METHOD FOR IDENTIFYING M1 GENERATION PLANT MUTANTS RESULTING FROM PHYSICAL AND CHEMICAL MUTAGENESIS AND FOR ACQUIRING MUTANT, IDENTIFICATION OF GENOTYPING PRIMER FOR ORYZA SATIVA MUTATION, MUTANT GENE, AND USE THEREOF
20220348913 · 2022-11-03
Inventors
- Bingran Zhao (Changsha, Hunan, CN)
- Ye Shao (Changsha, Hunan, CN)
- Bigang Mao (Changsha, Hunan, CN)
- Li Tang (Changsha, Hunan, CN)
- Yan Peng (Changsha, Hunan, CN)
- Yuanyi Hu (Changsha, Hunan, CN)
- Wenjian Li (Changsha, Hunan, CN)
- Lixia Yu (Changsha, Hunan, CN)
- Yan Du (Changsha, Hunan, CN)
- Yaokui Li (Changsha, Hunan, CN)
- Dan Zhang (Changsha, Hunan, CN)
- Lianyang Bai (Changsha, Hunan, CN)
- Longping Yuan (Changsha, Hunan, CN)
Cpc classification
C12Q1/6848
CHEMISTRY; METALLURGY
C12N15/111
CHEMISTRY; METALLURGY
International classification
C12N15/11
CHEMISTRY; METALLURGY
C12Q1/6848
CHEMISTRY; METALLURGY
Abstract
The present disclosure discloses a method for identifying a M1 generation plant mutant resulting from physical and chemical mutagenesis, a method for acquiring the plant mutant, a mutant gene, and use thereof. The method for identifying a M1 generation plant mutant resulting from physical and chemical mutagenesis includes: mutagenizing a plant to obtain an M1 generation plant mutant, extracting a mixed pool of DNA from the obtained M1 generation plant mutant, subjecting the mixed pool of DNA to high-depth targeted sequencing for a target gene region, and aligning a sequencing result with the target gene region to identify whether there are target single nucleotide polymorphisms (SNPs) and/or Indel. The method of the present disclosure has high efficiency and high accuracy, involves simple operations, and is of progressive significance for the identification and acquisition of innovative germplasms.
Claims
1. A method for high-throughput targeted identification of an M1 generation plant mutant resulting from physical and chemical mutagenesis, comprising the following steps: a) mutagenizing plants by the physical and chemical mutagenesis at a non-lethal dose to obtain an M1 generation plant material; b) planting each individual plant in the M1 generation plant material independently, collecting leaves from each planted individual plant, and mixing leaves collected from an individual plant; c) extracting a mixed pool of DNA from a mixed leaf material; d) subjecting the mixed pool of DNA to high-depth targeted sequencing for a target gene region; and e) aligning a high-depth targeted sequencing result with a related sequence of the target gene region to identify whether a population DNA sample in the high-depth targeted sequencing result comprises target single nucleotide polymorphisms (SNPs) and/or Indels of the target gene region.
2. The method according to claim 1, wherein after the identification in step e) is completed, the method further comprises using one or more verification modes to verify an identification result, such as to determine whether the sample comprises the target SNPs and/or Indels of the target gene region; and the verification mode specifically comprises: e.sub.1: testing all plants by a digital polymerase chain reaction (dPCR) identification mode for verification; e.sub.2: genotyping each individual plant by a Kompetitive Allele Specific PCR (KASP) genotyping mode for verification; and e.sub.3: verifying each individual plant by a Sanger sequencing mode.
3. The method according to claim 2, wherein the verification mode comprises the following two steps: 1) detecting population DNA in the high-depth targeted sequencing result by the dPCR identification mode to identify whether the population DNA sample comprises target SNPs and/or Indels of the target gene region, and if so, proceeding to step 2), otherwise, finishing; and 2) based on SNP and/or Indel loci identified by dPCR, designing a KASP genotyping primer, and subjecting each individual plant in a population corresponding to a mixed pool sample of the plant mutant to KASP genotyping to finally determine whether there is a chimeric individual plant with a mutation in the target gene region.
4. The method according to claim 3, wherein the related sequence of the target gene region is a gene sequence of Oryza sativa OsNramp5 gene, there is a 18 bp deletion of [CTACGTGGCAATTCACA (SEQ ID NO: 28)/−] at 8875646-8875663 from a junction between intron 8 and exon 9 of the OsNramp5 gene, and the KASP genotyping primer comprises the following sequences: TABLE-US-00013 FAM (SEQ ID NO: 1) 5’-GAAGGTGACCAAGTTCATGCTGAAGAACCTGCACCCGTCCT-3’, HEX (SEQ ID NO: 2) 5-’GAAGGTCGGAGTCAACGGATTGAAGAACCTGCACCCGTCAC-’3, and COMMON (SEQ ID NO: 3) 5’-GCATGGAAAGAAACTGAACAAAGAT-3’.
5. The method according to claim 3, wherein the related sequence of the target gene region is a gene sequence of Oryza sativa OsRR22 gene, there is a 1 bp deletion of [G/−] at 4138902 in exon 3 of the OsRR22 gene, and the KASP genotyping primer comprises the following sequences: TABLE-US-00014 FAM (SEQ ID NO: 4) 5’-GAAGGTGACCAAGTTCATGCTCAGGCACCATGAGTTATCCCT-3’, HEX (SEQ ID NO: 5) 5’-GAAGGTCGGAGTCAACGGATTCAGGCACCATGAGTTATCCCC-3’, and COMMON (SEQ ID NO: 6) 5’-’TGTTATCAGTAAATGGAGAGACAAAGAC-3’.
6. The method according to claim 3, wherein the related sequence of the target gene region is a gene sequence of Oryza sativa OsRR22 gene, there is a 7 bp deletion of [CGGCTTT/−] at 4140861-4140867 in exon 5 of the OsRR22 gene, and the KASP genotyping primer comprises the following sequences: TABLE-US-00015 FAM (SEQ ID NO: 7) 5-’GAAGGTGACCAAGTTCATGCTGCAAGCTCCTGAAGTCCGAA-’3 (SEQ ID NO: 7), HEX (SEQ ID NO: 8) 5’-GAAGGTCGGAGTCAACGGATTCAAGCTCCTGAAGTCCGCG-3’, and COMMON (SEQ ID NO: 9) 5’-TTCTGCTGCTCTTCCATCTTTCA-3’.
