NOVEL ANTI-FIBROBLAST ACTIVATION PROTEIN (FAP) BINDING AGENTS AND USES THEREOF
20180022822 · 2018-01-25
Inventors
- Chad BROKOPP (Schlieren, CH)
- Jan Grimm (Dübendorf, CH)
- Benoit Combaluzier (Urdorf, CH)
- Manuel Tobias Gersbacher (Zurich, CH)
Cpc classification
A61P1/04
HUMAN NECESSITIES
A61P29/00
HUMAN NECESSITIES
A61P17/02
HUMAN NECESSITIES
A61P9/10
HUMAN NECESSITIES
C07K2319/70
CHEMISTRY; METALLURGY
A61P43/00
HUMAN NECESSITIES
C07K2317/40
CHEMISTRY; METALLURGY
C07K2319/74
CHEMISTRY; METALLURGY
C07K2317/92
CHEMISTRY; METALLURGY
A61P7/02
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
C07K2317/76
CHEMISTRY; METALLURGY
C07K14/70575
CHEMISTRY; METALLURGY
C07K2317/34
CHEMISTRY; METALLURGY
International classification
Abstract
Provided are novel human-derived antibodies specific for Fibroblast Activation Protein (FAP), preferably capable of selectively inhibiting the enzymatic activity of FAP, and chimeric antigen receptors (CARs) directed against the human FAP antigen as well as methods related thereto. In addition, methods of diagnosing and/or monitoring diseases and treatments thereof which are associated with FAP are provided. Assays and kits related to antibodies specific for FAP are also disclosed. The novel anti-FAP antibodies can be used in pharmaceutical and diagnostic compositions for FAP-targeted immunotherapy and diagnostics.
Claims
1-15. (canceled)
16. A monoclonal human B cell-derived anti-Fibroblast Activation Protein (FAP) antibody, or a biotechnological or synthetic derivative thereof, wherein at least one of the complementarity determining regions (CDRs) and/or variable heavy chain and/or variable light chain of the antibody are encoded by a cDNA derived from an mRNA obtained from a human memory B cell which produced an anti-FAP antibody.
17. The antibody of claim 16, which: (a) is capable of binding to captured or directly coated human FAP with an EC50 of 0.1 M; (b) is capable of binding a FAP epitope in a peptide of 15 amino acids in length, wherein the epitope comprises the amino acid sequence of any one of SEQ ID NOs: 30-37, 60, and 61; (c) is capable of binding a FAP epitope in a peptide of 15 amino acids in length, wherein the epitope consists of the amino acid sequence of any one of SEQ ID NOs: 30-37, 60, and 61; (d) is capable of binding to transmembrane FAP; (e) comprises a human constant region, and/or an Fc region or a region equivalent to an Fc region; or (f) comprises a glyco-engineered Fc region and has an increased proportion of non-fucosylated oligosaccharides in the Fc region as compared to a non-glyco-engineered antibody.
18. The antibody of claim 16, comprising in its variable region or binding domain: (a) at least one CDR of any one of SEQ ID NOs: 62-130; (b) a variable heavy chain amino acid sequence of any one of SEQ ID NOs: 2, 4, 8, 12, 16, 20, 24, 41, 45, 49, 53, and 57, and/or a variable light chain amino acid sequence of any one of SEQ ID NOs: 6, 10, 14, 18, 22, 26, 43, 47, 51, 55, and 59; (c) at least one CDR consisting of an amino acid sequence resulting from a partial alteration of any one of the amino acid sequences of (a); or (d) a variable heavy chain and/or a variable light chain comprising an amino acid sequence resulting from a partial alteration of the amino acid sequence of (b).
19. The antibody of claim 18, wherein the partial alteration comprises alterations of less than 50% of the amino acid residues in any one of the amino acid sequences of (a) or of the amino acid sequence of (b).
20. The antibody of claim 16, which shows a higher avidity of binding to FAP under acidic pH as compared to neutral or physiological pH.
21. The antibody of claim 20, wherein the acidic pH is 6.4 or 6.8, and the physiological pH is 7.4.
22. The antibody of claim 16, comprising in its variable region or binding domain: (a) at least one CDR of any one of SEQ ID NOs: 62-76, 83-88, 101-106, and 113-118; (b) a variable heavy chain amino acid sequence of any one of SEQ ID NOs: 2, 4, 8, 16, 41, and 49, and/or a variable light chain amino acid sequence of any one of SEQ ID NOs: 6, 10, 18, 43, and 51; (c) at least one CDR consisting of an amino acid sequence resulting from a partial alteration of any one of the amino acid sequences of (a); or (d) a variable heavy chain and/or a variable light chain comprising an amino acid sequence resulting from a partial alteration of the amino acid sequence of (b).
23. The antibody of claim 22, which is capable of binding a FAP epitope in a peptide of 15 amino acids in length, wherein the epitope comprises the amino acid sequence of any one of SEQ ID NOs: 30-33, 35, 60, and 61.
24. The antibody of claim 23, wherein the epitope consists of the amino acid sequence of any one of SEQ ID NOs: 30-33, 35, 60, and 61.
25. The antibody of claim 16, wherein the antibody binds to FAP and at least one additional epitope and/or target.
26. The antibody of claim 25, wherein the antibody is bispecific or multivalent.
27. The antibody of claim 26, wherein the antibody is a bispecific antibody, a trifunctional antibody, a tetrabody, a bivalent single chain fragment (ScFv), a bispecific T-cell engager (BiTE), a bispecific killer cell engager (BiKE), a dual affinity retargeting molecule (DART), or a DuoBody.
28. The antibody of claim 25, wherein the antibody further binds to death receptor 5 (DR5) and/or CD3, in addition to FAP.
29. A chimeric antigen receptor (CAR), wherein an antigen bound by the CAR is FAP, wherein the CAR comprises a first receptor comprising a variable region or a binding domain derived from the anti-FAP antibody of claim 16.
30. The CAR of claim 29, wherein the CAR or a cell expressing the CAR exhibits a higher avidity of binding to FAP, or a cell expressing FAP on its cell surface, under acid pH as compared to neutral or physiological pH.
31. The CAR of claim 30, wherein the acidic pH is 6.4 or 6.8, and the physiological pH is 7.4.
32. The CAR of claim 29, wherein the first receptor or a second receptor comprises at least one further antigen binding domain.
33. The CAR of claim 32, wherein the further antigen binding domain is specific for a CD3 receptor or a death receptor.
34. The CAR of claim 33, wherein the death receptor is the death receptor 5 (DR5).
35. The CAR of claim 29, wherein the CAR comprises an extracellular domain, a transmembrane domain, and an intracellular signaling domain.
36. The CAR of claim 35, wherein the intracellular signaling domain comprises a 4-1 BB costimulatory domain, a CD28 costimulatory domain, and/or a CD3 endodomain.
37. A host cell genetically modified to express the CAR of claim 29, wherein the host cell optionally expresses and secretes a monoclonal human B cell-derived anti-FAP antibody, or a biotechnological or synthetic derivative thereof, wherein at least one of the CDRs and/or V.sub.H chain and/or V.sub.L chain of the antibody are encoded by a cDNA derived from an mRNA obtained from a human memory B cell which produced an anti-FAP antibody.
38. The host cell of claim 37, wherein the host cell is a T cell, a cytotoxic T lymphocyte (CTL), a natural killer cell, a hematopoietic stem cell (HSC), an embryonic stem cell, or a pluripotent stem cell.
39. The host cell of claim 38, wherein the T cell is a CAR T cell.
40. The host cell of claim 37, wherein host cell exhibits a higher avidity of binding to FAP, or cell expressing FAP on its cell surface, under acidic pH as compared to neutral or physiological pH.
41. The host cell of claim 40, wherein the acidic pH is 6.4 or 6.8, and the physiological pH is 7.4.
42. A pharmaceutical or diagnostic composition comprising: (a) a monoclonal human B cell-derived anti-FAP antibody, or a biotechnological or synthetic derivative thereof, wherein at least one of the CDRs and/or V.sub.H chain and/or V.sub.L chain of the antibody are encoded by a cDNA derived from an mRNA obtained from a human memory B cell which produced an anti-FAP antibody; (b) a CAR, wherein an antigen bound by the CAR is FAP, wherein the CAR comprises a first receptor comprising a variable region or a binding domain derived from the anti-FAP antibody of part (a); or (c) the host cell of claim 37.
43. A method of treating a subject having a disease or disorder characterized by abnormal expression of FAP, the method comprising administering to the subject in need thereof a therapeutically effective amount of: (a) a monoclonal human B cell-derived anti-FAP antibody, or a biotechnological or synthetic derivative thereof, wherein at least one of the CDRs and/or V.sub.H chain and/or V.sub.L chain of the antibody are encoded by a cDNA derived from an mRNA obtained from a human memory B cell which produced an anti-FAP antibody; (b) a CAR, wherein an antigen bound by the CAR is FAP, wherein the CAR comprises a first receptor comprising a variable region or a binding domain derived from the anti-FAP antibody of part (a); (c) the host cell of claim 37; or (d) a pharmaceutical composition comprising any one of (a)-(c).
44. The method of claim 43, wherein the disease or disorder characterized by abnormal expression of FAP is cancer.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0151]
[0152]
[0164]
[0165]
[0171]
[0172]
[0173]
[0180]
[0181]
[0182]
[0183]
[0184]
[0185]
[0186]
[0187]
[0188]
[0189]
[0190]
[0191]
[0192]
[0193]
[0194]
[0195]
[0196]
[0197]
[0198]
[0199]
DETAILED DESCRIPTION OF THE INVENTION
[0200] The present invention generally relates to human auto-antibodies against fibroblast activation protein (FAP) and recombinant derivatives thereof. More specifically, the present invention relates to monoclonal anti-FAP antibodies which are characterized in that at least one of their CDRs are derived from an FAP specific antibody produced by a human memory B cell. The anti-FAP antibodies of the present invention are particular useful in immunotherapy and in vivo detection and labeling of FAP-related diseases, i.e. diseases which affected cells and tissue are characterized by the (elevated) expression of FAP. Due to their human derivation, the resulting recombinant antibodies of the present invention can be reasonably expected to be efficacious and safe as therapeutic agent, and highly specific as a diagnostic reagent for the detection of FAP both in vitro as well as in vivo on cells and in tissue without giving false positives.
[0201] Furthermore, the present invention relates to FAP-binding molecules, in particular anti-FAP antibodies, which exhibit an increased avidity to transmembrane FAP at acidic pH found in tumors, compared to lower avidity at the neutral pH of healthy tissue. The pH dependent avidity is important because FAP is expressed also in healthy tissue, and antibody binding to healthy tissue may cause side effects. Therefore, due to the preferential binding of antibodies of the present invention to FAP in the tumor microenvironment a higher therapeutic effect can be achieved without the side effects associated with binding to transmembrane FAP in other tissue.
[0202] In a further aspect, the present invention relates to an anti-FAP antibody and equivalent agent which selectively binds to and inhibits the enzymatic activity of FAP, which in addition is characterized by anti-coagulant activity and thus useful as an anti-thrombolytic agent. Furthermore, based on a unique and novel epitope of FAP recognized by a human-derived anti-FAP antibody of the present invention a novel in vitro assay for determining FAP in a body fluid, in particular blood and blood plasma, respectively, is provided, wherein an increased level of FAP reliably correlates with the presence of the FAP-related disease such as cancer and atherosclerosis.
[0203] In addition, the present invention relates to diagnostic and pharmaceutical compositions comprising the subject anti-FAP antibody or equivalent FAP-binding agent, in particular for use in diagnosis and treatment of tumor and cardiovascular diseases such as thrombosis.
[0204] In a particular aspect, the present invention relates to a chimeric antigen receptor (CAR) directed against human FAP, wherein one receptor comprises a variable region or binding domain derived from the anti-FAP antibody of the present invention and preferably a further receptor is preferentially specific for the CD3 antigen allowing the CAR to graft an arbitrary specificity onto an immune effector cell. Thus, the CAR of the present invention is useful for therapeutic purposes, preferably for T cell mediated treatment of FAP induced or associated tumors.
[0205] The embodiments of the present invention derived from the results of the appending Examples as illustrated in the Figures are summarized in the claims and in items [1] to [48], supra, and are supplemented with the following description. Furthermore, for the avoidance of any doubt the technical content of the prior art referred to in the background section form part of the disclosure of the present invention and may be relied upon for any embodiment claimed herein. However, this is not an admission that these documents represent relevant prior art as to the present invention.
I. Definitions
[0206] Unless otherwise stated, a term as used herein is given the definition as provided in the Oxford Dictionary of Biochemistry and Molecular Biology, Oxford University Press, 1997, revised 2000 and reprinted 2003, ISBN 0 19 850673 2.
[0207] It is to be noted that the term a or an entity refers to one or more of that entity; for example, an antibody, is understood to represent one or more antibodies. As such, the terms a (or an), one or more, and at least one can be used interchangeably herein.
[0208] Activation, as used herein, refers to the state of a T cell that has been sufficiently stimulated to induce detectable cellular proliferation. Activation can also be associated with induced cytokine production, and detectable effector functions. The term activated T cells refers to, among other things, T cells that are undergoing cell division.
[0209] As used herein, reference to an antibody or equivalent agent that specifically binds, selectively binds, or preferentially binds FAP refers to an antibody that does not bind other unrelated proteins. In one example, an anti-FAP antibody or equivalent FAP-binding agent disclosed herein can bind human recombinant FAP or an epitope thereof and shows no binding above about 2 times background for other proteins. Information and databank accession numbers for the nucleotide and amino acid sequence of human FAP is given the background section, supra. In a preferred embodiment, the antibody of the present invention does not substantially recognize FAP homologues such as rhDPPIV, rhPOP/PREP, rhDPP8, and rhDPP9 or other unrelated human antigens; see Example 6 and
[0210] Furthermore, as used herein, reference to a FAP inhibitory antibody or equivalent agent that specifically inhibits, selectively inhibits, or preferentially inhibits FAP refers to an antibody or agent that selectively binds to and inhibits the enzymatic activity of FAP but does not substantially inhibit the enzymatic activity FAP homologues such as rhDPPIV, rhPOP/PREP, rhDPP8, and rhDPP9; see Example 6 and
[0211] The term pH refers to the Latin term pondus hydrogenii and symbolizes the logarithm of the reciprocal of hydrogen ion concentration in gram atoms per liter, used to express the acidity or alkalinity of a solution on a scale of 0 to 14, where less than 7 represents acidity, 7 neutrality, and more than 7 alkalinity. Pure water has a pH of about 7. The typical physiological pH of a normal human organ, tissue or microenvironment of a cell is 7.2-7.4 (average 7.4) while tumor tissues have been shown to have a more acidic extracellular pH (pHe) (pH=6.5-6.9); see, e.g., Estrella et al. Cancer Res. 73 (2013), 1524-1535 and references cited supra. As demonstrated in Example 18 and illustrated in
[0212] In addition, as used herein, reference to an anti-coagulant refers an anti-FAP antibody or equivalent FAP-binding agent which is capable in a dose dependent manner to prolong clot formation time of human blood plasma, preferably accompanied by reduction of the maximum clotting angle, decrease of maximum clot elasticity, and reduction of clot rigidity; see Example 13 and
[0213] In this context, as used herein, reference to a thrombolytic agent or thrombolytic therapy refers an anti-FAP antibody or equivalent FAP-binding agent and use thereof, respectively, which is capable of inhibiting FAP mediated activation of a2-Antiplasmin, a coagulation factor which inhibits plasmin-mediated thrombolysis; see Example 14 and
[0214] Since the sequences of the FAP antibodies of the present invention have been obtained from human subjects, the FAP antibodies of the present invention may also be called human auto-antibodies or human-derived antibodies in order to emphasize that those antibodies were indeed expressed initially by the subjects and are not synthetic constructs generated, for example, by means of human immunoglobulin expressing phage libraries, which hitherto represented one common method for trying to provide human-like antibodies. On the other hand, the human-derived antibody of the present invention may be denoted synthetic, recombinant, and/or biotechnological in order distinguish it from human serum antibodies per se, which may be purified via protein A or affinity column.
Peptides:
[0215] The term peptide is understood to include the terms polypeptide and protein (which, at times, may be used interchangeably herein) within its meaning. Similarly, fragments of proteins and polypeptides are also contemplated and may be referred to herein as peptides. Nevertheless, the term peptide preferably denotes an amino acid polymer including at least 5 contiguous amino acids, preferably at least 10 contiguous amino acids, more preferably at least 15 contiguous amino acids, still more preferably at least 20 contiguous amino acids, and particularly preferred at least 25 contiguous amino acids. In addition, the peptide in accordance with present invention typically has no more than 100 contiguous amino acids, preferably less than 80 contiguous amino acids, more preferably less than 50 contiguous amino acids and still more preferred no more than 15 contiguous amino acids of the FAP polypeptide.
Polypeptides:
[0216] As used herein, the term polypeptide is intended to encompass a singular polypeptide as well as plural polypeptides, and refers to a molecule composed of monomers (amino acids) linearly linked by amide bonds (also known as peptide bonds). The term polypeptide refers to any chain or chains of two or more amino acids, and does not refer to a specific length of the product. Thus, peptides, dipeptides, tripeptides, oligopeptides, protein, amino acid chain, or any other term used to refer to a chain or chains of two or more amino acids, are included within the definition of polypeptide, and the term polypeptide may be used instead of, or interchangeably with any of these terms.
[0217] The term polypeptide is also intended to refer to the products of post-expression modifications of the polypeptide, including without limitation glycosylation, acetylation, phosphorylation, amidation and derivatization by known protecting/blocking groups, proteolytic cleavage, or modification by non-naturally occurring amino acids. A polypeptide may be derived from a natural biological source or produced by recombinant technology, but is not necessarily translated from a designated nucleic acid sequence. It may be generated in any manner, including by chemical synthesis.
[0218] A polypeptide of the invention may be of a size of about 3 or more, 5 or more, 10 or more, 20 or more, 25 or more, 50 or more, 75 or more, 100 or more, 200 or more, 500 or more, 1,000 or more, or 2,000 or more amino acids. Polypeptides may have a defined three-dimensional structure, although they do not necessarily have such structure. Polypeptides with a defined three-dimensional structure are referred to as folded, and polypeptides which do not possess a defined three-dimensional structure, but rather can adopt a large number of different conformations, and are referred to as unfolded. As used herein, the term glycoprotein refers to a protein coupled to at least one carbohydrate moiety that is attached to the protein via an oxygen-containing or a nitrogen-containing side chain of an amino acid residue, e.g., a serine residue or an asparagine residue.
[0219] By an isolated polypeptide or a fragment, variant, or derivative thereof is intended a polypeptide that is not in its natural milieu. No particular level of purification is required. For example, an isolated polypeptide can be removed from its native or natural environment. Recombinantly produced polypeptides and proteins expressed in host cells are considered isolated for purposed of the invention, as are native or recombinant polypeptides which have been separated, fractionated, or partially or substantially purified by any suitable technique.
[0220] Recombinant peptides, polypeptides or proteins refer to peptides, polypeptides or proteins produced by recombinant DNA techniques, i.e. produced from cells, microbial or mammalian, transformed by an exogenous recombinant DNA expression construct encoding the fusion protein including the desired peptide. Proteins or peptides expressed in most bacterial cultures will typically be free of glycan. Proteins or polypeptides expressed in yeast may have a glycosylation pattern different from that expressed in mammalian cells.
[0221] Included as polypeptides of the present invention are fragments, derivatives, analogs or variants of the foregoing polypeptides and any combinations thereof as well. The terms fragment, variant, derivative, and analog include peptides and polypeptides having an amino acid sequence sufficiently similar to the amino acid sequence of the natural peptide. The term sufficiently similar means a first amino acid sequence that contains a sufficient or minimum number of identical or equivalent amino acid residues relative to a second amino acid sequence such that the first and second amino acid sequences have a common structural domain and/or common functional activity. For example, amino acid sequences that comprise a common structural domain that is at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100%, identical are defined herein as sufficiently similar. Preferably, variants will be sufficiently similar to the amino acid sequence of the preferred peptides of the present invention, in particular to FAP, variants, derivatives or analogs of either of them. Such variants generally retain the functional activity of the peptides of the present invention. Variants include peptides that differ in amino acid sequence from the native and wildtype peptide, respectively, by way of one or more amino acid deletion(s), addition(s), and/or substitution(s). These may be naturally occurring variants as well as artificially designed ones.
[0222] Furthermore, the terms fragment, variant, derivative, and analog when referring to antibodies or antibody polypeptides of the present invention include any polypeptides which retain at least some of the antigen-binding properties of the corresponding native binding molecule, antibody, or polypeptide. Fragments of polypeptides of the present invention include proteolytic fragments, as well as deletion fragments, in addition to specific antibody fragments discussed elsewhere herein. Variants of antibodies and antibody polypeptides of the present invention include fragments as described above, and also polypeptides with altered amino acid sequences due to amino acid substitutions, deletions, or insertions. Variants may occur naturally or be non-naturally occurring. Non-naturally occurring variants may be produced using art-known mutagenesis techniques. Variant polypeptides may comprise conservative or non-conservative amino acid substitutions, deletions or additions. Derivatives of FAP-specific binding molecules, e.g., antibodies, antibody polypeptides or chimeric antigen receptors (CARs) of the present invention, are polypeptides which have been altered so as to exhibit additional features not found on the native polypeptide. Examples include fusion proteins. Variant polypeptides may also be referred to herein as polypeptide analogs. As used herein a derivative of a binding molecule or fragment thereof, an antibody, an antibody polypeptide, a CAR refers to a subject polypeptide having one or more residues chemically derivatized by reaction of a functional side group. Also included as derivatives are those peptides which contain one or more naturally occurring amino acid derivatives of the twenty standard amino acids. For example, 4-hydroxyproline may be substituted for proline; 5-hydroxylysine may be substituted for lysine; 3-methylhistidine may be substituted for histidine; homoserine may be substituted for serine; and ornithine may be substituted for lysine.
Determination of Similarity and/or Identity of Molecules:
[0223] Similarity between two peptides is determined by comparing the amino acid sequence of one peptide to the sequence of a second peptide. An amino acid of one peptide is similar to the corresponding amino acid of a second peptide if it is identical or a conservative amino acid substitution. Conservative substitutions include those described in Dayhoff, M. O., ed., The Atlas of Protein Sequence and Structure 5, National Biomedical Research Foundation, Washington, D.C. (1978), and in Argos, EMBO J. 8 (1989), 779-785. For example, amino acids belonging to one of the following groups represent conservative changes or substitutions: -Ala, Pro, Gly, Gln, Asn, Ser, Thr; -Cys, Ser, Tyr, Thr; -Val, Be, Leu, Met, Ala, Phe; -Lys, Arg, His; -Phe, Tyr, Trp, His; and -Asp, Glu.
[0224] Similarity between two polynucleotides is determined by comparing the nucleic acid sequence of one polynucleotide to the sequence of a polynucleotide. A nucleic acid of one polynucleotide is similar to the corresponding nucleic acid of a second polynucleotide if it is identical or, if the nucleic acid is part of a coding sequence, the respective triplet comprising the nucleic acid encodes for the same amino acid or for a conservative amino acid substitution.
[0225] The determination of percent identity or similarity between two sequences is preferably accomplished using the mathematical algorithm of Karlin and Altschul (1993) Proc. Natl. Acad. Sci USA 90: 5873-5877. Such an algorithm is incorporated into the BLASTn and BLASTp programs of Altschul et al. (1990) J. Mol. Biol. 215: 403-410 available at NCBI (http://www.ncbi.nlm.nih.gov/blast/Blast.cge).
[0226] The determination of percent identity or similarity is performed with the standard parameters of the BLASTn programs for BLAST polynucleotide searches and BLASTp programs for BLAST protein search, as recommended on the NCBI webpage and in the BLAST Program Selection Guide in respect of sequences of a specific length and composition. BLAST polynucleotide searches are performed with the BLASTn program.
[0227] For the general parameters, the Max Target Sequences box may be set to 100, the Short queries box may be ticked, the Expect threshold box may be set to 1000 and the Word Size box may be set to 7 as recommended for short sequences (less than 20 bases) on the NCBI webpage. For longer sequences the Expect threshold box may be set to 10 and the Word Size box may be set to 11. For the scoring parameters the Match/mismatch Scores may be set to 1, 2 and the Gap Costs box may be set to linear. For the Filters and Masking parameters, the Low complexity regions box may not be ticked, the Species-specific repeats box may not be ticked, the Mask for lookup table only box may be ticked, the DUST Filter Settings may be ticked and the Mask lower case letters box may not be ticked. In general the Search for short nearly exact matches may be used in this respect, which provides most of the above indicated settings. Further information in this respect may be found in the BLAST Program Selection Guide published on the NCBI webpage.
[0228] BLAST protein searches are performed with the BLASTp program. For the general parameters, the Max Target Sequences box may be set to 100, the Short queries box may be ticked, the Expect threshold box may be set to 10 and the Word Size box may be set to 3. For the scoring parameters the Matrix box may be set to BLOSUM62, the Gap Costs Box may be set to Existence: 11 Extension: 1, the Compositional adjustments box may be set to Conditional compositional score matrix adjustment. For the Filters and Masking parameters the Low complexity regions box may not be ticked, the Mask for lookup table only box may not be ticked and the Mask lower case letters box may not be ticked.
[0229] Modifications of both programs, e.g., in respect of the length of the searched sequences, are performed according to the recommendations in the BLAST Program Selection Guide published in a HTML and a PDF version on the NCBI webpage.
Polynucleotides:
[0230] The term polynucleotide is intended to encompass a singular nucleic acid as well as plural nucleic acids, and refers to an isolated nucleic acid molecule or construct, e.g., messenger RNA (mRNA) or plasmid DNA (pDNA). A polynucleotide may comprise a conventional phosphodiester bond or a non-conventional bond (e.g., an amide bond, such as found in peptide nucleic acids (PNA)). The term nucleic acid refers to any one or more nucleic acid segments, e.g., DNA or RNA fragments, present in a polynucleotide. By isolated nucleic acid or polynucleotide is intended a nucleic acid molecule, DNA or RNA, which has been removed from its native environment. For example, a recombinant polynucleotide encoding an antibody contained in a vector is considered isolated for the purposes of the present invention. Further examples of an isolated polynucleotide include recombinant polynucleotides maintained in heterologous host cells or purified (partially or substantially) polynucleotides in solution. Isolated RNA molecules include in vivo or in vitro RNA transcripts of polynucleotides of the present invention. Isolated polynucleotides or nucleic acids according to the present invention further include such molecules produced synthetically. In addition, polynucleotide or a nucleic acid may be or may include a regulatory element such as a promoter, ribosome binding site, or a transcription terminator.
[0231] As used herein, a coding region is a portion of nucleic acid which consists of codons translated into amino acids. Although a stop codon (TAG, TGA, or TAA) is not translated into an amino acid, it may be considered to be part of a coding region, but any flanking sequences, for example promoters, ribosome binding sites, transcriptional terminators, introns, and the like, are not part of a coding region. Two or more coding regions of the present invention can be present in a single polynucleotide construct, e.g., on a single vector, or in separate polynucleotide constructs, e.g., on separate (different) vectors. Furthermore, any vector may contain a single coding region, or may comprise two or more coding regions, e.g., a single vector may separately encode an immunoglobulin heavy chain variable region and an immunoglobulin light chain variable region. In addition, a vector, polynucleotide, or nucleic acid of the invention may encode heterologous coding regions, either fused or unfused to a nucleic acid encoding a binding molecule, an antibody, or fragment, variant, a CAR, or derivative thereof. Heterologous coding regions include without limitation specialized elements or motifs, such as a secretory signal peptide or a heterologous functional domain.
