Expression in insect cells of genes with overlapping open reading frames, methods and compositions therefor
09879282 ยท 2018-01-30
Assignee
Inventors
Cpc classification
C12N7/00
CHEMISTRY; METALLURGY
C12N2750/14152
CHEMISTRY; METALLURGY
C12N2750/00043
CHEMISTRY; METALLURGY
C12N2750/00051
CHEMISTRY; METALLURGY
C12N2750/14151
CHEMISTRY; METALLURGY
C12N2830/42
CHEMISTRY; METALLURGY
International classification
C12N15/00
CHEMISTRY; METALLURGY
C12N7/00
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
Abstract
The present teachings disclose nucleic acid cassettes for expressing in an insect cell a plurality of polypeptides encoded by a gene comprising overlapping open reading frames (ORFs). A cassette comprises, in 5 to 3 order, a) a first insect cell-operable promoter, b) a 5 portion of a gene comprising a first ORF of the gene, c) an intron comprising a second insect cell-operable promoter, and d) a 3 portion of the gene comprising at least one additional ORF. Vectors and insect cells comprising the cassettes are also disclosed, as well as methods for production of recombinant adeno-associated virus in insect cells using the cassettes.
Claims
1. An in vitro method of expressing a plurality of polypeptides encoded by a parvovirus Rep gene, the Rep gene comprising overlapping ORFs in an insect cell, the method comprising: a) infecting or transfecting one or more insect cells with a nucleic acid cassette, the cassette comprising in 5 to 3 order: (i) a first cell operable-promoter linked operably to a 5 portion of a first ORF of the parvovirus Rep gene, the first ORF comprising a translation initiation codon; and (ii) an intron comprising a second insect cell-operable promoter, the second promoter operably linked to a 5 portion of an at least one additional ORF of a parvovirus Rep gene, wherein the at least one additional ORF comprises at least one additional translation initiation codon and overlaps with the 3 portion of the first ORF; and b) culturing the one or more insect cells in a culture medium such that it expresses the plurality polypeptides encoded by the parvovirus Rep gene.
2. The method of claim 1, wherein the nucleic acid cassette further comprises a polyadenylation signal situated 3 to the at least one additional ORF of ii).
3. The method of claim 1, wherein each of the first insect cell-operable promoter and the second insect cell-operable promoter is independently selected from the group consisting of a p10 promoter and a polh promoter.
4. The method of claim 1, wherein the nucleic acid cassette is comprised within a plasmid, a virus, another vector, or a combination thereof.
5. An in vitro method of expressing a plurality of polypeptides encoded by a polyomavirus capsid Cap gene comprising overlapping ORFs in an insect cell, the method comprising: a) infecting or transfecting one or more insect cells with a nucleic acid cassette, the cassette comprising in 5 to 3 order: (i) a first cell operable-promoter linked operably to a 5 portion of a first ORF of the polyomavirus Cap gene, the first ORF comprising a translation initiation codon; and (ii) an intron comprising a second insect cell-operable promoter, the second promoter operably linked to a 5 portion of an at least one additional ORF of a polyomavirus Cap gene, wherein the at least one additional ORF comprises at least one additional translation initiation codon and overlaps with the 3 portion of the first ORF; and b) culturing the one or more insect cells in a culture medium such that it expresses the plurality polypeptides encoded by the Cap gene.
6. The method of claim 5, wherein the at least one insect cell is selected from the group consisting of a Trichoplusiani BTI-Tn-5B1-4 cell, a Spodoptera frugiperda Sf9 cell, and a Spodoptera frugiperda Sf21 cell.
7. The method of claim 5, wherein the Cap gene comprises a VP1 ORF and a VP2/VP3 ORF.
8. The method of claim 5, wherein the nucleic acid cassette further comprises a polyadenylation signal situated 3 to the at least one additional ORF of ii).
9. The method of claim 5, wherein each of the first insect cell-operable promoter and the second insect cell-operable promoter is independently selected from the group consisting of a p10 promoter and a polh promoter.
10. The method of claim 5, wherein the nucleic acid cassette is comprised within a plasmid, a virus, another vector, or a combination thereof.
11. An in vitro method of expressing a plurality of polypeptides encoded by a parvovirus capsid (Cap) gene, the Cap gene comprising overlapping ORFs in an insect cell, the method comprising: a) infecting or transfecting one or more insect cells with a nucleic acid cassette, the cassette comprising in 5 to 3 order: (i) a first cell operable-promoter linked operably to a 5 portion of a first ORF of the parvovirus Cap gene, the first ORF comprising a translation initiation codon; and (ii) an intron comprising a second insect cell-operable promoter, the second promoter operably linked to a 5 portion of an at least one additional ORF of a parvovirus Cap gene, wherein the at least one additional ORF comprises at least one additional translation initiation codon and overlaps with the 3 portion of the first ORF; and b) culturing the one or more insect cells in a culture medium such that it expresses the plurality of polypeptides encoded by the parvovirus Cap gene.
12. The method of claim 11, wherein the at least one insect cell is selected from the group consisting of a Trichoplusiani BTI-Tn-5B1-4 cell, a Spodoptera frugiperda Sf9 cell and a Spodoptera frugiperda Sf21 cell.
13. The method of claim 1, wherein the Rep gene comprises a Rep 78/68 ORF and a Rep 52/40 ORF.
14. The method of claim 11, wherein the Cap gene comprises a VP1 ORF and a VP2/VP3 ORF.
15. The method of claim 11, wherein the nucleic acid cassette further comprises a polyadenylation signal situated 3 to the at least one additional ORF of ii).
16. The method of claim 11, wherein each of the first insect cell-operable promoter and the second insect cell-operable promoter is independently selected from the group consisting of a p10 promoter and a polh promoter.
17. The method of claim 11, wherein the nucleic acid cassette is comprised within a plasmid, a virus, another vector, or a combination thereof.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
DETAILED DESCRIPTION
(15) The methods and compositions described herein utilize laboratory techniques well known to skilled artisans, and can be found in laboratory manuals such as Sambrook, J., et al., Molecular Cloning: A Laboratory Manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 2001; Methods In Molecular Biology, ed. Richard, Humana Press, NJ, 1995; Spector, D. L. et al., Cells: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1998; and Harlow, E., Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1999. Additional references describing methods of expression of heterologous polypeptides in insect cells, as well as methods of introducing vectors and nucleic acids into insect cells and methods of maintaining insect cell cultures include, for example, O'Reilly et al., Baculovirus Expression Vectors, A Laboratory Manual, Oxford Univ. Press, 1994; Samulski et al., J. Vir. 63: 3822-3288, 1989; Kajigaya et al., Proc. Nat'l. Acad. Sci. USA 88: 4646-4650, 1991; Ruffing et al., J. Vir. 66: 6922-6930, 1992; Kimbauer et al., Vir. 219: 37-44, 1996; Zhao et al., Vir. 272: 382-393, 2000; and Samulski et al., U.S. Pat. No. 6,204,059.
