 weeks after vaccination, as tested by the Ceditest BVDV ELISA (Cedi Diagnostics).

(84) Performance of Gravidity:

(85) NCP7: animal 5: abortion on day 71 p.i.

(86) fetus mummified, virus isolation from all organ and blood samples negative but positive from bone marrow lavage ( replicates)
NCP7N.sup.pro: animal 4: abortion on day 46 p.i. advanced mazeration, dead for 2-3 weeks, isolation from all organ and blood samples negative

(87) The heifers were sacrificed approximately at 12 weeks after BVDV infection. Gross necropsy did not reveal any fetopathogenic effects. Development, size, and weight of the fetuses were inconspicuous.

(88) Virus isolation in cell culture was performed from 0.3 g of organ material (shock frozen, ground with sea sand) followed by 2 consecutive passages of the supernatants in case of first negative results.

(89) TABLE-US-00002 Virus isolation from maternal and fetal tissues NCP7 animal 3 animal 2 animal 1 tonsil (mother) 4x 4x 4x uterus (mother) 4x 4x 4x cotyledone 4x 4x 4x amnion +++/1x++/2x+ +++/2x+/ +/(+)// skin 4x +++ 4x +++ 4x +++ thyreoidea 4x +++ 4x +++ 4x +++ thymus 4x +++ 4x +++ 4x +++ liver 4x +++ 4x +++ 4x +++ kidney 4x +++ 4x +++ 4x +++ intestine (ileum) 4x +++ 4x +++ 4x +++ parotis 4x +++ 4x +++ 4x +++ tonsil 4x +++ 4x +++ 4x +++ lung 4x +++ 4x +++ 4x +++ spleen 4x +++ 4x +++ 4x +++ cerebellum 4x +++ 4x +++ 4x +++ lymphnode 4x +++ 4x +++ 4x +++ lavage of bon 4x +++ 4x +++ 4x +++ purified leuko 4x +++ 4x +++ 4x +++ allantoic fluid 2x +++/++/+ 4x +++ 4x +++ serum 2x ++/2x+ 4x +++ 4x +++ 4 replicates Graduation of fluorescence intensity: +: plaques ++: non-infected spots +++: layer completely infected NCP7 N.sup.pro: all samples negative

(90) Virus isolation was conducted on KOP-R cells, interferon-incompetent MDBK cells, and on the highly susceptible MDBK-clone 6.

(91) Furthermore, 1 g of fetal tissue material was homogenised and cultured in flasks on interferon-incompetent MDBK cells and on MDBK-clone 6 cells. The cultures, as well as 2 additional passages, were stained negative for BVDV in immunofluorescence analyses.

(92) Fetal tissues were also subjected to quantitative real-time RT-PCR (qRT-PCR) analyses. At present, we tested leukocytes, lung and kidney.

(93) Genome copies were extrapolated to 1.0 g of tissue material, 1 ml whole blood or 1 ml bone marrow lavage.

(94) The parental BVDV strain NCP7 as well as the N.sup.pro deletion mutant crossed the placenta and were able to establish infection in all fetuses. However, no infectious NCP7N.sup.pro virus was re-isolated from a large panel of fetal organs. In addition, no virus genomes could be detected in purified blood leukocytes of the NCP7N.sup.pro fetuses. In comparison with the BVDV NCP7 RNA loads for, the copy numbers of NCP7N.sup.pro were 5,000-fold (lungs) to 20,000-fold (kidney) reduced.

Example 4

(95) Comparison of Vaccines/Vaccination Strategies

(96) 1.sup.st Animal Trial: Vaccination Challenge Trial

(97) v890FLC, cp7N.sup.pro; v890FLN.sup.pro and a combination of both N.sup.pro mutants in a single application were used to vaccinate groups of cattle (2 different vaccination schemes).

(98) 2.sup.nd Animal Trial: Vaccination Challenge Trial

(99) cp7N.sup.pro and v890FLN.sup.pro where administered as a sequential vaccine (1.sup.st shot: cp7N.sup.pro/2.sup.nd shot: v890FLN.sup.pro)

(100) 3.sup.rd Animal Trial: Vaccination Challenge Trial

(101) cp7N.sup.pro_E2CS8644, a chimera composed of cp7N.sup.pro as backbone with the cp7 E2 replaced by the E2 coding region of the BVDV-2 strain CS8644 was used as vaccine candidate, either solely or in combination with cp7N.sup.pro in one single application.