[0232] In certain embodiments, the polynucleotide or nucleic acid is DNA. In the case of DNA, a polynucleotide comprising a nucleic acid which encodes a polypeptide normally may include a promoter and/or other transcription or translation control elements operable associated with one or more coding regions. An operable association is when a coding region for a gene product, e.g., a polypeptide, is associated with one or more regulatory sequences in such a way as to place expression of the gene product under the influence or control of the regulatory sequence(s). Two DNA fragments (such as a polypeptide coding region and a promoter associated therewith) are operable associated or operable linked if induction of promoter function results in the transcription of mRNA encoding the desired gene product and if the nature of the linkage between the two DNA fragments does not interfere with the ability of the expression regulatory sequences to direct the expression of the gene product or interfere with the ability of the DNA template to be transcribed. Thus, a promoter region would be operable associated with a nucleic acid encoding a polypeptide if the promoter was capable of effecting transcription of that nucleic acid. The promoter may be a cell-specific promoter that directs substantial transcription of the DNA only in predetermined cells. Other transcription control elements, besides a promoter, for example enhancers, operators, repressors, and transcription termination signals, can be operable associated with the polynucleotide to direct cell-specific transcription. Suitable promoters and other transcription control regions are disclosed herein.
[0233] A variety of transcription control regions are known to those skilled in the art. These include, without limitation, transcription control regions which function in vertebrate cells, such as, but not limited to, promoter and enhancer segments from cytomegaloviruses (the immediate early promoter, in conjunction with intron-A), simian virus 40 (the early promoter), and retroviruses (such as Rous sarcoma virus). Other transcription control regions include those derived from vertebrate genes such as actin, heat shock protein, bovine growth hormone and rabbit -globin, as well as other sequences capable of controlling gene expression in eukaryotic cells. Additional suitable transcription control regions include tissue-specific promoters and enhancers as well as lymphokine-inducible promoters (e.g., promoters inducible by interferons or interleukins).
[0234] Similarly, a variety of translation control elements are known to those of ordinary skill in the art. These include, but are not limited to ribosome binding sites, translation initiation and termination codons, and elements derived from picornaviruses (particularly an internal ribosome entry site, or IRES, also referred to as a CITE sequence).
[0235] In other embodiments, a polynucleotide of the present invention is RNA, for example, in the form of messenger RNA (mRNA).
[0236] Polynucleotide and nucleic acid coding regions of the present invention may be associated with additional coding regions which encode secretory or signal peptides, which direct the secretion of a polypeptide encoded by a polynucleotide of the present invention. According to the signal hypothesis, proteins secreted by mammalian cells have a signal peptide or secretory leader sequence which is cleaved from the mature protein once export of the growing protein chain across the rough endoplasmic reticulum has been initiated. Those of ordinary skill in the art are aware that polypeptides secreted by vertebrate cells generally have a signal peptide fused to the N-terminus of the polypeptide, which is cleaved from the complete or full-length polypeptide to produce a secreted or mature form of the polypeptide. In certain embodiments, the native signal peptide, e.g., an immunoglobulin heavy chain or light chain signal peptide is used, or a functional derivative of that sequence that retains the ability to direct the secretion of the polypeptide that is operable associated with it. Alternatively, a heterologous mammalian signal peptide, or a functional derivative thereof, may be used. For example, the wild-type leader sequence may be substituted with the leader sequence of human tissue plasminogen activator (TPA) or mouse -glucuronidase.
[0237] A binding molecule or FAP-binding agent as used in the context of the present invention relates primarily to antibodies, CARs, and fragments thereof, but may also refer to other non-antibody molecules that bind to FAP including but not limited to hormones, receptors, ligands, major histocompatibility complex (MHC) molecules, chaperones such as heat shock proteins (HSPs) as well as cell-cell adhesion molecules such as members of the cadherin, intergrin, C-type lectin and immunoglobulin (Ig) superfamilies. Thus, for the sake of clarity only and without restricting the scope of the present invention most of the following embodiments are discussed with respect to antibodies and antibody-like molecules, in particular CARs which represent the preferred binding molecules for the development of therapeutic and diagnostic agents.
Antibodies:
[0238] The terms antibody and immunoglobulin are used interchangeably herein. An antibody or immunoglobulin is a binding molecule which comprises at least the variable domain of a heavy chain, and normally comprises at least the variable domains of a heavy chain and a light chain. Basic immunoglobulin structures in vertebrate systems are relatively well understood; see, e.g., Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988).
[0239] As will be discussed in more detail below, the term immunoglobulin comprises various broad classes of polypeptides that can be distinguished biochemically. Those skilled in the art will appreciate that heavy chains are classified as gamma, mu, alpha, delta, or epsilon, (, , , , ) with some subclasses among them (e.g., 1-4). It is the nature of this chain that determines the class of the antibody as IgG, IgM, IgA IgG, or IgE, respectively. The immunoglobulin subclasses (isotypes) e.g., IgG1, IgG2, IgG3, IgG4, IgA1, etc. are well characterized and are known to confer functional specialization. Modified versions of each of these classes and isotypes are readily discernible to the skilled artisan in view of the instant disclosure and, accordingly, are within the scope of the instant invention. All immunoglobulin classes are clearly within the scope of the present invention, the following discussion will generally be directed to the IgG class of immunoglobulin molecules. With regard to IgG, a standard immunoglobulin molecule comprises two identical light chain polypeptides of molecular weight approximately 23,000 Daltons, and two identical heavy chain polypeptides of molecular weight 53,000-70,000. The four chains are typically joined by disulfide bonds in a Y configuration wherein the light chains bracket the heavy chains starting at the mouth of the Y and continuing through the variable region.
[0240] Light chains are classified as either kappa or lambda (, ). Each heavy chain class may be bound with either a kappa or lambda light chain. In general, the light and heavy chains are covalently bonded to each other, and the tail portions of the two heavy chains are bonded to each other by covalent disulfide linkages or non-covalent linkages when the immunoglobulins are generated either by hybridomas, B cells or genetically engineered host cells. In the heavy chain, the amino acid sequences run from an N-terminus at the forked ends of the Y configuration to the C-terminus at the bottom of each chain.
[0241] Both the light and heavy chains are divided into regions of structural and functional homology. The terms constant and variable are used functionally. In this regard, it will be appreciated that the variable domains of both the light (V.sub.L) and heavy (V.sub.H) chain portions determine antigen recognition and specificity. Conversely, the constant domains of the light chain (CL) and the heavy chain (CH1, CH2 or CH3) confer important biological properties such as secretion, transplacental mobility, Fc receptor binding, complement binding, and the like. By convention the numbering of the constant region domains increases as they become more distal from the antigen-binding site or amino-terminus of the antibody. The N-terminal portion is a variable region and at the C-terminal portion is a constant region; the CH3 and CL domains actually comprise the carboxy-terminus of the heavy and light chain, respectively.
[0242] As indicated above, the variable region allows the antibody to selectively recognize and specifically bind epitopes on antigens. That is, the V.sub.L domain and V.sub.H domain, or subset of the complementarity determining regions (CDRs), of an antibody combine to form the variable region that defines a three dimensional antigen-binding site. This quaternary antibody structure forms the antigen-binding site present at the end of each arm of the Y. More specifically, the antigen-binding site is defined by three CDRs on each of the V.sub.H and V.sub.L chains. Any antibody or immunoglobulin fragment which contains sufficient structure to specifically bind to FAP is denoted herein interchangeably as a binding fragment or an immunospecific fragment.
[0243] In naturally occurring antibodies, an antibody comprises six hypervariable regions, sometimes called complementarity determining regions or CDRs present in each antigen-binding domain, which are short, non-contiguous sequences of amino acids that are specifically positioned to form the antigen-binding domain as the antibody assumes its three dimensional configuration in an aqueous environment. The CDRs are flanked by four relatively conserved framework regions or FRs which show less inter-molecular variability. The framework regions largely adopt a (3-sheet conformation and the CDRs form loops which connect, and in some cases form part of, the -sheet structure. Thus, framework regions act to form a scaffold that provides for positioning the CDRs in correct orientation by inter-chain, non-covalent interactions. The antigen-binding domain formed by the positioned CDRs defines a surface complementary to the epitope on the immunoreactive antigen. This complementary surface promotes the non-covalent binding of the antibody to its cognate epitope. The amino acids comprising the CDRs and the framework regions, respectively, can be readily identified for any given heavy or light chain variable region by one of ordinary skill in the art, since they have been precisely defined; see, Sequences of Proteins of Immunological Interest, Kabat, E., et al., U.S. Department of Health and Human Services, (1983); and Chothia and Lesk, J. Mol. Biol., 196 (1987), 901-917.
[0244] In the case where there are two or more definitions of a term which is used and/or accepted within the art, the definition of the term as used herein is intended to include all such meanings unless explicitly stated to the contrary. A specific example is the use of the term complementarity determining region (CDR) to describe the non-contiguous antigen combining sites found within the variable region of both heavy and light chain polypeptides. This particular region has been described by Kabat et al., U.S. Dept. of Health and Human Services, Sequences of Proteins of Immunological Interest (1983) and by Chothia and Lesk, J. Mol. Biol., 196 (1987), 901-917, which are incorporated herein by reference, where the definitions include overlapping or subsets of amino acid residues when compared against each other. Nevertheless, application of either definition to refer to a CDR of an antibody or variants thereof is intended to be within the scope of the term as defined and used herein. The appropriate amino acid residues which encompass the CDRs as defined by each of the above cited references are set forth below in Table I as a comparison. The exact residue numbers which encompass a particular CDR will vary depending on the sequence and size of the CDR. Those skilled in the art can routinely determine which residues comprise a particular hypervariable region or CDR of the human IgG subtype of antibody given the variable region amino acid sequence of the antibody.
TABLE-US-00002 TABLE I CDR Definitions.sup.1 Kabat Chothia VH CDR1 31-35 26-32 VH CDR2 50-65 52-58 VH CDR3 95-102 95-102 VL CDR1 24-34 26-32 VL CDR2 50-56 50-52 VL CDR3 89-97 91-96 .sup.1Numbering of all CDR definitions in Table I is according to the numbering conventions set forth by Kabat et al. (see below).
[0245] Kabat et al. also defined a numbering system for variable domain sequences that is applicable to any antibody. One of ordinary skill in the art can unambiguously assign this system of Kabat numbering to any variable domain sequence, without reliance on any experimental data beyond the sequence itself. As used herein, Kabat numbering refers to the numbering system set forth by Kabat et al., U.S. Dept. of Health and Human Services, Sequence of Proteins of Immunological Interest (1983). Unless otherwise specified, references to the numbering of specific amino acid residue positions in an antibody or antigen-binding fragment, variant, or derivative thereof of the present invention are according to the Kabat numbering system, which however is theoretical and may not equally apply to every antibody of the present invention. For example, depending on the position of the first CDR the following CDRs might be shifted in either direction.
[0246] Antibodies or antigen-binding fragments, immunospecific fragments, variants, or derivatives thereof of the invention include, but are not limited to, polyclonal, monoclonal, multispecific, human, humanized, primatized, murinized or chimeric antibodies, single chain antibodies, epitope-binding fragments, e.g., Fab, Fab and F(ab)2, Fd, Fvs, single-chain Fvs (scFv), single-chain antibodies, disulfide-linked Fvs (sdFv), fragments comprising either a V.sub.L or V.sub.H domain, fragments produced by a Fab expression library, and anti-idiotypic (anti-Id) antibodies (including, e.g., anti-Id antibodies to antibodies disclosed herein). ScFv molecules are known in the art and are described, e.g., in U.S. Pat. No. 5,892,019. Immunoglobulin or antibody molecules of the invention can be of any type (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2) or subclass of immunoglobulin molecule.
[0247] In one embodiment, antibodies or antigen-binding fragments, immunospecific fragments, variants, or derivatives thereof of the invention further include, but are not limited to bispecific antibodies, trifunctional antibodies, tetrabodies, bispecific T-cell engagers (BiTEs), bispecific killer cell engagers (BiKEs), dual affinity retargeting molecules (DARTs) and DuoBodies, which are all well known in the art and are described; see the documents cited supra. Thus, in this embodiment the antibodies or antigen-binding fragments, immunospecific fragments, variants, or derivatives thereof of the present invention do not only bind to FAP, but at least one further epitope/target. In a preferred embodiment, in addition to FAP the antibody of the present invention binds to the death receptor 5 (DRS) or to CD3.
[0248] In one embodiment, the antibody of the present invention is not IgM or a derivative thereof with a pentavalent structure. Particular, in specific applications of the present invention, especially therapeutic use, IgMs are less useful than IgG and other bivalent antibodies or corresponding binding molecules since IgMs due to their pentavalent structure and lack of affinity maturation often show unspecific cross-reactivities and very low affinity.
[0249] In a particularly preferred embodiment, the antibody of the present invention is not a polyclonal antibody, i.e. it substantially consists of one particular antibody species rather than being a mixture obtained from a plasma immunoglobulin sample.
[0250] Antibody fragments, including single-chain antibodies, may comprise the variable region(s) alone or in combination with the entirety or a portion of the following: hinge region, CH1, CH2, and CH3 domains. Also included in the invention are FAP binding fragments which comprise any combination of variable region(s) with a hinge region, CH1, CH2, and CH3 domains. Antibodies or immunospecific fragments thereof of the present invention may be from any animal origin including birds and mammals. Preferably, the antibodies are human, murine, donkey, rabbit, goat, guinea pig, camel, llama, horse, or chicken antibodies. In another embodiment, the variable region may be condricthoid in origin (e.g., from sharks).
[0251] In one aspect, the antibody of the present invention is a human monoclonal antibody isolated from a human. Optionally, the framework region of the human antibody is aligned and adopted in accordance with the pertinent human germ line variable region sequences in the database; see, e.g., Vbase (http://vbase.mrc-cpe.cam.ac.uk/) hosted by the MRC Centre for Protein Engineering (Cambridge, UK). For example, amino acids considered to potentially deviate from the true germ line sequence could be due to the PCR primer sequences incorporated during the cloning process. Compared to artificially generated human-like antibodies such as single chain antibody fragments (scFvs) from a phage displayed antibody library or xenogeneic mice the human monoclonal antibody of the present invention is characterized by (i) being obtained using the human immune response rather than that of animal surrogates, i.e. the antibody has been generated in response to natural FAP in its relevant conformation in the human body, (ii) having protected the individual or is at least significant for the presence of FAP, and (iii) since the antibody is of human origin the risks of cross-reactivity against self-antigens is minimized. Thus, in accordance with the present invention the terms human monoclonal antibody, human monoclonal autoantibody, human antibody and the like are used to denote a FAP binding molecule which is of human origin, i.e. which has been isolated from a human cell such as a B cell or hybridoma thereof or the cDNA of which has been directly cloned from mRNA of a human cell, for example a human memory B cell. A human antibody is still human, i.e. human-derived even if amino acid substitutions are made in the antibody, e.g., to improve binding characteristics.
[0252] In one embodiment the human-derived antibodies of the present invention comprises heterologous regions compared to the natural occurring antibodies, e.g. amino acid substitutions in the framework region, constant region exogenously fused to the variable region, different amino acids at the C- or N-terminal ends and the like.
[0253] Antibodies derived from human immunoglobulin libraries or from animals transgenic for one or more human immunoglobulins and that do not express endogenous immunoglobulins, as described infra and, for example in, U.S. Pat. No. 5,939,598 by Kucherlapati et al., are denoted human-like antibodies in order distinguish them from truly human antibodies of the present invention.
[0254] For example, the paring of heavy and light chains of human-like antibodies such as synthetic and semi-synthetic antibodies typically isolated from phage display do not necessarily reflect the original paring as it occurred in the original human B cell. Accordingly Fab and scFv fragments obtained from recombinant expression libraries as commonly used in the prior art can be considered as being artificial with all possible associated effects on immunogenicity and stability.
[0255] In contrast, the present invention provides isolated affinity-matured antibodies from selected human subjects, which are characterized by their therapeutic utility and their tolerance in man.
[0256] As used herein, the term rodentized antibody or rodentized immunoglobulin refers to an antibody comprising one or more CDRs from a human antibody of the present invention; and a human framework region that contains amino acid substitutions and/or deletions and/or insertions that are based on a rodent antibody sequence. When referred to rodents, preferably sequences originating in mice and rats are used, wherein the antibodies comprising such sequences are referred to as murinized or ratinized respectively. The human immunoglobulin providing the CDRs is called the parent or acceptor and the rodent antibody providing the framework changes is called the donor. Constant regions need not be present, but if they are, they are usually substantially identical to the rodent antibody constant regions, i.e. at least about 85% to 90%, preferably about 95% or more identical. Hence, in some embodiments, a full-length murinized human heavy or light chain immunoglobulin contains a mouse constant region, human CDRs, and a substantially human framework that has a number of murinizing amino acid substitutions. Typically, a murinized antibody is an antibody comprising a murinized variable light chain and/or a murinized variable heavy chain. For example, a murinized antibody would not encompass a typical chimeric antibody, e.g., because the entire variable region of a chimeric antibody is non-mouse. A modified antibody that has been murinized by the process of murinization binds to the same antigen as the parent antibody that provides the CDRs and is usually less immunogenic in mice, as compared to the parent antibody. The above explanations in respect of murinized antibodies apply analogously for other rodentized antibodies, such as ratinized antibodies, wherein rat sequences are used instead of the murine.
[0257] As used herein, the term heavy chain portion includes amino acid sequences derived from an immunoglobulin heavy chain. A polypeptide comprising a heavy chain portion comprises at least one of: a CH1 domain, a hinge (e.g., upper, middle, and/or lower hinge region) domain, a CH2 domain, a CH3 domain, or a variant or fragment thereof. For example, a binding polypeptide for use in the invention may comprise a polypeptide chain comprising a CH1 domain; a polypeptide chain comprising a CH1 domain, at least a portion of a hinge domain, and a CH2 domain; a polypeptide chain comprising a CH1 domain and a CH3 domain; a polypeptide chain comprising a CH1 domain, at least a portion of a hinge domain, and a CH3 domain, or a polypeptide chain comprising a CH1 domain, at least a portion of a hinge domain, a CH2 domain, and a CH3 domain. In another embodiment, a polypeptide of the invention comprises a polypeptide chain comprising a CH3 domain. Further, a binding polypeptide for use in the invention may lack at least a portion of a CH2 domain (e.g., all or part of a CH2 domain). As set forth above, it will be understood by one of ordinary skill in the art that these domains (e.g., the heavy chain portions) may be modified such that they vary in amino acid sequence from the naturally occurring immunoglobulin molecule.
[0258] In certain antibodies, or antigen-binding fragments, variants, or derivatives thereof disclosed herein, the heavy chain portions of one polypeptide chain of a multimer are identical to those on a second polypeptide chain of the multimer. Alternatively, heavy chain portion-containing monomers of the invention are not identical. For example, each monomer may comprise a different target binding site, forming, for example, a bispecific antibody or diabody.
[0259] In another embodiment, the antibodies, or antigen-binding fragments, variants, or derivatives thereof disclosed herein are composed of a single polypeptide chain such as scFvs and are to be expressed intracellularly (intrabodies) for potential in vivo therapeutic and diagnostic applications.
[0260] The heavy chain portions of a binding polypeptide for use in the diagnostic and treatment methods disclosed herein may be derived from different immunoglobulin molecules. For example, a heavy chain portion of a polypeptide may comprise a CH1 domain derived from an IgG1 molecule and a hinge region derived from an IgG3 molecule. In another example, a heavy chain portion can comprise a hinge region derived, in part, from an IgG1 molecule and, in part, from an IgG3 molecule. In another example, a heavy chain portion can comprise a chimeric hinge derived, in part, from an IgG1 molecule and, in part, from an IgG4 molecule.
[0261] As used herein, the term light chain portion includes amino acid sequences derived from an immunoglobulin light chain. Preferably, the light chain portion comprises at least one of a V.sub.L or CL domain.
[0262] The minimum size of a peptide or polypeptide epitope for an antibody is thought to be about four to five amino acids. Peptide or polypeptide epitopes preferably contain at least seven, more preferably at least nine and most preferably between at least about 15 to about 30 amino acids. Since a CDR can recognize an antigenic peptide or polypeptide in its tertiary form, the amino acids comprising an epitope need not be contiguous, and in some cases, may not even be on the same peptide chain. In the present invention, a peptide or polypeptide epitope recognized by antibodies of the present invention contains a sequence of at least 4, at least 5, at least 6, at least 7, more preferably at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, or between about 15 to about 30 contiguous or non-contiguous amino acids of FAP.
[0263] As previously indicated, the subunit structures and three dimensional configuration of the constant regions of the various immunoglobulin classes are well known. As used herein, the term V.sub.H domain includes the amino terminal variable domain of an immunoglobulin heavy chain and the term CH1 domain includes the first (most amino terminal) constant region domain of an immunoglobulin heavy chain. The CH1 domain is adjacent to the V.sub.H domain and is amino terminal to the hinge region of an immunoglobulin heavy chain molecule.
[0264] As used herein the term CH2 domain includes the portion of a heavy chain molecule that extends, e.g., from about residue 244 to residue 360 of an antibody using conventional numbering schemes (residues 244 to 360, Kabat numbering system; and residues 231-340, EU numbering system; see Kabat E A et al. op. cit). The CH2 domain is unique in that it is not closely paired with another domain. Rather, two N-linked branched carbohydrate chains are interposed between the two CH2 domains of an intact native IgG molecule. It is also well documented that the CH3 domain extends from the CH2 domain to the C-terminal of the IgG molecule and comprises approximately 108 residues.
[0265] As used herein, the term hinge region includes the portion of a heavy chain molecule that joins the CH1 domain to the CH2 domain. This hinge region comprises approximately 25 residues and is flexible, thus allowing the two N-terminal antigen-binding regions to move independently. Hinge regions can be subdivided into three distinct domains: upper, middle, and lower hinge domains; see Roux et al., J. Immunol. 161 (1998), 4083-4090.
[0266] As used herein the term disulfide bond includes the covalent bond formed between two sulfur atoms. The amino acid cysteine comprises a thiol group that can form a disulfide bond or bridge with a second thiol group. In most naturally occurring IgG molecules, the CH1 and CL regions are linked by a disulfide bond and the two heavy chains are linked by two disulfide bonds at positions corresponding to 239 and 242 using the Kabat numbering system (position 226 or 229, EU numbering system).
[0267] As used herein, the terms linked, fused or fusion are used interchangeably. These terms refer to the joining together of two more elements or components, by whatever means including chemical conjugation or recombinant means. An in-frame fusion refers to the joining of two or more polynucleotide open reading frames (ORFs) to form a continuous longer ORF, in a manner that maintains the correct translational reading frame of the original ORFs. Thus, a recombinant fusion protein is a single protein containing two or more segments that correspond to polypeptides encoded by the original ORFs (which segments are not normally so joined in nature). Although the reading frame is thus made continuous throughout the fused segments, the segments may be physically or spatially separated by, for example, in-frame linker sequence. For example, polynucleotides encoding the CDRs of an immunoglobulin variable region may be fused, in-frame, but be separated by a polynucleotide encoding at least one immunoglobulin framework region or additional CDR regions, as long as the fused CDRs are co-translated as part of a continuous polypeptide.
[0268] The term expression as used herein refers to a process by which a gene produces a biochemical, for example, an RNA or polypeptide. The process includes any manifestation of the functional presence of the gene within the cell including, without limitation, gene knockdown as well as both transient expression and stable expression. It includes without limitation transcription of the gene into messenger RNA (mRNA), transfer RNA (tRNA), small hairpin RNA (shRNA), small interfering RNA (siRNA) or any other RNA product, and the translation of mRNA into polypeptide(s). If the final desired product is a biochemical, expression includes the creation of that biochemical and any precursors. Expression of a gene produces a gene product. As used herein, a gene product can be either a nucleic acid, e.g., a messenger RNA produced by transcription of a gene, or a polypeptide which is translated from a transcript. Gene products described herein further include nucleic acids with post transcriptional modifications, e.g., polyadenylation, or polypeptides with post translational modifications, e.g., methylation, glycosylation, the addition of lipids, association with other protein subunits, proteolytic cleavage, and the like.
[0269] As used herein, the term sample refers to any biological material obtained from a subject or patient. In one aspect, a sample can comprise blood, peritoneal fluid, CSF, saliva or urine. In other aspects, a sample can comprise whole blood, blood plasma, blood serum, B cells enriched from blood samples, and cultured cells (e.g., B cells from a subject). A sample can also include a biopsy or tissue sample including neural tissue. In still other aspects, a sample can comprise whole cells and/or a lysate of the cells. Blood samples can be collected by methods known in the art. In one aspect, the pellet can be resuspended by vortexing at 4 C. in 200 l buffer (20 mM Tris, pH. 7.5, 0.5% Nonidet, 1 mM EDTA, 1 mM PMSF, 0.1 M NaCl, IX Sigma Protease Inhibitor, and IX Sigma Phosphatase Inhibitors 1 and 2). The suspension can be kept on ice for 20 min. with intermittent vortexing. After spinning at 15,000g for 5 min at about 4 C., aliquots of supernatant can be stored at about 70 C.
Chimeric Antigen Receptors (CARs):
[0270] As used herein, the term Chimeric Antigen Receptor and CAR, respectively, refers to a recombinant polypeptide construct, e.g. fusion protein comprising at least an extracellular antigen binding domain, a transmembrane domain and a cytoplasmic signaling domain comprising a functional signaling domain derived from a stimulatory molecule as defined below. Thus, CARs are generally generated by fusing the antigen-binding domain/region, for example single chain fragment of the variable region (scFv) of a monoclonal antibody (mAb) to membrane-spanning and intracellular-signaling domains; see, e.g. FIG. 1 of Dai et al. (Dai et al., JNCI J. Natl. Cancer. Inst. 108 (2016), 1-15: djv439) for schematic representation of the CAR structure. In one embodiment, the stimulatory molecule is the zeta chain associated with the T cell receptor complex. In one embodiment, the cytoplasmic signaling domain further comprises one or more functional signaling domains derived from at least one costimulatory molecule as defined below. In one aspect, the costimulatory molecule is chosen from the group consisting of CD27, CD28, 4-1BB (i.e., CD137), OX40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD 7, LIGHT, NKG2C, B7-H3, a ligand that specifically binds with CD83, and any combination thereof. Unless indicated otherwise, the definition of the basic structure and components of CARs as defined in the international application WO 2014/055442 apply.
[0271] In one embodiment the CAR comprises an optional leader sequence at the amino-terminus (N-ter) of the CAR fusion protein. In one aspect, the CAR further comprises a leader sequence at the N-terminus of the extracellular antigen recognition domain, wherein the leader sequence is optionally cleaved from the antigen binding domain during cellular processing and localization of the CAR to the cellular membrane.
[0272] As used herein, a signaling domain is the functional portion of a protein which acts by transmitting information within the cell to regulate cellular activity via defined signaling pathways by generating second messengers or functioning as effectors by responding to such messengers.
[0273] By the term stimulation, used in the context of CAR T cell, is meant a primary response induced by binding of a stimulatory molecule (e.g., a TCR/CD3 complex) with its cognate ligand thereby mediating a signal transduction event, such as, but not limited to, signal transduction via the TCR/CD3 complex. Stimulation can mediate altered expression of certain molecules, such as downregulation of TGF-, and/or reorganization of cytoskeletal structures, and the like.