7. The method according to claim 1, wherein the non-lethal dose in step a) refers to controlling a dose within a range of 20% higher and lower a median-lethal dose.
8. The method according to claim 1, wherein the physical and chemical mutagenesis in step a) comprises one or two selected from the group consisting of physical mutagenesis and chemical mutagenesis; the physical mutagenesis comprises ultraviolet (UV) mutagenesis, X-ray mutagenesis, γ-ray mutagenesis, β-ray mutagenesis, α-ray mutagenesis, high-energy particle mutagenesis, cosmic ray mutagenesis, and microgravity mutagenesis; the chemical mutagenesis comprises alkylating agent mutagenesis, azide mutagenesis, base analog mutagenesis, lithium chloride mutagenesis, antibiotic mutagenesis, and intercalative dye mutagenesis; and the alkylating agent mutagenesis comprises ethyl methanesulfonate (EMS) mutagenesis, diethyl sulfate (DES) mutagenesis, and ethyleneimine (EI) mutagenesis.
9. The method according to claim 1, wherein in step b), when each individual plant in the M1 generation plant material is planted independently, an arbitrary number of plants are clustered as a population, and each population is numbered; and in step c), leaves of each population are mixed in a centrifuge tube for DNA extraction.
10. The method according to claim 9, wherein the population comprises 48, 96, or 192 plants; during the leaf collection, leaves are collected from different parts of a same individual plant at a same amount; and in step d), a sequencing depth of the high-depth targeted sequencing for a single population with 48 plants is greater than 2,000×, a sequencing depth of the high-depth targeted sequencing for a single population with 96 plants is greater than 5,000×, and a sequencing depth of the high-depth targeted sequencing for a single population with 192 plants is greater than 10,000×.
11. The method according claim 1, wherein in step d), the target gene region comprises an exon region of a target gene or a non-coding region of the target gene; the high-depth targeted sequencing comprises multiplex PCR-based targeted capture technology, liquid-phase probe hybridization capture-based targeted capture technology, or third-generation sequencing-based single-molecule targeted sequencing technology; and a sequencing depth of the high-depth targeted sequencing is determined according to a number of individual plants in each population.
12. The method according to claim 1, wherein the target gene is the Oryza sativa OsNramp5 gene or the Oryza sativa OsRR22 gene.
13. The method according to claim 1, wherein on the basis of identifying a chimeric individual plant with a mutation of a target gene region by the method, the method further comprises the following steps to obtain a mutant: f) for each chimeric individual plant with the mutation of the target gene region, extracting DNA of leaves corresponding to each ear for DNA identification, selecting an ear with the mutation, and mixed-collecting seeds; and g) mixed-sowing seeds obtained from the mixed-collecting, and collecting leaves from each individual plant independently for DNA identification to finally obtain an M2 individual plant with a target genetic phenotype.
14. The method according to claim 13, wherein the chimeric individual plant with the mutation of the target gene region refers to a chimeric individual plant with the Oryza sativa OsNramp5.sup.−18 mutant gene, the Oryza sativa OsRR22.sup.−1 mutant gene, or the Oryza sativa OsRR22.sup.−7 mutant gene; compared with the OsNramp5 gene sequence of Nipponbare, the Oryza sativa OsNramp5.sup.−18 mutant gene comprises a 18 bp deletion of [CTACGTGGCAATTCACA (SEQ ID NO: 28)/−] at 8875646-8875663 (RAP_Locus) in exon 9; compared with the OsRR22 gene sequence of Nipponbare, the Oryza sativa OsRR22.sup.−1 mutant gene comprises a 1 bp deletion of [G/−] at 4138902 (RAP_Locus) in exon 3 of the OsRR22 gene; and compared with the OsRR22 gene sequence of Nipponbare, the Oryza sativa OsRR22.sup.−7 mutant gene comprises a 7 bp deletion of [CGGCTTT/−] at 4140861-4140867 (RAP_Locus) in exon 5.
15. The method according to claim 13, wherein in step f), the DNA identification refers to identification with a designed KASP genotyping primer; and in step g), the DNA identification refers to identification with a designed KASP genotyping primer.
16. An Oryza sativa mutant gene obtained in the identification of an M1 generation Oryza sativa mutant resulting from physical and chemical mutagenesis by the method according to claim 12, wherein the Oryza sativa mutant gene is an Oryza sativa OsNramp5.sup.−18 mutant gene, an Oryza sativa OsRR22.sup.−1 mutant gene, or an Oryza sativa OsRR22.sup.−7 mutant gene; compared with the OsNramp5 gene sequence of Nipponbare, the Oryza sativa OsNramp5.sup.−18 mutant gene comprises a 18 bp deletion of [CCTACGTGGCAATTCACA (SEQ ID NO: 28)/−] at 8875646-8875663 (RAP_Locus) in exon 9; compared with theOsRR22 gene sequence of Nipponbare, the Oryza sativa OsRR22.sup.−1 mutant gene comprises a 1 bp deletion of [G/−] at 4138902 (RAP_Locus) in exon 3 of the OsRR22 gene; and compared with the OsRR22 gene sequence of Nipponbare, the Oryza sativa OsRR22.sup.−7 mutant gene comprises a 7 bp deletion of [CGGCTTT/−] at 4140861-4140867 (RAP_Locus) in exon 5.
17. The Oryza sativa mutant gene according to claim 16, wherein the Oryza sativa OsNramp5.sup.−18 mutant gene has a nucleotide sequence shown in SEQ ID NO: 19, or a truncated sequence of the nucleotide sequence, or a specific sequence that has 95% or more homology with the nucleotide sequence and encodes the same functional protein as the nucleotide sequence; the Oryza sativa OsRR22.sup.−1 mutant gene has a nucleotide sequence shown in SEQ ID NO: 20, or a truncated sequence of the nucleotide sequence, or a specific sequence that has 95% or more homology with the nucleotide sequence and encodes the same functional protein as the nucleotide sequence; and the Oryza sativa OsRR22.sup.−7 mutant gene has a nucleotide sequence shown in SEQ ID NO: 21, or a truncated sequence of the nucleotide sequence, or a specific sequence that has 95% or more homology with the nucleotide sequence and encodes the same functional protein as the nucleotide sequence.
