ALDOLASE, ALDOLASE MUTANT, AND METHOD AND COMPOSITION FOR PRODUCING TAGATOSE BY USING SAME

Abstract

There are provided aldolase, an aldolase mutant, a method for producing tagatose, and a composition for producing tagatose using the same. The technical feature of the present invention is environment-friendly due to the use of an enzyme acquired from microorganisms, requires only a simple process of enzyme-immobilization, uses a low-cost substrate compared with that of a conventional method for producing tagatose, and has a remarkably high yield, thereby greatly reducing production cost while maximizing production effect.

Claims

1. A method of producing tagatose from fructose, the method comprising: reacting fructose 6-phosphate with tagatose 6-phosphate epimerase or a mutant thereof to obtain tagatose 6-phosphate; and converting the tagatose 6-phosphate to tagatose.

2. The method of claim 1, wherein the tagatose 6-phosphate epimerase catalyzes the conversion of fructose 6-phosphate to tagatose-6-phosphate.

3. The method of claim 1, wherein the tagatose 6-phosphate epimerase is SEQ ID NOS: 1.

4. The method of claim 1, wherein the tagatose 6-phosphate epimerase is SEQ ID NOS: 2.

5. The method of claim 1, wherein the tagatose 6-phosphate epimerase is SEQ ID NOS: 3.

6. The method of claim 1, wherein the tagatose 6-phosphate epimerase is SEQ ID NOS: 4.

7. The method of claim 1, wherein the mutant comprises at least one amino acid substitution of SEQ ID NO: 1 selected from the group consisting of: i) a substitution of arginine residue with glutamine at a position corresponding to position 332, ii) a substitution of glutamine residue with alanine at a position corresponding to position 314, iii) a substitution of histidine residue with alanine at a position corresponding to position 227, and iv) a substitution of serine residue with alanine at a position corresponding to position 62.

8. The method of claim 1, wherein the fructose 6-phosphate is obtained by treating fructose or a fructose-containing material with hexokinase.

9. The method of claim 1, wherein the tagatose is obtained by treating the tagatose 6-phosphate with phytase.

10. The method of claim 1, wherein the reaction of the fructose 6-phosphate with the tagatose 6-phosphate epimerase is performed at a pH from 7.0 to 9.0.

11. The method of claim 1, wherein the reaction of the fructose 6-phosphate with the tagatose 6-phosphate epimerase is performed at a temperature from 30 C. to 70 C.

Description

DESCRIPTION OF DRAWINGS

[0055] FIG. 1 is a schematic diagram illustrating the production of tagatose from fructose by a cocktail reaction introduced in the present invention.

[0056] FIGS. 2 to 4 illustrate the comparison results of phylogenetic trees and amino acid sequences with fructose 1,6-diphosphate aldolased enzyme derived from Escherichia coli K-12, regarding the selection of fructose 1,6-diphosphate aldolase of Streptococcus thermophilus, Caldicellulosiruptor saccharolyticus, and Kluyveromyceslactis introduced in the present invention.

[0057] FIG. 5 is a graph illustrating the relative activities of fructose 1,6-diphosphate aldolased enzyme derived from Escherichia coli K-12 and fructose 1,6-diphosphate aldolased enzyme of fructose 1,6-diphosphate aldolase of Streptococcus thermophilus, Caldicellulosiruptor saccharolyticus, and Kluyveromyceslactis after reacting with 5 mM fructose 6-phosphate at pH 8.5 at 50 C. for 1 hour.

[0058] FIG. 6 is a graph illustrating comparison results of the metal specificity of fructose 1,6-diphosphate aldolases of the present invention.

[0059] FIGS. 7 to 9 are graphs illustrating the relative activity and conversion (FIG. 9) of tagatose 6-phosphate in fructose 6-phosphate according to an enzyme optimum pH (FIG. 7) and optimum temperature (FIG. 8) for fructose 1,6-diphosphate aldolase of Streptococcus thermophilus, respectively.