[0274] A stimulatory molecule, used in the context of CAR T, means a molecule expressed by a T cell that provide the primary cytoplasmic signaling sequence(s) that regulate primary activation of the TCR complex in a stimulatory way of the T cell signaling pathway. In one embodiment, the primary signal is initiated by, for instance, binding of a TCR/CD3 complex with an MHC molecule loaded with peptide, and which leads to mediation of a T cell response, including, but not limited to, proliferation, activation, differentiation, and the like. Primary cytoplasmic signaling sequences that act in a stimulatory manner may contain signaling motifs which are known as immunoreceptor tyrosine-based activation motifs or ITAMs. Examples of ITAM containing primary cytoplasmic signaling sequences that are of particular use in the invention include those derived from TCR zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CDS, CD22, CD79a, CD79b, CD278 (also known as ICOS) and CD66d. In a specific CAR of the invention, the cytoplasmic signaling molecule in any one or more CARS of the invention, including CARs comprises a cytoplasmic signaling sequence derived from CD3-zeta.
[0275] As used herein zeta or alternatively zeta chain, CD3-zeta or TCR-zeta is defined as the protein provided as GenBank Accession No. BAG36664.1, or the equivalent residues from a non-human species, e.g., mouse, rodent, monkey, ape and the like, and a zeta stimulatory domain or alternatively a CD3-zeta stimulatory domain or a TCR-zeta stimulatory domain is defined as the amino acid residues from the cytoplasmic domain of the zeta chain that are sufficient to functionally transmit an initial signal necessary for T cell activation. In one aspect the cytoplasmic domain of zeta comprises residues 52 through 164 of GenBank Accession No. BAG36664.1 or the equivalent residues from a non-human species, e.g., mouse, rodent, monkey, ape and the like, that are functional orthologs thereof.
[0276] A costimulatory molecule refers to the cognate binding partner on a T cell that specifically binds with a costimulatory ligand, thereby mediating a costimulatory response by the T cell, such as, but not limited to, proliferation. Costimulatory molecules are cell surface molecules other than antigen receptors or their ligands that are required for an efficient immune response. Costimulatory molecules include, but are not limited to an MHC class I molecule, BTLA and a Toll ligand receptor, as well as OX40, CD27, CD28, CDS, ICAM-1, LFA-1 (CD1 1a/CD18) and 4-1BB (CD137).
[0277] As used herein 4-1BB is defined as member of the TNFR superfamily with an amino acid sequence provided as GenBank Accession No. AAA62478.2, or the equivalent residues from a non-human species, e.g., mouse, rodent, monkey, ape and the like; and a 4-1BB costimulatory domain are defined amino acid residues 214-255 of GenBank Accession No. AAA62478.2, or the equivalent residues from a non-human species, e.g., mouse, rodent, monkey, ape and the like.
[0278] As used herein, the terms linked, fused or fusion are used interchangeably. These terms refer to the joining together of two more elements or components, by whatever means including chemical conjugation or recombinant means. An in-frame fusion refers to the joining of two or more polynucleotide open reading frames (ORFs) to form a continuous longer ORF, in a manner that maintains the correct translational reading frame of the original ORFs. Thus, a recombinant fusion protein is a single protein containing two or more segments that correspond to polypeptides encoded by the original ORFs (which segments are not normally so joined in nature). Although the reading frame is thus made continuous throughout the fused segments, the segments may be physically or spatially separated by, for example, in-frame linker sequence. For example, polynucleotides encoding the CDRs of an immunoglobulin variable region may be fused, in-frame, but be separated by a polynucleotide encoding at least one immunoglobulin framework region or additional CDR regions, as long as the fused CDRs are co-translated as part of a continuous polypeptide.
[0279] The term expression as used herein refers to a process by which a gene produces a biochemical, for example, an RNA or polypeptide. The process includes any manifestation of the functional presence of the gene within the cell including, without limitation, gene knockdown as well as both transient expression and stable expression. It includes without limitation transcription of the gene into messenger RNA (mRNA), transfer RNA (tRNA), small hairpin RNA (shRNA), small interfering RNA (siRNA) or any other RNA product, and the translation of mRNA into polypeptide(s). If the final desired product is a biochemical, expression includes the creation of that biochemical and any precursors. Expression of a gene produces a gene product. As used herein, a gene product can be either a nucleic acid, e.g., a messenger RNA produced by transcription of a gene, or a polypeptide which is translated from a transcript. Gene products described herein further include nucleic acids with post transcriptional modifications, e.g., polyadenylation, or polypeptides with post translational modifications, e.g., methylation, glycosylation, the addition of lipids, association with other protein subunits, proteolytic cleavage, and the like.
Binding Characteristics of Antibodies and Chimeric Antigen Receptors (CARs):
[0280] By specifically binding, or specifically recognizing, used interchangeably herein, it is generally meant that a binding molecule, e.g., an antibody or CAR binds to an epitope via its antigen-binding domain, and that the binding entails some complementarity between the antigen-binding domain and the epitope. According to this definition, the binding molecule is said to specifically bind to an epitope when it binds to that epitope, via its antigen-binding domain more readily than it would bind to a random, unrelated epitope. The term specificity is used herein to qualify the relative affinity by which a certain antibody or CAR binds to a certain epitope. For example, antibody or CAR A may be deemed to have a higher specificity for a given epitope than antibody or CAR B, or antibody or CAR A may be said to bind to epitope C with a higher specificity than it has for related epitope D.
[0281] Where present, the term immunological binding characteristics, or other binding characteristics of an antibody or a CAR with an antigen, in all of its grammatical forms, refers to the specificity, affinity, cross-reactivity, and other binding characteristics of an antibody or CAR.
[0282] By preferentially binding, it is meant that the binding molecule, e.g., antibody or CAR specifically binds to an epitope more readily than it would bind to a related, similar, homologous, or analogous epitope. Thus, a binding molecule which preferentially binds to a given epitope would more likely bind to that epitope than to a related epitope, even though such an antibody or CAR may cross-react with the related epitope.
[0283] By way of non-limiting example, a binding molecule, e.g., an antibody or CAR may be considered to bind a first epitope preferentially if it binds said first epitope with a dissociation constant (K.sub.D) that is less than the binding molecule's K.sub.D for the second epitope. In another non-limiting example, a binding molecule may be considered to bind a first antigen preferentially if it binds the first epitope with an affinity that is at least one order of magnitude less than the binding molecule's K.sub.D for the second epitope. In another non-limiting example, an antibody or CAR may be considered to bind a first epitope preferentially if it binds the first epitope with an affinity that is at least two orders of magnitude less than the binding molecule's K.sub.D for the second epitope.
[0284] In another non-limiting example, a binding molecule, e.g., an antibody or CAR may be considered to bind a first epitope preferentially if it binds the first epitope with an off rate (k(off)) that is less than the binding molecule's k(off) for the second epitope. In another non-limiting example, an binding molecule may be considered to bind a first epitope preferentially if it binds the first epitope with an affinity that is at least one order of magnitude less than the binding molecule's k(off) for the second epitope. In another non-limiting example, an antibody or CAR may be considered to bind a first epitope preferentially if it binds the first epitope with an affinity that is at least two orders of magnitude less than the binding molecule's k(off) for the second epitope.
[0285] A binding molecule, e.g., an antibody or antigen-binding fragment, variant, CAR, or derivative disclosed herein may be said to bind FAP or a fragment, variant or specific conformation thereof with an off rate (k(off)) of less than or equal to 510.sup.2 sec.sup.1, 10.sup.2 sec.sup.1, 510.sup.3 sec.sup.1 or 10.sup.3 sec.sup.1. More preferably, an antibody or CAR of the invention may be said to bind FAP or a fragment, variant or specific conformation thereof with an off rate (k(off)) less than or equal to 510.sup.4 sec.sup.1, 10.sup.4 sec.sup.1, 510.sup.5 sec.sup.1, or 10.sup.5 sec.sup.1 510.sup.6 sec.sup.1, 10.sup.6 sec.sup.1, 510.sup.7 sec.sup.1 or 10.sup.7 sec.sup.1.
[0286] A binding molecule, e.g., an antibody or antigen-binding fragment, variant, CAR, or derivative disclosed herein may be said to bind FAP or a fragment, variant or specific conformation thereof with an on rate (k(on)) of greater than or equal to 10.sup.3 M.sup.1 sec.sup.1, 510.sup.3M.sup.1 sec.sup.1, 10.sup.4 M.sup.1 sec.sup.1 or 510.sup.4 M.sup.1 sec.sup.1. More preferably, an antibody or CAR of the invention may be said to bind FAP or a fragment, variant or specific conformation thereof with an on rate (k(on)) greater than or equal to 10.sup.5 M.sup.1 sec.sup.1, 510.sup.5 M.sup.1 sec.sup.1, 10.sup.6 M.sup.1 sec.sup.1, or 510.sup.6 M.sup.1 sec.sup.1 or 10.sup.7 M.sup.1 sec.sup.1.
[0287] A binding molecule, e.g., an antibody or CAR is said to competitively inhibit binding of a reference antibody or CAR to a given epitope if it preferentially binds to that epitope to the extent that it blocks, to some degree, binding of the reference antibody or CAR to the epitope. Competitive inhibition may be determined by any method known in the art, for example, competition ELISA assays. A binding molecule may be said to competitively inhibit binding of the reference antibody or CAR to a given epitope by at least 90%, at least 80%, at least 70%, at least 60%, or at least 50%.
[0288] As used herein, the term affinity refers to a measure of the strength of the binding of an individual epitope with the CDR of a binding molecule, e.g., an immunoglobulin molecule or CAR; see, e.g., Harlow et al., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 2nd ed. (1988) at pages 27-28. As used herein, the term avidity refers to the overall stability of the complex between a population of binding molecules and an antigen, that is, the functional combining strength of an binding molecule mixture with the antigen; see, e.g., Harlow at pages 29-34. Avidity is related to both the affinity of individual binding molecules in the population with specific epitopes, and also the valences of the binding molecules and the antigen. For example, the interaction between a bivalent monoclonal antibody and an antigen with a highly repeating epitope structure, such as a polymer, would be one of high avidity. The affinity or avidity of an antibody for an antigen can be determined experimentally using any suitable method; see, for example, Berzofsky et al., Antibody-Antigen Interactions In Fundamental Immunology, Paul, W. E., Ed., Raven Press New York, N Y (1984), Kuby, Janis Immunology, W. H. Freeman and Company New York, N Y (1992), and methods described herein. General techniques for measuring the affinity of an antibody or CAR for an antigen include ELISA, RIA, and surface plasmon resonance. The measured affinity of a particular antibody/CAR-antigen interaction can vary if measured under different conditions, e.g., salt concentration, pH. Thus, measurements of affinity and other antigen-binding parameters, e.g., K.sub.D, IC.sub.50, are preferably made with standardized solutions of antibody/CAR and antigen, and a standardized buffer.
[0289] Binding molecules, e.g., antibodies or antigen-binding fragments, variants, CARs or derivatives thereof of the invention may also be described or specified in terms of their cross-reactivity. As used herein, the term cross-reactivity refers to the ability of a binding molecule, specific for one antigen, to react with a second antigen; a measure of relatedness between two different antigenic substances. Thus, a binding molecule is cross reactive if it binds to an epitope other than the one that induced its formation. The cross-reactive epitope generally contains many of the same complementary structural features as the inducing epitope, and in some cases, may actually fit better than the original.
[0290] For example, certain antibodies or CARs have some degree of cross-reactivity, in that they bind related, but non-identical epitopes, e.g., epitopes with at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 65%, at least 60%, at least 55%, and at least 50% identity (as calculated using methods known in the art and described herein) to a reference epitope. An antibody or CAR may be said to have little or no cross-reactivity if it does not bind epitopes with less than 95%, less than 90%, less than 85%, less than 80%, less than 75%, less than 70%, less than 65%, less than 60%, less than 55%, and less than 50% identity (as calculated using methods known in the art and described herein) to a reference epitope. An antibody or CAR may be deemed highly specific for a certain epitope, if it does not bind any other analog, ortholog, or homolog of that epitope.
[0291] Binding molecules, e.g., antibodies or antigen-binding fragments, variants, CARs or derivatives thereof of the invention may also be described or specified in terms of their binding affinity to FAP and/or fragments thereof. Preferred binding affinities include those with a dissociation constant or Kd less than 510.sup.2M, 10.sup.2M, 510.sup.3M, 10.sup.3M, 510.sup.4M, 10.sup.4M, 510.sup.5M, 10.sup.5M, 510.sup.6 M, 10.sup.6M, 510.sup.7 M, 10.sup.7M, 510.sup.8 M, 10.sup.8 M, 510.sup.9M, 10.sup.9 M, 510.sup.10 M, 10.sup.10 M, 510.sup.11 M, 10.sup.11M, 510.sup.12M, 10.sup.12 M, 510.sup.13M, 10.sup.13M, 510.sup.14M, 10.sup.14 M, 510.sup.15M, or 10.sup.15 M.
Diseases:
[0292] Unless stated otherwise, the terms disorder and disease are used interchangeably herein and comprise any undesired physiological change in a subject, an animal, an isolated organ, tissue or cell/cell culture. FAP-related diseases and disorders comprise but are not limited to: [0293] Proliferative diseases including metastatic breast cancer, colorectal cancer, kidney cancer, chronic lymphocytary leukemia, pancreatic adenocarcinoma, carcinoma, invasive lobular carcinoma, non-small cell lung cancer, myeloma and tumor stroma. [0294] Diseases involving tissue remodeling and/or chronic inflammation (including but not limited to fibrotic disease, wound healing, keloid formation, osteoarthritis, rheumatoid arthritis and related disorders involving cartilage degradation, atherosclerotic disease and Crohn's disease). [0295] Diseases involving endocrinological disorder (including but not limited to disorders of glucose metabolism) and diseases involving blood clotting disorders. [0296] Cardiovascular diseases including heart disorders, as well as disorders of the blood vessels of the circulation system caused by, e.g., abnormally high concentrations of lipids in the blood vessels, atherosclerosis, atherosclerotic plaques, atherothrombosis, myocardial infarction heart attack, chronic liver disease, cerebral venous thrombosis, deep venous thrombosis and pulmonary embolism.
[0297] The term cancer and tumor may be used interchangeably herein and defines as disease characterized by the rapid and uncontrolled growth of aberrant cells. Cancer cells can spread locally or through the bloodstream and lymphatic system to other parts of the body. Examples of various cancers include but are not limited to, breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, renal cancer, liver cancer, brain cancer, lymphoma, leukemia, lung cancer and the like. Preferably, cancer and tumor cells are characterized by aberrant expression of FAP on their cell surface.
Treatment:
[0298] As used herein, the terms treat or treatment refer to both therapeutic treatment and prophylactic or preventative measures, wherein the object is to prevent or slow down (lessen) an undesired physiological change or disorder, such as the development of cardiac deficiency or tumors, preferably as characterized above. Beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable. Treatment can also mean prolonging survival as compared to expected survival if not receiving treatment. Those in need of treatment include those already with the condition or disorder as well as those prone to have the condition or disorder or those in which the manifestation of the condition or disorder is to be prevented.
[0299] If not stated otherwise the term drug, medicine, or medicament are used interchangeably herein and shall include but are not limited to all (A) articles, medicines and preparations for internal or external use, and any substance or mixture of substances intended to be used for diagnosis, cure, mitigation, treatment, or prevention of disease of either man or other animals; and (B) articles, medicines and preparations (other than food) intended to affect the structure or any function of the body of man or other animals; and (C) articles intended for use as a component of any article specified in clause (A) and (B). The term drug, medicine, or medicament shall include the complete formula of the preparation intended for use in either man or other animals containing one or more agents, compounds, substances or (chemical) compositions as and in some other context also other pharmaceutically inactive excipients as fillers, disintegrants, lubricants, glidants, binders or ensuring easy transport, disintegration, disaggregation, dissolution and biological availability of the drug, medicine, or medicament at an intended target location within the body of man or other animals, e.g., at the skin, in the stomach or the intestine. The terms agent, compound, or substance are used interchangeably herein and shall include, in a more particular context, but are not limited to all pharmacologically active agents, i.e. agents that induce a desired biological or pharmacological effect or are investigated or tested for the capability of inducing such a possible pharmacological effect by the methods of the present invention.
[0300] The term anti-tumor effect as used herein, refers to a biological effect which can be manifested by various means, including but not limited to, a decrease in tumor volume, a decrease in the number of tumor cells, a decrease in the number of metastases, an increase in life expectancy, a decrease in tumor cell proliferation, a decrease in tumor cell survival, or amelioration of various physiological symptoms associated with the cancerous condition. An anti-tumor effect can also be manifested by the ability of the peptides, polynucleotides, cells, antibodies and CARs of the invention in prevention of the occurrence of tumor in the first place.
[0301] By subject or individual or animal or patient or mammal, is meant any subject, particularly a mammalian subject, e.g., a human patient, for whom diagnosis, prognosis, prevention, or therapy is desired.
Pharmaceutical Carriers:
[0302] Pharmaceutically acceptable carriers and administration routes can be taken from corresponding literature known to the person skilled in the art. The pharmaceutical compositions of the present invention can be formulated according to methods well known in the art; see for example Remington: The Science and Practice of Pharmacy (2000) by the University of Sciences in Philadelphia, ISBN 0-683-306472, Vaccine Protocols 2nd Edition by Robinson et al., Humana Press, Totowa, N.J., USA, 2003; Banga, Therapeutic Peptides and Proteins: Formulation, Processing, and Delivery Systems. 2nd Edition by Taylor and Francis. (2006), ISBN: 0-8493-1630-8. Examples of suitable pharmaceutical carriers are well known in the art and include phosphate buffered saline solutions, water, emulsions, such as oil/water emulsions, various types of wetting agents, sterile solutions etc. Compositions comprising such carriers can be formulated by well-known conventional methods. These pharmaceutical compositions can be administered to the subject at a suitable dose. Administration of the suitable compositions may be effected by different ways. Examples include administering a composition containing a pharmaceutically acceptable carrier via oral, intranasal, rectal, topical, intraperitoneal, intravenous, intramuscular, subcutaneous, subdermal, transdermal, intrathecal, and intracranial methods. Aerosol formulations such as nasal spray formulations include purified aqueous or other solutions of the active agent with preservative agents and isotonic agents. Such formulations are preferably adjusted to a pH and isotonic state compatible with the nasal mucous membranes. Pharmaceutical compositions for oral administration, such as single domain antibody molecules (e.g., Nanobodies) etc. are also envisaged in the present invention. Such oral formulations may be in tablet, capsule, powder, liquid or semi-solid form. A tablet may comprise a solid carrier, such as gelatin or an adjuvant. Formulations for rectal or vaginal administration may be presented as a suppository with a suitable carrier; see also O'Hagan et al., Nature Reviews, Drug Discovery 2(9) (2003), 727-735. Further guidance regarding formulations that are suitable for various types of administration can be found in Remington's Pharmaceutical Sciences, Mace Publishing Company, Philadelphia, Pa., 17th ed. (1985) and corresponding updates. For a brief review of methods for drug delivery see Langer, Science 249 (1990), 1527-1533.
II. Antibodies of the Present Invention
[0303] The present invention generally relates to human-derived anti-FAP antibodies and antigen-binding fragments thereof, which preferably demonstrate the immunological binding characteristics and/or biological properties as outlined for the antibodies illustrated in the Examples. In accordance with the present invention human monoclonal antibodies specific for FAP were cloned from a pool of healthy human subjects. However, in another embodiment of the present invention, the human monoclonal anti-FAP antibodies might also be cloned from patients showing symptoms of a FAP-related disease and/or disorder associated with FAP.
[0304] In the course of the experiments performed in accordance with the present invention, antibodies present in the conditioned media of cultured human memory B cell were evaluated for their capacity to bind to FAP and to more than 10 other proteins including bovine serum albumin (BSA). Only the B-cell supernatants able to bind to the FAP protein but not to any of the other proteins in the screen were selected for further analysis, including determination of the antibody class and light chain subclass. The selected B-cells were then processed for antibody cloning.
[0305] In brief, this consisted in the extraction of messenger RNAs from the selected B-cells, retro-transcription by RT-PCR, amplification of the antibody-coding regions by PCR, cloning into plasmid vectors and sequencing. Selected human antibodies were then produced by recombinant expression in HEK293 or CHO cells and purification, and subsequently characterized for their capacity to bind human FAP protein. The combination of various tests, e.g. recombinant expression of the antibodies in HEK293 or CHO cells and the subsequent characterization of their binding specificities towards human FAP protein, and their distinctive binding to FAP and not to FAP homologues confirmed that for the first time human antibodies have been cloned that are highly specific for FAP and distinctively recognize and selectively bind FAP protein. In some cases, mouse chimeric antibodies are generated on the basis of the variable domains of the human antibodies of the present invention. As described in Example 9 and shown in
[0306] Thus, the present invention generally relates to recombinant human-derived monoclonal anti-FAP antibody and biotechnological and synthetic derivatives thereof. In one embodiment of the present invention, the antibody is capable of binding human and murine FAP; see Example 7 and
[0307] In one embodiment, the present invention is directed to an anti-FAP antibody, or antigen-binding fragment, variant or derivatives thereof, where the antibody specifically binds to the same epitope of FAP as a reference antibody selected from the group consisting of NI-206.18H2, NI-206.82C2, NI-206.59B4, NI-206.22F7, NI-206.27E8, NI-206.12G4, and NI-206.17A6; see Example 3 and
[0308] In one embodiment, the antibody of the present invention exhibits the binding properties of the exemplary NI-206.82C2, NI-206.59B4, NI-206.22F7, NI-206.27E8, NI-206.12G4, NI-206.17A6, NI-206.18H2, NI-206.20A8, NI-206.6D3, NI-206.14C5 and NI-206.34C11 antibodies as described in the Examples.
[0309] The term does not substantially recognize when used in the present application to describe the binding affinity of a molecule of a group comprising an antibody, a fragment thereof or a binding molecule for a specific target molecule, antigen and/or conformation of the target molecule and/or antigen means that the molecule of the aforementioned group binds said molecule, antigen and/or conformation with a binding affinity which is at least 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold or 9-fold less than the binding affinity of the molecule of the aforementioned group for binding another molecule, antigen and/or conformation. Very often the dissociation constant (KD) is used as a measure of the binding affinity. Sometimes, it is the EC50 on a specific assay as for example an ELISA assay that is used as a measure of the binding affinity. Preferably the term does not substantially recognize when used in the present application means that the molecule of the aforementioned group binds said molecule, antigen and/or conformation with a binding affinity which is at least or 10-fold, 20-fold, 50-fold, 100-fold, 1000-fold or 10000-fold less than the binding affinity of said molecule of the aforementioned group for binding to another molecule, antigen and/or conformation. In this context, the binding affinities may be in the range as shown for the NI-206.82C2, NI-206.59B4, NI-206.22F7, NI-206.27E8, NI-206.12G4, NI-206.17A6, NI-206.18H2, NI-206.20A8 and NI-206.6D3 antibodies in
[0310] Some antibodies are able to bind to a wide array of biomolecules, e.g., proteins. As the skilled artisan will appreciate, the term specific is used herein to indicate that other biomolecules than FAP protein or fragments thereof do not significantly bind to the antigen-binding molecule, e.g., one of the antibodies of the present invention. Preferably, the level of binding to a biomolecule other than FAP results in a binding affinity which is at most only 20% or less, 10% or less, only 5% or less, only 2% or less or only 1% or less (i.e. at least 5, 10, 20, 50 or 100 fold lower, or anything beyond that) of the affinity to FAP, respectively; see e.g.,
[0311] The present invention further exemplifies several binding molecules, e.g., antibodies and binding fragments thereof, which may be characterized by comprising in their variable region, e.g., binding domain at least one complementarity determining region (CDR) of the V.sub.H and/or V.sub.L variable region comprising any one of the amino acid sequences depicted in
[0312] In one embodiment, the antibody of the present invention is any one of the antibodies comprising an amino acid sequence of the V.sub.H and/or V.sub.L region as depicted in
[0313] In a further embodiment of the present invention the anti-FAP antibody, FAP-binding fragment, synthetic or biotechnological variant thereof can be optimized to have appropriate binding affinity to the target and pharmacokinetic properties. Therefore, at least one amino acid in the CDR or variable region, which is prone to modifications selected from the group consisting of glycosylation, oxidation, deamination, peptide bond cleavage, iso-aspartate formation and/or unpaired cysteine is substituted by a mutated amino acid that lack such alteration or wherein at least one carbohydrate moiety is deleted or added chemically or enzymatically to the antibody. Examples for amino acid optimization can be found in e.g. international applications WO 2010/121140 and WO 2012/049570. Additional modification optimizing the antibody properties are described in Gavel et al., Protein Engineering 3 (1990), 433-442 and Helenius et al., Annu. Rev. Biochem. 73 (2004), 1019-1049.
[0314] Alternatively, the antibody of the present invention is an antibody or antigen-binding fragment, derivative or variant thereof, which competes for binding to FAP with at least one of the antibodies having the V.sub.H and/or V.sub.L region as depicted in any one of
[0315] The antibody of the present invention may be human, in particular for therapeutic applications. Alternatively, the antibody of the present invention is a rodent, rodentized or chimeric rodent-human antibody, preferably a murine, murinized or chimeric murine-human antibody or a rat, ratinized or chimeric rat-human antibody which are particularly useful for diagnostic methods and studies in animals. In one embodiment the antibody of the present invention is a chimeric rodent-human or a rodentized antibody.
[0316] As mentioned above, due to its generation upon a human immune response the human monoclonal antibody of the present invention will recognize epitopes which are of particular pathological relevance and which might not be accessible or less immunogenic in case of immunization processes for the generation of, for example, mouse monoclonal antibodies and in vitro screening of phage display libraries, respectively. Accordingly, it is prudent to stipulate that the epitope of the human anti-FAP antibody of the present invention is unique and no other antibody which is capable of binding to the epitope recognized by the human monoclonal antibody of the present invention exists. A further indication for the uniqueness of the antibodies of the present invention is the fact that, as indicated in the Examples, for the first time a selective and potent FAP inhibitory anti-FAP antibody NI-206.82C2 has been provided, which may not be obtainable by the usual processes for antibody generation, such as immunization or in vitro library screenings.
[0317] Therefore, in one embodiment the present invention also extends generally to anti-FAP antibodies and FAP-binding molecules which compete with the human monoclonal antibody of the present invention for specific binding to FAP. The present invention is more specifically directed to an antibody, or antigen-binding fragment, variant or derivatives thereof, where the antibody specifically binds to the same epitope of FAP as a reference antibody selected from the group consisting of NI-206.18H2, NI-206.82C2, NI-206.59B4, NI-206.22F7, NI-206.27E8, NI-206.12G4 and NI-206.17A6.