18. Use of the Oryza sativa mutant gene according to claim 16 in molecular marker-assisted breeding (MAB) of a crop.
19. The use according to claim 18, wherein when the Oryza sativa mutant gene is the Oryza sativa OsNramp5.sup.−18 mutant gene, the Oryza sativa OsNramp5.sup.−18 mutant gene or a mutant carrying the Oryza sativa OsNramp5.sup.−18 mutant gene is used in the selective breeding or preparation of an Oryza sativa variety with a low-cadmium-absorption phenotype; and when the Oryza sativa mutant gene is the Oryza sativa OsRR22.sup.−1 mutant gene or the Oryza sativa OsRR22.sup.−7 mutant gene, the Oryza sativa OsRR22.sup.−1 or OsRR22.sup.−7 mutant gene or a mutant carrying the Oryza sativa OsRR22.sup.−1 or OsRR22.sup.−7 mutant gene is used in the selective breeding or preparation of an Oryza sativa variety with a salt-tolerant phenotype.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0067] To describe the technical solutions in examples of the present disclosure or in the prior art more clearly, the accompanying drawings required for describing the examples or the prior art will be briefly described below. Apparently, the accompanying drawings in the following description show some examples of the present disclosure, and a person of ordinary skill in the art may still derive other drawings from these accompanying drawings without creative efforts.
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
DETAILED DESCRIPTION OF THE EMBODIMENTS
[0077] In order to facilitate the understanding of the present disclosure, the present disclosure is described in detail below in conjunction with the accompanying drawings of the specification and the preferred examples, but the protection scope of the present disclosure is not limited to the following specific examples.
[0078] Unless otherwise defined, all technical terms used hereinafter have the same meaning as commonly understood by those skilled in the art. The technical terms used herein are merely for the purpose of describing specific examples, and are not intended to limit the protection scope of the present disclosure.
[0079] Unless otherwise specified, various raw materials, reagents, instruments, equipment, and the like used in the present disclosure can be purchased from the market or can be prepared by existing methods.
Example 1
[0080] A method for high-throughput targeted identification of an M1 generation plant mutant resulting from physical and chemical mutagenesis and for acquisition of the mutant as shown in
[0081] 1. 20,000 seeds of the Oryza sativa variety 638S (hereinafter referred to as 638S) were irradiated with 80 MeV/u carbon ions (.sup.12C.sup.6+) at a dose of 180 Gy to obtain an M1 generation of the Oryza sativa variety 638S.
[0082] 2. Seedlings were cultivated using the 20,000 638S M1 generation seeds, and then each individual seedling was planted independently. 96 plants, as a population, were planted in 8 rows, with 12 plants in each row. 100 populations, a total of 9,600 plants, were planted and numbered 1 to 100.
[0083] 3. With each population as a unit, leaves were collected from each individual plant at an equal amount, and a total of 96 leaf samples were mixed in a centrifuge tube for DNA extraction. A total of 100 DNA samples were extracted and then numbered corresponding to the population numbers of 1 to 100.
[0084] 4. With DNA of each population as a sequencing sample, targeted high-depth sequencing was conducted for exon regions of the OsNramp5 (0507g0257200) and OsRR22 (0506g0183100) genes at a sequencing depth of >5,000×.
[0085] 5. The high-depth targeted sequencing data were aligned with a Nipponbare sequence to obtain the SNP and Indel data of the exons of the OsNramp5 and OsRR22 genes in the 100 samples. According to test results, it was found that sample 32 had an 18 bp deletion of [CCTACGTGGCAATTCACA (SEQ ID NO: 28)/−] at 8875646-8875663 (RAP_Locus) of the OsNramp5 gene, in which 1 bp was at a junction between intron 8 and exon 9; according to test results, it was also found that sample 26 had a 1 bp deletion of [G/−] at 4138902 (RAP_Locus) of the OsRR22 gene, which was located in exon 3; and according to test results, it was also found that sample 34 had a 7 bp deletion of [CGGCTTT/−] at 4140861-4140867 (RAP_Locus) of the OsRR22 gene, which was located in exon 5.
[0086] 6. The Indels in the sequencing data of the above population samples 32, 26, and 34 were verified by the dPCR technology. Verification results showed that the deletion mutation genotypes in the targeted sequencing data were present in the three samples, respectively.
[0087] 7. According to the deletion mutation genotypes in the DNA of the population samples 32, 26, and 34, the following KASP genotyping primers were designed (which were produced by Beijing Tsingke Biotechnology Co., Ltd.):
[0088] 32FAM 5′-GAAGGTGACCAAGTTCATGCTGAAGAACCTGCACCCGTCCT-3′ (as shown in SEQ ID NO: 1, in which an underlined part represents a fluorescent tag primer);
[0089] 32HEX 5′-GAAGGTCGGAGTCAACGGATTGAAGAACCTGCACCCGTCAC-3′ (as shown in SEQ ID NO: 2, in which an underlined part represents a fluorescent tag primer);
[0090] 32COMMON 5′-GCATGGAAAGAAACTGAACAAAGAT-3′ (as shown in SEQ ID NO: 3);
[0091] 26FAM 5′-GAAGGTGACCAAGTTCATGCTCAGGCACCATGAGTTATCCCT-3′ (as shown in SEQ ID NO: 4, in which an underlined part represents a fluorescent tag primer);
[0092] 26HEX 5′-GAAGGTCGGAGTCAACGGATTCAGGCACCATGAGTTATCCCC-3′ (as shown in SEQ ID NO: 5, in which an underlined part represents a fluorescent tag primer);
[0093] 26COMMON 5′-TGTTATCAGTAAATGGAGAGACAAAGAC-3′ (as shown in SEQ ID NO: 6);
[0094] 34FAM 5′-GAAGGTGACCAAGTTCATGCTGCAAGCTCCTGAAGTCCGAA-3′ (as shown in SEQ ID NO: 7, in which an underlined part represents a fluorescent tag primer);
[0095] 34HEX 5′-GAAGGTCGGAGTCAACGGATTCAAGCTCCTGAAGTCCGCG-3′ (as shown in SEQ ID NO: 8, in which an underlined part represents a fluorescent tag primer); and
[0096] 34COMMON 5′-TTCTGCTGCTCTTCCATCTTTCA-3′ (as shown in SEQ ID NO: 9).