(16) As used in the description and the appended claims, the singular forms a, an and the are intended to include the plural forms as well, unless the context indicates otherwise. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety.
(17) The present inventor has developed a method for expressing a gene with overlapping reading frames in insect cells. The inventor has discovered that incorporating into a single gene an artificial intron comprising an insect cell-operable promoter can provide expression of overlapping open reading frames in an insect cell. Overlapping reading frames as used herein, refers to coding sequence from a gene which can be transcribed into multiple mRNA molecules from multiple transcription start sites; in various aspects, these mRNA molecules can be translated into multiple polypeptides. Overlapping reading frames include coding sequences which can be transcribed into mRNA molecules having different translation start sites (start codons) from one gene, with either frame-shifted reading frames or non-frame-shifted reading frames.
(18) In some aspects, a cassette of the present teachings can comprise a Rep gene, a p10 promoter and an intron comprising a polh promoter. In various aspects, upon infection of an insect cell by a baculovirus including such a cassette, Rep78 or Rep68 pre-mRNA can be transcribed from the p10 promoter, and mature mRNA can be formed by splicing out the artificial intron. In addition, the Rep52 or Rep40 mRNA can be transcribed from a polh promoter located inside the artificial intron. As a result, an insect cell can express both Rep78 (or Rep68) and Rep52 (or Rep40) from the same Rep coding sequence, while avoiding the use of separate Rep78 and Rep52 sequences. In other aspects, any insect cell-operable promoter can be used instead of a p10 or polh promoter.
(19) In some embodiments, the present teachings relate to the expression of overlapping Rep and Cap genes of adeno-associated virus in insect cells by incorporating into the Rep and Cap genes respectively an artificial intron comprising an insect cell-operable promoter. In some aspects, rAAV can be produced in the insect cells by employing the Rep and Cap coding sequences. By insertion of the artificial intron into the Rep coding sequence, both the Rep78 (or Rep68) and Rep52 (or Rep40) can be expressed from the single Rep coding sequence without the need to use two separate Rep coding sequences (
(20) In some aspects, the present teachings provides a method of producing an AAV in an insect cell. These methods comprise expressing Rep proteins and Cap proteins by transcribing mRNAs encoding the Rep proteins and Cap proteins. In these methods, at least one vector is introduced into an insect cell. A vector of these aspects comprises one or more nucleic acid molecules comprising a cassette, each cassette comprising, in 5 to 3 order, a first insect cell-operable promoter, a 5 portion of a gene comprising a first ORF of the gene comprising multiple ORFs, an intron comprising a second insect cell-operable promoter, and a 3 portion of the gene comprising at least one additional ORF. In various configurations, an insect cell-compatible vector can comprise a first nucleotide sequence comprising the Rep coding sequence and at least one artificial intron comprising an insect cell-operable promoter, and a second nucleotide sequence comprising the Cap coding sequence and at least one artificial intron. An insect cell into which such vectors are introduced can then be maintained under conditions such that AAV is produced. In some configurations, the insect cell can further comprise a nucleic acid comprising at least one AAV ITR. This nucleotide acid can also include a transgene, such as a gene encoding a reporter polypeptide or a polypeptide of therapeutic interest. In various configurations, this nucleic acid can be introduced into the cell by a vector. This vector can be distinct from the vector(s) comprising the Rep and/or Cap genes, or, in some configurations, a single vector can comprise the nucleic acid comprising at least one AAV ITR, the Rep gene and the Cap gene.
(21) The inventor has determined that AAV Rep and ITR sequences also efficiently cross-complement other AAV Rep and ITR sequences in insect cells. Generally, the Cap proteins, which determine the cellular tropicity of the AAV particle, and related Cap protein-encoding sequences are significantly less conserved than Rep proteins and genes among different AAV serotypes. In view of the ability Rep and ITR sequences to cross-complement corresponding sequences of other serotypes, pseudotyped AAV particles comprising the capsid proteins of a serotype (e.g., AAV6) and the Rep and/or ITR sequences of another AAV serotype (e.g., AAV2) can readily be generated. As used herein, pseudotype refers to the source of Cap protein in an adeno-associated virus. See, e.g., Halbert, C. L., et al., J. Virol. 74: 1524-1532, 2000; Halbert, C. L., et al., J. Virol. 75: 6615-6624, 2001. For example, the inventor has produced high titers of rAAV2/6 and rAAV2/8 (i.e., pseudotyped AAV comprising the ITRs and Rep sequences of AAV2 and VP sequences derived from AAV6 and AAV8, respectively) in Sf9 cells (see Example 4). In view of the conserved nature of Rep and ITR sequences among AAV serotypes, production of a pseudotyped vector comprising the Cap genes of a particular AAV serotype in a packaging cell system indicates that nonpseudotyped vectors of that serotype also can be successfully produced in that system. For example, the efficient production of rAAV2/6 and rAAV2/8 in Sf9 cells indicates that rAAV6 and rAAV8 also can be efficiently produced in these cells.
(22) In view of the foregoing, it will be understood that sequences from more than one AAV serotype can be combined for production of AAV in insect cells. For example, a nucleic acid comprising at least one AAV ITR nucleotide sequence can be derived from one serotype, such as AAV2, while other nucleic acids can comprise open reading frames or coding sequences derived from one or more other serotypes, such as, for example, serotype 3. In various configurations, nucleic acids of any of AAV serotypes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, and 11 can provide a Rep gene, a Cap gene, and/or an AAV ITR in the present methods.
(23) In some aspects of these methods, an AAV ITR can be an AAV1, AAV2, or an AAV6 ITR; a nucleic acid comprising the Rep ORFs can comprise an AAV1, an AAV2, or an AAV6 Rep gene; and a nucleic acid comprising the Cap ORFs can comprise an AAV1, an AAV2, or an AAV6 Cap gene.