[0318] Competition between antibodies is determined by an assay in which the immunoglobulin under test inhibits specific binding of a reference antibody to a common antigen, such as FAP. Numerous types of competitive binding assays are known, for example: solid phase direct or indirect radioimmunoassay (RIA), solid phase direct or indirect enzyme immunoassay (EIA), sandwich competition assay; see Stahli et al., Methods in Enzymology 9 (1983), 242-253; solid phase direct biotin-avidin EIA; see Kirkland et al., J. Immunol. 137 (1986), 3614-3619 and Cheung et al., Virology 176 (1990), 546-552; solid phase direct labeled assay, solid phase direct labeled sandwich assay; see Harlow and Lane, Antibodies, A Laboratory Manual, Cold Spring Harbor Press (1988); solid phase direct label RIA using I.sup.125 label; see Morel et al., Molec. Immunol. 25 (1988), 7-15 and Moldenhauer et al., Scand. J. Immunol. 32 (1990), 77-82. Typically, such an assay involves the use of purified FAP or epitope containing antigen thereof bound to a solid surface or cells bearing either of these, an unlabeled test immunoglobulin and a labeled reference immunoglobulin, i.e. the human monoclonal antibody of the present invention. Competitive inhibition is measured by determining the amount of label bound to the solid surface or cells in the presence of the test immunoglobulin. Usually the test immunoglobulin is present in excess. Preferably, the competitive binding assay is performed under conditions as described for the ELISA assay in the appended Examples. Antibodies identified by competition assay (competing antibodies) include antibodies binding to the same epitope as the reference antibody and antibodies binding to an adjacent epitope sufficiently proximal to the epitope bound by the reference antibody for steric hindrance to occur. Usually, when a competing antibody is present in excess, it will inhibit specific binding of a reference antibody to a common antigen by at least 50% or 75%. Hence, the present invention is further drawn to an antibody, or antigen-binding fragment, variant or derivatives thereof, where the antibody competitively inhibits a reference antibody selected from the group consisting of NI-206.82C2, NI-206.59B4, NI-206.22F7, NI-206.27E8, NI-206.12G4, NI-206.17A6, NI-206.18H2, NI-206.20A8, NI-206.6D3, NI-206.14C5 and NI-206.34C11 from binding to FAP or fragments thereof
[0319] In another embodiment, the present invention provides an isolated polypeptide comprising, consisting essentially of, or consisting of an immunoglobulin heavy chain variable region (V.sub.H), where at least one of V.sub.H-CDRs of the heavy chain variable region or at least two of the V.sub.H-CDRs of the heavy chain variable region are at least 80%, 85%, 90% or 95% identical to reference heavy chain V.sub.H-CDR1, V.sub.H-CDR2 or V.sub.H-CDR3 amino acid sequences from the antibodies disclosed herein. Alternatively, the V.sub.H-CDR1, V.sub.H-CDR2 and V.sub.H-CDR3 regions of the V.sub.H are at least 80%, 85%, 90% or 95% identical to reference heavy chain V.sub.H-CDR1, V.sub.H-CDR2 and V.sub.H-CDR3 amino acid sequences from the antibodies disclosed herein. Thus, according to this embodiment a heavy chain variable region of the invention has V.sub.H-CDR1, V.sub.H-CDR2 and V.sub.H-CDR3 polypeptide sequences related to the groups shown in
[0320] In another embodiment, the present invention provides an isolated polypeptide comprising, consisting essentially of, or consisting of an immunoglobulin heavy chain variable region (V.sub.H) in which the V.sub.H-CDR1, V.sub.H-CDR2 and V.sub.H-CDR3 regions have polypeptide sequences which are identical to the V.sub.H-CDR1, V.sub.H-CDR2 and V.sub.H-CDR3 groups shown in
[0321] In another embodiment, the present invention provides an isolated polypeptide comprising, consisting essentially of, or consisting of an immunoglobulin heavy chain variable region (V.sub.H) in which the V.sub.H-CDR1, V.sub.H-CDR2 and V.sub.H-CDR3 regions have polypeptide sequences which are identical to the V.sub.H-CDR1, V.sub.H-CDR2 and V.sub.H-CDR3 groups shown in
[0322] In another embodiment, the present invention provides an isolated polypeptide comprising, consisting essentially of, or consisting of an immunoglobulin light chain variable region (V.sub.L), where at least one of the V.sub.L-CDRs of the light chain variable region or at least two of the V.sub.L-CDRs of the light chain variable region are at least 80%, 85%, 90% or 95% identical to reference light chain V.sub.L-CDR1, V.sub.L-CDR2 or V.sub.L-CDR3 amino acid sequences from antibodies disclosed herein. Alternatively, the V.sub.L-CDR1, V.sub.L-CDR2 and V.sub.L-CDR3 regions of the V.sub.L are at least 80%, 85%, 90% or 95% identical to reference light chain V.sub.L-CDR1, V.sub.L-CDR2 and V.sub.L-CDR3 amino acid sequences from antibodies disclosed herein. Thus, according to this embodiment a light chain variable region of the invention has V.sub.L-CDR1, V.sub.L-CDR2 and V.sub.L-CDR3 polypeptide sequences related to the polypeptides shown in
[0323] In another embodiment, the present invention provides an isolated polypeptide comprising, consisting essentially of, or consisting of an immunoglobulin heavy chain variable region (V.sub.L) in which the V.sub.L-CDR1, V.sub.L-CDR2 and V.sub.L-CDR3 regions have polypeptide sequences which are identical to the V.sub.L-CDR1, V.sub.L-CDR2 and V.sub.L-CDR3 groups shown in
[0324] An immunoglobulin or its encoding cDNA may be further modified. Thus, in a further embodiment the method of the present invention comprises any one of the step(s) of producing a chimeric antibody, murinized antibody, single-chain antibody, Fab-fragment, bi-specific antibody, fusion antibody, labeled antibody or an analog of any one of those. Corresponding methods are known to the person skilled in the art and are described, e.g., in Harlow and Lane Antibodies, A Laboratory Manual, CSH Press, Cold Spring Harbor (1988). When derivatives of said antibodies are obtained by the phage display technique, surface plasmon resonance as employed in the BIAcore system can be used to increase the efficiency of phage antibodies which bind to the same epitope as that of any one of the antibodies described herein (Schier, Human Antibodies Hybridomas 7 (1996), 97-105; Malmborg, J. Immunol. Methods 183 (1995), 7-13). The production of chimeric antibodies is described, for example, in international application WO 89/09622. Methods for the production of humanized antibodies are described in, e.g., European application EP-A1 0 239 400 and international application WO 90/07861. Further sources of antibodies to be utilized in accordance with the present invention are so-called xenogeneic antibodies. The general principle for the production of xenogeneic antibodies such as human-like antibodies in mice is described in, e.g., international applications WO 91/10741, WO 94/02602, WO 96/34096 and WO 96/33735. As discussed above, the antibody of the invention may exist in a variety of forms besides complete antibodies; including, for example, Fv, Fab and F(ab).sub.2, as well as in single chains; see e.g. international application WO 88/09344. In one embodiment therefore, the antibody of the present invention is provided, which is selected from the group consisting of a single chain Fv fragment (scFv), a F(ab) fragment, a F(ab) fragment, and a F(ab)2 fragment.
[0325] The antibodies of the present invention or their corresponding immunoglobulin chain(s) can be further modified using conventional techniques known in the art, for example, by using amino acid deletion(s), insertion(s), substitution(s), addition(s), and/or recombination(s) and/or any other modification(s) known in the art either alone or in combination. Methods for introducing such modifications in the DNA sequence underlying the amino acid sequence of an immunoglobulin chain are well known to the person skilled in the art; see, e.g., Sambrook, Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory (1989) N.Y. and Ausubel, Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, N.Y. (1994). Modifications of the antibody of the invention include chemical and/or enzymatic derivatizations at one or more constituent amino acids, including side chain modifications, backbone modifications, and N- and C-terminal modifications including acetylation, hydroxylation, methylation, amidation, and the attachment of carbohydrate or lipid moieties, cofactors, and the like. Likewise, the present invention encompasses the production of chimeric proteins which comprise the described antibody or some fragment thereof at the amino terminus fused to heterologous molecule such as an immunostimulatory ligand at the carboxyl terminus; see, e.g., international application WO 00/30680 for corresponding technical details.
[0326] Additionally, the present invention encompasses peptides including those containing a binding molecule as described above, for example containing the CDR3 region of the variable region of any one of the mentioned antibodies, in particular CDR3 of the heavy chain since it has frequently been observed that heavy chain CDR3 (HCDR3) is the region having a greater degree of variability and a predominant participation in antigen-antibody interaction. Such peptides may easily be synthesized or produced by recombinant means to produce a binding agent useful according to the invention. Such methods are well known to those of ordinary skill in the art. Peptides can be synthesized for example, using automated peptide synthesizers which are commercially available. The peptides can also be produced by recombinant techniques by incorporating the DNA expressing the peptide into an expression vector and transforming cells with the expression vector to produce the peptide.
[0327] Hence, the present invention relates to any FAP-binding molecule, e.g., an antibody or binding fragment thereof which is oriented towards the anti-FAP antibodies and/or antibodies capable of binding FAP and/or fragments thereof and displays the mentioned properties for exemplary recombinant human NI-206.82C2, NI-206.59B4, NI-206.22F7, NI-206.27E8, NI-206.12G4, NI-206.17A6, NI-206.18H2, NI-206.20A8, NI-206.6D3, NI-206.14C5 and NI-206.34C11. Such antibodies and binding molecules can be tested for their binding specificity and affinity by ELISA and immunohistochemistry as described herein, see, e.g., the Examples. These characteristics of the antibodies and binding molecules can be tested by Western Blot as well.
[0328] As an alternative to obtaining immunoglobulins directly from the culture of B cells or memory B cells, the cells can be used as a source of rearranged heavy chain and light chain loci for subsequent expression and/or genetic manipulation. Rearranged antibody genes can be reverse transcribed from appropriate mRNAs to produce cDNA. If desired, the heavy chain constant region can be exchanged for that of a different isotype or eliminated altogether. The variable regions can be linked to encode single chain Fv regions. Multiple Fv regions can be linked to confer binding ability to more than one target or chimeric heavy and light chain combinations can be employed. Once the genetic material is available, design of analogs as described above which retain both their ability to bind the desired target is straightforward. Methods for the cloning of antibody variable regions and generation of recombinant antibodies are known to the person skilled in the art and are described, for example, Gilliland et al., Tissue Antigens 47 (1996), 1-20; Doenecke et al., Leukemia 11 (1997), 1787-1792.
[0329] Once the appropriate genetic material is obtained and, if desired, modified to encode an analog, the coding sequences, including those that encode, at a minimum, the variable regions of the heavy and light chain, can be inserted into expression systems contained on vectors which can be transfected into standard recombinant host cells. A variety of such host cells may be used; for efficient processing, however, mammalian cells are preferred. Typical mammalian cell lines useful for this purpose include, but are not limited to, CHO cells, HEK 293 cells, or NSO cells.
[0330] The production of the antibody or analog is then undertaken by culturing the modified recombinant host under culture conditions appropriate for the growth of the host cells and the expression of the coding sequences. The antibodies are then recovered by isolating them from the culture. The expression systems are preferably designed to include signal peptides so that the resulting antibodies are secreted into the medium; however, intracellular production is also possible.
[0331] In accordance with the above, the present invention also relates to a polynucleotide encoding the antibody or equivalent binding molecule of the present invention, in case of the antibody preferably at least a variable region of an immunoglobulin chain of the antibody described above. Typically, said variable region encoded by the polynucleotide comprises at least one complementarity determining region (CDR) of the V.sub.H and/or V.sub.L of the variable region of the said antibody. In one embodiment of the present invention, the polynucleotide is a cDNA.
[0332] The person skilled in the art will readily appreciate that the variable domain of the antibody having the above-described variable domain can be used for the construction of other polypeptides or antibodies of desired specificity and biological function. Thus, the present invention also encompasses polypeptides and antibodies comprising at least one CDR of the above-described variable domain and which advantageously have substantially the same or similar binding properties as the antibody described in the appended examples. The person skilled in the art knows that binding affinity may be enhanced by making amino acid substitutions within the CDRs or within the hypervariable loops (Chothia and Lesk, J. Mol. Biol. 196 (1987), 901-917) which partially overlap with the CDRs as defined by Kabat; see, e.g., Riechmann, et al, Nature 332 (1988), 323-327. Thus, the present invention also relates to antibodies wherein one or more of the mentioned CDRs comprise one or more, preferably not more than two amino acid substitutions. Preferably, the antibody of the invention comprises in one or both of its immunoglobulin chains two or all three CDRs of the variable regions as set forth in
[0333] Binding molecules, e.g., antibodies, or antigen-binding fragments, variants, or derivatives thereof of the invention, as known by those of ordinary skill in the art, can comprise a constant region which mediates one or more effector functions. For example, binding of the C1 component of complement to an antibody constant region may activate the complement system. Activation of complement is important in the opsonization and lysis of cell pathogens. The activation of complement also stimulates the inflammatory response and may also be involved in autoimmune hypersensitivity. Further, antibodies bind to receptors on various cells via the Fc region, with a Fc receptor binding site on the antibody Fc region binding to a Fc receptor (FcR) on a cell. There are a number of Fc receptors which are specific for different classes of antibody, including IgG (gamma receptors), IgE (epsilon receptors), IgA (alpha receptors) and IgM (mu receptors). Binding of antibody to Fc receptors on cell surfaces triggers a number of important and diverse biological responses including engulfment and destruction of antibody-coated particles, clearance of immune complexes, lysis of antibody-coated target cells by killer cells (called antibody-dependent cell-mediated cytotoxicity, or ADCC), release of inflammatory mediators, placental transfer and control of immunoglobulin production.
[0334] Accordingly, certain embodiments of the present invention include an antibody, or antigen-binding fragment, variant, or derivative thereof, in which at least a fraction of one or more of the constant region domains has been deleted or otherwise altered so as to provide desired biochemical characteristics such as reduced effector functions, the ability to non-covalently dimerize, increased ability to localize at the site of FAP expression on the cell surface, e.g., on tumor cells, reduced serum half-life, or increased serum half-life when compared with a whole, unaltered antibody of approximately the same immunogenicity. For example, certain antibodies for use in the diagnostic and treatment methods described herein are domain deleted antibodies which comprise a polypeptide chain similar to an immunoglobulin heavy chain, but which lack at least a portion of one or more heavy chain domains. For instance, in certain antibodies, one entire domain of the constant region of the modified antibody will be deleted, for example, all or part of the CH2 domain will be deleted. In other embodiments, certain antibodies for use in the diagnostic and treatment methods described herein have a constant region, e.g., an IgG heavy chain constant region, which is altered to eliminate glycosylation, referred to elsewhere herein as aglycosylated or agly antibodies. Such agly antibodies may be prepared enzymatically as well as by engineering the consensus glycosylation site(s) in the constant region. While not being bound by theory, it is believed that agly antibodies may have an improved safety and stability profile in vivo. Methods of producing aglycosylated antibodies, having desired effector function are found for example in international application WO 2005/018572, which is incorporated by reference in its entirety.
[0335] In certain antibodies, or antigen-binding fragments, variants, or derivatives thereof described herein, the Fc portion may be mutated to decrease effector function using techniques known in the art. For example, the deletion or inactivation (through point mutations or other means) of a constant region domain may reduce Fc receptor binding of the circulating modified antibody thereby increasing FAP localization. In other cases it may be that constant region modifications consistent with the instant invention moderate complement binding and thus reduce the serum half-life and nonspecific association of a conjugated cytotoxin. Yet other modifications of the constant region may be used to modify disulfide linkages or oligosaccharide moieties that allow for enhanced localization due to increased antigen specificity or antibody flexibility. The resulting physiological profile, bioavailability and other biochemical effects of the modifications, such as FAP localization, biodistribution and serum half-life, may easily be measured and quantified using well know immunological techniques without undue experimentation.
[0336] In certain antibodies, or antigen-binding fragments, variants, or derivatives thereof described herein, the Fc portion may be mutated or exchanged for alternative protein sequences to increase the cellular uptake of antibodies by way of example by enhancing receptor-mediated endocytosis of antibodies via Fc receptors, LRP, or Thy1 receptors or by SuperAntibody Technology, which is said to enable antibodies to be shuttled into living cells without harming them (Expert Opin. Biol. Ther. (2005), 237-241). For example, the generation of fusion proteins of the antibody binding region and the cognate protein ligands of cell surface receptors or bi- or multi-specific antibodies with a specific sequences binding to FAP as well as a cell surface receptor may be engineered using techniques known in the art.
[0337] In certain antibodies, or antigen-binding fragments, variants, or derivatives thereof described herein, the Fc portion may be mutated or exchanged for alternative protein sequences or the antibody may be chemically modified to increase its blood brain barrier penetration.
[0338] Modified forms of antibodies, or antigen-binding fragments, variants, or derivatives thereof of the invention can be made from whole precursor or parent antibodies using techniques known in the art. Exemplary techniques are discussed in more detail herein. Antibodies, or antigen-binding fragments, variants, or derivatives thereof of the invention can be made or manufactured using techniques that are known in the art. In certain embodiments, antibody molecules or fragments thereof are recombinantly produced, i.e., are produced using recombinant DNA technology. Exemplary techniques for making antibody molecules or fragments thereof are discussed in more detail elsewhere herein.
[0339] Antibodies, or antigen-binding fragments, variants, or derivatives thereof of the invention also include derivatives that are modified, e.g., by the covalent attachment of any type of molecule to the antibody such that covalent attachment does not prevent the antibody from specifically binding to its cognate epitope. For example, but not by way of limitation, the antibody derivatives include antibodies that have been modified, e.g., by glycosylation, acetylation, pegylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to a cellular ligand or other protein, etc. Any of numerous chemical modifications may be carried out by known techniques, including, but not limited to specific chemical cleavage, acetylation, formylation, metabolic synthesis of tunicamycin, etc. Additionally, the derivative may contain one or more non-classical amino acids.
[0340] In particular preferred embodiments, antibodies, or antigen-binding fragments, variants, or derivatives thereof of the invention will not elicit a deleterious immune response in the animal to be treated, e.g., in a human. In certain embodiments, binding molecules, e.g., antibodies, or antigen-binding fragments thereof of the invention are derived from a patient, e.g., a human patient, and are subsequently used in the same species from which they are derived, e.g., human, alleviating or minimizing the occurrence of deleterious immune responses.
[0341] De-immunization can also be used to decrease the immunogenicity of an antibody. As used herein, the term de-immunization includes alteration of an antibody to modify T cell epitopes; see, e.g., international applications WO 98/52976 and WO 00/34317. For example, V.sub.H and V.sub.L sequences from the starting antibody are analyzed and a human T cell epitope map from each V region showing the location of epitopes in relation to complementarity determining regions (CDRs) and other key residues within the sequence. Individual T cell epitopes from the T cell epitope map are analyzed in order to identify alternative amino acid substitutions with a low risk of altering activity of the final antibody. A range of alternative V.sub.H and V.sub.L sequences are designed comprising combinations of amino acid substitutions and these sequences are subsequently incorporated into a range of binding polypeptides, e.g., FAP-specific antibodies or immunospecific fragments thereof for use in the diagnostic and treatment methods disclosed herein, which are then tested for function. Typically, between 12 and 24 variant antibodies are generated and tested. Complete heavy and light chain genes comprising modified V and human C regions are then cloned into expression vectors and the subsequent plasmids introduced into cell lines for the production of whole antibody. The antibodies are then compared in appropriate biochemical and biological assays, and the optimal variant is identified.
[0342] Monoclonal antibodies can be prepared using a wide variety of techniques known in the art including the use of hybridoma, recombinant, and phage display technologies, or a combination thereof. For example, monoclonal antibodies can be produced using hybridoma techniques including those known in the art and taught, for example, in Harlow et al., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 2nd ed. (1988); Hammerling et al., in: Monoclonal Antibodies and T-Cell Hybridomas Elsevier, N.Y., 563-681 (1981), said references incorporated by reference in their entireties. The term monoclonal antibody as used herein is not limited to antibodies produced through hybridoma technology. The term monoclonal antibody refers to an antibody that is derived from a single clone, including any eukaryotic, prokaryotic, or phage clone, and not the method by which it is produced. Thus, the term monoclonal antibody is not limited to antibodies produced through hybridoma technology. In certain embodiments, antibodies of the present invention are derived from human B cells which have been immortalized via transformation with Epstein-Barr virus, as described herein.
[0343] In the well-known hybridoma process (Kohler et al., Nature 256 (1975), 495) the relatively short-lived, or mortal, lymphocytes from a mammal, e.g., B cells derived from a human subject as described herein, are fused with an immortal tumor cell line (e.g., a myeloma cell line), thus, producing hybrid cells or hybridomas which are both immortal and capable of producing the genetically coded antibody of the B cell. The resulting hybrids are segregated into single genetic strains by selection, dilution, and re-growth with each individual strain comprising specific genes for the formation of a single antibody. They produce antibodies, which are homogeneous against a desired antigen and, in reference to their pure genetic parentage, are termed monoclonal.
[0344] Hybridoma cells thus prepared are seeded and grown in a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused, parental myeloma cells. Those skilled in the art will appreciate that reagents, cell lines and media for the formation, selection and growth of hybridomas are commercially available from a number of sources and standardized protocols are well established. Generally, culture medium in which the hybridoma cells are growing is assayed for production of monoclonal antibodies against the desired antigen. The binding specificity of the monoclonal antibodies produced by hybridoma cells is determined by in vitro assays such as immunoprecipitation, radioimmunoassay (RIA) or enzyme-linked immunoabsorbent assay (ELISA) as described herein. After hybridoma cells are identified that produce antibodies of the desired specificity, affinity and/or activity, the clones may be subcloned by limiting dilution procedures and grown by standard methods; see, e.g., Goding, Monoclonal Antibodies: Principles and Practice, Academic Press (1986), 59-103. It will further be appreciated that the monoclonal antibodies secreted by the subclones may be separated from culture medium, ascites fluid or serum by conventional purification procedures such as, for example, protein-A, hydroxylapatite chromatography, gel electrophoresis, dialysis or affinity chromatography.
[0345] In another embodiment, lymphocytes can be selected by micromanipulation and the variable genes isolated. For example, peripheral blood mononuclear cells can be isolated from an immunized or naturally immune mammal, e.g., a human, and cultured for about 7 days in vitro. The cultures can be screened for specific IgGs that meet the screening criteria. Cells from positive wells can be isolated. Individual Ig-producing B cells can be isolated by FACS or by identifying them in a complement-mediated hemolytic plaque assay. Ig-producing B cells can be micromanipulated into a tube and the V.sub.H and V.sub.L genes can be amplified using, e.g., RT-PCR. The V.sub.H and V.sub.L genes can be cloned into an antibody expression vector and transfected into cells (e.g., eukaryotic or prokaryotic cells) for expression.
[0346] Alternatively, antibody-producing cell lines may be selected and cultured using techniques well known to the skilled artisan. Such techniques are described in a variety of laboratory manuals and primary publications. In this respect, techniques suitable for use in the invention as described below are described in Current Protocols in Immunology, Coligan et al., Eds., Green Publishing Associates and Wiley-Interscience, John Wiley and Sons, New York (1991) which is herein incorporated by reference in its entirety, including supplements.
[0347] Antibody fragments that recognize specific epitopes may be generated by known techniques. For example, Fab and F(ab)2 fragments may be produced recombinantly or by proteolytic cleavage of immunoglobulin molecules, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab)2 fragments). F(ab)2 fragments contain the variable region, the light chain constant region and the CH1 domain of the heavy chain. Such fragments are sufficient for use, for example, in immunodiagnostic procedures involving coupling the immunospecific portions of immunoglobulins to detecting reagents such as radioisotopes.
[0348] In one embodiment, an antibody of the invention comprises at least one CDR of an antibody molecule. In another embodiment, an antibody of the invention comprises at least two CDRs from one or more antibody molecules. In another embodiment, an antibody of the invention comprises at least three CDRs from one or more antibody molecules. In another embodiment, an antibody of the invention comprises at least four CDRs from one or more antibody molecules. In another embodiment, an antibody of the invention comprises at least five CDRs from one or more antibody molecules. In another embodiment, an antibody of the invention comprises at least six CDRs from one or more antibody molecules. Exemplary antibody molecules comprising at least one CDR that can be included in the subject antibodies are described herein.
[0349] Antibodies of the present invention can be produced by any method known in the art for the synthesis of antibodies, in particular, by chemical synthesis or preferably by recombinant expression techniques as described herein.
[0350] In one embodiment, an antibody, or antigen-binding fragment, variant, or derivative thereof of the invention comprises a synthetic constant region wherein one or more domains are partially or entirely deleted (domain-deleted antibodies). In certain embodiments compatible modified antibodies will comprise domain deleted constructs or variants wherein the entire CH2 domain has been removed (CH2 constructs). For other embodiments a short connecting peptide may be substituted for the deleted domain to provide flexibility and freedom of movement for the variable region. Those skilled in the art will appreciate that such constructs are particularly preferred due to the regulatory properties of the CH2 domain on the catabolic rate of the antibody. Domain deleted constructs can be derived using a vector encoding an IgG.sub.1 human constant domain, see, e.g., international applications WO 02/060955 and WO 02/096948A2. This vector is engineered to delete the CH2 domain and provide a synthetic vector expressing a domain deleted IgG.sub.1 constant region.
[0351] In certain embodiments, antibodies, or antigen-binding fragments, variants, or derivatives thereof of the present invention are minibodies. Minibodies can be made using methods described in the art, see, e.g., U.S. Pat. No. 5,837,821 or international application WO 94/09817.
[0352] In one embodiment, an antibody, or antigen-binding fragment, variant, or derivative thereof of the invention comprises an immunoglobulin heavy chain having deletion or substitution of a few or even a single amino acid as long as it permits association between the monomeric subunits. For example, the mutation of a single amino acid in selected areas of the CH2 domain may be enough to substantially reduce Fc binding and thereby increase FAP localization. Similarly, it may be desirable to simply delete that part of one or more constant region domains that control the effector function (e.g. complement binding) to be modulated. Such partial deletions of the constant regions may improve selected characteristics of the antibody (serum half-life) while leaving other desirable functions associated with the subject constant region domain intact. Moreover, as alluded to above, the constant regions of the disclosed antibodies may be synthetic through the mutation or substitution of one or more amino acids that enhances the profile of the resulting construct. In this respect it may be possible to disrupt the activity provided by a conserved binding site (e.g. Fc binding) while substantially maintaining the configuration and immunogenic profile of the modified antibody. Yet other embodiments comprise the addition of one or more amino acids to the constant region to enhance desirable characteristics such as an effector function or provide for more cytotoxin or carbohydrate attachment. In such embodiments it may be desirable to insert or replicate specific sequences derived from selected constant region domains.
[0353] The present invention also provides antibodies that comprise, consist essentially of, or consist of, variants (including derivatives) of antibody molecules (e.g., the V.sub.H regions and/or V.sub.L regions) described herein, which antibodies or fragments thereof immunospecifically bind to FAP. Standard techniques known to those of skill in the art can be used to introduce mutations in the nucleotide sequence encoding an antibody, including, but not limited to, site-directed mutagenesis and PCR-mediated mutagenesis which result in amino acid substitutions. Preferably, the variants (including derivatives) encode less than 50 amino acid substitutions, less than 40 amino acid substitutions, less than 30 amino acid substitutions, less than 25 amino acid substitutions, less than 20 amino acid substitutions, less than 15 amino acid substitutions, less than 10 amino acid substitutions, less than 5 amino acid substitutions, less than 4 amino acid substitutions, less than 3 amino acid substitutions, or less than 2 amino acid substitutions relative to the reference V.sub.H region, V.sub.H-CDR1, V.sub.H-CDR2, V.sub.H-CDR3, V.sub.L region, V.sub.L-CDR1, V.sub.L-CDR2, or V.sub.L-CDR3. A conservative amino acid substitution is one in which the amino acid residue is replaced with an amino acid residue having a side chain with a similar charge. Families of amino acid residues having side chains with similar charges have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Alternatively, mutations can be introduced randomly along all or part of the coding sequence, such as by saturation mutagenesis, and the resultant mutants can be screened for biological activity to identify mutants that retain activity (e.g., the ability to bind and inhibit FAP).