[0097] 8. The KASP genotyping primers for the 3 deletion mutation loci were used to genotype the 96×3=288 individual plants in the populations 32, 26, and 34. According to genotyping results, it was found that the 5th plant in row 4 of the population 32 (32-D-5) had an 18 bp deletion genotype of [CCTACGTGGCAATTCACA (SEQ ID NO: 28)/−] in exon 9 of the OsNramp5 gene (as shown in
[0098] The use of the KASP genotyping primers for the deletion mutation loci to genotype the 96×3=288 individual plants in the populations 32, 26, and 34 was specifically as follows:
[0099] (1) extraction of Oryza sativa leaf DNA by the cetyltrimethylammonium bromide (CTAB) method;
[0100] (2) 5 μl of a KASP genotyping system:
TABLE-US-00007 FAM-X 10 μM 0.15 μl HEX-Y 10 μM 0.15 μl COMMON 10 μM 0.3 μl KASP MIX 2.5 μl sample DNA 10 ng to 100 ng H.sub.2O making up to 5 μl;
[0101] (3) PCR reaction procedure
TABLE-US-00008 94° C. 10 min 94° C. 20 s ] 10× 65° C. to 0.8° C./cycle 1 min 94° C. 20 s ] 30× 57° C. 1 min 4° C. ∞.
[0102] 9. DNA was extracted from leaves corresponding to each ear on each of the individual plants 32-D-5, 26-A-7, and 34-C-6, and a sequencing test was conducted for the Indel mutation in each individual plant. It was found that 3 ears on the individual plant 32-D-5 had the mutation genotype (as shown in SEQ ID NO: 19) of [CTACGTGGCAATTCACA (SEQ ID NO: 28)/−], 2 ears on the individual plant 26−A-7 had the mutation genotype of [G/−] (as shown in SEQ ID NO: 20), and 4 ears on the individual plant 34-C-6 had the mutation genotype (as shown in SEQ ID NO: 21) of [GGCTTT/−]. With each individual plant as a unit, seeds of ears with the mutation genotype were mixed-collected.
[0103] 10. Seeds of each of 32-D-5, 26-A-7, and 34-C-6 were grouped into 3 populations and then sown, and each individual plant was genotyped with the KASP primers designed in step 7 above. Finally, 6385-32-D-5 with a low-cadmium-absorption phenotype was obtained from an M2 population of 32-D-5; and 638S-26-A-7 and 638S-34-C-6 with a salt-tolerant phenotype was obtained from M2 populations of 26-A-7 and 34-C-6, respectively.
Example 2
[0104] A method for high-throughput targeted identification of an M1 generation plant mutant resulting from physical and chemical mutagenesis and for acquisition of the mutant as shown in
[0105] 1. 20,000 seeds of the Oryza sativa variety Huahang 31 were taken and soaked in water for 16 h in a constant-temperature incubator at 28° C., and then taken out and air-dried; the seeds were then soaked in a 1% (w/w) EMS solution for 8 h in a constant-temperature incubator at 28° C., and then taken out and air-dried; and the seeds were rinsed with water 8 times, subjected to germination at 37° C., and sown for seedling cultivation, and resulting seedlings were planted. 96 plants, as a population, were planted in 8 rows, with 12 plants in each row. 100 populations, a total of 9,600 plants, were planted and numbered 1 to 100.
[0106] 2. With each population as a unit, leaves were collected from each individual plant at an equal amount, and a total of 96 leaf samples were mixed in a centrifuge tube for DNA extraction. A total of 100 DNA samples were extracted and then numbered corresponding to the population numbers of 1 to 100.
[0107] 3. With DNA of each population as a sequencing sample, targeted high-depth sequencing was conducted for an exon region of the OsBADH2 (0508g0424500) gene at a sequencing depth of >5,000×.
[0108] 4. The high-depth targeted sequencing data were aligned with a Nipponbare sequence to obtain the SNP and Indel data of the exon of the OsBADH2 gene in the 100 samples. According to test results, it was found that sample 72 had a single base mutation of [G/A] at 20381445 (RAP_Locus) of the OsBADH2 gene, which caused an amino acid 109 to change from Trp to a terminator, such that the protein coding of the OsBADH2 gene was terminated prematurely.
[0109] 5. The SNP in the sequencing data of the above population sample 72 was verified by the dPCR technology. Verification results showed that the SNP genotype in the targeted sequencing data was present in this sample.
[0110] 6. According to the SNP genotype in the DNA of the population sample 72, the following KASP genotyping primers were designed:
[0111] 72FAM 5′-GAAGGTGACCAAGTTCATGCTGAAGCCTCTTGATGAAGCAGCATG-3′ (as shown in SEQ ID NO: 10, in which an underlined part represents a fluorescent tag primer);
[0112] 72HEX 5′-GAAGGTCGGAGTCAACGGATTGAAGCCTCTTGATGAAGCAGCATA-3′ (as shown in SEQ ID NO: 11, in which an underlined part represents a fluorescent tag primer); and
[0113] 72COMMON 5′-CAACATCGTCCTGACAAATGGAAT-3′ (as shown in SEQ ID NO: 12).
[0114] 7. The KASP genotyping primers designed above were used to genotype the 96 individual plants in the population 72. According to genotyping results, it was found that the 3rd plant in row 7 of the population 72 (72-G-3) had the single base mutation genotype of [G/A] in exon 3 of the OsBADH2 gene. Finally, an M1 generation individual plant 72-G-3 with an early termination mutation of the target gene was obtained.
[0115] 8. DNA was extracted from leaves corresponding to each ear on the individual plant 72-G-3, and a sequencing test was conducted for the SNP mutation in the individual plant. It was found that 3 ears on the individual plant 72-G-3 had the single base mutation genotype of [G/A]. Seeds of ears with the mutation genotype were mixed-collected.
[0116] 9. Seedlings were cultivated using the seeds of the individual plant 72-G-3, then each individual seedling was planted independently, and each individual plant was genotyped with the KASP primers designed in step 6 above. Finally, Huahang 31-72-G-3 with a rice aroma phenotype was obtained from an M2 population of 72-G-3.