(24) In some aspects, modified AAV sequences also can be used to produce rAAV in insect cells. For example, nucleotide sequences having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% sequence identity to an AAV1, AAV2, AAV3, and/or AAV4 ITR, Rep, or Cap can be used in place of wild-type AAV ITR, Rep, or Cap sequences, provided that rAAV particles are produced in infected cells. Similarly, amino acid sequences having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% sequence identity to an AAV1, AAV2, AAV3, and/or AAV4 polypeptide sequences can be used in place of wild-type AAV ITR, Rep, or Cap sequences, provided that rAAV particles are produced in infected cells.
(25) In various aspects, any insect cell known to a skilled artisan which can be maintained in culture can be used with the present methods. Non-limiting examples of cell lines include Sf9 cells from Spodoptera frugiperda, Sf21 cells from Spodoptera frugiperda, Drosophila cell lines, or mosquito cell lines, e.g., cell lines derived from Aedes albopictus. In some aspects, a cell line can be a Spodoptera frugiperda Sf9 cell line.
(26) Any vector known to a skilled artisan can be employed with the present teachings provided it is insect cell-compatible. The presence of a vector in the insect cell need not be permanent. The vectors can be introduced by any method known, for example by chemical treatment of the cells, electroporation, or infection. In some aspects, a vector can be a baculovirus, a viral vector, or a plasmid.
(27) If three vectors are used, a first vector can comprise a first nucleotide sequence comprising a first insect cell-operable promoter, a Rep coding sequence and an artificial intron comprising a second insect cell-operable promoter; a second vector can comprise a second nucleotide sequence comprising a third insect cell-operable promoter, Cap coding sequence and an artificial intron comprising a fourth insect cell-operable promoter; and a third nucleotide sequence comprising at least one AAV ITR nucleotide sequence. In
(28) In some aspects, AAV can be produced using two vectors in accordance with the disclosed methods. In these aspects, a first vector can comprise a nucleotide sequence comprising a first insect cell-operable promoter which is operably linked to a 5 portion of a Rep coding sequence, an artificial intron comprising a second insect cell-operable promoter which is operably linked to a 3 portion of the Rep coding sequence; a third insect cell-operable promoter operably linked to a 5 portion of a Cap coding sequence, and an artificial intron comprising a fourth insect cell-operable promoter which is operably linked to a 3 portion of the Cap coding sequence. A second vector of these aspects can comprise a nucleotide sequence comprising at least one AAV ITR nucleotide sequence.
(29) In various configurations, the sequences comprised by each vector can be in any order relative to each other. For example, in some arrangements, a vector can comprise ITRs and a Cap coding sequence, and the Cap coding sequence can be located on the vector such that, upon replication of the DNA between ITR sequences, the Cap coding sequence can be replicated, while in other arrangements, the Cap coding sequences are not replicated. In other configurations, Rep coding sequence and the Cap coding sequence can be in any order on a vector.
(30) Methods of introduction of nucleic acid sequences into an insect genome are well known to skilled artisans, as are methods for selecting and identifying cells harboring introduced nucleic acids. The incorporation into the genome can be aided for example, the use of a vector comprising nucleotide sequences with extensive sequence similarity to one or more regions of a genome of an insect host cell. The use of genetic elements, such as transposons, provide a method for introducing a nucleotide sequence into a genome. In some aspects of the present methods, a transformed cell can be selected or identified with the aid of a marker gene which can be encoded by a nucleic acid sequence added to the cell. The some aspects, incorporation of the nucleic acid sequence into a host cell genome then can be determined by standard methods well known to skilled artisans such as Southern blots or polymerase chain reaction (PCR) assays.
(31) In some aspects, an ITR can be engineered so that binding sites for replication polypeptides are situated on both strands of the A regions and D regions, and are located symmetrically, one on each side of the palindrome. On a double-stranded circular DNA template (e.g., a plasmid), the Rep78- or Rep68-assisted nucleic acid replication can then proceed in both directions and a single ITR suffices for AAV replication of a circular vector. Thus, one ITR nucleotide sequence can be used in the context of the present teachings. However, two or another even number of regular ITRs can be used. In some aspects, two ITR sequences are used.
(32) In various aspects, a nucleic acid comprising at least one AAV ITR can further comprise a nucleic acid sequence encoding at least one gene product of interest or transgene for expression in a mammalian cell, located such that it will be incorporated into an AAV genome replicated in the insect cell. Any nucleic acid can be incorporated for later expression in a mammalian cell transfected with the AAV produced in accordance with the present teachings. For example, the nucleic acid can encode a protein, express antisense RNA, or small interfering RNA (SiRNA). The protein can be a secretory protein, or a protein which will affect primarily the cell that is infected with the insect-produced AAV. In some aspects, a product of interest can be Rep78 or Rep68. Accordingly, in these aspects, a nucleotide sequence can comprise two nucleic acid sequences, each encoding one gene product of interest for expression in a mammalian cell. Each of the two nucleic acid sequences encoding a product of interest can be arranged such that it will be incorporated into an rAAV genome replicated in an insect cell.
(33) In various configurations, a product of interest can be a gene product which can be a polypeptide or an RNA molecule. Non-limiting examples of a polypeptide of interest include proteins such as an enzyme, a clotting factor, a peptide hormone or a fusion protein. Other examples of products of interest include a gene product which complements a genetic defect, an RNA molecule, or a transcription factor. For example, a gene product of interest can comprisise a nucleotide sequence that provides a regulatory function (e.g., a transposon). Examples of gene products of interest include, but are not limited to: hormone receptors (e.g., mineralcorticosteroid, glucocorticoid, and thyroid hormone receptors); intramembrane proteins (e.g., TM-1 and TM-7); intracellular receptors (e.g., orphans, retinoids, vitamin D3 and vitamin A receptors); signaling molecules (e.g., kinases, transcription factors, and signal transducers and activators of transcription receptors of the cytokine superfamily (e.g. erythropoietin, growth hormone, interferons, and interleukins, and colony-stimulating factors; G-protein coupled receptors, e.g., hormones, calcitonin, epinephrine, gastrin, and paracrine or autocrine mediators, such as stomatostatin or prostaglandins; neurotransmitter receptors (norepinephrine, dopamine, serotonin or acetylcholine); pathogenic antigens, which can be of viral, bacterial, allergenic, or cancerous origin; and ligands of tyrosine kinase receptors (such as insulin growth factor, and nerve growth factor).