(102) Challenge Strain

(103) For all three trials a virulent German field isolate, BVDV-2 strain HI916, which causes reproducible and clear clinical signs of disease as determined in a previous trial was used.

(104) Further Indication to all Labels/Legends of Below Given Schemes and Diagrams (if Mutants are not Explicitly Named):

(105) TABLE-US-00003 BVDV-2 or 890 stands for v890FL BVDV-1 stands for cp7N.sup.pro N means N.sup.pro
Design of the cp7N.sup.pro/v890FLN.sup.pro/v890FLC Vaccination-Challenge Trial

(106) Animal trial 1 time scale, sampling periods and experimental design is represented in FIG. 9

(107) TABLE-US-00004 TABLE 2 Outline of the animal groups used in the cp7Npro/ v890FLNpro/v890FLC vaccination-challenge trial 5 BVDV- 5 2Npro & 5 5 5 BVDV- BVDV- BVDV- BVDV-2C controls 1Npro 1Npro 2Npro 1.sup.st 1.02 10.sup.6 unvaccinated 9.28 10.sup.5 1.26 10.sup.6 9.28 10.sup.5 TCID50/animal TCID50/ TCID50/ TCID50/ animal animal animal 2.sup.nd 6.32 10.sup.5 i.m. i.m. i.m. i.m. TCID50/animal i.m. challenge infection 2.25 10.sup.6 TCID50/animal i.n. (nebulizer) heterologous BVDV-2 HI916 (assessed as effective and virulent challenge strain in previous trial)
Animals:

(108) 25 BVDV nave calves (n=5 per group) were vaccinated according to the protocol and 60 days later, a challenge infection with BVDV-2 strain HI916 (German field isolate, established as challenge strain in a previous animal trial) was carried out.

(109) Vaccination:

(110) double application of BVDV v890FLC: 1.sup.st shot: 1.0210.sup.6/2.sup.nd shot: 6.3210.sup.5 TCID50 (2 ml i.m.)

(111) single application of 9.2810.sup.5 TCID50 BVDV cp7N.sup.pro (2 ml i.m.)

(112) single application of 9.2810.sup.5 TCID50 BVDV v890FLN.sup.pro (2 ml i.m.)

(113) single application of 1.2610.sup.6 TCID50 BVDV cp7N.sup.pro & v890FLN.sup.pro (2 ml i.m.)

(114) Challenge Infection:

(115) 2.2510.sup.6 TCID50 BVDV-2 HI916 intranasallyusing a nebulizer

(116) Sampling Periods:

(117) daily for 10 days after vaccination (v890FLC group: for 8 days after 1st vaccination, no sampling after 2.sup.nd vaccination/no sampling of the control group) all groups for 14 d after challenge infection
Results I
I.I Vaccination:
v890FLC (Vaccination d 0 and d 25)
1.sup.st Vaccination (d 0):

(118) Clinical Signs and Blood Picture: animals showed neither adverse reactions nor a temperature rise or clinical signs of disease. no leucopenia could be observed.

(119) Virus Isolation: neither shedding via nasal excretions nor pseudovirion viremia was detectable by virus isolation.fwdarw.therefore, the group was not sampled following second vaccination

(120) Serology: developed only a marginal rise in inhibition levels and remained negative until booster vaccination the applied NS3-specific blocking ELISA (Prionics) neutralising antibody titres against all three strains tested (BVDV-1: SE5508/BVDV-2: 890 and HI916) were not detectable after the first vaccination
2.sup.nd Vaccination (d 25): not sampled for vi and blood picture

(121) Serology: showed a clear boost in antibody development being ELISA positive as soon as 7 days after their second vaccination stayed at basal to non detectable neutralising titre levels until challenge infectionvery low to nonexistenteven against the parental BVDV-2 890 strain
cp7N.sup.pro (Vaccination d 25)