[0354] For example, it is possible to introduce mutations only in framework regions or only in CDR regions of an antibody molecule. Introduced mutations may be silent or neutral missense mutations, e.g., have no, or little, effect on an antibody's ability to bind antigen, indeed some such mutations do not alter the amino acid sequence whatsoever. These types of mutations may be useful to optimize codon usage, or improve a hybridoma's antibody production. Codon-optimized coding regions encoding antibodies of the present invention are disclosed elsewhere herein. Alternatively, non-neutral missense mutations may alter an antibody's ability to bind antigen. The location of most silent and neutral missense mutations is likely to be in the framework regions, while the location of most non-neutral missense mutations is likely to be in CDR, though this is not an absolute requirement. One of skill in the art would be able to design and test mutant molecules with desired properties such as no alteration in antigen-binding activity or alteration in binding activity (e.g., improvements in antigen-binding activity or change in antibody specificity). Following mutagenesis, the encoded protein may routinely be expressed and the functional and/or biological activity of the encoded protein, (e.g., ability to immunospecifically bind at least one epitope of FAP) can be determined using techniques described herein or by routinely modifying techniques known in the art.
III. Chimeric Antigen Receptors (CARs) of the Present Invention
[0355] As mentioned, next to human-derived anti-FAP antibodies, in a further aspect the present invention generally relates to chimeric antigen receptors (CARs), comprising a variable domain or binding domain, e.g. scFv fragment from said human-derived anti-FAP antibodies of the present invention. Thus, it is prudent to expect that the CARs of the present invention exhibit the same or similar characteristics, especially binding characteristics like the anti-FAP antibodies of the present invention. The CARs of the present invention are preferably used for treating cancer, in particular cancer that may be selected from hematological malignancy, a solid tumor, a primary or a metastasizing tumor. Since FAP is mainly associated with stromal cells, said CARs preferentially target the stromal cell population in tumor microenvironment. Thus, in one embodiment the present invention provides CARs targeting stromal cells, rather than tumor cells directly, as it was seen that stromal cells existing in the tumor microenvironment have tumorigenic activity. For example, stromal cells in tumor microenvironments promote tumor growth and metastasis. Therefore, targeting of FAP expressing stromal cells affects a tumor cell so that the tumor cell fails to grow, is prompted to die, or otherwise is affected so that the tumor burden in a patient is diminished or eliminated.
[0356] As mentioned hereinbefore, the basic structure of CARs is well known in the art; see also the documents cited in the background section and, for example Gross and Eshhar, Therapeutic Potential of T Cell Chimeric Antigen Receptors (CARs) in Cancer Treatment: Counteracting Off-Tumor Toxicities for Safe CAR T Cell Therapy in Annual Review of Pharmacology and Toxicology 56 (2016), 59-83 and Zhang et al., New Strategies for the Treatment of Solid Tumors with CAR-T Cells in Int. J. Biol. Sci. 12 (2016), 718-729. In one embodiment of the present invention, the FAP binding domain (extracellular domain) of said CAR is preferably fused with an intracellular domain (cytoplasmic domain) comprising a costimulatory signaling region and a zeta chain portion. Preferably, the antigen binding domain is fused with one or more intracellular domains selected from the group of a CD137 (4-1BB) signaling domain, a CD28 signaling domain, a CD3zeta signal domain, and any combination thereof. The costimulatory signaling region refers to a portion of the CAR comprising the intracellular domain of a costimulatory molecule. Costimulatory molecules are cell surface molecules other than antigens receptors or their ligands that are required for an efficient response of lymphocytes to antigen.
[0357] Between the extracellular domain and the transmembrane domain of the CAR, or between the cytoplasmic domain and the transmembrane domain of the CAR, there may be incorporated a spacer domain. As used herein, the term spacer domain generally means any oligo- or polypeptide that functions to link the transmembrane domain to, either the extracellular domain or, the cytoplasmic domain in the polypeptide chain. A spacer domain may comprise up to 300 amino acids, preferably 10 to 100 amino acids and most preferably 25 to 50 amino acids. Preferably, the CAR comprises an extracellular domain, a transmembrane domain and a cytoplasmic domain. Detailed description of the preparation of such CARs and amino acid sequences of the spacer domain, hinge domain, signaling domains and transmembrane domains that can be used for the construction of CARs in accordance with the present invention can be found, e.g., in international application WO 2014/055442.
[0358] In general, the extracellular domain, i.e. the FAP antigen binding domain of the CAR of the present invention may comprise or consist of the anti-FAP antibody heavy chain variable region which may in turn be covalently associated with the anti-FAP antibody light chain variable region by virtue of the presence of CH1 constant domain and hinge region or by virtue of the presence hinge, CH2 and CH3 domain. Thus, the CAR of the present invention can be engineered to include any FAP-binding moiety of any one of the antibodies of the present invention. In one embodiment, the FAP binding domain and its encoding nucleic acid sequence, respectively, comprises a nucleic acid sequence comprising SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 40, 42, 44, 46, 48, 50, 52, 54, 56 or 58 or a part of said nucleic acid sequences, at least a part encoding one CDR of the light or heavy chain of the antibodies encoded by said nucleic acids. In one embodiment, the FAP binding domain comprises an amino acid sequence comprising SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 41, 43, 45, 47, 51, 53, 55, 57 or 59 or a part of said amino acid sequences, at least a part constituting at least one CDR of the light or heavy chain of said antibodies. With respect to the transmembrane domain, in general the CAR can be designed to comprise a transmembrane domain that is fused to the extracellular domain of the CAR. In one embodiment, the transmembrane domain that naturally is associated with one of the domains in the CAR is used. In some instances, the transmembrane domain can be selected or modified by amino acid substitution to avoid binding of such domains to the transmembrane domains of the same or different surface membrane proteins to minimize interactions with other members of the receptor complex.
[0359] The transmembrane domain may be derived either from a natural or from a synthetic source. Where the source is natural, the domain may be derived from any membrane-bound or transmembrane protein. Transmembrane regions of particular use in this invention may be derived from (i.e. comprise) at least the transmembrane region(s) of) the alpha, beta or zeta chain of the T-cell receptor, CD28, CD3 epsilon, CD45, CD4, CDS, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154. Alternatively the transmembrane domain may be synthetic, in which case it will comprise predominantly hydrophobic residues such as leucine and valine. Preferably a triplet of phenylalanine, tryptophan and valine will be found at each end of a synthetic transmembrane domain. Optionally, a short oligo- or polypeptide linker, preferably between 2 and 10 amino acids in length may form the linkage between the transmembrane domain and the cytoplasmic signalling domain of the CAR. A glycine-serine doublet provides a particularly suitable linker.
[0360] The cytoplasmic domain or otherwise the intracellular signalling domain of the CAR of the present invention is responsible for activation of at least one of the normal effector functions of the immune cell in which the CAR has been placed in. The term effector function refers to a specialized function of a cell. Effector function of a T cell, for example, may be cytolytic activity or helper activity including the secretion of cytokines. Thus the term intracellular signalling domain refers to the portion of a protein which transduces the effector function signal and directs the cell to perform a specialized function. While usually the entire intracellular signalling domain can be employed, in many cases it is not necessary to use the entire chain. To the extent that a truncated portion of the intracellular signalling domain is used, such truncated portion may be used in place of the intact chain as long as it transduces the effector function signal. The term intracellular signalling domain is thus meant to include any truncated portion of the intracellular signalling domain sufficient to transduce the effector function signal.
[0361] Preferred examples of intracellular signalling domains for use in the CAR of the invention include the cytoplasmic sequences of the T cell receptor (TCR) and co-receptors that act in concert to initiate signal transduction following antigen receptor engagement, as well as any derivative or variant of these sequences and any synthetic sequence that has the same functional capability. It is known that signals generated through the TCR alone are insufficient for full activation of the T cell and that a secondary or co-stimulatory signal is also required. Thus, T cell activation can be said to be mediated by two distinct classes of cytoplasmic signalling sequence: those that initiate antigen-dependent primary activation through the TCR (primary cytoplasmic signalling sequences) and those that act in an antigen-independent manner to provide a secondary or co-stimulatory signal (secondary cytoplasmic signalling sequences).
[0362] Primary cytoplasmic signalling sequences regulate primary activation of the TCR complex either in a stimulatory way, or in an inhibitory way. Primary cytoplasmic signalling sequences that act in a stimulatory manner may contain signalling motifs which are known as immunoreceptor tyrosine-based activation motifs or ITAMs.
[0363] Examples of ITAM containing primary cytoplasmic signalling sequences that are of particular use in the invention include those derived from TCR zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CDS, CD22, CD79a, CD79b, and CD66d. It is particularly preferred that cytoplasmic signalling molecule in the CAR of the invention comprises a cytoplasmic signalling sequence derived from CD3 zeta.
[0364] In a preferred embodiment, the cytoplasmic domain of the CAR can be designed to comprise the CD3-zeta signalling domain by itself or combined with any other desired cytoplasmic domain(s) useful in the context of the CAR of the invention. For example, the cytoplasmic domain of the CAR can comprise a CD3 zeta chain portion and a costimulatory signalling region. The costimulatory signalling region refers to a portion of the CAR comprising the intracellular domain of a costimulatory molecule. A costimulatory molecule is a cell surface molecule other than an antigen receptor or their ligands that is required for an efficient response of lymphocytes to an antigen. Examples of such molecules include CD27, CD28, 4-1BB (CD137), OX40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, and a ligand that specifically binds with CD83, and the like. Thus, while the invention in exemplified primarily with 4-1BB and CD28 as the co-stimulatory signaling element, other costimulatory elements are within the scope of the invention.
[0365] The cytoplasmic signaling sequences within the cytoplasmic signaling portion of the CAR of the invention may be linked to each other in a random or specified order. Optionally, a short oligo- or polypeptide linker, preferably between 2 and 10 amino acids in length may form the linkage. A glycine-serine doublet provides a particularly suitable linker.
[0366] In one embodiment, the cytoplasmic domain is designed to comprise the signaling domain of CD3-zeta and the signaling domain of CD28. In yet another embodiment, the cytoplasmic domain is designed to comprise the signaling domain of CD3-zeta and the signaling domain of CD28 and 4-1BB.
[0367] Furthermore, the person skilled in the art will appreciate that in principle the design of FAP CARs described in the prior art, for example in Tran et al. (J. Exp. Med. 210 (2013), 1125-1135), Schuberth et al. (J. Transl. Med. 11 (2013), 187), Kakarla et al. (Mol. Ther. 21 (2013), 1611-1620), Wang et al. (Cancer Immunol. Res. 2 (2014), 154-166 as well as in WO 2014055442 A2 using FAP binding domains derived from mouse monoclonal anti-FAP antibodies such as antibody F19 can be used to construct the FAP CARs of the present invention via replacing the described FAP binding domain with the FAP binding domain of the human monoclonal anti-FAP antibodies described in the present invention.
IV. Polynucleotides Encoding Antibodies and CARs
[0368] The present invention also relates to DNA constructs comprising a nucleic acid sequence encoding a CAR and/or an antibody, or antigen-binding fragment, variant, or derivative thereof; see supra. In case of the CAR, the DNA construct comprises the nucleic acid sequence encoding any one of the FAP binding domains of the present invention operably liked to the nucleic acid sequence encoding an intracellular domain. An exemplary intracellular domain that can be used in the CAR of the invention includes but is not limited to the intracellular domain of CD3-zeta, CD28, 4-1BB, and the like. In some instances, the CAR can comprise any combination of CD3-zeta, CD28, 4-1BB, and the like.
[0369] A polynucleotide encoding a CAR or an antibody, or antigen-binding fragment, variant, or derivative thereof can be composed of any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA. For example, a polynucleotide encoding a CAR or an antibody, or antigen-binding fragment, variant, or derivative thereof can be composed of single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single-stranded and double-stranded regions. In addition, a polynucleotide encoding a CAR or an antibody, or antigen-binding fragment, variant, or derivative thereof can be composed of triple-stranded regions comprising RNA or DNA or both RNA and DNA. A polynucleotide encoding a CAR or an antibody, or antigen-binding fragment, variant, or derivative thereof may also contain one or more modified bases or DNA or RNA backbones modified for stability or for other reasons. Modified bases include, for example, tritylated bases and unusual bases such as inosine. A variety of modifications can be made to DNA and RNA; thus, polynucleotide embraces chemically, enzymatically, or metabolically modified forms.
[0370] An isolated polynucleotide encoding a non-natural variant of a polypeptide derived from an immunoglobulin (e.g., an immunoglobulin heavy chain portion or light chain portion) or a CAR can be created by introducing one or more nucleotide substitutions, additions or deletions into the nucleotide sequence such that one or more amino acid substitutions, additions or deletions are introduced into the encoded protein. Mutations may be introduced by standard techniques, such as site-directed mutagenesis and PCR-mediated mutagenesis. Preferably, conservative amino acid substitutions are made at one or more non-essential amino acid residues.
[0371] As is well known, RNA may be isolated from the original B cells, hybridoma cells or from other transformed cells by standard techniques, such as a guanidinium isothiocyanate extraction and precipitation followed by centrifugation or chromatography. Where desirable, mRNA may be isolated from total RNA by standard techniques such as chromatography on oligo dT cellulose. Suitable techniques are familiar in the art. In one embodiment, cDNAs that encode the light and the heavy chains of the antibody may be made, either simultaneously or separately, using reverse transcriptase and DNA polymerase in accordance with well-known methods. PCR may be initiated by consensus constant region primers or by more specific primers based on the published heavy and light chain DNA and amino acid sequences. As discussed above, PCR also may be used to isolate DNA clones encoding the antibody light and heavy chains. In this case the libraries may be screened by consensus primers or larger homologous probes, such as human constant region probes.
[0372] DNA, typically plasmid DNA, may be isolated from the cells using techniques known in the art, restriction mapped and sequenced in accordance with standard, well known techniques set forth in detail, e.g., in the foregoing references relating to recombinant DNA techniques. Of course, the DNA may be synthetic according to the present invention at any point during the isolation process or subsequent analysis.
[0373] In this context, the present invention also relates to a polynucleotide encoding at least the binding domain or variable region of an immunoglobulin chain of the antibody of the present invention, preferably which can constitute the binding domain (extracellular domain) of the CAR of the present invention. In one embodiment, the present invention provides an isolated polynucleotide comprising, consisting essentially of, or consisting of a nucleic acid encoding an immunoglobulin heavy chain variable region (V.sub.H), where at least one of the CDRs of the heavy chain variable region or at least two of the V.sub.H-CDRs of the heavy chain variable region are at least 80%, 85%, 90%, or 95% identical to reference heavy chain V.sub.H-CDR1, V.sub.H-CDR2, or V.sub.H-CDR3 amino acid sequences from the antibodies disclosed herein. Alternatively, the V.sub.H-CDR1, V.sub.H-CDR2, or V.sub.H-CDR3 regions of the V.sub.H are at least 80%, 85%, 90%, or 95% identical to reference heavy chain V.sub.H-CDR1, V.sub.H-CDR2, and V.sub.H-CDR3 amino acid sequences from the antibodies disclosed herein. Thus, according to this embodiment a heavy chain variable region of the invention has V.sub.H-CDR1, V.sub.H-CDR2, or V.sub.H-CDR3 polypeptide sequences related to the polypeptide sequences shown in
[0374] In another embodiment, the present invention provides an isolated polynucleotide comprising, consisting essentially of, or consisting of a nucleic acid encoding an immunoglobulin light chain variable region (V.sub.L), preferably which can constitute the binding domain (extracellular domain) of the CAR of the present invention, where at least one of the V.sub.L-CDRs of the light chain variable region or at least two of the V.sub.L-CDRs of the light chain variable region are at least 80%, 85%, 90%, or 95% identical to reference light chain V.sub.L-CDR1, V.sub.L-CDR2, or V.sub.L-CDR3 amino acid sequences from the antibodies disclosed herein. Alternatively, the V.sub.L-CDR1, V.sub.L-CDR2, or V.sub.L-CDR3 regions of the V.sub.L are at least 80%, 85%, 90%, or 95% identical to reference light chain V.sub.L-CDR1, V.sub.L-CDR2, and V.sub.L-CDR3 amino acid sequences from the antibodies disclosed herein. Thus, according to this embodiment a light chain variable region of the invention has V.sub.L-CDR1, V.sub.L-CDR2, or V.sub.L-CDR3 polypeptide sequences related to the polypeptide sequences shown in
[0375] In another embodiment, the present invention provides an isolated polynucleotide comprising, consisting essentially of, or consisting of a nucleic acid encoding an immunoglobulin heavy chain variable region (V.sub.H), preferably which can constitute the binding domain (extracellular domain) of the CAR of the present invention, in which the V.sub.H-CDR1, V.sub.H-CDR2, and V.sub.H-CDR3 regions have polypeptide sequences which are identical to the V.sub.H-CDR1, V.sub.H-CDR2, and V.sub.H-CDR3 groups shown in
[0376] As known in the art, sequence identity between two polypeptides or two polynucleotides is determined by comparing the amino acid or nucleic acid sequence of one polypeptide or polynucleotide to the sequence of a second polypeptide or polynucleotide. When discussed herein, whether any particular polypeptide is at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% identical to another polypeptide can be determined using methods and computer programs/software known in the art such as, but not limited to, the BESTFIT program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, Wis. 53711). BESTFIT uses the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2 (1981), 482-489, to find the best segment of homology between two sequences. When using BESTFIT or any other sequence alignment program to determine whether a particular sequence is, for example, 95% identical to a reference sequence according to the present invention, the parameters are set, of course, such that the percentage of identity is calculated over the full length of the reference polypeptide sequence and that gaps in homology of up to 5% of the total number of amino acids in the reference sequence are allowed.
[0377] In a preferred embodiment of the present invention, the polynucleotide comprises, consists essentially of, or consists of a nucleic acid having a polynucleotide sequence of the V.sub.H or V.sub.L region of an anti-FAP antibody and/or antibody recognizing FAP species and/or fragments thereof, preferably which can constitute the binding domain (extracellular domain) of the CAR of the present invention, as depicted in and Table II. In this respect, the person skilled in the art will readily appreciate that the polynucleotides encoding at least the variable domain of the light and/or heavy chain may encode the variable domain of both immunoglobulin chains or only one. In one embodiment therefore, the polynucleotide comprises, consists essentially of, or consists of a nucleic acid having a polynucleotide sequence of the V.sub.H and the V.sub.L region of an anti-FAP antibody as depicted in Table II.
TABLE-US-00003 TABLEII NucleotidesequencesoftheV.sub.HandV.sub.Lregionofantibodiesrecognizinghuman FAPorpeptidesthereof. Nucleotidesequencesofvariableheavy(VH)andvariablelight(VL) Antibody chainsorvariablekappa-lightchains(VK) NI-206.82C2-VH CAGGTGCAGCTGCAGGAGTCGGGTCCAGGACTGGTGAAGCCCTCGCAGACCCTCTCAC (notPIMC) TCACCTGTGCCATCTCCGGGGACAGTGTCTCTAGCAACAGTGTTACTTGGAACTGGAT CAGGCAGTCCCCATCGAGAGGCCTTGAGTGGCTGGGAAGGACATACTACAGGTCCAAG TGGTATAATGATTATGCAGTATCTGTGAAAGGTCGAATAACCATCAATCCAGACACTT CCAAGAACCAGTTCTACCTGCAGTTGAAATCTGTGACTCCCGAGGATGCGGCTGTCTA TTATTGTGCAAGAGATAGTAGCATCTTATATGGGGACTACTGGGGCCAGGGAACCCTG GTCACCGTCTCCTCG SEQIDNO.:1 NI-206.82C2-VH CAGGTACAGCTGCAGCAGTCAGGTCCAGGACTGGTGAAGCCCTCGCAGACCCTCTCAC (PIMC) TCACCTGTGCCATCTCCGGGGACAGTGTCTCTAGCAACAGTGTTACTTGGAACTGGAT CAGGCAGTCCCCATCGAGAGGCCTTGAGTGGCTGGGAAGGACATACTACAGGTCCAAG TGGTATAATGATTATGCAGTATCTGTGAAAGGTCGAATAACCATCAATCCAGACACTT CCAAGAACCAGTTCTACCTGCAGTTGAAATCTGTGACTCCCGAGGATGCGGCTGTCTA TTATTGTGCAAGAGATAGTAGCATCTTATATGGGGACTACTGGGGCCAGGGAACCCTG GTCACCGTCTCCTCG SEQIDNO.:3 NI-206.82C2-VL CAGGCTGTGCTGACTCAGCCGTCTTCCCTCTCTGCATCTCCTGGAGCATCAGCCAGTC (PIMCbydefault) TCACCTGCACCTTGCCCAGTGGCATCAATGTTGGTACCTACAGGATATTCTGGTTCCA GCAGAAGCCAGGGAGTCCTCCCCAGTATCTCCTGAGTTACAAATCAGACTCAGATAAT CACCAGGGCTCTGGAGTCCCCAGCCGCTTCTCTGGATCCAAAGATGCTTCGGCCAATG CAGGGATTTTACTCATCTCTGGGCTCCAGTCTGAGGATGAGGCTGACTATTACTGTAT GATTTGGCACAGCAGCGCTTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTA SEQIDNO.:5 NI-206.59B4-VH CAGGTACAGCTGGTGCAATCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGG (PIMC) TCTCCTGCAAGACTTCTGGATACACCTTCACCGACTACTATATACACTGGGTGCGACA GGCCCCTGGACAAGGGCTTGAATGGATGGGATGGATCAACCCTAACAGAGGTGGCACA AACTATGCACAAAAATTTCAGGGCAGGGTCACCATGACCAGGGACACCTCCATCGCTA CAGCCTACATGGAGTTGAGTAGACTGAGATCTGACGACACGGCCGTGTATTACTGTGC GACTGCGTCGCTAAAAATAGCAGCAGTTGGTACATTTGACTGCTGGGGCCAGGGCACC CTGGTCACCGTCTCCTCG SEQIDNO.:7 NI-206.59B4-VL TCCTATGAGCTGACTCAGCCACCCTCGGTGTCAGTGTCCCCAGGACAGACGGCCAGGA (PIMC) TCACCTGCTCTGGAGATGCATTGTCAAAGCAATATGCTTTTTGGTTCCAGCAGAAGCC AGGCCAGGCCCCTATATTGGTGATATATCAAGACACTAAGAGGCCCTCAGGGATCCCT GGGCGATTCTCTGGCTCCAGCTCAGGGACAACAGTCACGTTGACCATCAGTGGAGCCC AGGCAGACGACGAGGCTGACTATTATTGTCAATCAGCAGACAGCAGTGGTACTTATGT CTTCGGAACTGGGACCAAGGTCACCGTCCTA SEQIDNO.:9 NI-206.22F7-VH GAGGTGCAGCTGGTGGAGACTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGAC (notPIMC) TCTCCTGTGCAGCCTCTGGATTCAGCTTCAGTACCCATGGCATGTACTGGGTCCGCCA GCCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATCATATGATGGAAGTGATAAA AAGTATGCAGACTCCGTGAAGGGCCGGTTCACCATCTCCAGAGACAATTCCAAGAACA CGGTGTATTTGGAAATGAGCAGCGTGAGAGCTGAGGACACGGCTCTATATTACTGTTT CTGCCGCCGGGATGCTTTTGATCTCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCG SEQIDNO.:11 NI-206.22F7-VL TCCTATGTGCTGACTCAGCCACCCTCGGTGTCAGTGTCCCCAGGACAAACGGCCAGGA (notPIMC) TCACCTGCTCTGGAGATGCATTGCCAAAAAAGTATGCTTATTGGTACCAGCAGAAGTC AGGCCAGGCCCCTGTGCTGGTCATCTATGAGGACACCAAACGACCCTCCGGGATCCCT GAGAGATTCTCTGGCTCCAGCTCAGGGACAATGGCCACCTTGACTATCAGTGGGGCCC AGGTGGAGGATGAAGCTGACTATTACTGTTACTCAACAGACAGCAGCGGTAATTATTG GGTATTCGGCGGAGGGACCGAGGTGACCGTCCTA SEQIDNO.:13 NI-206.27E8-VH GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTTGAGCCTGGGGGGTCCCTAAGAC (PIMCbydefault) TCTCCTGTGCAGCCTCTGGTTTCACTTTCAGTGATGCCTGGATGAACTGGGTCCGCCA GGCTCCAGGGAAGGGGCTGGAGTGGGTCGGGCGTATTAAAACGAAAAGCGATGGTGGG ACAACAGACTACGCTGCACCCGTGAGAGGCAGATTTTCCATCTCAAGAGATGATTCAA AAAACACACTGTTTCTGGAAATGAACAGCCTGAAGACCGAGGACACAGCCATATATTA TTGTTTTATTACTGTCATAGTAGTATCCTCCGAATCTCCACTTGACCACTGGGGCCAG GGAACCCTGGTCACCGTCTCCTCG SEQIDNO.:15 NI-206.27E8-VL TCCTATGAGCTGACTCAGCCACCCTCGGTGTCAGTGTCCCCAGGACAGACGGCCAGGA (PIMCbydefault) TCACCTGCTCTGGAGACGAACTGCCAAAACAATATGCTTATTGGTACCAGCAGAAGCC AGGCCAGGCCCCTGTGTTGGTGATATATAAGGACAGACAGAGGCCCTCAGGGATCCCT GAGCGATTCTCTGGCTCCAGCTCAGGGACAACAGTCACGTTGACCATCAGTGGAGTCC AGGCAGAAGACGAGGCTGACTATTACTGTCAATCAGCATACAGCATTAATACTTATGT GATTTTCGGCGGAGGGACCAAGCTGACCGTCCTA SEQIDNO.:17 NI-206.12G4-VH GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTCAAGCCTGGAGGGTCCCTGAGAC (notPIMC) TCTCCTGTGCAGCCTCTGGATTCACCTTCAGTGACTACTACATGAGCTGGATCCGCCA GGCTCCAGGGAAGGGGCTGGAATGGATTTCTTATATTAGTAGTGGTAGTAGTTACACA AACTATGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAAGT CAGTGTATCTGGAAGTCAACGGCCTGACAGTCGAGGACACGGCTGTGTATTACTGTGC GAGAGTTCGATATGGGGACCGGGAGATGGCAACAATCGGAGGATTTGATTTCTGGGGC CAGGGAACCCTGGTCACCGTCTCCTCG SEQIDNO.:19 NI-206.12G4-VL TCCTATGAGCTGACTCAGCCACCCTCGGTGTCAGTGTCCCCAGGACAGACGGCCAGGA (PIMCbydefault) TCACCTGCTCTGGAGATGCACTGCCAAAGCAATATGCTTATTGGTATCAACAGAGCCC AGGCCAGGCCCCTGTGTTGGTGATATATAAAGACAGTGAGAGGCCCTCAGGGATCCCT GAGCGATTCTCTGGCTCCAGCTCAGGGACAACAGTCACGTTGACCATCAGTGGAGTCC AGGCAGAAGACGAGGCTGACTATTACTGTCAATCAGCAGACAGCGGTGGTACTTCTAG GATATTCGGCGGAGGGACCAAGTTGACCGTCCTG SEQIDNO.:21 NI-206.17A6-VH CAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAGGTCTACGGAGACCCTGTCCC (PIMCbydefault) TCACCTGCCTTGTCTCTGGTGACTCCATCAACAGTCACTACTGGAGTTGGCTCCGGCA GTCCCCAGGGAGGGGCCTGGAATGGATTGGGTACATTTACTACACTGGGCCCACCAAC TACAATCCCTCCCTCAAGAGTCGAGTCTCCATATCACTGGGCACGTCCAAGGACCAGT TCTCCCTGAAGCTGAGTTCTGTGACCGCTGCGGACACGGCCAGATATTACTGTGCGAG