(34) In various aspects, a gene product of interest can be a therapeutic gene product. A therapeutic gene product can be a polypeptide, RNA molecule, or other gene product that, when expressed in a target cell, provides a therapeutic effect, such as, for example, ablation of an infected cell (e.g., as described by Goldsmith et al., WO 90/07936), expression of a polypeptide having a therapeutic biological activity, and/or expression of an RNA molecule for antisense therapy (e.g., regulation of expression of a endogenous or heterologous gene in a target cell genome). For example, in a patient about to receive a heterologous transplant or graft, one may administer a polynucleotide encoding a toxin to T cells targeting the graft.
(35) An AAV protein can be a gene product of interest. For example, the sequence of a Rep protein, such as Rep78 or Rep68, or a functional fragment thereof can be a gene product of interest for expression in a mammalian cell. A nucleic acid sequence encoding Rep78 and/or Rep68, if present in a rAAV genome of the present teachings and expressed in a mammalian cell transduced with the rAAV produced in accordance with the present teachings, allows for integration of the rAAV into the genome of the transduced mammalian cell. Expression of Rep78 and/or Rep68 in an rAAV-transduced or infected mammalian cell can bestow an advantage for certain uses of the rAAV produced in an insect cell, such as allowing long term or permanent expression of any other gene product of interest introduced in the cell by the rAAV.
(36) A selectable marker is one type of a gene product of interest. Expression of a protein encoded by the selectable marker allows a host cell transfected with an expression vector which includes the selectable marker to be distinguished from a host cell which does not have the expression vector encoding the selectable marker. An example is a host cell which can use the selectable marker to survive a selection process that would otherwise kill the host cell, such as treatment with an antibiotic. Such a selectable marker can be one or more antibiotic resistance factors, such as neomycin resistance (e.g., neo), hygromycin resistance, and puromycin resistance. A selectable marker also can be a cell-surface marker, such as nerve growth factor receptor or truncated versions thereof. Cells that express the cell-surface marker then can be selected using an antibody targeted to the cell-surface marker. The antibody targeted to the cell surface marker can be directly labeled (e.g., with a fluorescent substrate) or can be detected using a secondary labeled antibody or substrate which binds to the antibody targeted to the cell-surface marker. Alternatively, cells can be negatively selected by using an enzyme, such as Herpes simplex virus thymidine kinase (HSVTK) that converts a pro-toxin (gancyclovir) into a toxin or bacterial Cytosine Deaminase (CD) which converts the pro-toxin 5-fluorocytosine (5-FC) into the toxin 5-fluorouracil (5-FU). Alternatively, any nucleic acid sequence encoding a polypeptide can be used as a selectable marker as long as the polypeptide is easily recognized by an antibody.
(37) A nucleic acid encoding a selectable marker can encode, for example, a beta-lactamase, a luciferase, a green fluorescent protein (GFP), a beta-galactosidase, or other reporter gene as that term is understood in the art, including cell-surface markers, such as CD4 or the truncated nerve growth factor (NGFR) (for GFP, see WO 96/23810; Heim et al., Current Biology 2:178-182 (1996); Heim et al., Proc. Natl. Acad. Sci. USA (1995); or Heim et al., Science 373:663-664 (1995); for beta-lactamase, see WO 96/30540). In some aspects, a selectable marker can be a beta-lactamase. The nucleic acid encoding a selectable marker can encode, for example, a fluorescent protein. A fluorescent protein can be detected by determining the amount of any quantitative fluorescent property, e.g., the amount of fluorescence at a particular wavelength, or the integral of fluorescence over an emission spectrum. Techniques for measuring fluorescence are well-known to persons of skill in the art.
(38) In various aspects, a nucleic acid for expression in the mammalian cell can be incorporated into the AAV genome produced in the insect cell if it is located between two regular ITRs, or is located on either side of an ITR engineered with two D regions.
(39) In various aspects, a nucleotide sequence encoding a gene product of interest for expression in a mammalian cell can be operably linked to at least one mammalian cell-compatible expression control sequence, e.g., a promoter. Many such promoters are known in the art. It will be understood by a skilled artisan that promoters of these aspects include those that are inducible, tissue-specific, and/or cell cycle-specific. For example, an E2F promoter can mediate tumor-selective, and, in particular, neurological cell tumor-selective expression in vivo by being de-repressed in such cells in vivo. Parr et al., Nat. Med. 3: 1145-1149 (1997). In addition, in some configurations, more than one expression control sequence can be operably linked to a given nucleotide sequence. For example, a promoter sequence, a translation initiation sequence, and a stop codon can be operably linked to a nucleotide sequence.
(40) Splice sites are sequences on a mRNA which facilitate the removal of parts of the mRNA sequences after the transcription (formation) of the mRNA. Typically, the splicing occurs in the nucleus, prior to mRNA transport into a cell's cytoplasm.
(41) In some aspects, an expression control sequence can share sequence identity with known expression control sequences. A determination of the degree of sequence identity of two nucleic acids sequences is a determination of the percentage of time a nucleotide, from among the four known natural nucleotides, exactly matches a counterpart on a second nucleotide sequence, i.e., a T matches a T, an A matches an A, a G matches a G, and a C matches a C. A sequence identity of at least 50%, 60%, 70%, 80%, 90% or more, can be considered to have substantial sequence similarity with an expression control sequence. In some aspects, sequence identity can be calculated between sequences without introduction of gaps in one or both of the sequences being compared.
(42) A skilled artisan will understand that in order to optimize the sequence similarity between two nucleotide sequences, gaps can be introduced in either or both of the two sequences. In some aspects, if gaps are introduced, only nucleotides of a first sequence which pair with a nucleotide in a second nucleotide sequence (whether or not there is a match) are used to calculate percentage homology. Algorithms that have worked out the rules of calculation of percentage homology are known. Examples of such programs include the SIM, GAP, NAP, LAP2, GAP2, ALIGN, BLAST, and PIPMAKER.
(43) For example, the ALIGN program produces an optimal alignment of two chosen protein or nucleic acid sequences using a modification of the dynamic programming algorithm described by Myers and Miller, CABIOS, 4, 11-17 (1988). Preferably, if available, the ALIGN program is used with weighted end-gaps. If gap opening and gap extension penalties are available, they are preferably set between about 5 to 15 and 0 to 3, respectively, more preferably about 12 and 0.5 to 2, respectively, for amino acid sequence alignments, and 10 to 20 and 3 to 5, respectively, more preferably about 16 and 4, respectively, for nucleic acid sequence alignments. The ALIGN program and principles underlying it are further described in, e.g., Pearson et al., Proc. Natl. Acad. Sci. USA, 85: 2444-48 (1988), and Pearson et al., Methods Enzymol. 183:63-98 (1990).