(122) Clinical Signs and Blood Picture: one animal showed a little elevation in temperature for one (day 28) some clinical reaction post vaccination; animals had slightly elevated mean clinical score values for 2 days (day 28 and day 35) due to mild respiratory symptoms short and monophasic decline in leukocyte counts (up to 20% reduction day 29/30) thrombocyte counts also slightly decreased paralleling leukocyte counts

(123) Virus Isolation: no nasal virus shedding and very limited vaccine virus viremia (3 animals, 2 days)

(124) Serology: positive in the NS3 blocking ELISA from day 14 p. vacc. neutralising antibody titres were found in all immunised groups as soon as 14 days after vaccination: BVDV-1 SE5508: highest titres of all groups BVDV-2 HI916: medium titres BVDV-2 890: similar values and trends as against HI916
v890FLN.sup.pro (Vaccination d 25)

(125) Clinical Signs and Blood Picture: one animal showed a little elevation in temperature for two days (day 31, day 32). no raised clinical scores short and monophasic decline in their leukocyte counts (up to 20% reduction day 30) thrombocyte counts also slightly decreased paralleling leukocyte counts

(126) Virus Isolation: vaccine virus was detected in the nasal swab sample from one immunised animal on one single day (day 32, after blind passage)very limited vaccine virus viremia 2 animals, 3 to 4 days

(127) Serology: positive in the NS3 blocking ELISA from day 14 p. vacc. neutralising antibody titres as soon as 14 days after vaccination BVDV-1 SE5508: stayed basal in their titres BVDV-2 HI916: highest titres BVDV-2 890: similar values and trends as against H916
cp7N.sup.pro & V890FLN.sup.pro (Vaccination d 25)

(128) Clinical Signs and Blood Picture: no temperature rise after vaccination no raised clinical scores short and monophasic decline in their leukocyte counts (max 28%) thrombocyte counts also slightly decreased paralleling leukocyte counts

(129) Virus Isolation: no nasal virus shedding and very limited vaccine virus viremia (3 animals, 1 to 2 days)

(130) Serology: positive in a NS3 blocking ELISA from day 14 p. vacc. neutralising antibody titres were found as soon as 14 days after vaccination BVDV-1 SE5508: highest titres BVDV-2 HI916: high titres (lower than solely BVDV-2Npro application group) BVDV-2 890: similar values and trends
Controls: (Unvaccinated) stayed seronegative during the vaccination period stayed basal in their titres
I.II Challenge Infection (Day 60)
Controls:

(131) Clinical Signs and Blood Picture: biphasic rise in body temperatures: a slight one at day 3 and a pronounced one at days 8 and 9 p. chall. with maximum mean group values of up to 41 C. showed typical and clear signs of clinical disease: distinct rise in clinical scores peaking at days 8 to 10: marked respiratory symptoms (coughing and mucopurulent nasal discharge), depression with reduced appetite, 2 animals had a watery diarrhoea for 2 to 3 days developed a severe leukopaenia: bi- to triphasic decrease (days 3, 7 and 13 p. chall.) in leukocyte counts with maximum levels of 48% reduction at day 7 p. chall. thrombocyte counts were not as heavily affected as expected: mean reduction to a maximum of 35% at day 3 p. chall. counts notably increased after acute infection in the controls (to mean values of 195%), corresponding to severity of infection and disease

(132) Virus Isolation: challenge virus was detectable in the nasal swab samples of all control animals from day 61 till day 71long and distinct challenge virus viremia in the control group for up to 11 days (day 62-day 73)

(133) Serology: all control animals scored positive in the NS3 blocking ELISA from day 14 p. chall. on detectable neutralising titres from day 14 on against all three strains, higher titres against BVDV-2 strains
BVDV-2C

(134) Clinical Signs and Blood Picture: elevation in body temperature at day 7 but stayed in the physiological range clinical effects of the challenge infection were clearly reduced compared to the controls only a single decline of the leukocyte counts: maximal decrease of about 12% on day 4 p. chall; quickly recovered to pre-infection counts (day 7 p. chall.) thrombocyte counts: a single less marked decrease.