[0060] FIGS. 10 to 12 are graphs illustrating the relative activity and conversion (FIG. 12) of tagatose 6-phosphate in fructose 6-phosphate according to an enzyme optimum pH (FIG. 10) and optimum temperature (FIG. 11) for fructose 1,6-diphosphate aldolase of Caldicellulosiruptor saccharolyticus, respectively.

[0061] FIGS. 13 to 15 are graphs illustrating the relative activity and conversion (FIG. 15) of tagatose 6-phosphate in fructose 6-phosphate according to an enzyme optimum pH (FIG. 13) and optimum temperature (FIG. 14) for fructose 1,6-diphosphate aldolase of Kluyveromyces lactis, respectively.

[0062] FIG. 16 is a graph illustrating the results of the conversion of fructose 6-phosphate into tagatose 6-phosphate using each of the fructose 1,6-diphosphate aldolases used in the present invention. The fructose 1,6-diphosphate aldolase of Kluyveromyces lactis exhibited an activity similar to that of the enzyme derived from Escherichia coli K-12, and the enzyme derived from Streptococcus thermophilus exhibited a fast initial conversion but exhibited a slower conversion of 71%. The enzyme derived from Caldicellulosiruptor saccharolyticus exhibited a conversion of about 80%, similar to that of the enzyme derived from Escherichia coli K-12, and a fast initial conversion.

[0063] FIG. 17 is a schematic diagram of RSF Duet-1 vector system used in the present invention, and this system aims at cloning other enzymes along with fructose 1,6-diphosphate aldolase.

[0064] FIG. 18 is a graph illustrating the production activity obtained by reacting hexokinase derived from Saccharomyces cerevisiae with fructose in a concentration from 5 mM to 50 mM for 1 hour.

[0065] FIGS. 19 to 22 illustrate the metal specificity of fructose 1,6-diphosphate aldolase of Escherichia coli of the present invention (FIG. 19), the conversion from fructose 6-phosphate into tagatose 6-phosphate according to an optimum pH for fructose 1,6-diphosphate aldolase of Escherichia coli (FIG. 20), the conversion according to an optimum temperature (FIG. 21), respectively. FIG. 22 is a graph illustrating the result of converting 10 mM fructose 6-phosphate into tagatose 6-phosphate under the optimum conditions confirmed in the results of FIGS. 19 to 21.

[0066] FIG. 23 lists the conversion into tagatose according to the concentration of phytase when reacting the tagatose 6-phosphate, which was converted in the present invention, with phytase.

[0067] FIG. 24 is a graph illustrating the comparison result of enzyme activity between gene-mutating enzymes constructed in the present invention and a wild-type enzyme, in which increased conversion rate and improved productivity are obtained by a faster conversion rate.

BEST MODE

[0068] Hereinafter, the present invention will be described in detail with reference to Examples. However, the scope of right of the present invention is not limited by these Examples.

EXAMPLE 1

Large-Scale Production of Fructose 1,6-diphosphate aldolased Enzyme

[0069] Regarding fructose 1,6-diphosphate aldolase genes, DNA from Escherichia coli strain K-12, and each strain of Streptococcus thermophilus, Caldicellulosiruptor saccharolyticus, and Kluyveromyces lactis were suggested as genes for fructose 1,6-diphosphate aldolase, but they were obtained in a large-scale by performing PCR amplification after designing primers (see Table 2) based on the nucleotide sequence of DNA of genes, which have never been identified, inserting the PCR product into an RSF Duet-1 vector [Novagen] using restriction enzymes, Sal I and Not I to construct a recombinant vector, RSF Duet-1/fructose 1,6-diphosphate aldolase, followed by transforming the recombinant vector into E. coli BL21(DE3) by a conventional transformation method. Additionally, the E. coli BL21 strain was stored in liquid nitrogen prior to cultivation for a large-scale production.