(44) The BLAST programs provide analysis of at least two amino acid or nucleotide sequences, either by aligning a selected sequence against multiple sequences in a database (e.g., GenSeq), or, with BL2SEQ, between two selected sequences. BLAST programs are preferably modified by low complexity filtering programs such as the DUST or SEG programs, which are preferably integrated into the BLAST program operations (see, e.g., Wooton et al., Compu. Chem., 17:149-63 (1993); Altschul et al., Nat. Genet., 6: 119-29 (1994); Hancock et al., Comput. Appl. Biosci., 10:67-70 (1994); and Wootton et al., Meth. in Enzym., 266:554-71 (1996)). If a lambda ratio is used, preferred settings for the ratio are between 0.75 and 0.95, more preferably between 0.8 and 0.9. If gap existence costs (or gap scores) are used, the gap existence cost preferably is set between about 5 and 15, more preferably about 10, and the per residue gap cost preferably is set between about 0 to 5, more preferably between 0 and 3 (e.g., 0.5). Similar gap parameters can be used with other programs as appropriate. The BLAST programs and principles underlying them are further described in, e.g., Altschul et al., J. Mol. Biol., 215: 403-10 (1990), Karlin and Altschul, Proc. Natl. Acad. Sci. USA, 87: 2264-68 (1990) (as modified by Karlin and Altschul, Proc. Natl. Acad. Sci. USA, 90: 5873-77 (1993)), and Altschul et al., Nucl. Acids Res., 25: 3389-3402 (1997).
(45) In some aspects of the methods disclosed herein, it is possible to use less than the four Rep enzymes, such as only one of the Rep78/Rep68 enzymes and only one of the Rep52/Rep40 enzymes, wherein both of the enzymes are expressed from the same single Rep coding sequence comprising the artificial intron. Since the AAV p5 and p19 promoters function poorly in insect cells, an insect cell-operable promoter, e.g., p10 or polh promoter, replaces the p5 and p19 promoters for Rep78/68 and Rep52/40. Becaue the p19 promoter is located in the Rep coding region, replacing p19 promoter with any other promoter changes the codons of Rep ORF and therefore the functions of Rep78/68 protein.
(46) Methods of the present teachings utilize an artificial intron that functions in insect cells and provides a method of inserting an insect cell-operable promoter into the p19 promoter area without changing the Rep78/68 coding sequence and functions, and makes it possible to express both Rep78 and Rep52 or Rep68 and Rep40 from a single expression cassette.
(47) In some aspects, the Rep coding sequence can comprise an artificial intron comprising the polh promoter (
(48) In some aspects, the present teachings disclose using an artificial intron to express all three Cap proteins (VP1, VP2, and VP3) from a single Cap coding nucleotide without mutating the AUG translation initiation codon of VP1 protein. In some configurations, an artificial intron is inserted between nucleotides 2227 and 2228 according to the AAV genome (AF043303) such that the VP2 and VP3 proteins can be synthesized from a polh promoter situated within the artificial intron, whereas the VP1 protein can be expressed from a polh promoter located upstream of the Cap coding sequence (
(49) In various aspects of the present teachings, variations of the artificial intron sequence can be used in the disclosed methods. In some configurations, a sequence with substantial sequence similarity to an artificial intron nucleotide sequence can be utilized. For example, a sequence of at least 60%, 70%, or 90% sequence identity to the artificial intron nucleotide sequence of SEQ ID NO: 1 can be introduced into a cassette such that both the Rep78 (or Rep68) and Rep52 (or Rep40), or all three Cap proteins (VP1, VP2, and VP3) can be expressed.
(50) In various aspects of the present teachings, an insect cell-compatible vector comprising at least one nucleotide sequences of the present teachings is provided. In some configurations, a vector can comprise an AAV Rep-encoding nucleotide sequence, and further comprise an artificial intron comprising an insect cell-operable promoter. In accordance with another configuration, an insect cell-compatible vector can comprise an AAV Cap-encoding nucleotide sequence, and further comprise an artificial intron of nucleotide sequence of SEQ ID NO:1 or a nucleotide sequence having substantial sequence identity with the sequence set forth as SEQ ID NO:1. In some configurations, the AAV capsid proteins VP1, VP2 and VP3 can be from AAV2.
(51) In various aspects of the present teaching, an insect cell is disclosed comprising at least one of a first nucleotide sequence, a second nucleotide sequence and a third nucleotide sequence. In these aspects, a first nucleotide sequence can comprise a first insect cell-operable promoter, a 5 portion of Rep-encoding nucleotide sequence, an artificial intron comprising a second insect cell-operable promoter, and a 3 portion of the Rep-encoding nucleotide sequence, wherein the first insect cell-operable promoter is operably linked to the 5 portion of the Rep-encoding nucleotide sequence and the second insect cell-operable promoter is operably linked to the 3 portion of the Rep-encoding nucleotide sequence. Furthermore, in these aspects, a second nucleotide sequence can comprise a third insect cel-operable promoter, a 5 portion of a Cap-encoding nucleotide sequence, an artificial intron comprising a fourth insect cell-operable promoter, and a 3 portion of the Cap-encoding nucleotide sequence, wherein the third promoter is operably linked to the 5 portion of the Cap-encoding nucleotide sequence and the fourth promoter is operably linked to the 3 portion of the Cap-encoding nucleotide sequence. In addition, an insect cell of these teachings can comprise a first nucleotide sequence comprising at least one AAV ITR nucleotide sequence.
(52) In some aspects of the present teachings, a nucleotide sequence comprised by an insect cell can comprise two AAV ITR nucleotide sequences and at least one nucleotide sequence encoding a gene product of interest or a transgene for expression in a mammalian cell between the two AAV ITR nucleotide sequences. In various configurations, at least one of the first, second, and third nucleotide sequences can be stably integrated in the insect cell.
(53) In another aspect, the present teachings provide a method of producing a parvoviral genome in an insect cell. In the method, as illustrated in
(54) In yet another aspect, the present teaching disclose methods of producing empty parvoviral particles in an insect cell. In these method, illustrated in
EXAMPLES
(55) Various aspects of the present teachings can be illustrated by the following non-limiting examples. The following examples are illustrative, and are not intended to limit the scope of the claims. The description of a composition or a method in an example does not imply that a described article or composition has, or has not, been produced, or that a described method has, or has not, been performed, except for results presented in past tense.