(135) Virus Isolation: duration and levels of nasal virus shedding markedly reduced: all animals shed on 1 to 4 dayschallenge virus viremia: also clearly reduced in time and amount BVDV-2C: 4 animals, 1 day

(136) Serology: NS3 antibodies were slightly boostered; mean blocking values of 100% were reached at day 89 boost in neutralising antibodies titres, detectable after 7 resp.14 days post challenge and peaking at day 14 to day 28 p. chall. BVDV-1 SE5508 increased, but mean values peaked at a markedly lower level than against BVDV-2 strains BVDV-2 strain 890: titres after 7 days; at the term of the study end titres were very similar in all groups BVDV-2 strain HI916: titres remained slightly lower than against 890 strain
BVDV-1N.sup.pro

(137) Clinical Signs and Blood Picture: elevation in body temperature at day 7 p. chall. up to 40 C. clinical effects of the challenge infection were clearly reduced; moderate respiratory symptoms noticed only a single decline of leukocyte counts (maximal decrease of about 12% 4 p. chall.); animals quickly recovered to pre-infection counts (day 7 p. chall.) thrombocyte counts: no marked decrease; after acute infection notably increased (175%)

(138) Virus Isolation: nasal virus shedding: duration (day 62-day 68) and levels markedly reduced: 4 animals, 1 to 3 dayschallenge virus viremia: clear reduction in time (day 63-day 68) and amount: all animals, 1 to 5 days;

(139) Serology: NS3 antibodies (blocking ELISA (Prionics)): slightly boostered; mean blocking values of 100% reached at day 89 boost effect on neutralising antibodies titres peaking at day 14 to day 28 p. chall. BVDV-1 SE5508: maximum titres reached 14 days post challenge BVDV-2 890: maximum titres 14 days post challenge; at the term of the study end titres were very similar in the groups BVDV-2 HI916: maximum titres 14 days post challenge; remained slightly lower than against 890 strain
BVDV-2N.sup.pro

(140) Clinical Signs and Blood Picture: no elevation in body temperature no clinical effects no decrease in leukocyte blood counts thrombocyte counts: a single decrease up to 20% on day 4 post challenge.

(141) Virus Isolation: neither shedding of challenge virus nor challenge virus viremia

(142) Serology: NS3 antibodies (blocking ELISA (Prionics)): slightly boostered; mean blocking values of 100% reached at day 89 boost effect on neutralising antibodies titres peaking at day 14 to day 28 p. chall. BVDV-1 SE5508: increased, but mean values peaked at a markedly lower level than groups receiving BVDV-1. BVDV-2 890: maximum titres 14 days post challenge; at the term of the study end titres were very similar in the groups BVDV-2 HI916: maximum titres 14 days post challenge; similar to titres against BVDV-2 890
BVDV-1N.sup.pro+BVDV-2N.sup.pro

(143) Clinical Signs and Blood Picture: single elevation in body temperature at day 7 (39.8 C.) clinical effects of the challenge infection were clearly reduced; no rise of clinical scores single decline of the leukocyte counts (maximal decrease of 24% at day 10 p. chall.), reduced leukocyte counts persisted till the end of the trial (day 89mean reduction of 20 thrombocyte counts: single decrease of 25% on day 5 post challenge; increased after day

(144) Virus Isolation: nasal virus shedding: duration and levels markedly reduced: 2 animals, 1 to 2 dayschallenge virus viremia: clear reduction in time and amount: 2 animals, 1 to 3 days

(145) Serology: NS3 antibodies (blocking ELISA (Prionics)): slightly boostered; mean blocking values of 100% reached at day 89 boost effect on neutralising antibodies titres peaking at day 14 to day 28 p. chall. BVDV-1 SE5508: increased, but mean values peaked at a markedly lower level than groups receiving BVDV-1. BVDV-2 890: maximum titres 14 days post challenge; at the term of the study end titres were very similar in the groups BVDV-2 HI916: maximum titres 14 days post challenge; similar to titres against BVDV-2 890
In General: No clinical effects like bloody diarrhoea, petechia or haematomas on injection/injury sites could be observed in this trial. The conducted neutralising assays in this study showed that titres of BVDV-2 exposed animals against BVDV-2 strains were lower than those of the BVDV-1 vaccinated animals against the used BVDV-1 strain. Due to widely differing results of the NS3-specific ELISA and the neutralisation assay for the BVDV-2C-immunised group, we sequenced the region of the replicon encoding the E2 protein. The E2 protein is the major immunogen of BVDV and the predominant inducer of neutralising antibodies. We found one nucleotide change compared to the corresponding sequence of the parental full-length cDNA clone. It was located at nucleotide position 2736 referred to the full-length cDNA and leads to an amino acid change from Leucine to histidine.
Conclusions:

(146) All BVDV vaccine candidates tested for safety and efficacy markedly reduced the outcome of the heterologous BVDV-2 challenge infection in cattle while showing graduated protective effects with regards to clinical symptoms, nasal virus shedding and viremia. The v890FLN.sup.pro mutant provided complete protection leading to a sterile immunity against the highly virulent BVDV-2 challenge in all immunized animals. A vaccine comprising both the cp7N.sup.pro and the v890FLN.sup.pro strain did not provide sterile immunity against the same highly virulent BVDV-2 challenge.

(147) Design of the cp7N.sup.pro/v890FLN.sup.pro sequential vaccination-challenge trial

(148) Animal trial 2 time scale, sampling periods and experimental design is represented in FIG. 10.

(149) TABLE-US-00005 TABLE 3 Outline of the animal groups used in the cp7Npro/v890FLNpro sequential vaccination-challenge trial 5 BVDV-1Npro + 4 BVDV-2Npro controls 1.sup.st (BVDV-1 Npro) unvaccinated 1.12 10.sup.6 TCID50/animal 2.sup.nd (BVDV-2 Npro) i.m. 1.26 10.sup.5 TCID50/animal i.m. challenge infection 1.66 10.sup.5 TCID50/animal i.n. (nebulizer) heterologous BVDV-2 HI916 (assessed as effective and virulent challenge strain in previous trial)
Animals:

(150) 9 BVDV nave calves (n=5 vaccinated/n=4 unvaccinated control group) were vaccinated sequentially; 2 shots with an interval of 28 days according to the protocol and 28 days after the 2.sup.nd vaccination a challenge infection with BVDV-2 strain HI1916 (German field isolate, established as challenge strain in a previous animal trial) was carried out.

(151) Vaccination:

(152) 1.sup.st shot CP7 Npro: 1.1210.sup.6 TCID50/animal (2 ml i.m.)

(153) 2.sup.nd shot v890FLNpro: 1.2610.sup.5 TCID50/animal (2 ml i.m.)

(154) Challenge Infection:

(155) 1.6610.sup.5 TCID50 BVDV-2 HI916 intranasallyusing a nebulizer

(156) Results II

(157) II.I Vaccination (Day 56 and Day 28)

(158) cp7N.sup.pro/v890FLN.sup.pro

(159) 1.sup.st Vaccination d 56 (cp7N.sup.pro)

(160) Clinical Signs and Blood Picture: body temperatures of the animals stayed in the physiological range no adverse clinical reactions occurred; slight clinical (mainly respiratory) symptoms 7-8 days after vaccination led to an elevated score but were unlikely associated with vaccination, as alternating mild respiratory symptoms such as nasal discharge and sporadic coughing were observed during the whole period of monitoring in both groups leukocyte counts (weekly intervals): declined during first 4 weeks thrombocyte counts (weekly intervals): stayed unaffected

(161) Serology: positive in the applied antibody ELISA (IDEXX) from 14 d post vaccination neutralising antibodies detectable in the neutralisation assays from day 14 p. vacc. BVDV-1 SE5508: clear rise from day 14 p.vacc. BVDV-2 890: low to medium titres detectable on day 14 BVDV-2 HI916: titres basal to non detectable until second vaccination
2.sup.nd Vaccination d 28 (v890FLN.sup.pro)

(162) Clinical Signs and Blood Picture: body temperatures of the animals stayed in the physiological range no rise in the clinical score leukocyte counts (weekly intervals): a very slight decline (around 5%) displayed in a biphasic spiked curve between day 26 and 21 thrombocyte counts (weekly intervals): stayed unaffected