Example 3
[0117] A method for high-throughput targeted identification of an M1 generation plant mutant resulting from physical and chemical mutagenesis and for acquisition of the mutant as shown in
[0118] 1. 100,000 seeds of the Oryza sativa variety Huazhan were irradiated with .sup.60Co-γ rays at a dose of 350 Gy to obtain an M1 generation of the Oryza sativa variety Huazhan.
[0119] 2. Seedlings were cultivated using the 100,000 Huazhan M1 generation seeds; and then 96 plants, as a population, were planted in 8 rows, with 12 plants in each row. 500 populations, a total of 48,000 plants, were planted and numbered 1 to 500.
[0120] 3. With each population as a unit, leaves were collected from each individual plant at an equal amount, and a total of 96 leaf samples were mixed in a centrifuge tube for DNA extraction. A total of 500 DNA samples were extracted and then numbered corresponding to the population numbers of 1 to 500.
[0121] 4. With DNA of each population as a sequencing sample, targeted high-depth sequencing was conducted for transcription activator-like effector (TALE) binding regions of Xanthomonas oryzae in regulatory regions of the Os11N3 (Os11g0508600) and Os8N3 (Os08g0535200) genes at a sequencing depth of >5,000×.
[0122] 5. The high-depth targeted sequencing data were aligned with a Nipponbare sequence to obtain the SNP and Indel data of the TALE binding regions of Xanthomonas oryzae in regulatory regions of the Os11N3 and Os8N3 genes in the 500 samples. According to test results, it was found that sample 261 had a 22 bp deletion of [CAACCAGGTGCTAAGCTCATC (SEQ ID NO: 29)/−] at 18174476-18174497 (RAP_Locus) of the Os11N3 gene; and according to test results, it was also found that sample 385 had a 34 bp deletion of [TCTCCCCCTACTGTACACCACCAAAAGTGGAGGG (SEQ ID NO: 30)/−] at 26728837-26728870 (RAP_Locus) of the Os8N3 gene.
[0123] 6. The Indels in the sequencing data of the above samples 261 and 385 were verified by the dPCR technology. Verification results showed that the deletion mutation genotypes in the targeted sequencing data were present in the three samples, respectively.
[0124] 7. According to the deletion mutation genotypes in the DNA of the population samples 261 and 385, the following KASP genotyping primers were designed:
[0125] 261FAM 5′-GAAGGTGACCAAGTTCATGCTTCCTAGCACTATATAAACCCCCTC-3′ (as shown in SEQ ID NO: 13, in which an underlined part represents a fluorescent tag primer);
[0126] 261HEX 5′-GAAGGTCGGAGTCAACGGATTTCCTAGCACTATATAAACCCCCTA-3′ (as shown in SEQ ID NO: 14, in which an underlined part represents a fluorescent tag primer);
[0127] 261COMMON 5′-CTTGAGTTTGCTTTGCTTGAAGGC-3′ (as shown in SEQ ID NO: 15);
[0128] 385FAM 5′-GAAGGTGACCAAGTTCATGCTGGCTCAGTGTTTATATAGTTGGAGAC-3′ (as shown in SEQ ID NO: 16, in which an underlined part represents a fluorescent tag primer);
[0129] 385HEX 5′-GAAGGTCGGAGTCAACGGATTGGCTCAGTGTTTATATAGTTGGAGA-3′ (as shown in SEQ ID NO: 17, in which an underlined part represents a fluorescent tag primer); and
[0130] 385COMMON 5′-GAAAAAAAAGCAAAGGTTAGATATGCA-3′ (as shown in SEQ ID NO: 18).
[0131] 8. The KASP genotyping primers for the 2 deletion mutation loci were used to genotype the 96×2=192 individual plants in the populations 261 and 385. According to genotyping results, it was found that the 7th plant in row 2 of the population 261 (261-B-7) had a 22 bp deletion genotype of [CCAACCAGGTGCTAAGCTCATC (SEQ ID NO: 29)/−] in the TALE binding region of Xanthomonas oryzae in the regulatory region of the Os11N3 gene; and according to genotyping results, it was also found that the 3rd plant in row 8 of the population 385 (385-H-3) had a 34 bp deletion genotype of [TCTCCCCCTACTGTACACCACCAAAAGTGGAGGG (SEQ ID NO: 30)/−] in the TALE binding region of Xanthomonas oryzae in the regulatory region of the Os8N3 gene. Finally, 2 M1 generation individual plants with a deletion mutation of the target gene were obtained, including 1 chimera 261-B-7 with an Os11N3 gene frameshift mutation and 1 chimera 385-H-3 with an Os8N3 gene frameshift mutation.
[0132] 9. DNA was extracted from leaves corresponding to each ear on each of the individual plants 261-B-7 and 385-H-3, and a sequencing test was conducted for the Indel mutation in each individual plant. It was found that 4 ears on the individual plant 261-B-7 had the mutation genotype of [CCAACCAGGTGCTAAGCTCATC (SEQ ID NO: 29)/−]; and 3 ears on the individual plant 385-H-3 had the mutation genotype of [TCTCCCCCTACTGTACACCACCAAAAGTGGAGGG (SEQ ID NO: 30)/−]. With each individual plant as a unit, seeds of ears with the mutation genotype were mixed-collected.
[0133] 10. Seeds of each of 261-B-7 and 385-H-3 were grouped into 2 populations and then sown, and each individual plant was genotyped with the KASP primers designed in step 7. Finally, Xanthomonas oryzae-resistant Huazhan-261-B-7 and Huazhan-385-H-3 were obtained from M2 populations of 261-B-7 and 385-H-3, respectively.
Example 4
[0134] The Oryza sativa OsNramp5.sup.−18 mutant gene obtained in Example 1 had a nucleotide sequence shown in SEQ ID NO: 19. According to the test results of Beijing Tsingke Biotechnology Co., Ltd., the Oryza sativa OsNramp5.sup.−18 mutant gene was obtained through an 18 bp deletion of [CCTACGTGGCAATTCACA (SEQ ID NO: 28)/−] at 8875646-8875663 (RAP_Locus) of the OsNramp5 gene, in which 1 bp was at a junction between intron 8 and exon 9.