Example 1
(56) This example demonstrates that a single nucleic acid comprising a AAV2 Rep coding sequence and an artificial intron comprising the polh promoter can express both Rep78 and Rep52 proteins.
(57) In these experiments, an artificial intron comprising the polh promoter was designed using similar splicing donor and acceptor sequences as reported by Chisholm and Henner J Virol. 62(9):3193-3200 (1988). An artificial intron (SEQ ID NO:1) is inserted into the Rep78 sequence such that the Rep52 mRNA is transcribed from the polh promoter located inside the artificial intron, whereas the Rep78 pre-mRNA is transcribed from the p10 promoter located upstream from the Rep78 start codon. Upon removal by splicing of the artificial intron by the host cell, mature Rep78 mRNA is formed (
(58) TABLE-US-00001 (SEQIDNO:2) 5-CAGTGGGCGTGGACTAATATGGAACAGTATTTAAGGTAAGTACT CCCTATCAGTGATAG-3 (SEQIDNO:3) 5-AGATCTATCATGGAGATAATTAAAATGATAACCATCTCGCAAAT AAATAAGTATTTTACT-3 (SEQIDNO:4) 5-GTTTTCGTAACAGTTTTGTAATAAAAAAACCTATAAATATTCCG GATTATTCATACCGTC-3 (SEQIDNO:5) 5-CCACCATCGGGCGCGAAGGGGGAGACCTGTAGTCAGAGCCCCCG GGCAGCACACACTGAC-3 (SEQIDNO:6) 5-ATCCACTCCCTTCCTATTGTTTCAGCGCCTGTTTGAATCTCACG GAGCGTAAACGGTTGG-3 (SEQIDNO:7) 5-TGGCGCAGCATCTGACGCAC-3 (SEQIDNO:8) 5-GCGTCAGATGCTGCGCCACCAACCGTTTACGCTCCGTGAGATTC AAACAG-3 (SEQIDNO:9) 5-GCGCTGAAACAATAGGAAGGGAGTGGATGTCAGTGTGTGCTGCC CGGGGGCTCTGACTAC-3 (SEQIDNO:10) 5-AGGTCTCCCCCTTCGCGCCCGATGGTGGGACGGTATGAATAATC CGGAATATTTATAGGT-3 (SEQIDNO:11) 5-TTTTTTATTACAAAACTGTTACGAAAACAGTAAAATACTTATTT ATTTGCGAGATGGTTA-3 (SEQIDNO:12) 5-TCATTTTAATTATCTCCATGATAGATCTCTATCACTGATAGGGA GTACTTACCTTAAATA-3 (SEQIDNO:13) 5-CTGTTCCATATTAGTCCACGCCCACTGGAGCT-3
(59) The plasmid pFBD-inRep was used to transform DH10Bac competent cells and recombinant Bacmid DNA containing the Rep coding sequence was isolated and used to generate recombinant baculovirus Bac-inRep in Sf9 cells according to the manufacturer's protocol (Invitrogen, Carlsbad, Calif.). Sf9 cells were maintained at 28 C. in SF900 II SFM containing 100 units/ml of penicillin and 100 g/ml of streptomycin (Invitrogen, Carlsbad, Calif.).
(60) To express the Rep proteins, Sf9 cells were infected at a multiplicity of infection (m.o.i.) of 1 for 3 days at 28 C. and harvested by centrifugation at 2,000 rpm for 15 min. The cell pellets were lysed in NuPAGE LDS Sample Buffer (Invitrogen, Carlsbad, Calif.), boiled for 5 min, sonicated for 10 seconds. The lysates were subjected to SDS-polyacrylamide gel electrophoresis (SDS-PAGE). Proteins were transferred onto PVDF membrane and the Rep78 and Rep52 were detected by monoclonal antibody clone 303.9 (American Research Products; San Jose, Calif.). The results presented in
Example 2
(61) This example demonstrates that a single AAV2 Cap coding sequence comprising the artificial intron comprising the polh promoter can express VP1, VP2, and VP3 proteins.
(62) The ORF located at the right side of the wild-type AAV genome codes for three overlapping capsid proteins, VP1, VP2, and VP3. In mammalian cells, these capsid proteins are synthesized from two spliced mRNAs arising from the p40 promoter. One message is translated into VP1, while another transcript encodes VP2 and VP3. The naturally occurring initiation codon for VP2 is ACG, which is poorly utilized, resulting in ribosome scanning through to the VP3 initiation codon (AUG). The alternate usage of two splice acceptor sites and the poor utilization of ACG initiation codon for VP2 are responsible for the stoichiometry of VP1, VP2, and VP3 in AAV2-infected mammalian cells and mirrors the protein ratio in the capsids, 1:1:10. The AAV cap intron is not spliced in insect cells.
(63) In order to express all three capsid proteins from a single coding sequence and preserve the native AUG start codon for VP1 protein, the same artificial intron as described in Example 1 above was used. It was inserted in the Cap coding sequence between nucleotides 2227 and 2228 according to the AAV genome (AF043303) wherein the sequence of nucleotides 2221-2230 is cttccagatt (SEQ ID NO: 26). First the plasmid pAAV-RC was digested with BamHI and EcoNI to isolate the backbone 4969 bp-fragment. The artificial intron was then amplified from pAAV-inRep using primers 5-GCGCGGATCCT GTTAAGATGGCTGCCGATGGTTATCTTCCAGGTAAGTACTCCCTATCAGTGATA GAG-3 (SEQ ID NO:16) and 5-ATATCGTCTCGCTGAAACAATAGGA AGGGAGTGGAT-3 (SEQ ID NO:17). The primer SEQ ID NO: 16 contains a BamHI site and the first 25 nucleotides of VP1 coding sequence (ATGGCTGCCGATGGTTATCTTCCAG, SEQ ID NO: 27) and the primer SEQ ID NO: 17 contains a BsmBI site. The PCR product was then digested with BamHI and BsmBI. A second PCR fragment was amplified from pAAV-RC using primers 5-AATTCGTCTCGTCAGATTGGCTCGAGGACACTCTCTCTGA-3 (SEQ ID NO:18) and 5-TCCCGGAGCCGTCTTAACAG-3 (SEQ ID NO:19) and digested with restriction enzymes BsmBI and EcoNI. The backbone fragment was ligated with the two PCR fragments to create pAAV-inCap. The entire Cap coding sequence comprising the artificial intron was then digested with BamHI and SnaBI and ligated to the BamHI and HindIII (blunted by Klenow) sites of pFastBacDual plasmid to create plasmid pFBD-inCap (
Example 3
(64) This example demonstrates that by using the same design of artificial intron, VP1, VP2, and VP3 proteins can be expressed from AAV8, AAV6, and AAV1 serotypes.