(163) Virus Isolation: no vaccine virus shedding nor vaccine virus viremia could be observed

(164) Serology: clear booster effect in the antibody ELISA from 7 d post second vaccination neutralising antibodies clearly boostered from day 7 p. 2.sup.nd vacc. BVDV-1 SE5508: clear boost; maximum titres already reached before challenge infection BVDV-2 890: clear boost BVDV-2 HI916: boost to detectable, but very low titres
Controls:

(165) Serology: stayed seronegative throughout the sampling period (ELISA and NAs)
In General:

(166) General decline in leukocyte counts in both groups over the first 4 weeks of the vaccination period could be indication of elevated counts at the start of the trial caused e.g. by a foregone (general) infection.

(167) II.II Challenge Infection (Day 0):

(168) Controls:

(169) Clinical Signs and Blood Picture: biphasic rise in their body temperatures: a very slight one at day 2 and 4 (remaining in the physiological range) and a moderate one at days 8 and 9 p. chall. with maximum mean group values of 39.7 C. showed typical and clear signs of clinical disease: rise in clinical scores peaking at days 8 to 10: respiratory symptoms (coughing and mucopurulent nasal discharge), slight depression with reduced appetite developed a clear leukopaenia: bi- to triphasic decrease (days 3, 7 and 11 p. chall.) of leukocyte counts with maximum levels of 45% reduction at day 7 p. chall. thrombocyte counts were not as heavily affected as expected: biphasic drop (day 7 and 11) with a mean reduction to a maximum of 40-50% afterwards counts notably increased till day 21 following acute infection in the controls (to mean values of 270%)

(170) Virus Isolation: challenge virus was detectable in the nasal swab samples of all control animals from day 1 till day 10long and distinct challenge virus viremia in the control group for up to 10 days (day 2-day 11)

(171) Serology: animals scored positive in the antibody ELISA from day 14 p. chall. on detectable neutralising titres from day 14 on against all three strains, higher titres against BVDV-2 strains BVDV-1 SE5508: positive, but low titres till the end of trial BVDV-2 890: clear boost BVDV-2 HI916: clear boost
CP7Npro/v890FLNpro

(172) Clinical Signs and Blood Picture: slight elevation in body temperature at day 8 but stayed in the physiological range clinical effects of the challenge infection were clearly reduced compared to the controls; infection led not to a rise in the mean clinical scores biphasic decline of the leukocyte counts on day 3 and 12: maximal decrease of about 12% on day 3 p. chall; quickly recovered to pre-infection counts after every drop (day 7/resp. day 14 p. chall.) thrombocyte counts: two very slight decreases (about 10%) on day 3 and 11 paralleling the leukocyte picture.

(173) Virus Isolation: duration and levels of nasal virus shedding markedly reduced: one animal was vi positive on 2 days (day 3 and 5); challenge virus viremia: also very clearly reduced in time and amount: 2 animals, 1 to 2 days.

(174) Serology: antibodies were clearly boostered, maximum ODs reached 14 days post challenge boost in neutralising antibodies titres observable after 7 resp.14 days all peaking at day 28 p. chall., similar titres against all three strains found at the end of the trial BVDV-1 SE5508 only slight increase BVDV-2 strain 890: boost to similar end titres as the controls BVDV-2 strain HI916: clear boost of the only low neutralising antibody titres developed before challenge infection
Conclusions:

(175) Neither vaccine virus viremia nor shedding could be observed in this trial. Again no clinical reactions and no fever could be observed in animals after vaccination.

(176) Decreases of leukocyte counts after second vaccination were not pronounced and also leukocyte reduction after challenge infection was not prominent (12%). Neutralising antibody titers were developed to similar levels as they were in the mixed application of cp7N.sup.pro/v890FLN.sup.pro. Challenge virus viremia (2 animals 1-2 days) and shedding (1 animal 2 days) could not be completely hindered and were similar as in the group receiving the single mixed applicationnevertheless clearly reduced compared to the control group. Sequential vaccination of cp7N.sup.pro and v890FLN.sup.pro did not lead to a sterile immunity in all animals as did the vaccination with v890FLN.sup.pro mutant alone.