[0135] The identification method of Example 1 shown in
[0136] Use of the Oryza sativa OsNramp5.sup.−18 mutant gene or the mutant carrying the Oryza sativa OsNramp5.sup.−18 mutant gene obtained in Example 1 in the selective breeding and preparation of an Oryza sativa variety with a low-cadmium-absorption phenotype was provided, specifically including the following steps:
[0137] 1) the obtained mutant carrying the genetic phenotype of the OsNramp5.sup.−18 mutant gene was used as a donor parent and the Oryza sativa Huazhan was used as a recipient parent for crossbreeding to obtain F1 seeds;
[0138] 2) the F1 seeds were sown, and then an individual plant was selected and crossed with the recurrent parent Oryza sativa Huazhan to obtain BC1F1 seeds;
[0139] 3) the BC1F1 seeds were sown, each individual plant was subjected to BC1F1 population DNA extraction, the KASP genotyping primers designed in Example 1 were used to conduct background selection on individual plants carrying the Oryza sativa OsNramp5.sup.−18 mutant gene, and an individual plant with the highest background similarity to the recurrent parent was selected for backcrossing to obtain BC2F1 seeds;
[0140] 4) the BC2F1 seeds were sown, each individual plant was subjected to BC2F1 population DNA extraction, the KASP genotyping primers designed in Example 1 were used to conduct background selection on individual plants carrying the Oryza sativa OsNramp5.sup.−18 mutant gene, and an individual plant with the highest background similarity to the recurrent parent was selected for backcrossing to obtain BC3F1 seeds;
[0141] 5) the BC3F1 seeds were sown, each individual plant was subjected to BC3F1 population DNA extraction, the KASP genotyping primers designed in Example 1 were used to conduct background selection on individual plants carrying the Oryza sativa OsNramp5.sup.−18 mutant gene, and an individual plant with highest background similarity to the recurrent parent was selected for selfing to obtain BC3F2 seeds; and
[0142] 6) the BC3F2 seeds were sown, each individual plant was subjected to BC3F2 population DNA extraction, the KASP genotyping primers designed in Example 1 were used to conduct background selection on individual plants carrying the Oryza sativa OsNramp5.sup.−18 mutant gene, and an individual plant Huazhan-Nramp5.sup.−18 with the same genetic background as the Oryza sativa Huazhan was selected and harvested, which was the Oryza sativa variety Huazhan-Nramp5.sup.−18 with a low-cadmium-absorption phenotype shown in
[0143] The Oryza sativa variety Huazhan-Nramp5.sup.−18 with a low-cadmium-absorption phenotype obtained above was subjected to a cadmium stress potting test. A soil was taken from a surface layer of a field, and the basic fertility thereof was tested. The soil was air-dried, sieved, subjected to impurity removal, thoroughly mixed, and dispensed into each pot at 25 mg/kg, then a Cd(CdCl.sub.2) solution was added to the standby soil at a cadmium concentration of 2 mg/kg, and then the soil was equilibrated for 4 weeks.
[0144] The mutant Huazhan-Nramp5.sup.−18 obtained in step 6) of this example and a Huazhan control were planted in the cadmium-contaminated pots, with 6 holes per pot and 2 plants per hole. 3 replicates were set for each test sample. Samples were taken at a maturity stage of Oryza sativa. Stems, leaves, and ears of an individual plant were separated, the ears were subjected to seed-husking, and the stems and leaves were rinsed with tap water and then washed with deionized water. Each sample was deactivated at 105° C. for 30 min and then dried at 80° C. to a constant weight. A dry weight of seeds per plant was determined, and results were shown in
Example 5
[0145] The Oryza sativa OsRR22.sup.−1 mutant gene obtained in Example 1 had a nucleotide sequence shown in SEQ ID NO: 20. According to the test results of Beijing Tsingke Biotechnology Co., Ltd., the Oryza sativa OsRR22.sup.−1 mutant gene was obtained through a 1 bp deletion of [G/−] (at 4138902) in exon 3 of the Oryza sativa OsRR22 gene.
[0146] The identification method of Example 1 shown in
[0147] Use of the Oryza sativa OsRR22.sup.−1 mutant gene or the mutant carrying the Oryza sativa OsRR22.sup.−1 mutant gene obtained in Example 1 in the selective breeding and preparation of an Oryza sativa variety with a low-cadmium-absorption phenotype was provided, specifically including the following steps:
[0148] 1) the mutant carrying the genetic phenotype of the OsRR22.sup.−1 mutant gene obtained in Example 1 was used as a donor parent and the Oryza sativa Huazhan was used as a recipient parent for crossbreeding to obtain F1 seeds;
[0149] 2) the F1 seeds were sown, and then an individual plant was selected and crossed with the recurrent parent Oryza sativa Huazhan to obtain BC1F1 seeds;
[0150] 3) the BC1F1 seeds were sown, each individual plant was subjected to BC1F1 population DNA extraction, the KASP genotyping primers designed in Example 1 were used to conduct background selection on individual plants carrying the Oryza sativa OsRR22.sup.−1 mutant gene, and an individual plant with the highest background similarity to the recurrent parent was selected for backcrossing to obtain BC2F1 seeds;
[0151] 4) the BC2F1 seeds were sown, each individual plant was subjected to BC2F1 population DNA extraction, the KASP genotyping primers designed in Example 1 were used to conduct background selection on individual plants carrying the Oryza sativa OsRR22.sup.−1 mutant gene, and an individual plant with the highest background similarity to the recurrent parent was selected for backcrossing to obtain BC3F1 seeds;
[0152] 5) the BC3F1 seeds were sown, each individual plant was subjected to BC3F1 population DNA extraction, the KASP genotyping primers designed in Example 1 were used to conduct background selection on individual plants carrying the Oryza sativa OsRR22.sup.−1 mutant gene, and an individual plant with highest background similarity to the recurrent parent was selected for selfing to obtain BC3F2 seeds; and
[0153] 6) the BC3F2 seeds were sown, each individual plant was subjected to BC3F2 population DNA extraction, the KASP genotyping primers designed in Example 1 were used to conduct background selection on individual plants carrying the Oryza sativa OsRR22.sup.−1 mutant gene, and an individual plant Huazhan-OsRR22.sup.−1 with the same genetic background as the Oryza sativa Huazhan was selected and harvested, which was the Oryza sativa variety Huazhan-OsRR22.sup.−1 with a salt-tolerant phenotype shown in
[0154] Seedlings were simultaneously cultivated for the mutant Huazhan-OsRR22.sup.−1 obtained in this example and Huazhan (WT). At the three-complete leaf and one-spear leaf stage, Oryza sativa seedlings were placed in a 0.8% sodium chloride aqueous solution to undergo a continuous stress treatment for 10 d, and then photographed. 10 plants were collected from each of the mutant and control groups and rinsed with pure water, then the residual water was removed, and a root length, a plant height, and a fresh seedling weight were measured. The measurement results were shown in Table 1 below.