AAATAAGGTCTTTTGGCGTGGTTCTGACTTCTACTACTACATGGACGTCTGGGGCAAA GGGACCACGGTCACCGTCTCCTCG SEQIDNO.:23 NI-206.17A6-VK GAAATTGTGTTGACACAGTCTCCAGGCACCCTGTCTTTGTCTCTAGGGGAAAGAGCCA (notPIMC) CCCTCTCCTGCAGGGCCAGTCAGAGTCTTGCCAACAACTACTTAGCCTGGTACCAGCA GAAACCTGGCCAGGCTCCCAGGCTCCTCATGTATGACGCATCCACCAGGGCCACTGGC ATCCCTGACAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACTCTCACCATCAGCA GACTGGAGCCTGAAGATTTTGCAGTGTATTACTGCCAGCAATTTGTTACCTCACACCA CATGTACATTTTTGGCCAGGGGACCAAGGTGGAAATCAAA SEQIDNO.:25 NI-206.18H2-VH CAGGTGCAGCTGCAGGAGTCGGGCCCACGACTGGTGAAGCCTTCGGAGACCCTGTCTC (notPIMC) TCACCTGCACTGTCTCTGGTTACTCCATTAGTAATGGTTACTACTGGGGCTGGATCCG ACAGCCCCCAGGGCAGGGGCTGGAGTGGATTGCGAGTGTCTGGCATAGTGGGAACACC TACCACAACCCGTCCCTCAAAAGTCGAGTCACCATTTTAGTGGACACGTTGAAGAACC AATTTTCCCTGAACCTGAAGTCTGTGACCGCCGCAGACACGGCCTTATATTACTGTGC GAGATCATATACACGAAACGACGTGGGCGCTTTTGAGACGTGGGGCCAAGGGACAATG GTCACCGTCTCTTCG SEQIDNO.:40 NI-206.18H2-VL TCCTATGAGCTGACTCAGCCACCCTCGGTGTCTGTGTCCCCAGGACAAACGGCCAGGA (PIMCbydefault) TCGCCTGCTCTGGAGATGAATTGCCAAAAAGATATGCTTATTGGTACCAGCAGAAGTC AGGCCAGGCCCCTGTACTGGTCATGTATGAGGACACCAAGCGACCCTCCGGGATTCCT GAGAGATTGTCTGGCTCCTCCTCAGGGACAGTGACCACTCTGACTATTAGTGGGGCCC AGGTGGAGGATGAGGCTGACTACTACTGTTACTCAACAGCCCCCAGTGGCAATCACAC TTTTGTCTTCGGAACTGGGACCAGGGTCACCGTCCTT SEQIDNO.:42 NI-206.20A8-VH GAGGTGCAGCTGGTGGAGTCCGGGGGAGGCTTGGTCCAGCCGGGGGGGTCCCTCAAAC (PIMCbydefault) TCTCCTGTGCAGGCTCTGGCTTAGACCTCAGTGCCTCTGCTGTGCACTGGGTCCGCCA GGCCTCCGGGAAAGGGCTGGAGTGGATTGGCCGCATCAGAAGCAAGCCTAATCACTAT GCGACAACATATCTGGCGTCGGTGAGAGGCAGATTCATCCTCTCCAGAGATGATTCAG AGAACACGGCCTATCTCCAAATGAACAGCCTGAGAACCGAGGACACAGCCGTATATTA CTGCAGAATTGGAATTCTGAATTCTGACCACTGGGGCCGGGGAACCCTGGTCACCGTC TCCTCG SEQIDNO.:44 NI-206.20A8-VL CAGTCTGTGCTGACTCAGCCACCCTCAGCGTCTGGGACCCCCGGGCAGACGGTCATCA (PIMCbydefault) TCTCTTGCTCTGGAAGCAGCTCCAATCTCGGAAGGAAAACTCTAAACTGGTACCAGCA ACTCCCAGGAGCGGCCCCCAAACTCCTCATTTTTAAAAATGATCAGCGGGCCTCAGGG GTCCCTGACCGATTCTCTGCCTCCAAGTCTGGCACCTCAGCCTCCCTGACCATCAGTG GACTCCAGTCTGACGATGAGGCTGATTATTACTGTGGAACATGGGATGACAGCCTGGA TAATTGGGTGTTCGGCGGAGGGACCAAGGTGACCGTCCTA SEQIDNO.:46 NI-206.6D3-VH GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTAAAGCCTGGGGAGTCCCTTAGAC (PIMCbydefault) TCTCCTGTGCAGCCTCTGGATTCACTTTCAGTAAGGCCTGGATGAACTGGGTCCGCCA GGGTCCAGGGAAGGGGCTGGAGTGGGTTGGCCGTGTTAAAAGCAAAACTGATGGTGGG ACAACAGACTACGCTGCACCCGTGAAAGGCAGATTCACCATCTCAAGAGACGATTCAA AAGACACAGTGTTTCTGCAAATGAACAGCCTGAAAACCGAAGATACAGCCGTATATTA CTGTTCCATCCAGTTTATTGTAGTAGGTGATAGGGGCCGAGACGACCAGTACATGGAC GTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCG SEQIDNO.:48 NI-206.6D3-VL TCCTATGTGCTGACTCAGCCACCCTCGGTGTCAGTGTCCCCAGGACAGACGGCCAGGA (notPIMC) TCACCTGCTCTGGAGATGCATTGCCAAAGCAATATGCTTTTTGGTACCAGCAGAAGCC AGGCCAGGCCCCTGTAATTATGATATATAAAGACAATCAGAGGCCCTCAGGGATCCCT GAGCGATTCTCTGGCTCCAGCTCAGGGACAACAGTCACGTTGACCATCAGTGGAGTCC AGACAGAAGACGAGGCTGACTATTACTGTCAATCAGCAGACAGCACTAATACTCATGT GGTATTCGGCGGAGGGACCAAGCTGACCGTCCTA SEQIDNO.:50 NI-206.14C5-VH CAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCC (PIMCbydefault) TCACTTGCACTGTCTCTAATGGCTCCATCAATAATAACTACTGGAGCTGGCTCCGGCA GCCCCCCGGGAAGGGGCTGCAATGGATTGGTTATGTCTATTACAGTGGGAGCGCAAAG TATAACCCCTCCCTCCAGAGTCGAGTCTCTCTTTCAGTAGACAGATCCAAGAACCAAT TCTCCCTGGAGCTGAGCTCTGTCACCGCTGCGGACACGGCCGTCTATTACTGTGCGAG GACCTATTGTAGTGGTCGTGACACTTGTTTCTATTTCTTTGACAACTGGGGCCAGGGA ACCCTGGTCACCGTCTCCTCG SEQIDNO.:52 NI-206.14C5-VL CAGTCTGCCCTGACTCAGCCTGCCTCCGTGTCTGGGTCTCCTAGACAGTCGCTCACCA (PIMCbydefault) TCTCCTGCACTGGAACCATGAGTGATGTTGGGAGGTATGACCTTGTCTCATGGTACCA ACAACACCCTGGCAAAGCCCCCAACGTCATCATTTATGCCGTCACTAAGCGGCCCTCA GGGGTTTCTGATCGCTTCTCTGGCTCCAAGTCTGGCACCACGGCCTCCCTGACAATCT CTGGGCTCCAGGCTGAGGACGAGGCTTATTATTACTGCTGTTCATATGCAACTGTTAA CAGTTGGCTATTCGGCGGAGGGACCAAGGTGACCGTCCTA SEQIDNO.:54 NI-206.34C11-VH GAGGTGCAGCTGGTGGAGACTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGAC (notPIMC) TCGCCTGTGCAGCCTCTGGATTCACCTTTAGCAGCTATGCCATGAGCTGGGTCCGCCA GGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGGTATTAGTGATAGTGGTGGTAGCACA TACTACGCTGACGCCGTGAAGGGCCGGTTCACCATTTCCAAAGACAATTCCAAGAACA CCCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTATATTACTGTGC GAGAGTTGACTCTAATAGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCC TCG SEQIDNO.:56 NI-206.34C11-VL CAGTCTGTGTTGACGCAGCCGCCCTCACTGTCTGCGGCCCCAGGACAGAAGGTCACCA (PIMCbydefault) TCTCCTGCTCTGGAAGCAGCTCCAACATTGGGAATAATTATGTATCCTGGTACCAGCA ACTCCCAGGAACAGCCCCCAAACTCCTCATTTATAACAATGATAAGCGGCCCTCAGGG ATTTCTGACCGATTCTCTGGCTCCAAGTCTGGCACGTCAGCCACCCTGGGCATCACCG GACTCCAGACTGGGGACGAGGCCGATTATTACTGCGGAACATGGGATAGGAGCCTGAG TGGTAGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTA SEQIDNO.:58
[0378] Due to the cloning strategy the amino acid sequence at the N- and C-terminus of the heavy chain and light chains may potentially contain primer-induced alterations in FR1 and FR4, which however do not substantially affect the biological activity of the antibody. In order to provide a consensus human antibody, the nucleotide and amino acid sequences of the original clone can be aligned with and tuned in accordance with the pertinent human germ line variable region sequences in the database; see, e.g., Vbase2, as described above. The amino acid sequence of human antibodies are indicated in bold when N- and C-terminus amino acids are considered to potentially deviate from the consensus germ line sequence due to the PCR primer and thus have been replaced by primer-induced mutation correction (PIMC).
[0379] The present invention also includes fragments of the polynucleotides of the invention, as described elsewhere. Additionally polynucleotides which encode fusion polynucleotides, Fab fragments, and other derivatives, as described herein, are also contemplated by the invention. The polynucleotides may be produced or manufactured by any method known in the art. For example, if the nucleotide sequence of the antibody is known, a polynucleotide encoding the antibody may be assembled from chemically synthesized oligonucleotides, e.g., as described in Kutmeier et al., BioTechniques 17 (1994), 242, which, briefly, involves the synthesis of overlapping oligonucleotides containing portions of the sequence encoding the antibody, annealing and ligating of those oligonucleotides, and then amplification of the ligated oligonucleotides by PCR.
[0380] Alternatively, a polynucleotide encoding a CAR or an antibody, or antigen-binding fragment, variant, or derivative thereof may be generated from nucleic acid from a suitable source. If a clone containing a nucleic acid encoding a particular antibody or a CAR is not available, but the sequence of the antibody or CAR molecule is known, a nucleic acid encoding the antibody or the CAR may be chemically synthesized or obtained from a suitable source (e.g., a cDNA library, or a cDNA library generated from, or nucleic acid, preferably polyA.sup. RNA, isolated from, any tissue or cells expressing the FAP-specific antibody or the corresponding CAR, by PCR amplification using synthetic primers hybridizable to the 3 and 5 ends of the sequence or by cloning using an oligonucleotide probe specific for the particular gene sequence to identify, e.g., a cDNA clone from a cDNA library that encodes the antibody. Amplified nucleic acids generated by PCR may then be cloned into replicable cloning vectors using any method well known in the art. Accordingly, in one embodiment of the present invention the cDNA encoding an antibody, immunoglobulin chain, or fragment thereof is used for the production of an anti-FAP antibody or the corresponding CAR.
[0381] Once the nucleotide sequence and corresponding amino acid sequence of the CAR or the antibody, or antigen-binding fragment, variant, or derivative thereof is determined, its nucleotide sequence may be manipulated using methods well known in the art for the manipulation of nucleotide sequences, e.g., recombinant DNA techniques, site directed mutagenesis, PCR, etc. (see, for example, the techniques described in Sambrook et al., Molecular Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (1990) and Ausubel et al., eds., Current Protocols in Molecular Biology, John Wiley & Sons, NY (1998), which are both incorporated by reference herein in their entireties), to generate antibodies and/or CARs having a different amino acid sequence, for example to create amino acid substitutions, deletions, and/or insertions.
V. Expression of Antibody Polypeptides
[0382] Following, manipulation of the isolated genetic material to provide antibodies, or antigen-binding fragments, variants, or derivatives thereof of the invention, are provided. The polynucleotides encoding the antibodies are typically inserted in an expression vector for introduction into host cells that may be used to produce the desired quantity of antibody. Recombinant expression of an antibody, or fragment, derivative, or analog thereof, e.g., a heavy or light chain of an antibody which binds to a target molecule is described herein. Once a polynucleotide encoding an antibody molecule or a heavy or light chain of an antibody, or portion thereof (preferably containing the heavy or light chain variable domain), of the invention has been obtained, the vector for the production of the antibody molecule may be produced by recombinant DNA technology using techniques well known in the art. Thus, methods for preparing a protein by expressing a polynucleotide containing an antibody encoding nucleotide sequence are described herein. Methods which are well known to those skilled in the art can be used to construct expression vectors containing antibody coding sequences and appropriate transcriptional and translational control signals. These methods include, for example, in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. The invention, thus, provides replicable vectors comprising a nucleotide sequence encoding an antibody molecule of the invention, or a heavy or light chain thereof, or a heavy or light chain variable domain, operable linked to a promoter. Such vectors may include the nucleotide sequence encoding the constant region of the antibody molecule (see, e.g., international applications WO 86/05807 and WO 89/01036; and U.S. Pat. No. 5,122,464) and the variable domain of the antibody may be cloned into such a vector for expression of the entire heavy or light chain.
[0383] The term vector or expression vector is used herein to mean vectors used in accordance with the present invention as a vehicle for introducing into and expressing a desired gene in a host cell. As known to those skilled in the art, such vectors may easily be selected from the group consisting of plasmids, phages, viruses, and retroviruses. In general, vectors compatible with the instant invention will comprise a selection marker, appropriate restriction sites to facilitate cloning of the desired gene and the ability to enter and/or replicate in eukaryotic or prokaryotic cells. For the purposes of this invention, numerous expression vector systems may be employed. For example, one class of vector utilizes DNA elements which are derived from animal viruses such as bovine papilloma virus, polyoma virus, adenovirus, vaccinia virus, baculovirus, retroviruses (RSV, MMTV or MOMLV), or SV40 virus. Others involve the use of polycistronic systems with internal ribosome binding sites. Additionally, cells which have integrated the DNA into their chromosomes may be selected by introducing one or more markers or reporters which allow selection of transfected host cells. The marker may provide for prototrophy to an auxotrophic host, biocide resistance (e.g., antibiotics), or resistance to heavy metals such as copper. The selectable marker gene can either be directly linked to the DNA sequences to be expressed, or introduced into the same cell by co-transformation. Reporter genes are used for identifying potentially transfected cells and for evaluating the functionality of regulatory sequences. In general, a reporter gene is a gene that is not present in or expressed by the recipient organism or tissue and that encodes a polypeptide whose expression is manifested by some easily detectable property, e.g., enzymatic activity. Expression of the reporter gene is assayed at a suitable time after the DNA has been introduced into the recipient cells. Suitable reporter genes may include genes encoding luciferase, beta-galactosidase, chloramphenicol acetyl transferase, secreted alkaline phosphatase, or the green fluorescent protein gene; see, e.g., Ui-Tei et al., FEBS Letters 479 (2000), 79-82. Additional elements may also be needed for optimal synthesis of mRNA. These elements may include signal sequences, splice signals, as well as transcriptional promoters, enhancers, and termination signals.
[0384] In particularly preferred embodiments the cloned variable region genes are inserted into an expression vector along with the heavy and light chain constant region genes (preferably human) as discussed above. This vector contains the cytomegalovirus promoter/enhancer, the mouse beta globin major promoter, the SV40 origin of replication, the bovine growth hormone polyadenylation sequence, neomycin phosphotransferase exon 1 and exon 2, the dihydrofolate reductase gene, and leader sequence. This vector has been found to result in very high level expression of antibodies upon incorporation of variable and constant region genes, transfection in CHO cells, followed by selection in G418 containing medium and methotrexate amplification. Of course, any expression vector which is capable of eliciting expression in eukaryotic cells may be used in the present invention. Examples of suitable vectors include, but are not limited to plasmids pcDNA3, pHCMV/Zeo, pCR3.1, pEF1/His, pIND/GS, pRc/HCMV2, pSV40/Zeo2, pTRACER-HCMV, pUB6/V5-His, pVAX1, and pZeoSV2 (available from Invitrogen, San Diego, Calif.), and plasmid pCI (available from Promega, Madison, Wis.). In general, screening large numbers of transformed cells for those which express suitably high levels if immunoglobulin heavy and light chains is routine experimentation which can be carried out, for example, by robotic systems. Vector systems are also taught in U.S. Pat. Nos. 5,736,137 and 5,658,570, each of which is incorporated by reference in its entirety herein. This system provides for high expression levels, e.g., >30 pg/cell/day. Other exemplary vector systems are disclosed e.g., in U.S. Pat. No. 6,413,777.
[0385] In other preferred embodiments the antibodies, or antigen-binding fragments, variants, or derivatives thereof of the invention may be expressed using polycistronic constructs such as those disclosed in US patent application publication no. 2003-0157641 A1 and incorporated herein in its entirety. In these expression systems, multiple gene products of interest such as heavy and light chains of antibodies may be produced from a single polycistronic construct. These systems advantageously use an internal ribosome entry site (IRES) to provide relatively high levels of antibodies. Compatible IRES sequences are disclosed in U.S. Pat. No. 6,193,980 which is also incorporated herein. Those skilled in the art will appreciate that such expression systems may be used to effectively produce the full range of antibodies disclosed in the instant application. Therefore, in one embodiment the present invention provides a vector comprising the polynucleotide encoding at least the binding domain or variable region of an immunoglobulin chain of the antibody, optionally in combination with a polynucleotide that encodes the variable region of the other immunoglobulin chain of said binding molecule.
[0386] More generally, once the vector or DNA sequence encoding a monomeric subunit of the antibody has been prepared, the expression vector may be introduced into an appropriate host cell. Introduction of the plasmid into the host cell can be accomplished by various techniques well known to those of skill in the art. These include, but are not limited to, transfection including lipotransfection using, e.g., Fugene or lipofectamine, protoplast fusion, calcium phosphate precipitation, cell fusion with enveloped DNA, microinjection, and infection with intact virus. Typically, plasmid introduction into the host is via standard calcium phosphate co-precipitation method. The host cells harboring the expression construct are grown under conditions appropriate to the production of the light chains and heavy chains, and assayed for heavy and/or light chain protein synthesis. Exemplary assay techniques include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), or fluorescence-activated cell sorter analysis (FACS), immunohistochemistry and the like.
[0387] The expression vector is transferred to a host cell by conventional techniques and the transfected cells are then cultured by conventional techniques to produce an antibody for use in the methods described herein. Thus, the invention includes host cells comprising a polynucleotide encoding an antibody of the invention, or a heavy or light chain thereof, or at least the binding domain or variable region of an immunoglobulin thereof, which preferably are operable linked to a heterologous promoter. In addition or alternatively the invention also includes host cells comprising a vector, as defined hereinabove, comprising a polynucleotide encoding at least the binding domain or variable region of an immunoglobulin chain of the antibody, optionally in combination with a polynucleotide that encodes the variable region of the other immunoglobulin chain of said binding molecule. In preferred embodiments for the expression of double-chained antibodies, a single vector or vectors encoding both the heavy and light chains may be co-expressed in the host cell for expression of the entire immunoglobulin molecule, as detailed below.
[0388] The host cell may be co-transfected with two expression vectors of the invention, the first vector encoding a heavy chain derived polypeptide and the second vector encoding a light chain derived polypeptide. The two vectors may contain identical selectable markers which enable equal expression of heavy and light chain polypeptides. Alternatively, a single vector may be used which encodes both heavy and light chain polypeptides. In such situations, the light chain is advantageously placed before the heavy chain to avoid an excess of toxic free heavy chain; see Proudfoot, Nature 322 (1986), 52; Kohler, Proc. Natl. Acad. Sci. USA 77 (1980), 2197. The coding sequences for the heavy and light chains may comprise cDNA or genomic DNA.
[0389] As used herein, host cells refers to cells which harbor vectors constructed using recombinant DNA techniques and encoding at least one heterologous gene. In descriptions of processes for isolation of antibodies from recombinant hosts, the terms cell and cell culture are used interchangeably to denote the source of antibody unless it is clearly specified otherwise. In other words, recovery of polypeptide from the cells may mean either from spun down whole cells, or from the cell culture containing both the medium and the suspended cells.
[0390] A variety of host-expression vector systems may be utilized to express antibody molecules for use in the methods described herein. Such host-expression systems represent vehicles by which the coding sequences of interest may be produced and subsequently purified, but also represent cells which may, when transformed or transfected with the appropriate nucleotide coding sequences, express an antibody molecule of the invention in situ. These include but are not limited to microorganisms such as bacteria (e.g., Escherichia coli, Bacillus subtilis) transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing antibody coding sequences; yeast (e.g., Saccharomyces, Pichia) transformed with recombinant yeast expression vectors containing antibody coding sequences; insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus) containing antibody coding sequences; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing antibody coding sequences; or mammalian cell systems (e.g., COS, CHO, NSO, BLK, 293, 3T3 cells) harboring recombinant expression constructs containing promoters derived from the genome of mammalian cells (e.g., metallothionein promoter) or from mammalian viruses (e.g., the adenovirus late promoter; the vaccinia virus 7.5K promoter). Preferably, bacterial cells such as E. coli, and more preferably, eukaryotic cells, especially for the expression of whole recombinant antibody molecule, are used for the expression of a recombinant antibody molecule. For example, mammalian cells such as Chinese Hamster Ovary (CHO) cells, in conjunction with a vector such as the major intermediate early gene promoter element from human cytomegalovirus is an effective expression system for antibodies; see, e.g., Foecking et al., Gene 45 (1986), 101; Cockett et al., Bio/Technology 8 (1990), 2.
[0391] The host cell line used for protein expression is often of mammalian origin; those skilled in the art are credited with ability to preferentially determine particular host cell lines which are best suited for the desired gene product to be expressed therein. Exemplary host cell lines include, but are not limited to, CHO (Chinese Hamster Ovary), DG44 and DUXB11 (Chinese Hamster Ovary lines, DHFR minus), HELA (human cervical carcinoma), CVI (monkey kidney line), COS (a derivative of CVI with SV40 T antigen), VERY, BHK (baby hamster kidney), MDCK, WI38, R1610 (Chinese hamster fibroblast) BALBC/3T3 (mouse fibroblast), HAK (hamster kidney line), SP2/O (mouse myeloma), P3x63-Ag3.653 (mouse myeloma), BFA-1c1BPT (bovine endothelial cells), RAJI (human lymphocyte) and 293 (human kidney). CHO and 293 cells are particularly preferred. Host cell lines are typically available from commercial services, the American Tissue Culture Collection or from published literature.
[0392] In addition, a host cell strain may be chosen which modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Such modifications (e.g., glycosylation) and processing (e.g., cleavage) of protein products may be important for the function of the protein. Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of proteins and gene products. Appropriate cell lines or host systems can be chosen to ensure the correct modification and processing of the foreign protein expressed. To this end, eukaryotic host cells which possess the cellular machinery for proper processing of the primary transcript, glycosylation, and phosphorylation of the gene product may be used.
[0393] For long-term, high-yield production of recombinant proteins, stable expression is preferred. For example, cell lines which stably express the antibody molecule may be engineered. Rather than using expression vectors which contain viral origins of replication, host cells can be transformed with DNA controlled by appropriate expression control elements (e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker. Following the introduction of the foreign DNA, engineered cells may be allowed to grow for 1-2 days in an enriched media, and then are switched to a selective media. The selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines. This method may advantageously be used to engineer cell lines which stably express the antibody molecule.
[0394] A number of selection systems may be used, including but not limited to the herpes simplex virus thymidine kinase (Wigler et al., Cell 11 (1977), 223), hypoxanthine-guanine phosphoribosyltransferase (Szybalska and Szybalski, Proc. Natl. Acad. Sci. USA 48 (1992), 202), and adenine phosphoribosyltransferase (Lowy et al., Cell 22 (1980), 817) genes can be employed in tk-, hgprt- or aprt-cells, respectively. Also, anti-metabolite resistance can be used as the basis of selection for the following genes: dhfr, which confers resistance to methotrexate (Wigler et al., Natl. Acad. Sci. USA 77 (1980), 357; O'Hare et al., Proc. Natl. Acad. Sci. USA 78 (1981), 1527); gpt, which confers resistance to mycophenolic acid (Mulligan and Berg, Proc. Natl. Acad. Sci. USA 78 (1981), 2072); neo, which confers resistance to the aminoglycoside G-418 Goldspiel et al., Clinical Pharmacy 12 (1993), 488-505; Wu and Wu, Biotherapy 3 (1991), 87-95; Tolstoshev, Ann. Rev. Pharmacol. Toxicol. 32 (1993), 573-596; Mulligan, Science 260 (1993), 926-932; and Morgan and Anderson, Ann. Rev. Biochem. 62 (1993), 191-217; TIB TECH 11 (1993), 155-215; and hygro, which confers resistance to hygromycin (Santerre et al., Gene 30 (1984), 147. Methods commonly known in the art of recombinant DNA technology which can be used are described in Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, N Y (1993); Kriegler, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, N Y (1990); and in Chapters 12 and 13, Dracopoli et al. (eds), Current Protocols in Human Genetics, John Wiley & Sons, N Y (1994); Colberre-Garapin et al., J. Mol. Biol. 150:1 (1981), which are incorporated by reference herein in their entireties.
[0395] The expression levels of an antibody molecule can be increased by vector amplification, for a review; see Bebbington and Hentschel, The use of vectors based on gene amplification for the expression of cloned genes in mammalian cells in DNA cloning, Academic Press, New York, Vol. 3. (1987). When a marker in the vector system expressing antibody is amplifiable, increase in the level of inhibitor present in culture of host cell will increase the number of copies of the marker gene. Since the amplified region is associated with the antibody gene, production of the antibody will also increase; see Crouse et al., Mol. Cell. Biol. 3 (1983), 257.
[0396] In vitro production allows scale-up to give large amounts of the desired polypeptides. Techniques for mammalian cell cultivation under tissue culture conditions are known in the art and include homogeneous suspension culture, e.g. in an airlift reactor or in a continuous stirrer reactor, or immobilized or entrapped cell culture, e.g. in hollow fibers, microcapsules, on agarose microbeads or ceramic cartridges. If necessary and/or desired, the solutions of polypeptides can be purified by the customary chromatography methods, for example gel filtration, ion-exchange chromatography, chromatography over DEAE-cellulose or (immuno-) affinity chromatography, e.g., after preferential biosynthesis of a synthetic hinge region polypeptide or prior to or subsequent to the HIC chromatography step described herein.
[0397] Genes encoding antibodies, or antigen-binding fragments, variants or derivatives thereof of the invention can also be expressed in non-mammalian cells such as bacteria or insect or yeast or plant cells. Bacteria which readily take up nucleic acids include members of the enterobacteriaceae, such as strains of E. coli or Salmonella; Bacillaceae, such as B. subtilis; Pneumococcus; Streptococcus, and Haemophilus influenzae. It will further be appreciated that, when expressed in bacteria, the heterologous polypeptides typically become part of inclusion bodies. The heterologous polypeptides must be isolated, purified and then assembled into functional molecules. Where tetravalent forms of antibodies are desired, the subunits will then self-assemble into tetravalent antibodies; see, e.g., international application WO 02/096948.