(177) Design of the BVDV-1/2 Chimera (cp7N.sup.pro_E2CS8644) Vaccination-Challenge Trial

(178) Animal trial 3 time scale, sampling periods and experimental design is represented in FIG. 11.

(179) TABLE-US-00006 TABLE 4 Outline of the animal groups used in the BVDV-1/2 chimera (cp7Npro_E2CS8644) vaccination-challenge trial 5 BVDV-1Npro 5 + BVDV-1Npro_E2 BVDV-1Npro_E2 4 BVDV-2 BVDV-2 controls 9.36 10.sup.5 TCID50/animal 2.04 10.sup.6 TCID50/animal unvaccinated i.m. i.m. i.m. challenge infection 2.95 10.sup.5 TCID50/animal i.n. (nebulizer) heterologous BVDV-2 HI916 (assessed as effective and virulent challenge strain in previous trial)
Animals:

(180) 14 BVDV nave calves (n=5 per vaccinated group/n=4 unvaccinated controls) were vaccinated according to the protocol and 28 days post vaccination, a challenge infection with BVDV-2 strain HI916 (German field isolate, established as challenge strain in a previous animal trial) was carried out.

(181) Vaccination:

(182) group 1: cp7 Npro_E2CS8644: 9.3610.sup.5 TCID50/animal (2 ml i.m.)

(183) group 2: cp7 Npro_E2CS8644+cp7Npro: 2.0410.sup.6 TCID50/animal (3 ml i.m.)

(184) Challenge Infection:

(185) 1.6610.sup.5 TCID50 BVDV-2 HI916 intranasallyusing a nebulizer

(186) Sampling Periods:

(187) daily for 11 days after vaccination (no sampling of the control group) all groups for 14 d after challenge infection
Results
III.I Vaccination (Day 28):
In General:

(188) Serology after Vaccination: neutralisation assays against the parental strains of the chimera were performed (BVDV-1 cp7 and BVDV-2 CS8644)
cp7 Npro_E2CS8644

(189) Clinical Signs and Blood Picture: body temperatures of the animals stayed in the physiological range throughout the vaccination period no adverse clinical reactions occurred; slight clinical (respiratory) symptoms throughout the vaccination period led intermittently to an elevated score (peaks day 25, 15, 11, 10 and 8) but this was unlikely associated with vaccination, as mild respiratory symptoms such as nasal discharge and sporadic coughing alternating in intensity were observed during the whole period of monitoring in both vaccinated groups leukocyte counts: a slight biphasic decline (around 10% days 3 and 7 post vaccination); on day19 animals had reached their pre-vaccination levels again thrombocyte count: there was a constant decrease over the vaccination periodoverall 25-30% in both vaccinated groups, declines after vaccination were only minimal (up to 5%)

(190) Virus Isolation: no vaccine virus shedding could be observedvaccine virus was isolated from the leukocytes of one animal on one day (d 24)

(191) Serology: in the applied NS3 blocking ELISA (Prionics) group stayed negative until challenge infection neutralising antibodies against BVDV-1 (cp7) and BVDV-2 (CS8644) BVDV-1 cp7: marginally titres detected 3 weeks p.vacc.; stayed low until challenge infection BVDV-2 CS8644: detected 3 weeks p.vacc.; higher on day 0
cp7 Npro_E2CS8644+cp7Npro

(192) Clinical Signs and Blood Picture: body temperatures of the animals stayed in the physiological range throughout the vaccination period no adverse clinical reactions occurred; slight clinical (respiratory) symptoms throughout the vaccination period led intermittently to an elevated score but this was unlikely associated with vaccination, as mild respiratory symptoms such as nasal discharge and sporadic coughing alternating in intensity were observed during the whole period of monitoring in both vaccinated groups leukocyte counts: slight decline 3 to 7 days post vaccination with a peak at d 7 p.vacc. (around 20%); increased on day 19 but 10% lower than pre-vaccination levels thrombocyte count: there was a constant decrease over the vaccination periodoverall 25-30% in both vaccinated groups, declines after vaccination were not clearly discernable

(193) Virus Isolation: neither vaccine virus shedding nor vaccine virus viremia could be observed