(65) The same artificial intron as used in examples supra was inserted into the Cap coding sequence of AAV serotype 8 between nucleotides 2145 and 2146 (accession no. NC_006261) wherein the nucleotide sequence 2141-2150 is tccagattgg (SEQ ID NO: 28), AAV serotype 6 between nucleotides 2232 and 2233 (accession no. NC_001862), wherein nucleotide sequence 2231-2240 is agattggctc (SEQ ID NO: 32), and AAV serotype 1 between nucleotides 2247 and 2248 (accession no. NC_002077), wherein nucleotide sequence 2241-2250 is cttccagatt (SEQ ID NO: 29, see Example 2). To construct pFBD-inCap8 and pFBD-inCap6, the artificial intron was amplified by PCR from pFBD-inCap using primers 5-ATGCCCTCAGAGAGGTTGTCCTCGAGCCAATCTGAAACAAT-3 (SEQ ID NO:21) and 5-CCCGGTACCGCATGCTATGC-3 (SEQ ID NO:22). The amplification product was digested with EcoNI and SphI, and the digested product was ligated to the EcoNI and SphI sites of pFBD-Cap8 and pFBD-Cap6 to create pFBD-inCap8 (
Example 4
(66) This example demonstrates that rAAV can be produced in insect cells by using the AAV Rep and Cap coding sequences, each comprising an artificial intron.
(67) In these experiments, Sf9 cells were grown at 28 C. to about 10.sup.7 cells/ml in SF900 II SFM media containing 100 units/ml of penicillin and 100 g/ml streptomycin, and diluted to about 510.sup.6 cells/ml prior to infection. Triple infection was employed to produce rAAV. A m.o.i. of 1 of each Bac-inRep, Bac-GFP (or Bac-RFP), and Bac-inCap was used to infect the Sf9 cells at 28 C. for 3 days to produce AAV type 2 vectors. For AAV type 1, 6, and 8 vector production, Bac-inCap was simply substituted by Bac-inCap1, Bac-inCap6, and Bac-inCap8, respectively in the triple infection. After 3 days of infection, cell pellets were collected by centrifugation at 2,000 rpm for 15 min in a tabletop centrifuge. The cell pellets were lysed in lysis buffer as described by Urabe et al., Hum Gene Ther. 1; 13 (16):1935-43 (2002) and cellular nucleic acids (DNA and RNA) were digested by benzonase (Sigma, St. Louis, Mo.). The cell lysates were cleared by centrifugation at 8,000 rpm for 30 min in an Avanti J-25 centrifuge (Backman, Fullerton, Calif.) and then loaded onto an SW28 centrifuge tube containing 5 ml of 1.55 g/cc, and 10 ml of 1.32 g/cc of CsCl solutions. After centrifugation at 28,000 rpm for about 16 hours at 15 C., the rAAV-containing fraction was collected by puncturing the centrifuge tube using a syringe needle and subjected to a second round of CsCl ultracentrifugation. The rAAV-containing fraction was collected again by puncturing the centrifuge tube using a syringe needle and dialyzed in PBS buffer to remove the salts and detergents. Vector titers were determined by quantitative real-time PCR assay according to manufacturer's protocol (Applied Biosystems, Foster City, Calif.). The results, presented in Table 1, show that high titers of rAAV vectors can be produced in Sf9 cells using the recombinant baculoviruses that carry the Rep and Cap coding sequences comprising the artificial intron, respectively.
(68) TABLE-US-00002 TABLE 1 AAV vector genome yields in Sf9 cells as determined by quantitative RT-PCR Experiment Serotype & Yield No. Transgene (vector genome/liter of Sf9 culture) 1 AAV2-GFP 1.56 10.sup.14 2 AAV2-RFP 1.58 10.sup.14 3 AAV2-GFP 9.77 10.sup.13 4 AAV6-GFP 3.53 10.sup.13 5 AAV8-GFP 9.65 10.sup.13 6 AAV1-GFP 4.36 10.sup.13 7 AAV1-GFP 4.47 10.sup.13
Example 5
(69) This example demonstrates the production of rAAV in insect cells using the two-vector system.
(70) The Rep and Cap coding sequence each comprising the artificial intron were cloned together using standard cloning techniques into a single baculovirus as shown in
(71) TABLE-US-00003 TABLE 2 AAV vector genome yields in Sf9 cells as determined by quantitative RT-PCR Experiment Serotype & Yield No. Transgene (vector genome/liter of Sf9 culture) 1 AAV2-GFP 1.33 10.sup.14 2 AAV2-GFP 1.06 10.sup.14
Example 6
(72) This example demonstrates that VP1, VP2, and VP3 proteins are properly packaged in virions by using AAV Cap coding sequences comprising the artificial intron.
(73) In these experiments, purified AAV2, AAV6, and AAV8 vectors, each at 10.sup.10 vector genomes, were boiled in NuPAGE LDS Sample Buffer for 5 min. Proteins were resolved by SDS-PAGE and transferred to PVDF membrane. The VP1, VP2, and VP3 proteins were detected by monoclonal antibody B1 clone as described in Example 2. The results demonstrate that by using the Cap coding sequences comprising the artificial intron, all three capsid proteins can be properly packaged into virions.
Example 7
(74) This example illustrates that AAV vectors produced in the insect cells using the Rep and Cap coding sequences comprising the artificial intron are infectious and can deliver genes to target cells.