[0070] Then, for a large-scale production of fructose 1,6-diphosphate aldolase, first, the frozen-stored BL21(DE3) strain was inoculated into a 250 mL flask including 50 mL of LB and seed-cultured in a shaking water bath maintained at 37 C. until the absorbance at 600 nm reached 2.0, and the seed-cultured culture broth was subjected to a main cultivation by adding it into a 7 L fermentor (Biotron, Korea) including a 5 L of a fermentation medium (10 g/L of glycerol, 1 g/L of peptone, 30 g/L of yeast extract, 0.14 g/L potassium diphosphate, and 1 g/L of monosodium phosphate). In particular, the large-scale production of fructose 1,6-diphosphate aldolase was induced by adding 1 mM ITPG when the absorbance at 600 nm reached 2.0. Specifically, the stirring speed at 500 rpm, aeration of 1.0 vvm, and the culture temperature at 37 C. were maintained during the above process.

EXAMPLE 2

Purification of Fructose 1,6-diphosphate aldolase

[0071] In order to accurately identify the characteristics of fructose 1,6-diphosphate aldolase,

the enzyme was purified using affinity HisTrap HP column, desalting HiPrep 16/60, and gel filtration Sephacryl S-100 HR column.

EXAMPLE 3

Metal Specificity of fructose 1,6-diphosphate aldolase

[0072] According to previous reports, fructose 1,6-diphosphate aldolase is involved in the conversion of 1,6-diphosphate substrate into dihydroxyacetone phosphate and glyceraldehyde 3-phosphate by metal zinc and improve titer. However, the present invention confirmed that a metal salt effect does not affect to increase titer when fructose 6-phosphate was applied as a substrate. In order to examine the metal salt effect, the enzyme activity was measured after treating with EDTA or adding 1 mM metal ions, as illustrated in figures below, and in particular, the reaction was performed in a 50 mM PIPES buffer solution (pH 8.5) including 0.15% fructose and 0.05 U/mL at 50 C. for 30 minutes, and the enzyme activity was measured after stopping the reaction with 0.2 M HCl.

[0073] As a result, it was confirmed that the fructose 1,6-diphosphate aldolase of the present invention exhibited no change in its activity by metal ions, and unlike as disclosed in previous reports, zinc ions were exhibited to be a metal enzyme that can significantly inhibit enzyme activity.

EXAMPLE 4

Activity of fructose 1,6-diphosphate aldolase According to Changes in pH and Temperature

[0074] In the present Example, in order to examine the activity of fructose 1,6-diphosphate aldolase according to changes in pH and temperature, the enzyme and the substrate were reacted at various pH and temperatures to compare the enzyme activity. In particular, to examine the effect of pH, the reaction was performed in a 50 mM Trizma base buffer solution including 0.15% fructose 6-phosphate and 0.05 U/mL of the enzyme at a pH from 7.0 to 9.0. Specifically, the reaction was performed at 50 C. for 1 hour. Then, 0.2 M HCl was added to stop the reaction and the enzyme activity was measured. The results are illustrated in each figure.

[0075] Additionally, in order to examine the effect of temperature, the reaction was performed in a 50 mM Trizma base buffer solution (pH 8.5) including 0.15% fructose 6-phosphate and 0.05 U/mL of the enzyme at a temperature from 30 C. to 70 C. for 1 hour. Specifically, 0.2 M HCl was added to stop the reaction and the enzyme activity was measured. The results are illustrated in each figure. As a result, the optimum pH was exhibited to be 8.5, being similar in both Streptococcus thermophilus and Kluyveromyceslactis, and their activities were exhibited to be independent of pH. The optimum temperature for each of the enzymes was exhibited to be 50 C., and Streptococcus thermophiles also showed 91% of relative activity at 30 C.

[0076] Based on the above results, it was confirmed that the conversion of fructose 6-phosphate into tagatose 6-phosphate at optimum temperature and pH according to time zone could reach from 70% to 80%, and the results are illustrated in figures. However, regarding the above reaction, any reaction in any range according to the desired yield or reaction conditions may be applied without defining particular pH or temperature.

EXAMPLE 5

Activity of Conversion from Fructose to fructose 6-phosphate by Hexokinase

[0077] For the production of tagatose at high concentration, as the first step, to produce fructose 6-phosphate by reacting fructose at a concentration of from 5 mM to 50 mM with an equal amount of adenosine triphosphate (ATP) and hexokinase derived from Saccharomyces cerevisiae, reacted with 250 U/mL of the enzyme included in a 50 mM Tris buffer solution (pH 7.5) at 30 C. for 60 minutes. Then, the enzyme activity was measured. The amount of fructose 6-phosphate production according to enzyme concentration is illustrated in FIG. 18. As a result, fructose 6-phosphate at a concentration of from 5 mM to 50 mM was produced, and this corresponds to 90% or higher of conversion.