(194) Serology: NS3 blocking ELISA (Prionics): marginally positive 3 weeks after immunisation; clearly positive on day of challenge infection neutralising antibodies against BVDV-1 (cp7) and BVDV-2 (CS8644) BVDV-1 cp7: detected from day 14 p.vacc., rising till challenge infection BVDV-2 CS8644: detected 3 weeks p.vacc.; but clearly lower titres as against BVDV-1
Controls:

(195) Serology: stayed seronegative throughout the sampling period (ELISA and NAs)
In General: leukocyte counts: there was a decline of about 20% in both vaccinated groups that stayed at a constant level till challenge infection (the counts were set to 100% prior to challenge)
III.II Challenge Infection (Day 0)
In General:

(196) Serology after Challenge Infection: additional neutralisation assay against the challenge strain (BVDV-2 HI916) was performed
Controls:

(197) Clinical Signs and Blood Picture: biphasic rise in their body temperatures: a slight one at day 3 and a pronounced one at days 7 and 8 p. chall. with maximum mean group values of up to 40.1 C. showed typical and clear signs of clinical disease: distinct rise in clinical scores peaking at days 8 to 11: marked respiratory symptoms (coughing and mucopurulent nasal discharge), depression with reduced appetite (pronounced in 2 animals) developed a severe leukopaenia: triphasic decrease (days 3, 7 and 11 p. chall.) in leukocyte counts with maximum levels of 44% reduction at day 3 p. chall. thrombocyte counts: reduction over 9 days following challenge to a maximum of 48% at day 9 p. chall. counts quickly increased afterwards acute to mean values of 115% at the end of the trial

(198) Virus Isolation: challenge virus was detectable in the nasal swab samples of all control animals on day 2 and 3 and day 5 till 13challenge virus viremia for up to 12 days (day 2-day 13)

(199) Serology: all control animals scored positive in the NS3 blocking ELISA from day 14 p. chall. on detectable neutralising titres from day 14 post challenge against all strains, higher titres against BVDV-2 strains
cp7 Npro_E2CS8644

(200) Clinical Signs and Blood Picture: body temperatures: single but pronounced rise peaking at day 7 with maximum mean group values of up to 40.5 C. no peak or clear rise of clinical scores compared to the vaccination period levels leukocyte counts: single decline (22% on day 3 post challenge); quickly recovering to their pre-vaccination levels again (day 7 post challenge) thrombocyte counts: reduction over 7 days following challenge; maximum of 19% at day 7 p. chall. counts quickly increased afterwards

(201) Virus Isolation: challenge virus shedding: 2 animals on day 3challenge virus viremia in 2 animals for 1-2 days (day 3 to 5)

(202) Serology: NS3 blocking ELISA (Prionics) clear boost, blocking values of about 100% at the end of the trial neutralising antibodies against BVDV-1 (cp7) and BVDV-2 (CS8644 and HI916) were boostered; titres against BVDV-1 stayed lower than in the mixed application group
cp7 Npro_E2CS8644+cp7Npro

(203) Clinical Signs and Blood Picture: body temperatures: single rise peaking at day 7 with maximum mean group values of up to 39.6 C. no peak or clear rise of clinical scores compared to the vaccination period levels leukocyte counts: single decline (15% on day 4 post challenge); quickly recovering to their pre-vaccination levels again (day 7 post challenge) thrombocyte counts: reduction over 7 days following challenge; maximum of 22% at day 7 p. chall. counts quickly increased afterwards

(204) Virus Isolation: neither challenge virus shedding nor challenge virus viremia could be observed

(205) Serology: NS3 blocking ELISA (Prionics) clear boost, blocking values of about 100% at the end of the trial neutralising antibodies against BVDV-1 (cp7) and BVDV-2 (CS8644 and HI916) were boostered; titres against BVDV-1 higher than in the group receiving only the chimera
Conclusions:

(206) Although a very mild clinical reaction could be seen in both vaccinated groups after challenge infection (cp7Npro_E2CS8644 fever, while in the group with the mixed application only raised temperature), vaccination with cp7N.sup.pro_E2CS8644+cp7N.sup.pro in one single application led to a sterile immunity after challenge infection.