(75) In these experiments, AAV2-GFP and AAV6-GFP were used to transduce HepG2 hepatocellular carcinoma cells (American Type Culture Collection, Manassas, Va.) to show the infectivity of the vectors produced in insect cells. HepG2 cells were grown at 37 C. in MEM medium (ATCC) supplemented with 10% fetal bovine serum (Hyclone, Logan, Utah) and 100 units/ml of penicillin and 100 g/ml of streptomycin (Invitrogen, Carlsbad, Calif.). HepG2 cells at 1.510.sup.5 cells/well were seeded in 24-well plate and grown overnight at 37 C. in a CO.sub.2 incubator. AAV vectors were diluted to 1.210.sup.9 vg/ml, 1.210.sup.8 vg/ml, 1.210.sup.7 vg/ml, and 1.210.sup.6 vg/ml in the culture medium without serum but containing 20 M of etoposide (A.G. Scientific, Inc., San Diego, Calif.). Old media were removed from the cells and 500 l of diluted AAV vectors were added to each well. Two days after transduction, GFP expressing cells were scored and photographed. The results show that HepG2 cells were efficiently transduced both by AAV2-GFP and AAV6-GFP vectors.
Example 8
(76) This example illustrates that nucleic acid sequences of the present teachings comprising Rep- or Cap-encoding sequences and an artificial intron are stable in a baculovirus.
(77) To demonstrate the stability of baculoviruses comprising the Rep and Cap coding sequences respectively, the baculoviruses were plaque purified and subsequently passaged for 5 times, and Rep and Cap protein expression was assayed. The plaque purification was performed as follows: Sf9 cells at 110.sup.6 cells/well were seeded in 6-well plate and incubated at 28 C. for 30 min. The baculoviruses were diluted to 100, 50, and 25 pfu/100 l. Old media were removed from the cells and the diluted baculoviruses were added to infect the cells for 20 min at 28 C. Agarose in DPBS at 1% was melted, cool to 37 C., and mixed with 1 volume of SF900II SFM at 37 C., and 1.5 ml of the agarose-SF900II SFM overlay was added to each well. When the agarose solidified, 1.5 ml of SF900II SFM was added to each well and the plates were incubated at 28 C. for 6 days to let plaques form. By the end of incubation, 6 plaques from Bac-inCap and 12 plaques from Bac-inRep were picked and transferred to microfuge tubes containing 500 l SF900II SFM media. Sf9 cells in 6-well plates were infected with 100 l of each plaque for 4 days. The cells were collected for Western blot analysis and the supernatants were collected and 3 l of the supernatants were used to infect Sf9 cells in 6-well plates. This procedure was repeated for 4 more times until passage 5. The results show that all the plaques picked through 5 passages express the Rep78 and Rep52 or the VP1, VP2, and VP3 proteins as expected, with no apparent loss of protein expression.
Example 9
(78) This example demonstrates expression in an insect cell of multiple SV40 VP proteins from a single expression cassette comprising multiple introns.
(79) Simian virus 40 (SV40) is a double-stranded DNA virus with a covalently closed circular genome of 5.2 kb, and has been sequenced in its entirety (Fiers, W., et al., Nature 273: 113-120, 1978). The sequence is available on the internet at http://www.ncbi.nlm.nih.gov/entrez/viewer.
(80) fcgi?db=nuccore&id=9628421, accession no. NC_001669. In mammalian cells, its three capsid proteins, VP1, VP2, and VP3 are all transcribed from the same SV40 promoter and expression of these VP proteins is controlled by mechanism of intron splicing. The VP3 protein is a truncated form of the VP2 protein and the 5 portion the sequence encoding the VP1 protein is overlapping with the 3 portion of VP2 and VP3 but does not share the same ORF.
(81) Artificial introns can be used to express SV40 capsid proteins in insect cells. To drive VP3 expression, an artificial intron comprising a polh promoter is inserted into the SV40 genome between nucleotides 913 and 914 wherein the sequence of nucleotides 911-920 is caggaatggc (SEQ ID NO: 30). To drive VP1 expression, an artificial intron comprising the same polh promoter is inserted between nucleotides 1462 and 1463 wherein the sequence of nucleotides 1461-1470 is aggcctgtac (SEQ ID NO: 31). The VP2 protein is expressed from the polh promoter operably linked to the VP2 gene (
(82) All publications and patent applications cited in this specification are herein incorporated by reference as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference. Although the foregoing teachings have been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to those of ordinary skill in the art in light of the teachings that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.
REFERENCES
(83) 1. Berns, K. I., Parvoviridae: The Viruses and Their Replication, Chapter 69 in Fields Virology (3d Ed. 1996). 2. Choi et al., Curr. Gene Ther., June; 5 (3):299-310 (2005). 3. Tratschin et al., Mol. Cell Biol., 5 (11):3251-3260 (1985). 4. Grimm et al., Hum. Gene Ther., 10 (15):2445-2450 (1999). 5. Jennings et al., Arthritis Res, 3:1 (2001). 6. Davidson et al., Proc. Natl. Acad. Sci. USA, 97 (7):3428-3432 (2000). 7. Urabi et al., J Virol., 80 (4):1874-85 (2006). 8. Kohlbrenner et al., Mol. Ther., 12 (6):1217-25 (2005). 9. Chao et al., Mol. Ther. 2:619 (2000). 10. Chiorini et al., J. Virol. 73:1309 (1999). 11. Xiao et al., J. Virol. 73:3994 (1999). 12. Muramatsu et al., Virology 221:208 (1996). 13. Chiorini et al., J. Vir. 71: 6823-33 (1997). 14. Srivastava et al., J. Vir. 45:555-64 (1983). 15. Chiorini et al., J. Vir. 73:1309-1319 (1999). 16. Rutledge et al., J. Vir. 72:309-319 (1998). 17. Wu et al., J. Vir. 74: 8635-47 (2000). 18. Samulski et al., J. Vir. 63:3822-8 (1989). 19. Kajigaya et al., Proc. Nat'l. Acad. Sci. USA 88: 4646-50 (1991). 20. Ruffing et al., J. Vir. 66:6922-30 (1992) 21. Kimbauer et al., Vir. 219:37-44 (1996). 22. Zhao et al., Vir. 272:382-93 (2000). 23. Chisholm and Henner, J. Virol., 62(9):3193-3200 (1988).
U.S. PATENT DOCUMENTS
(84) U.S. Pat. No. 5,387,484 A February 1995 Doany U.S. Pat. No. 5,688,676 A November 1997 Zhou et al. U.S. Pat. No. 5,691,176 A November 1997 Lebkowski et al. U.S. Pat. No. 5,741,683 A April 1998 Russell et al. U.S. Pat. No. 6,204,059 B1 March 2001 Samulski et al. 2002/0081721 A1 June 2002 Allen et al. U.S. Pat. No. 6,723,551 B2 April 2004 Kotin, et al 2006/0166363 A1 July 2006 Zolotukhin et al.