[0078] The hexokinase used in this Example was lyophilized powder, H4502 Type F-300 purchased from Sigma Aldrich (130 U/mg protein (biuret), Sigma) and the phytase was Genophos 10000G purchased from Genofocus, Inc.

EXAMPLE 6

Large-Scale Production of fructose 1,6-bisphosphate aldolased Enzyme

[0079] Fructose 1,6-diphosphate aldolase gene was obtained in a large-scale by performing PCR amplification after designing primers based on the nucleotide sequence of DNA of Escherichia coli strain K-12 substrain MG1655, inserting the PCR product into an RSF Duet-1 vector [Novagen] using restriction enzymes, Sal I and Not I to construct a recombinant vector, RSF Duet-1/fructose 1,6-diphosphate aldolase (FIG. 17), followed by transforming the recombinant vector into E. coli BL21(DE3) by a conventional transformation method. Additionally, the recombinant E. coli strain was stored in liquid nitrogen prior to cultivation for a large-scale production.

[0080] For a large-scale production of fructose 1,6-diphosphate aldolase, the frozen-stored BL21(DE3) strain was inoculated into a 250 mL flask including 50 mL of LB and seed-cultured in a shaking water bath maintained at 37 C. until the absorbance at 600 nm reached 2.0, and the seed-cultured culture broth was subjected to a main cultivation by adding it into a 7 L fermentor (Biotron, Korea) including a 5L of a fermentation medium (10 g/L of glycerol, 1 g/L of peptone, 30 g/L of yeast extract, 0.14 g/L potassium diphosphate, and 1 g/L of monosodium phosphate). In particular, the large-scale production of fructose 1,6-diphosphate aldolase was induced by adding 1 mM ITPG when the absorbance at 600 nm reached 2.0. Specifically, the stirring speed at 500 rpm, aeration of 1.0 vvm, and the culture temperature at 37 C. were maintained during the above process.

EXAMPLE 7

Production of Tagatose from tagatose 6-phosphate using Phytase

[0081] For the production of tagatose at high concentration, 10 mM tagatose 6-phosphate converted from fructose 6-phosphate was reacted with 10 to 50 U/mL of phytase in a 50 mM pH 7.5 Trizma buffer solution (pH 5.5) at 60 C. for 60 minutes. Then, the enzyme activity was measured. The amount of tagatose production according to enzyme concentration is listed in FIG. 23.

[0082] As a result, 9 mM of tagatose was produced for 50 U/mL of cultivation time, and this corresponds to 90% of conversion yield.

Example 8

Production of Tagatose from Fructose by a Cocktail Reaction of Hexokinase, Aldolase, and Phytase

[0083] Tagatose was produced from fructose by a cocktail reaction of hexokinase, aldolase, and phytase based on the Examples above. Fructose 6-phosphate was produced by reacting 5 mM fructose with an equal amount of adenosine triphosphate (ATP) and 250 U/mL of hexokinase derived from Saccharomyces cerevisiae in a 50 mM Trizma buffer solution (pH 7.5) at 30 C. for 60 minutes, and as a result, 100% of the 5 mM fructose was converted into 5 mM fructose 6-phosphate. As a serial reaction, when a 50 mM Trizma base buffer solution including 0.5 U/mL of fructose 1,6-bisphosphate aldolase was reacted at pH 8.5 for 30 minutes, 93% of the 5 mM fructose 6-phosphate was converted into 4.65 mM tagatose 6-phosphate. Then, when the reaction was performed in a 50 mM Trizma base buffer solution (pH 5.5) including 50 U/mL of the enzyme at 60 C. for 60 minutes, 100% of the 4.65 mM tagatose 6-phosphate was converted into 4.65 mM tagatose. Conclusively, as a result of the cocktail reaction of hexokinase, aldolase, and phytase using 5 mM fructose, 93% was successfully converted into 4.65 mM tagatose.