TABLE-US-00009 TABLE 1 Comparison results of salt tolerance between Huazhan-OsRR22.sup.−1 and Huazhan (WT) Root length Plant height Fresh seedling Sample (mm) (mm) weight (g) Huazhan (WT) 89.37 ± 2.31 109.10 ± 1.42 0.17 ± 0.01 Huazhan-OsRR22.sup.−1 .sup. 108 ± 4.12 118 ± 4.22 0.25 ± 0.01
[0155] It can be seen from the results in Table 1 that the Huazhan (WT) withered after 10 d of the stress treatment, while the mutant Huazhan-OsRR22.sup.−1 still grew normally; and the root length, plant height, and fresh seedling weight of the mutant were also significantly higher than that of the Huazhan (WT), indicating that the growth potential of the mutant Huazhan-OsRR22.sup.−1 under salt stress was significantly stronger than that of the WT control.
Example 6
[0156] The Oryza sativa OsRR22.sup.−7 mutant gene obtained in Example 1 had a nucleotide sequence shown in SEQ ID NO: 21. According to the test results of Beijing Tsingke Biotechnology Co., Ltd., the Oryza sativa OsRR22.sup.−7 mutant gene was obtained through a 7 bp deletion of KGGCTTT/−1 (at 4140861-4140867) in exon 5 of the Oryza sativa OsRR22 gene.
[0157] The identification method of Example 1 shown in
[0158] Use of the Oryza sativa OsRR22.sup.−7 mutant gene or the mutant carrying the Oryza sativa OsRR22.sup.−7 mutant gene obtained in Example 1 in the selective breeding and preparation of an Oryza sativa variety with a low-cadmium-absorption phenotype was provided, specifically including the following steps:
[0159] 1) the mutant carrying the genetic phenotype of the OsRR22.sup.−7 mutant gene obtained in Example 1 was used as a donor parent and the Oryza sativa Huazhan was used as a recipient parent for crossbreeding to obtain F1 seeds;
[0160] 2) the F1 seeds were sown, and then an individual plant was selected and crossed with the recurrent parent Oryza sativa Huazhan to obtain BC1F1 seeds;
[0161] 3) the BC1F1 seeds were sown, each individual plant was subjected to BC1F1 population DNA extraction, the KASP genotyping primers designed in Example 1 were used to conduct background selection on individual plants carrying the Oryza sativa OsRR22.sup.−7 mutant gene, and an individual plant with the highest background similarity to the recurrent parent was selected for backcrossing to obtain BC2F1 seeds;
[0162] 4) the BC2F1 seeds were sown, each individual plant was subjected to BC2F1 population DNA extraction, the KASP genotyping primers designed in Example 1 were used to conduct background selection on individual plants carrying the Oryza sativa OsRR22.sup.−7 mutant gene, and an individual plant with the highest background similarity to the recurrent parent was selected for backcrossing to obtain BC3F1 seeds;
[0163] 5) the BC3F1 seeds were sown, each individual plant was subjected to BC3F1 population DNA extraction, the KASP genotyping primers designed in Example 1 were used to conduct background selection on individual plants carrying the Oryza sativa OsRR22.sup.−7 mutant gene, and an individual plant with highest background similarity to the recurrent parent was selected for selfing to obtain BC3F2 seeds; and
[0164] 6) the BC3F2 seeds were sown, each individual plant was subjected to BC3F2 population DNA extraction, the KASP genotyping primers designed in Example 1 were used to conduct background selection on individual plants carrying the Oryza sativa OsRR22.sup.−7 mutant gene, and an individual plant Huazhan-OsRR22.sup.−7 with the same genetic background as the Oryza sativa Huazhan was selected and harvested, which was the Oryza sativa variety Huazhan-OsRR22.sup.−7 with a salt-tolerant phenotype shown in
[0165] Seedlings were simultaneously cultivated for the mutant Huazhan-OsRR22.sup.−7 obtained in this example and Huazhan (WT). At the three-complete leaf and one-spear leaf stage, Oryza sativa seedlings were placed in a 0.8% sodium chloride aqueous solution to undergo a continuous stress treatment for 10 d, and then photographed. 10 plants were collected from each of the mutant and control groups and rinsed with pure water, then the residual water was removed, and a root length, a plant height, and a fresh seedling weight were measured. The measurement results were shown in Table 2 below.
TABLE-US-00010 TABLE 2 Comparison results of salt tolerance between Huazhan-OsRR22.sup.−7 and Huazhan (WT) Root length Plant height Fresh seedling Sample (mm) (mm) weight (g) Huazhan (WT) 87.37 ± 2.24 106.10 ± 1.22 0.16 ± 0.01 Huazhan-OsRR22-7 .sup. 107 ± 3.12 116 ± 4.34 0.23 ± 0.01
[0166] It can be seen from the results in Table 2 that the Huazhan (WT) withered after 10 d of the stress treatment, while the mutant Huazhan-OsRR22.sup.−7 still grew normally; and the root length, plant height, and fresh seedling weight of the mutant were also significantly higher than that of the Huazhan (WT), indicating that the growth potential of the mutant Huazhan-OsRR22.sup.−7 under salt stress was significantly stronger than that of the WT control.