[0398] In bacterial systems, a number of expression vectors may be advantageously selected depending upon the use intended for the antibody molecule being expressed. For example, when a large quantity of such a protein is to be produced, for the generation of pharmaceutical compositions of an antibody molecule, vectors which direct the expression of high levels of fusion protein products that are readily purified may be desirable. Such vectors include, but are not limited, to the E. coli expression vector pUR278 (Ruther et al., EMBO J. 2 (1983), 1791), in which the antibody coding sequence may be ligated individually into the vector in frame with the lacZ coding region so that a fusion protein is produced; pIN vectors (Inouye and Inouye, Nucleic Acids Res. 13 (1985), 3101-3109; Van Heeke and Schuster, J. Biol. Chem. 24 (1989), 5503-5509); and the like. pGEX vectors may also be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST). In general, such fusion proteins are soluble and can easily be purified from lysed cells by adsorption and binding to a matrix of glutathione-agarose beads followed by elution in the presence of free glutathione. The pGEX vectors are designed to include thrombin or factor Xa protease cleavage sites so that the cloned target gene product can be released from the GST moiety.
[0399] In addition to prokaryotes, eukaryotic microbes may also be used. Saccharomyces cerevisiae, or common baker's yeast, is the most commonly used among eukaryotic microorganisms although a number of other strains are commonly available, e.g., Pichia pastoris. For expression in Saccharomyces, the plasmid YRp7, for example, (Stinchcomb et al., Nature 282 (1979), 39; Kingsman et al., Gene 7 (1979), 141; Tschemper et al., Gene 10 (1980), 157) is commonly used. This plasmid already contains the TRP1 gene which provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example ATCC No. 44076 or PEP4-1 (Jones, Genetics 85 (1977), 12). The presence of the trpl lesion as a characteristic of the yeast host cell genome then provides an effective environment for detecting transformation by growth in the absence of tryptophan.
[0400] In an insect system, Autographa californica nuclear polyhedrosis virus (AcNPV) is typically used as a vector to express foreign genes. The virus grows in Spodoptera frugiperda cells. The antibody coding sequence may be cloned individually into non-essential regions (for example the polyhedrin gene) of the virus and placed under control of an AcNPV promoter (for example the polyhedrin promoter).
[0401] Once an antibody molecule of the invention has been recombinantly expressed, the whole antibodies, their dimers, individual light and heavy chains, or other immunoglobulin forms of the present invention, can be purified according to standard procedures of the art, including for example, by chromatography (e.g., ion exchange, affinity, particularly by affinity for the specific antigen after Protein A, and sizing column chromatography), centrifugation, differential solubility, e.g. ammonium sulfate precipitation, or by any other standard technique for the purification of proteins; see, e.g., Scopes, Protein Purification, Springer Verlag, N.Y. (1982). Alternatively, a preferred method for increasing the affinity of antibodies of the invention is disclosed in US patent publication 2002-0123057 A1. In one embodiment therefore, the present invention also provides a method for preparing an anti-FAP antibody or a biotechnological or synthetic derivative thereof or immunoglobulin chain(s) thereof, said method comprising: [0402] (a) culturing the host cell as defined hereinabove, which cell comprises a polynucleotide or a vector as defined hereinbefore; and [0403] (b) isolating said antibody, biotechnological or synthetic derivative or immunoglobulin chain(s) thereof from the culture.
[0404] Furthermore, in one embodiment the present invention also relates to an antibody or immunoglobulin chain(s) thereof encoded by a polynucleotide as defined hereinabove or obtainable by the method for preparing an anti-FAP antibody.
VI. Expression of Chimeric Antigen Receptor (CAR) Polynucleotides
[0405] Regarding the manipulation of the isolated genetic material to provide CARs and CAR T cells of the present invention means and methods for expressing polynucleotides in general are already described with respect to antibodies hereinbefore, e.g. the choice of suitable expression vectors and their design as well as means and methods for transfection of mammalian cells (see section V) and can be applied to the expression of CARs as well. Furthermore, the general design and expression of CARs is described in detail in prior art, e.g. in Tran et al. (J. Exp. Med. 210 (2013), 1125-1135), Schuberth et al. (J. Transl. Med. 11 (2013), 187), Kakarla et al. (Mol. Ther. 21 (2013), 1611-1620), Wang et al. (Cancer Immunol. Res. 2 (2014), 154-166 as well as in WO 2014055442 A2.
[0406] The expression of natural or synthetic nucleic acids encoding the FAP CAR of the present invention is typically achieved by operably linking a nucleic acid encoding the CAR polypeptide or portions thereof to a promoter, and incorporating the construct into an expression vector. The vectors can be suitable for replication and integration eukaryotes. Typical cloning vectors contain transcription and translation terminators, initiation sequences, and promoters useful for regulation of the expression of the desired nucleic acid sequence. The term expression vector has been defined hereinbefore; see section V. The expression constructs of the present invention may also be used for nucleic acid immunization and gene therapy, using standard gene delivery protocols. Methods for gene delivery are known in the art; see, e.g., U.S. Pat. Nos. 5,399,346; 5,580,859; and 5,589,466, incorporated by reference herein in their entireties. In another embodiment, the invention provides a gene therapy vector.
[0407] In one embodiment of the present invention, the sequence of the CAR of the present invention is delivered into eukaryotic cells, tissue or whole organisms using a retroviral or lentiviral vector. In a preferred embodiment, the sequence of the CAR of the present invention is delivered into a T cell. Thus, the present invention is directed to a retroviral or lentiviral vector encoding a CAR that is stably integrated into a T cell and stably expressed therein.
[0408] Vectors derived from retroviruses such as the lentivirus are particularly suitable tools to achieve long-term gene transfer since they allow long-term, stable integration of a transgene and its propagation in daughter cells. Lentiviral vectors have the added advantage over vectors derived from onco-retroviruses such as murine leukemia viruses in that they can transduce non-proliferating cells, such as hepatocytes. They also have the added advantage of low immunogenicity.
[0409] A lentivirus as used herein refers to a genus of the Retroviridae family. Lentiviruses are unique among the retroviruses in being able to infect non-dividing cells; they can deliver a significant amount of genetic information into the DNA of the host cell, so they are one of the most efficient methods of a gene delivery vector. HIV, SIV, and FIV are all examples of lentiviruses. Vectors derived from lentiviruses offer the means to achieve significant levels of gene transfer in vivo. A lentiviral vector is a vector derived from at least a portion of a lentivirus genome, including especially a self-inactivating lentiviral vector as provided in Milone et al., Mol. Ther. 17 (2009), 1453-1464. Other Examples or lentivirus vectors that may be used in the clinic as an alternative to the pELPS vector, include but not limited to, e.g., the LENTIVECTOR gene delivery technology from Oxford BioMedica, the LENTIMAX vector system from Lentigen and the like. Nonclinical types of lentiviral vectors are also available and would be known to one skilled in the art.
[0410] The expression of natural or synthetic nucleic acids encoding the FAP CAR of the present invention can also be achieved by generating an RNA construct encoding the CAR of the present invention which can be directly transferred to the desired cell type.
[0411] In one embodiment of the present invention, the sequence of the CAR of the present invention is delivered into eukaryotic cells, tissue or whole organisms using in vitro transcribed mRNA. In a preferred embodiment, the sequence of the CAR of the present invention is delivered into a T cell.
[0412] Thus, the present invention also discloses an RNA construct encoding the CAR of the present invention that can be directly transfected into a T cell and transiently expressed therein. Transient, non-integrating expression of the CAR in a cell mitigates concerns associated with permanent and integrated expression of CAR in a cell. A method for generating mRNA for use in transfection involves in vitro transcription (IVT) of a the CAR with specially designed primers, followed by poly A addition, to produce a construct containing 3 and 5 untranslated sequence (UTR), a 5 cap and/or Internal Ribosome Entry Site (IRES), the gene to be expressed, and a polyA tail, typically 50-2000 bases in length. RNA produced by this means can efficiently transfect different kinds of cells; for detailed methods see, e.g., international application WO 2014/055442 and Schutsky et al., Oncotarget. 6 (2015), 28911-28928.
[0413] One advantage of the RNA transfection method is that RNA transfection is essentially transient and vector-free. An RNA transgene can be delivered to a lymphocyte and expressed therein following a brief in vitro cell activation, as a minimal expressing cassette without the need for any additional viral sequences. Under these conditions, integration of the transgene into the host cell genome is unlikely. Cloning of cells is not necessary because of the efficiency of transfection of the RNA and its ability to uniformly modify the entire lymphocyte population.
[0414] Genetic modification of T cells with in vitro-transcribed RNA (IVTRNA) makes use of two different strategies both of which have been successively tested in various animal models. Cells are transfected with in vitro-transcribed RNA by means of lipofection or electroporation. Preferably, it is desirable to stabilize IVTRNA using various modifications in order to achieve prolonged expression of transferred IVT-RNA.
[0415] Some IVT vectors are known in the literature which are utilized in a standardized manner as template for in vitro transcription and which have been genetically modified in such a way that stabilized RNA transcripts are produced. Currently protocols used in the art are based on a plasmid vector with the following structure: a 5 RNA polymerase promoter enabling RNA transcription, followed by a gene of interest which is flanked either 3 and/or 5 by untranslated regions (UTR), and a 3 polyadenyl cassette containing 50-70 A nucleotides. Prior to in vitro transcription, the circular plasmid is linearized downstream of the polyadenyl cassette by type II restriction enzymes (recognition sequence corresponds to cleavage site). The polyadenyl cassette thus corresponds to the later poly(A) sequence in the transcript. As a result of this procedure, some nucleotides remain as part of the enzyme cleavage site after linearization and extend or mask the poly(A) sequence at the 3 end. It is not clear, whether this non-physiological overhang affects the amount of protein produced intracellularly from such a construct. RNA has several advantages over more traditional plasmid or viral approaches. Gene expression from an RNA source does not require transcription and the protein product is produced rapidly after the transfection. Further, since the RNA has to only gain access to the cytoplasm, rather than the nucleus, and therefore typical transfection methods result in an extremely high rate of transfection. In addition, plasmid based approaches require that the promoter driving the expression of the gene of interest be active in the cells under study.
[0416] In another aspect, the RNA construct can be delivered into the cells by electroporation; see, e.g., the formulations and methodology of electroporation of nucleic acid constructs into mammalian cells as taught in US applications US 2004/0014645A1, US 2005/0052630A1, US 2005/0070841A1, US 2004/0059285A1, US 2004/0092907A1. The various parameters including electric field strength required for electroporation of any known cell type are generally known in the relevant research literature as well as numerous patents and applications in the field; see e.g., U.S. Pat. No. 6,678,556, U.S. Pat. No. 7,171,264, and U.S. Pat. No. 7,173,116. Apparatus for therapeutic application of electroporation are available commercially, e.g., the MedPulser DNA Electroporation Therapy System (Inovio/Genetronics, San Diego, Calif.), and are described in patents such as U.S. Pat. No. 6,567,694, U.S. Pat. No. 6,516,223, U.S. Pat. No. 5,993,434, U.S. Pat. No. 6,181,964, U.S. Pat. No. 6,241,701, and U.S. Pat. No. 6,233,482. Electroporation may also be used for transfection of cells in vitro as described e.g. in US20070128708A1. Electroporation may also be utilized to deliver nucleic acids into cells in vitro. Accordingly, electroporation-mediated administration into cells of nucleic acids including expression constructs utilizing any of the many available devices and electroporation systems known to those of skill in the art presents an exciting new means for delivering an RNA of interest to a target cell.
[0417] In one embodiment, the present invention provides a cell (e.g., T cell) engineered to express any one of the above-described CAR comprising an FAP binding domain of the anti-FAP antibodies of the present invention (also referred to as FAP CAR T cells), wherein the CAR T cell exhibits an antitumor property and wherein the CAR of the invention when expressed in a T cell is able to redirect antigen recognition based on the FAP antigen binding specificity. In one embodiment, the FAP CAR T cells of the invention can undergo robust in vivo T cell expansion and can establish FAP-specific memory cells that persist at high levels for an extended amount of time in blood and bone marrow. In some instances, the FAP CAR T cells of the invention infused into a patient can eliminate tumor cells in vivo in patients with cancer.
[0418] Prior to expansion and genetic modification of the T cells of the invention, a source of T cells has to be obtained from a subject. T cells can be obtained from a number of sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, cord blood, thymus tissue, tissue from a site of infection, ascites, pleural effusion, spleen tissue, and tumors. In certain embodiments of the present invention, any number of T cell lines available in the art, may be used. Methods to obtain and enrich those T cells are known to a person skilled in the art and are described for example in the international application WO 2014/055442.
[0419] Whether prior to or after genetic modification of the T cells to express the desirable CAR, the T cells can be activated and expanded generally using methods as described, for example, in U.S. Pat. Nos. 6,352,694; 6,534,055; 6,905,680; 6,692,964; 5,858,358; 6,887,466; 6,905,681; 7,144,575; 7,067,318; 7,172,869; 7,232,566; 7,175,843; 5,883,223; 6,905,874; 6,797,514; 6,867,041; and US patent application US 2006/0121005 A1.
[0420] Generally, the T cells of the invention are expanded by contact with a surface having attached thereto an agent that stimulates a CD3/TCR complex associated signal and a ligand that stimulates a co-stimulatory molecule on the surface of the T cells. In particular, T cell populations may be stimulated as described herein, such as by contact with an anti-CD3 antibody, or antigen-binding fragment thereof, or an anti-CD2 antibody immobilized on a surface, or by contact with a protein kinase C activator (e.g., bryostatin) in conjunction with a calcium ionophore. For costimulation of an accessory molecule on the surface of the T cells, a ligand that binds the accessory molecule is used. For example, a population of T cells can be contacted with an anti-CD3 antibody and an anti-CD28 antibody, under conditions appropriate for stimulating proliferation of the T cells. To stimulate proliferation of either CD4+ T cells or CD8+ T cells, an anti-CD3 antibody and an anti-CD28 antibody. Examples of an anti-CD28 antibody include 9.3, B-T3, XR-CD28 (Diaclone, Besancon, France) can be used as can other methods commonly known in the art (Berg et al., Transplant Proc. 30 (1998), 3975-3977; Haanen et al., J. Exp. Med. 190 (1999), 13191328; Garland et al., J. Immunol. Meth. 227 (1999), 53-63). Further details about the activation and expansion of the CAR T cells of the present invention are given in international application WO 2014/055442.
VII. Fusion Proteins and Conjugates
[0421] In certain embodiments, the antibody polypeptide comprises an amino acid sequence or one or more moieties not normally associated with an antibody. Exemplary modifications are described in more detail below. For example, a single-chain Fv antibody fragment of the invention may comprise a flexible linker sequence, or may be modified to add a functional moiety (e.g., PEG, a drug, a toxin, or a label such as a fluorescent, radioactive, enzyme, nuclear magnetic, heavy metal or an active biological agent such as cytokines, chemokines and chemical pathway mediators and the like). Also the CARs of the present invention can be designated as fusion protein.
[0422] An antibody polypeptide of the invention may comprise, consist essentially of, or consist of a fusion protein. Fusion proteins are chimeric molecules which comprise, for example, an immunoglobulin FAP-binding domain with at least one target binding site, and at least one heterologous portion, i.e., a portion with which it is not naturally linked in nature. The amino acid sequences may normally exist in separate proteins that are brought together in the fusion polypeptide or they may normally exist in the same protein but are placed in a new arrangement in the fusion polypeptide. Fusion proteins may be created, for example, by chemical synthesis, or by creating and translating a polynucleotide in which the peptide regions are encoded in the desired relationship.
[0423] The term heterologous as applied to a polynucleotide or a polypeptide, means that the polynucleotide or polypeptide is derived from a distinct entity from that of the rest of the entity to which it is being compared. For instance, as used herein, a heterologous polypeptide to be fused to an antibody, or an antigen-binding fragment, variant, or analog thereof is derived from a non-immunoglobulin polypeptide of the same species, or an immunoglobulin or non-immunoglobulin polypeptide of a different species. As discussed in more detail elsewhere herein, antibodies, or antigen-binding fragments, variants, or derivatives thereof of the invention may further be recombinantly fused to a heterologous polypeptide at the N- or C-terminus or chemically conjugated (including covalent and non-covalent conjugations) to polypeptides or other compositions. For example, antibodies may be recombinantly fused or conjugated to molecules useful as labels in detection assays and effector molecules such as heterologous polypeptides, drugs, radionuclides, or toxins; see, e.g., international applications WO 92/08495; WO 91/14438; WO 89/12624; U.S. Pat. No. 5,314,995; and European patent application EP 0 396 387. They can also be fused to signaling and transmembrane domains as described above to form the chimeric antigen receptor (CARs) of the present invention.
[0424] Antibodies, or antigen-binding fragments, variants, or derivatives thereof of the invention can be composed of amino acids joined to each other by peptide bonds or modified peptide bonds, i.e., peptide isosteres, and may contain amino acids other than the 20 gene-encoded amino acids. Antibodies may be modified by natural processes, such as posttranslational processing, or by chemical modification techniques which are well known in the art. Such modifications are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature. Modifications can occur anywhere in the antibodies, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini, or on moieties such as carbohydrates. It will be appreciated that the same type of modification may be present in the same or varying degrees at several sites in a given antibody. Also, a given antibody may contain many types of modifications. Antibodies may be branched, for example, as a result of ubiquitination, and they may be cyclic, with or without branching. Cyclic, branched, and branched cyclic antibodies may result from posttranslational natural processes or may be made by synthetic methods. Modifications include acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphatidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cysteine, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, pegylation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination; see, e.g., ProteinsStructure And Molecular Properties, T. E. Creighton, W. H. Freeman and Company, New York 2nd Ed., (1993); Posttranslational Covalent Modification Of Proteins, B. C. Johnson, Ed., Academic Press, New York, (1983) 1-12; Seifter et al., Meth. Enzymol. 182 (1990), 626-646; Rattan et al., Ann. NY Acad. Sci. 663 (1992), 48-62).
[0425] The present invention also provides for fusion proteins comprising an antibody, or antigen-binding fragment, variant, or derivative thereof, and a heterologous polypeptide. In one embodiment, a fusion protein of the invention comprises, consists essentially of, or consists of, a polypeptide having the amino acid sequence of any one or more of the V.sub.H regions of an antibody of the invention or the amino acid sequence of any one or more of the V.sub.L regions of an antibody of the invention or fragments or variants thereof, and a heterologous polypeptide sequence. In another embodiment, a fusion protein for use in the diagnostic and treatment methods disclosed herein comprises, consists essentially of, or consists of a polypeptide having the amino acid sequence of any one, two, three of the V.sub.H-CDRs of an antibody, or fragments, variants, or derivatives thereof, or the amino acid sequence of any one, two, three of the V.sub.L-CDRs of an antibody, or fragments, variants, or derivatives thereof, and a heterologous polypeptide sequence. In one embodiment, the fusion protein comprises a polypeptide having the amino acid sequence of a V.sub.H-CDR3 of an antibody of the present invention, or fragment, derivative, or variant thereof, and a heterologous polypeptide sequence, which fusion protein specifically binds to FAP. In another embodiment, a fusion protein comprises a polypeptide having the amino acid sequence of at least one V.sub.H region of an antibody of the invention and the amino acid sequence of at least one V.sub.L region of an antibody of the invention or fragments, derivatives or variants thereof, and a heterologous polypeptide sequence. Preferably, the V.sub.H and V.sub.L regions of the fusion protein correspond to a single source antibody (or scFv or Fab fragment) which specifically binds FAP. In yet another embodiment, a fusion protein for use in the diagnostic and treatment methods disclosed herein comprises a polypeptide having the amino acid sequence of any one, two, three, or more of the V.sub.H CDRs of an antibody and the amino acid sequence of any one, two, three, or more of the V.sub.L CDRs of an antibody, or fragments or variants thereof, and a heterologous polypeptide sequence. Preferably, two, three, four, five, six, or more of the V.sub.H-CDR(s) or V.sub.L-CDR(s) correspond to single source antibody (or scFv or Fab fragment) of the invention. Nucleic acid molecules encoding these fusion proteins are also encompassed by the invention.
[0426] Exemplary fusion proteins reported in the literature include fusions of the T cell receptor (Gascoigne et al., Proc. Natl. Acad. Sci. USA 84 (1987), 2936-2940; CD4 (Capon et al., Nature 337 (1989), 525-531; Traunecker et al., Nature 339 (1989), 68-70; Zettmeissl et al., DNA Cell Biol. USA 9 (1990), 347-353; and Byrn et al., Nature 344 (1990), 667-670); L-selectin (homing receptor) (Watson et al., J. Cell. Biol. 110 (1990), 2221-2229; and Watson et al., Nature 349 (1991), 164-167); CD44 (Aruffo et al., Cell 61 (1990), 1303-1313); CD28 and B7 (Linsley et al., J. Exp. Med. 173 (1991), 721-730); CTLA-4 (Lisley et al., J. Exp. Med. 174 (1991), 561-569); CD22 (Stamenkovic et al., Cell 66 (1991), 1133-1144); TNF receptor (Ashkenazi et al., Proc. Natl. Acad. Sci. USA 88 (1991), 10535-10539; Lesslauer et al., Eur. J. Immunol. 27 (1991), 2883-2886; and Peppel et al., J. Exp. Med. 174 (1991), 1483-1489 (1991); and IgE receptor a (Ridgway and Gorman, J. Cell. Biol. 115 (1991), Abstract No. 1448).
[0427] As discussed elsewhere herein, antibodies, or antigen-binding fragments, variants, or derivatives thereof of the invention may be fused to heterologous polypeptides to increase the in vivo half-life of the polypeptides or for use in immunoassays using methods known in the art. For example, in one embodiment, PEG can be conjugated to the antibodies of the invention to increase their half-life in vivo; see, e.g., Leong et al., Cytokine 16 (2001), 106-119; Adv. in Drug Deliv. Rev. 54 (2002), 531; or Weir et al., Biochem. Soc. Transactions 30 (2002), 512.
[0428] Moreover, antibodies, or antigen-binding fragments, variants, or derivatives thereof of the invention can be fused to marker sequences, such as a peptide to facilitate their purification or detection. In preferred embodiments, the marker amino acid sequence is a hexa-histidine peptide (HIS), such as the tag provided in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, Calif., 91311), among others, many of which are commercially available. As described in Gentz et al., Proc. Natl. Acad. Sci. USA 86 (1989), 821-824, for instance, hexa-histidine provides for convenient purification of the fusion protein. Other peptide tags useful for purification include, but are not limited to, the HA tag, which corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson et al., Cell 37 (1984), 767), GST, c-mycand the flag tag; see, e.g., Bill Brizzard, BioTechniques 44 (2008) 693-695 for a review of epitope tagging techniques, and Table 1 on page 694 therein listing the most common epitope tags usable in the present invention, the subject matter of which is hereby expressly incorporated by reference.
[0429] Fusion proteins can be prepared using methods that are well known in the art; see for example U.S. Pat. Nos. 5,116,964 and 5,225,538. The precise site at which the fusion is made may be selected empirically to optimize the secretion or binding characteristics of the fusion protein. DNA encoding the fusion protein is then transfected into a host cell for expression, which is performed as described hereinbefore.
[0430] Antibodies of the present invention may be used in non-conjugated form or may be conjugated to at least one of a variety of molecules, e.g., to improve the therapeutic properties of the molecule, to facilitate target detection, or for imaging or therapy of the patient. Antibodies, or antigen-binding fragments, variants, or derivatives thereof of the invention can be labeled or conjugated either before or after purification, when purification is performed. In particular, antibodies, or antigen-binding fragments, variants, or derivatives thereof of the invention may be conjugated to therapeutic agents, prodrugs, peptides, proteins, enzymes, viruses, lipids, biological response modifiers, pharmaceutical agents, or PEG.
[0431] Conjugates that are immunotoxins including conventional antibodies have been widely described in the art. The toxins may be coupled to the antibodies by conventional coupling techniques or immunotoxins containing protein toxin portions can be produced as fusion proteins. The antibodies of the present invention can be used in a corresponding way to obtain such immunotoxins. Illustrative of such immunotoxins are those described by Byers, Seminars Cell. Biol. 2 (1991), 59-70 and by Fanger, Immunol. Today 12 (1991), 51-54.
[0432] Those skilled in the art will appreciate that conjugates may also be assembled using a variety of techniques depending on the selected agent to be conjugated. For example, conjugates with biotin are prepared, e.g., by reacting a FAP-binding polypeptide with an activated ester of biotin such as the biotin N-hydroxysuccinimide ester. Similarly, conjugates with a fluorescent marker may be prepared in the presence of a coupling agent, e.g. those listed herein, or by reaction with an isothiocyanate, preferably fluorescein-isothiocyanate. Conjugates of the antibodies, or antigen-binding fragments, variants or derivatives thereof of the invention are prepared in an analogous manner.
[0433] The present invention further encompasses antibodies, biotechnological and synthetic derivatives thereof as well as equivalent FAP-binding agents of the invention conjugated to a diagnostic or therapeutic agent. Especially for therapeutic use, the antibody of the present invention and fusion proteins thereof as well as compositions according to the present invention can comprise a biologically active agent such as cytokines, chemokines or signaling pathway mediators or radioisotopes for therapeutic use. For example, cytokines, which are known to have anti-cancer activity, cannot find their way cannot find their way to clinical exploitation due to their devastating toxicity shown during dose escalation to therapeutically active concentrations. To circumvent these problems, an elegant and efficient way to accumulate therapeutic agents at the tumor site, thus reducing systemic side effects, is their conjugation to tumor-specific antibodies, e.g. to FAP. A review about immunocytokines conjugated to a single-chain human antibody that selectively targets tumor-associated stroma or blood vessels is given, e.g., in Ronca et al., Immunobiology 214 (2009), 800-810.
[0434] The antibodies can be used diagnostically to, for example, demonstrate presence of a FAP-related disease to indicate the risk of getting a disease or disorder associated with FAP, to monitor the development or progression of such a disease, i.e. a disease showing the occurrence of, or related to elevated levels of FAP, or as part of a clinical testing procedure to, e.g., determine the efficacy of a given treatment and/or prevention regimen. In one embodiment thus, the present invention relates to an antibody, which is detectably labeled. Furthermore, in one embodiment, the present invention relates to an antibody, which is attached to a drug. Detection can be facilitated by coupling the antibody, or antigen-binding fragment, variant, or derivative thereof to a detectable substance. The detectable substances or label may be in general an enzyme; a heavy metal, preferably gold; a dye, preferably a fluorescent or luminescent dye; or a radioactive label. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, radioactive materials, positron emitting metals using various positron emission tomographies, and nonradioactive paramagnetic metal ions; see, e.g., U.S. Pat. No. 4,741,900 for metal ions which can be conjugated to antibodies for use as diagnostics according to the present invention. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, beta-galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an example of a luminescent material includes luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin; and examples of suitable radioactive material include .sup.125I, .sup.131I, .sup.111In or .sup.99Tc. Therefore, in one embodiment the present invention provides a detectably labeled antibody, wherein the detectable label is selected from the group consisting of an enzyme, a radioisotope, a fluorophore and a heavy metal. Further suitable radioactive labels and cytotoxins for FAP-targeting are known to the person skilled in the art; see, e.g., international application WO 2011/040972.