EXAMPLE 9

Change in Activity of Gene Mutant Enzyme According to Amino Acid Substitution of Aldolase

[0084] For the production of tagatose at high concentration of the present invention, in order to increase the activity of aldolase, an amino acid substitution was caused by manipulating basic gene sequence and the change in activity of the enzyme was observed. As a result, a gene mutant enzyme, which can exhibit a fast conversion effect through a faster initial reaction speed, was successfully constructed. The gene sequences encoding the amino acids to be mutated were mutated with site directed mutation and thereby a gene mutant enzyme was constructed. Site directed mutation was performed using the Muta-Direct Site Directed Mutagenesis Kit, and primers, in which the genes encoding 332R, 314Q, 227H, and 62S, i.e., the amino acids to be mutated, were substituted to encode glutamic acid or alanine (see sequences in Table 1), were constructed to amplify a recombinant plasmid, which was sequenced after transformation, and the strains having substituted mutant enzymes were selected via screening. The selected gene mutant enzymes were subjected to purification in the same manner as in wild-type strain according to Example 2, and reacted in a 50 mM Trizma base buffer solution (pH 8.5) including 1.0% fructose 6-phosphate and 0.04 U/mL of the enzyme for 10 minutes, for comparison of activities. In particular, the reaction was stopped by adding 0.2 M HCl, the amount of the converted tagatose 6-phosphate and the fructose 6-phosphate was analyzed, the enzyme activity was measured by converting the activity of the wild-type enzyme into relative activity 100%, and the results are illustrated in FIG. 24. As a result, the R332Q mutant showed an increase of about 140%, the Q314A showed an increase of about 250%, the H227A mutant showed an increase of about 230%, and the S62A mutant showed an increase of about 150%, relative to that of the wild-type enzyme, respectively.

TABLE-US-00001 TABLE1 Name Nucleotidesequence5to3' S62A GGTTATCGTTCAGTTCGCCAACGGTGGTGCTTC (SEQIDNO:7) S62Aanti GAAGCACCACCGTTGGCGAACTGAACGATAACC (SEQIDNO:8) H227A GCGTCCTTCGGTAACGTAGCCGGTGTTTACAAG (SEQIDNO:9) H227Aanti CTTGTAAACACCGGCTACGTTACCGAAGGACGC (SEQIDNO:10) Q314A CTTATCTGCAGGGTGCGCTGGGTAACC (SEQIDNO:11) Q314Aanti GGTTACCCAGCGCACCCTGCAGATAAG (SEQIDNO:12) R331Q TACGATCCGCAGGTATGGCTGCGTGCCG (SEQIDNO:13) R331Qanti CGGCACGCAGCCATACCTGCGGATCGTA (SEQIDNO:14)

[0085] Table 1 lists information on primers used in constructing mutants of fructose 1,6-bisphosphate aldolase.

TABLE-US-00002 TABLE2 Escherichiacoli SalI GTCGACTCTAAGATTTTTGATTTCGTAAAACC(SEQ (strainK12) IDNO:15) NotI GCGGCCGCTTACAGAACGTCGATCGCGTT(SEQID NO:16) Streptococcus SalI GTCGACGCAATCGTTTCAGCAGAAAAATTTG(SEQ thermophilus IDNO:17) NotI GCGGCCGCTTAAGCTTTGTTTGCTGAACC(SEQID NO:18) Caldicellulosiruptor SalI GTCGACCCACTTGTAACAACCAAAGAG(SEQID saccharolyticus NO:19) NotI GCGGCCGCTTAGCCTCTGTTCTTCTTAATCTC(SEQ IDNO:20) Kluyveromyces SalI GTCGACCCAGCTCAAGACGTATTGACCAG(SEQID lactis NO:21) NotI GCGGCCGCTTATTCCAAAGCACCCTTAGTAC(SEQ IDNO:22)

[0086] Table 2 lists information on primers used in the present invention for each of fructose 1,6-diphosphate aldolase gene.