Example 7
[0167] A method for high-throughput targeted identification of an M1 generation Sorghum bicolor mutant resulting from physical and chemical mutagenesis and for acquisition of the mutant as shown in
[0168] 1. 20,000 seeds of the Sorghum bicolor variety 654 were taken and soaked in water for 16 h in a constant-temperature incubator at 28° C., and then taken out and air-dried; the seeds were then soaked in a 1% (w/w) EMS solution for 8 h in a constant-temperature incubator at 28° C., and then taken out and air-dried; and the seeds were rinsed with water 8 times, subjected to germination at 37° C., and sown for seedling cultivation, and resulting seedlings were planted. 96 plants, as a population, were planted in 8 rows, with 12 plants in each row. 100 populations, a total of 9,600 plants, were planted and numbered 1 to 100.
[0169] 2. With each population as a unit, leaves were collected from each individual plant at an equal amount, and a total of 96 leaf samples were mixed in a centrifuge tube for DNA extraction. A total of 100 DNA samples were extracted and then numbered corresponding to the population numbers of 1 to 100.
[0170] 3. With DNA of each population as a sequencing sample, targeted high-depth sequencing was conducted for an exon region of the ALS (GenBank: LN898467.1) gene at a sequencing depth of >5,000×.
[0171] 4. The high-depth targeted sequencing data were aligned with the reference genome Sorghum_bicolor NCBIv3 to obtain the SNP and Indel data of the exon of the ALS gene in the 100 samples. According to test results, it was found that sample 68 had a single base mutation of [G/A] at base 1,871 of the only exon of the ALS gene, which caused an amino acid 624 to change from Ser to Asn.
[0172] 5. The SNP in the sequencing data of the above population sample 68 was verified by the dPCR technology. Verification results showed that the SNP genotype in the targeted sequencing data was present in this sample.
[0173] 6. According to the SNP genotype in the DNA of the population sample 68, the following KASP genotyping primers were designed:
TABLE-US-00011 68FAM (SEQ ID NO: 22) 5’-GAAGGTGACCAAGTTCATGCTAGCATGTGTTGCCTATGATCCCTA G-3’ 68HEX (SEQ ID NO: 23) 5’-GAAGGTCGGAGTCAACGGATTAGCATGTGTTGCCTATGATCCCTA A-3’ 68COMMON (SEQ ID NO: 24) 5’-TCAATACACAGTCCTGCCATCACC-3’.
[0174] 7. The KASP genotyping primers designed above were used to genotype the 96 individual plants in the population 68. According to genotyping results, it was found that the 8th plant in row 6 of the population 68 (68-F-8) had the single base mutation genotype of [G/A] at base 1,871 of the ALS gene. Finally, an individual plant in which the amino acid 624 in an ALS protein encoded by the target gene changed from Ser to Asn was obtained.
[0175] 8. DNA was extracted from leaves corresponding to each ear on the individual plant 68-F-8, and a sequencing test was conducted for the SNP mutation in the individual plant. It was found that 5 ears on the individual plant 68-F-8 had the single base mutation genotype of [G/A]. Seeds of ears with the mutation genotype were mixed-collected.
[0176] 9. Seedlings were cultivated using the seeds of the individual plant 68-F-8, then each individual seedling was planted independently, and each individual plant was genotyped with the KASP primers designed in step 6 above. Finally, Sorghum bicolor with an imidazolinone herbicide-resistant phenotype was obtained from an M2 population of 68-F-8.
Example 8
[0177] A method for high-throughput targeted identification of an M1 generation Zea mays mutant resulting from physical and chemical mutagenesis and for acquisition of the mutant as shown in
[0178] 1. 20,000 seeds of the Zea mays variety 345 (hereinafter referred to as 345) were irradiated with 80 MeV/u carbon ions (.sup.12C.sup.6+) at a dose of 180 Gy to obtain an M1 generation of the Zea mays variety 345.
[0179] 2. Seedlings were cultivated using the 20,000 345 M1 generation seeds, and then each individual seedling was planted independently. 96 plants, as a population, were planted in 8 rows, with 12 plants in each row. 100 populations, a total of 9,600 plants, were planted and numbered 1 to 100.
[0180] 3. With each population as a unit, leaves were collected from each individual plant at an equal amount, and a total of 96 leaf samples were mixed in a centrifuge tube for DNA extraction. A total of 100 DNA samples were extracted and then numbered corresponding to the population numbers of 1 to 100.
[0181] 4. With DNA of each population as a sequencing sample, targeted high-depth sequencing was conducted for an exon region of the ZmTMS5 gene at a sequencing depth of >5,000×.
[0182] 5. The high-depth targeted sequencing data were aligned with a Zea mays reference genome B73_RefGen_v4 to obtain the SNP and Indel data of the exon of the ZmTMS5 gene in the 100 samples. According to test results, it was found that sample 54 had a 1 bp deletion of [C/−] at a base 38 of exon 1 of the ZmTMS5 gene.
[0183] 6. The Indel in the sequencing data of the population sample 54 was verified by the dPCR technology. Verification results showed that the deletion mutation genotype in the targeted sequencing data was present in this sample.
[0184] 7. According to the deletion mutation genotype in the DNA of the population sample 54, the following KASP genotyping primers were designed:
TABLE-US-00012 38FAM (SEQ ID NO: 25) 5’-GAAGGTGACCAAGTTCATGCTCGAGTCCACTGTGGAGGTTCC-3’ 38HEX (SEQ ID NO: 26) 5’-GAAGGTCGGAGTCAACGGATTCGAGTCCACTGTGGAGGTTCT-3’ and 38COMMON (SEQ ID NO: 27) 5’-ACCCCTCGATCTCTATACGGTG-3’
[0185] The KASP genotyping primers designed above were used to genotype the 96 individual plants in the population 54. According to genotyping results, it was found that the 3rd plant in row 4 of the population 54 (54-D-3) had the single base mutation genotype of [C/−] at base 38 of the ZmTMS5 gene.
[0186] 8. DNA was extracted from leaves corresponding to each ear on the individual plant 54-D-3, and a sequencing test was conducted for the Indel mutation in the individual plant. It was found that 4 ears on the individual plant 54-D-3 had the single base deletion mutation genotype of [C/−]. Seeds of ears with the mutation genotype were mixed-collected.
[0187] 9. Seedlings were cultivated using the seeds of the individual plant 54-D-3, then each individual seedling was planted independently, and each individual plant was genotyped with the KASP primers designed in step 6 above. Finally, a Zea mays variety 345 with thermo-sensitive male sterility was obtained from an M2 population of 54-D-3.