[0435] An antibody, or antigen-binding fragment, variant, or derivative thereof also can be detectably labeled by coupling it to a chemiluminescent compound. The presence of the chemiluminescent-tagged antibody is then determined by detecting the presence of luminescence that arises during the course of a chemical reaction. Examples of particularly useful chemiluminescent labeling compounds are luminol, isoluminol, theromatic acridinium ester, imidazole, acridinium salt and oxalate ester. One of the ways in which an antibody, or antigen-binding fragment, variant, or derivative thereof can be detectably labeled is by linking the same to an enzyme and using the linked product in an enzyme immunoassay (EIA) (Voller, A., The Enzyme Linked Immunosorbent Assay (ELISA) Microbiological Associates Quarterly Publication, Walkersville, Md., Diagnostic Horizons 2 (1978), 1-7); Voller et al., J. Clin. Pathol. 31 (1978), 507-520; Butler, Meth. Enzymol. 73 (1981), 482-523; Maggio, (ed.), Enzyme Immunoassay, CRC Press, Boca Raton, Fla., (1980); Ishikawa, et al., (eds.), Enzyme Immunoassay, Kgaku Shoin, Tokyo (1981). The enzyme, which is bound to the antibody, will react with an appropriate substrate, preferably a chromogenic substrate, in such a manner as to produce a chemical moiety which can be detected, for example, by spectrophotometric, fluorimetric or by visual means. Enzymes which can be used to detectably label the antibody include, but are not limited to, malate dehydrogenase, staphylococcal nuclease, delta-5-steroid isomerase, yeast alcohol dehydrogenase, alpha-glycerophosphate, dehydrogenase, triose phosphate isomerase, horseradish peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, beta-galactosidase, ribonuclease, urease, catalase, glucose-6-phosphate dehydrogenase, glucoamylase and acetylcholinesterase. Additionally, the detection can be accomplished by colorimetric methods which employ a chromogenic substrate for the enzyme. Detection may also be accomplished by visual comparison of the extent of enzymatic reaction of a substrate in comparison with similarly prepared standards.
[0436] Detection may also be accomplished using any of a variety of other immunoassays. For example, by radioactively labeling the antibody, or antigen-binding fragment, variant, or derivative thereof, it is possible to detect the antibody through the use of a radioimmunoassay (RIA) (see, for example, Weintraub, B., Principles of Radioimmunoassays, Seventh Training Course on Radioligand Assay Techniques, The Endocrine Society, (March, 1986)), which is incorporated by reference herein). The radioactive isotope can be detected by means including, but not limited to, a gamma counter, a scintillation counter, or autoradiography. An antibody, or antigen-binding fragment, variant, or derivative thereof can also be detectably labeled using fluorescence emitting metals such as .sup.152Eu, or others of the lanthanide series. These metals can be attached to the antibody using such metal chelating groups as diethylenetriaminepentacetic acid (DTPA) or ethylenediaminetetraacetic acid (EDTA).
[0437] Techniques for conjugating various moieties to an antibody, or antigen-binding fragment, variant, or derivative thereof are well known, see, e.g., Arnon et al., Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy, in Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.), pp. 243-56 (Alan R. Liss, Inc. (1985); Hellstrom et al., Antibodies For Drug Delivery, in Controlled Drug Delivery (2nd Ed.), Robinson et al. (eds.), Marcel Dekker, Inc., (1987) 623-53; Thorpe, Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review, in Monoclonal Antibodies '84: Biological And Clinical Applications, Pinchera et al. (eds.), (1985) 475-506; Analysis, Results, And Future Prospective Of The Therapeutic Use Of Radiolabeled Antibody In Cancer Therapy, in Monoclonal Antibodies For Cancer Detection And Therapy, Baldwin et al. (eds.), Academic Press (1985) 303-16, and Thorpe et al., The Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates, Immunol. Rev. 62 (1982), 119-158. As mentioned, in certain embodiments, a moiety that enhances the stability or efficacy of a binding molecule, e.g., a binding polypeptide, e.g., an antibody or immunospecific fragment thereof can be conjugated. For example, in one embodiment, PEG can be conjugated to the binding molecules of the invention to increase their half-life in vivo. Leong et al., Cytokine 16 (2001), 106; Adv. in Drug Deliv. Rev. 54 (2002), 531; or Weir et al., Biochem. Soc. Transactions 30 (2002), 512.
VIII. Compositions and Methods of Use
[0438] As demonstrated in the appended Examples and illustrated in the Figures the anti-FAP antibody of the present invention is capable of selectively binding FAP in vitro and its epitope provide for a reliable FAP non-invasive and tissue-free detection assay. Furthermore, the anti-FAP antibody of the present invention is capable of selectively binding FAP in vivo in human blood plasma and on diseased tissue characterized by the presence of FAP such as breast cancer tissue, carcinoma, multiple myeloma tissue as well as atherosclerotic plaque and obstructive coronary thrombi. Moreover, in some embodiments the anti-FAP antibody of the present has an inhibitory effect on FAP serine protease activity and is biologically active in vivo, exerting therapeutic effects such as prolonging blood coagulation and arterial occlusion times as well as anti-tumor effect on, e.g., colorectal cancer. All these properties make the anti-FAP antibody of the present invention and equivalents thereof described in the preceding sections useful in variety of diagnostic and therapeutic applications.
[0439] Thus, the present invention relates to compositions comprising the aforementioned FAP-binding molecule, e.g., antibody or biotechnological or synthetic derivative thereof of the present invention, or the polynucleotide, vector, cell or peptide of the invention as defined hereinbefore and uses thereof. In one embodiment, the composition of the present invention is a pharmaceutical composition and further comprises a pharmaceutically acceptable carrier. Furthermore, the pharmaceutical composition of the present invention may comprise further agents such as anti-tumor agents, interleukins or interferons depending on the intended use of the pharmaceutical composition. For use in the treatment of a disease or disorder showing the occurrence of, or related to increased level of FAP, the additional agent may be selected from the group consisting of small organic molecules, anti-FAP antibodies, and combinations thereof. Hence, in a particular preferred embodiment the present invention relates to the use of the FAP-binding molecule, e.g., antibody or antigen-binding fragment thereof of the present invention or of a binding molecule having substantially the same binding specificities of any one thereof, the polynucleotide, the vector or the cell of the present invention for the preparation of a pharmaceutical or diagnostic composition for prophylactic and therapeutic treatment of a disease or disorder associated with FAP, monitoring the progression of a disease or disorder associated with FAP or a response to a FAP-targeted treatment in a subject or for determining a subject's risk for developing a disease or disorder associated with FAP.
[0440] Hence, in one embodiment the present invention relates to a method of treating a disease or disorder characterized by abnormal expression of FAP in affected tissue and organs such as cancer, vascular system, see also supra, which method comprises administering to a subject in need thereof a therapeutically effective amount of any one of the afore-described FAP-binding agents, antibodies, polynucleotides, vectors, cells or peptides of the instant invention.
[0441] A particular advantage of the therapeutic approach of the present invention lies in the fact that the recombinant antibodies of the present invention are derived from human memory B cells which have already successfully gone through somatic maturation, i.e. the optimization with respect to selectivity and effectiveness in the high affinity binding to the target FAP molecule by means of somatic variation of the variable regions of the antibody.
[0442] The knowledge that such cells in vivo, e.g. in a human, have not been activated by means of related or other physiological proteins or cell structures in the sense of an autoimmunological or allergic reaction is also of great medical importance since this signifies a considerably increased chance of successfully living through the clinical test phases. So to speak, efficiency, acceptability and tolerability have already been demonstrated before the preclinical and clinical development of the prophylactic or therapeutic antibody in at least one human subject. It can thus be expected that the human anti-FAP antibodies of the present invention, both its target-specific efficiency as therapeutic agent and its decreased probability of side effects significantly increase its clinical probability of success.
[0443] The present invention also provides a pharmaceutical and diagnostic, respectively, pack or kit comprising one or more containers filled with one or more of the above described ingredients, e.g. anti-FAP antibody, binding fragment, derivative or variant thereof, polynucleotide, vector, cell and/or peptide of the present invention. Associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration. In addition or alternatively the kit comprises reagents and/or instructions for use in appropriate diagnostic assays. The composition, e.g. kit of the present invention is of course particularly suitable for the risk assessment, diagnosis, prevention and treatment of a disease or disorder which is accompanied with the presence of FAP, and in particular applicable for the treatment of disorders generally characterized by FAP expression comprising diseases and/or disorders such as cancer, atherosclerosis and clotting disorders; see supra.
[0444] The pharmaceutical compositions of the present invention can be formulated according to methods well known in the art; see for example Remington: The Science and Practice of Pharmacy (2000) by the University of Sciences in Philadelphia, ISBN 0-683-306472. Examples of suitable pharmaceutical carriers are well known in the art and include phosphate buffered saline solutions, water, emulsions, such as oil/water emulsions, various types of wetting agents, sterile solutions etc. Compositions comprising such carriers can be formulated by well-known conventional methods. These pharmaceutical compositions can be administered to the subject at a suitable dose. Administration of the suitable compositions may be effected by different ways, e.g., by intravenous, intraperitoneal, subcutaneous, intramuscular, intranasal, topical or intradermal administration or spinal or brain delivery. Aerosol formulations such as nasal spray formulations include purified aqueous or other solutions of the active agent with preservative agents and isotonic agents. Such formulations are preferably adjusted to a pH and isotonic state compatible with the nasal mucous membranes. Formulations for rectal or vaginal administration may be presented as a suppository with a suitable carrier.
[0445] The dosage regimen will be determined by the attending physician and clinical factors. As is well known in the medical arts, dosages for any one patient depends upon many factors, including the patient's size, body surface area, age, the particular compound to be administered, sex, time and route of administration, general health, and other drugs being administered concurrently. A typical dose can be, for example, in the range of 0.001 to 1000 g (or of nucleic acid for expression or for inhibition of expression in this range); however, doses below or above this exemplary range are envisioned, especially considering the aforementioned factors. Generally, the dosage can range, e.g., from about 0.0001 to 100 mg/kg, and more usually 0.01 to 5 mg/kg (e.g., 0.02 mg/kg, 0.25 mg/kg, 0.5 mg/kg, 0.75 mg/kg, 1 mg/kg, 2 mg/kg, etc.), of the host body weight. For example dosages can be 1 mg/kg body weight or 10 mg/kg body weight or within the range of 1-10 mg/kg, preferably at least 1 mg/kg. Doses intermediate in the above ranges are also intended to be within the scope of the invention. Subjects can be administered such doses daily, on alternative days, weekly or according to any other schedule determined by empirical analysis. An exemplary treatment entails administration in multiple dosages over a prolonged period, for example, of at least six months. Additional exemplary treatment regimens entail administration once per every two weeks or once a month or once every 3 to 6 months. Exemplary dosage schedules include 1-10 mg/kg or 15 mg/kg on consecutive days, 30 mg/kg on alternate days or 60 mg/kg weekly. In some methods, two or more monoclonal antibodies with different binding specificities are administered simultaneously, in which case the dosage of each antibody administered falls within the ranges indicated. Progress can be monitored by periodic assessment. Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline, and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases, and the like. Furthermore, the pharmaceutical composition of the invention may comprise further agents such as dopamine or psychopharmacologic drugs, depending on the intended use of the pharmaceutical composition.
[0446] In one embodiment, it may be beneficial to use recombinant Fab (rFab) and single chain fragments (scFvs) of the antibody of the present invention, which might more readily penetrate a cell membrane. The perceived advantages of using small Fab and scFv engineered antibody formats which lack the effector function include more efficient passage across the blood-brain barrier and minimizing the risk of triggering inflammatory side reactions. Furthermore, besides scFv and single-domain antibodies retain the binding specificity of full-length antibodies, they can be expressed as single genes and intracellularly in mammalian cells as intrabodies, with the potential for alteration of the folding, interactions, modifications, or subcellular localization of their targets; see for review, e.g., Miller and Messer, Molecular Therapy 12 (2005), 394-401.
[0447] In a different approach Muller et al., Expert Opin. Biol. Ther. (2005), 237-241, describe a technology platform, so-called SuperAntibody Technology, which is said to enable antibodies to be shuttled into living cells without harming them. Such cell-penetrating antibodies open new diagnostic and therapeutic windows. The term TransMabs has been coined for these antibodies.
[0448] In a further embodiment, co-administration or sequential administration of other FAP-targeting agents may be desirable. Examples of agents which can be used to treat a subject include, but are not limited to: Agents which stabilize the FAP-tetramer, such as Tafamidis Meglumin, diflusinal, doxycyclin with ursodeoxycholic acid; anti-inflammatory agents such as diflusinal, corticosteroids, 2-(2,6-dichloranilino) phenylacetic acid (diclofenac), iso-butyl-propanoic-phenolic acid (ibuprofen); diuretics, Epigallocatechin gallate, Melphalan hydrochloride, dexamethasone, Bortezomib, Bortezomib-Melphalan, Bortezomib-dexamethasone, Melphalan-dexamethasone, Bortezomib-Melphalan-dexamethasone; antidepressants, antipsychotic drugs, neuroleptics, antidementiva (e.g. the NMDA-rezeptor antagonist memantine), acetylcholinesterase inhibitors (e.g. Donepezil, HCl, Rivastigmine, Galantamine), glutamat-antagonists and other nootropics blood pressure medication (e.g. Dihydralazin, Methyldopa), cytostatics, glucocorticoides, angiotensin-converting-enzyme (ACE) inhibitors; anti-inflammatory agents or any combination thereof.
[0449] Examples of agents which may be used for treating or preventing organ rejection following clinical organ transplantation include but are not limited to the agents of the group which lead to a weakening of the immune system, i.e. immunosuppressive comprising such as calcineurin inhibitors such as cyclosporine and Tacrolimus, inhibitors of proliferation such as mTOR inhibitors comprising Everolimus and Sirolimus (rapamycin) as well as antimetabolites such as Azathioprin, Mycophenolat Mofetil/MMF and mycophenolic acid, and corticosteroids such as cortisone and cortisol as well as synthetical substances such as Prednison or Prednisolon can be used. Additionally antibodies can be used such as anti-IL2-receptor monoclonal antibodies (e.g. Basiliximab, Daclizumab) as well as anti-CD3 monoclonal antibodies (e.g. Muromonab-CD3), and polyclonal compositions such as anti-thymocyte globulin (ATG); and glucagon-like peptide-1 (GLP-1) receptor agonists (see, e.g., Noguchi et al., Acta Med. Okayama, 60 (2006), and the international application WO 2012/088157). Furthermore, additional agents might comprise agents for the prophylaxis and or treatment of infections and other side effects after an organ transplantation comprising valganciclovir, cytomegalie-immunoglobulin, gancyclovir, amphotericin B, pyrimethamin, ranitidine, ramipril, furosemide, benzbromaron. Therefore, in one embodiment a composition is provided further comprising an additional agent useful for treating FAP amyloidosis and/or in treating or preventing organ rejection following, e.g. clinical liver transplantation.
[0450] In a particular preferred embodiment, the present invention relates to a therapeutic agent, preferably FAP-targeting agent for use in the treatment of a patient suffering from or being at risk of developing a disease associated with FAP as characterized hereinbefore, characterized in that a sample of the patient's blood, compared to a control sample from a healthy subject shows an elevated level of FAP as determined by detecting an epitope of FAP consisting of or comprising the amino acid sequence of any one of SEQ ID NOS: 30 to 32 and 60. Preferably, the patient has been diagnosed in accordance with the method of the present invention as described further below. In practice, it can be expected that the medication with FAP-targeting agents, in particular anti-FAP antibodies NI-206.82C2 and NI-206.18H2 and its biotechnological and synthetic derivatives as well as equivalent FAP-binding agents will most often be combined with the method and assay of the present invention, illustrated in the Examples that quantifies the epitopes 525-PPQFDRSKKYP-535 and 501-IQLPKEEIKKL-511, thereby specifically measuring the amount of the drug target FAP and thus also allowing to dose the therapeutically effective amount for medication.
[0451] A therapeutically effective dose or amount refers to that amount of the active ingredient sufficient to ameliorate the symptoms or condition. Therapeutic efficacy and toxicity of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., ED.sub.50 (the dose therapeutically effective in 50% of the population) and LD.sub.50 (the dose lethal to 50% of the population). The dose ratio between therapeutic and toxic effects is the therapeutic index, and it can be expressed as the ratio, LD.sub.50/ED.sub.50.
[0452] From the foregoing, it is evident that the present invention encompasses any use of an FAP-binding molecule comprising at least one CDR of the above described antibodies, in particular for diagnosing and/or treatment of a FAP-related disease or disorder. Preferably, said binding molecule is an antibody of the present invention. In addition, the present invention relates to anti-idiotypic antibodies of any one of the mentioned antibodies described hereinbefore. These are antibodies or other binding molecules which bind to the unique antigenic peptide sequence located on an antibody's variable region near the antigen-binding site and are useful, e.g., for the detection of anti-FAP antibodies in a sample obtained from a subject. In one embodiment thus, the present invention provides an antibody as defined hereinabove and below or a FAP-binding molecule having substantially the same binding specificities of any one thereof, the polynucleotide, the vector or the cell as defined herein or a pharmaceutical or diagnostic composition comprising any one thereof for use in prophylactic treatment, therapeutic treatment and/or monitoring the progression or a response to treatment of a disease or disorder related to FAP, see supra.
[0453] In another embodiment the present invention relates to a diagnostic composition comprising any one of the above described FAP-binding molecules, antibodies, antigen-binding fragments, polynucleotides, vectors, cells and/or peptides of the invention and optionally suitable means for detection such as reagents conventionally used in immuno- or nucleic acid-based diagnostic methods. The antibodies of the invention are, for example, suited for use in immunoassays in which they can be utilized in liquid phase or bound to a solid phase carrier. Examples of immunoassays which can utilize the antibody of the invention are competitive and non-competitive immunoassays in either a direct or indirect format. Examples of such immunoassays are the radioimmunoassay (RIA), the sandwich (immunometric assay), flow cytometry, and the Western blot assay. The antigens and antibodies of the invention can be bound to many different carriers and used to isolate cells specifically bound thereto. Examples of well-known carriers include glass, polystyrene, polyvinyl chloride, polypropylene, polyethylene, polycarbonate, dextran, nylon, amyloses, natural and modified celluloses, polyacrylamides, agaroses, and magnetite. The nature of the carrier can be either soluble or insoluble for the purposes of the invention. There are many different labels and methods of labeling known to those of ordinary skill in the art. Examples of the types of labels which can be used in the present invention include enzymes, radioisotopes, colloidal metals, fluorescent compounds, chemiluminescent compounds, and bioluminescent compounds; see also the embodiments discussed hereinabove.
[0454] By a further embodiment, the FAP-binding molecules, in particular antibodies of the present invention may also be used in a method for the diagnosis of a FAP-related disease or disorder in an individual by obtaining a body fluid sample from the tested individual which may be a blood sample, a plasma sample, a serum sample, a lymph sample or any other body fluid sample, such as a saliva or a urine sample and contacting the body fluid sample with an antibody of the instant invention under conditions enabling the formation of antibody-antigen complexes. The level of such complexes is then determined by methods known in the art, a level significantly higher than that formed in a control sample indicating the disease or disorder in the tested individual. In the same manner, the specific antigen bound by the antibodies of the invention may also be used. Thus, the present invention relates to an in vitro immunoassay comprising the binding molecule, e.g., antibody or antigen-binding fragment thereof of the invention. Preferably, the FAP-binding molecule is anti-FAP antibody NI-206.82C2 or NI-206.18H2 or a recombinant, biotechnological or synthetic derivative thereof.
[0455] In a further embodiment of the present invention the FAP-binding molecules, in particular antibodies of the present invention may also be used in a method for the diagnosis of a disease or disorder in an individual by obtaining a biopsy from the tested individual which may be skin, salivary gland, hair roots, heart, colon, nerve, subcutaneous fat biopsies, or a biopsy from any affected organs.
[0456] In this context, the present invention also relates to means specifically designed for this purpose. For example, an antibody-based array may be used, which is for example loaded with antibodies or equivalent antigen-binding molecules of the present invention which specifically recognize FAP. Design of microarray immunoassays is summarized in Kusnezow et al., Mol. Cell Proteomics 5 (2006), 1681-1696. Accordingly, the present invention also relates to microarrays loaded with FAP-binding molecules identified in accordance with the present invention.
[0457] In one embodiment, the present invention relates to a method of diagnosing a disease or disorder related to FAP in a subject, the method comprising determining the presence of FAP in a sample from the subject to be diagnosed with at least one antibody of the present invention, a FAP-binding fragment thereof or an FAP-binding molecule having substantially the same binding specificities of any one thereof, wherein the presence of FAP is indicative for a FAP-related disease and an increase of the level of FAP in comparison to the level in a healthy control is indicative for progression of FAP amyloidosis in said subject.
[0458] The subject to be diagnosed may be asymptomatic or preclinical for the disease. Preferably, the control subject has a disease associated with FAP, wherein a similarity between the level of FAP and the reference standard indicates that the subject to be diagnosed has a FAP-related disease or is at risk to develop a FAP-related disease. Alternatively, or in addition as a second control the control subject does not have a FAP-related disease, wherein a difference between the level of physiological FAP and the reference standard indicates that the subject to be diagnosed has a FAP-related disease or is at risk to develop a FAP-related disease. Preferably, the subject to be diagnosed and the control subject(s) are age-matched. The sample to be analyzed may be any body fluid suspected to contain FAP, for example a blood, blood plasma, blood serum, urine, peritoneal fluid, saliva or cerebral spinal fluid (CSF).
[0459] The level of FAP may be assessed by any suitable method known in the art comprising, e.g., analyzing FAP by one or more techniques chosen from Western blot, immunoprecipitation, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), fluorescent activated cell sorting (FACS), two-dimensional gel electrophoresis, mass spectroscopy (MS), matrix-assisted laser desorption/ionization-time of flight-MS (MALDI-TOF), surface-enhanced laser desorption ionization-time of flight (SELDI-TOF), high performance liquid chromatography (HPLC), fast protein liquid chromatography (FPLC), multidimensional liquid chromatography (LC) followed by tandem mass spectrometry (MS/MS), and laser densitometry. Preferably, said in vivo imaging of FAP comprises scintigraphy, positron emission tomography (PET), single photon emission tomography (SPECT), near infrared (NIR) optical imaging or magnetic resonance imaging (MRI).
[0460] In a particular preferred embodiment, the present invention relates to an in vitro method of diagnosing whether a subject suffers from a disease associated with FAP or whether a subject is amenable to the treatment with a FAP-specific therapeutic agent, the method comprising determining in a sample derived from a body fluid of the subject, preferably blood the presence of FAP, wherein an elevated level of FAP compared to the level in a control sample from a healthy subject is indicative for the disease and possibility for the treatment with the agent, wherein the method is characterized in that the level of FAP is determined by way of detecting an epitope of FAP comprising or consisting of the amino acid sequence of any one of SEQ ID NOS: 30 to 32 or 60. As demonstrated in Example 15 and illustrated in
[0461] As indicated above, the antibodies of the present invention, fragments thereof and molecules of the same binding specificity as the antibodies and fragments thereof may be used not only in vitro but in vivo as well, wherein besides diagnostic, therapeutic applications as well may be pursued. In one embodiment thus, the present invention also relates to a FAP-binding molecule comprising at least one CDR of an antibody of the present invention for the preparation of a composition for in vivo detection/imaging of or targeting a therapeutic and/or diagnostic agent to FAP in the human or animal body. Potential therapeutic and/or diagnostic agents may be chosen from the non-exhaustive enumerations of the therapeutic agents useful in treatment FAP-related diseases and potential labels as indicated hereinbefore. In respect of the in vivo imaging, in one preferred embodiment the present invention provides said FAP-binding molecule comprising at least one CDR of an antibody of the present invention, wherein said in vivo imaging comprises scintigraphy, positron emission tomography (PET), single photon emission tomography (SPECT), near infrared (NIR) optical imaging or magnetic resonance imaging (MRI). In a further embodiment the present invention also provides said FAP-binding molecule comprising at least one CDR of an antibody of the present invention, or said molecule for the preparation of a composition for the above specified in vivo imaging methods, for the use in the method of diagnosing or monitoring the progression of a disease or disorder related to FAP in a subject, as defined hereinabove.
[0462] Since the antigen binding domain of the CARs of the present invention are derived from the human anti-FAP antibodies of the present invention, it is prudent to expect that said CARs substantially retain the binding characteristics of these antibodies, in particular the selectively and pH-dependent binding to FAP in vivo in human blood plasma and on diseased tissue characterized by the presence of FAP such as breast cancer tissue, carcinoma, multiple myeloma tissue, atherosclerotic plaque and obstructive coronary thrombi as well as the same or similar inhibitory effect on FAP serine protease activity and the anti-tumor effect. Furthermore, since the recombinant antibodies of the present invention are derived from human memory B cells it is possible to produce CARs entirely made up of human-derived components thus arriving at a FAP CAR and CAR T cell which less immunogenic, if at all compared to those described in the prior art using for example FAP binding domain from mouse monoclonal antibody.
[0463] Thus, the present invention inter alia relates a cell (e.g., T cell) modified to express the FAP CAR of the present invention which is preferably entirely human in the sense of substantially lacking antigens foreign to the human body and, in some instances, can elicit a CAR-mediated T-cell response. The invention provides the use of the FAP CAR to redirect the specificity of a primary T cell to the FAP antigen. Thus, the present invention also provides a method for use in stimulating a T cell-mediated immune response to a population of stromal cells within a tumor microenvironment in a mammal comprising the step of administering to the mammal a T cell that expresses the FAP CAR of the present invention.
[0464] In one embodiment, the CAR of the present invention is for use in a type of cellular therapy where T cells are genetically modified to express a CAR and the CAR T cell is infused to a recipient in need thereof. The infused cell is able to reduce tumor burden in the recipient. Unlike antibody therapies, CAR T cells are able to replicate in vivo resulting in long term persistence that can lead to sustained tumor control. In one embodiment, the CAR T cells of the invention can undergo robust in vivo T cell expansion and can persist for an extended amount of time. In another embodiment, the CAR T cells of the invention evolve into specific memory T cells that can be reactivated to inhibit any additional tumor formation or growth. For example, CAR T cells of the invention can undergo robust in vivo T cell expansion and persist at high levels for an extended amount of time in blood and bone marrow and form specific memory T cells. Without wishing to be bound by any particular theory, CAR T cells may differentiate in vivo into a central memory-like state upon encounter and subsequent elimination of target cells expressing the surrogate antigen.
[0465] Without wishing to be bound by any particular theory, the response elicited by the CAR-modified T cells may be an active or a passive immune response. In addition, the CAR mediated immune response may be part of an adoptive immunotherapy approach in which CAR-modified T cells induce an immune response specific to the antigen binding domain in the CAR. For example, a FAP CAR T cell elicits an immune response specific against cells expressing FAP. While the data disclosed herein specifically disclose a CAR comprising an anti-FAP binding domain, along with 4-1BB and CD3zeta signaling domains, the invention should be construed to include any number of variations for each of the components of the construct as described elsewhere herein.
[0466] As described elsewhere herein, the present invention provides FAP CAR T cells for use in the targeting of stromal cells which exist in the tumor microenvironment to treat cancers. As such, the present invention includes the CARs of the present invention for use in the treatment of any cancer where stromal cells exist. Cancers that may be treated include tumors that are not vascularized, or not yet substantially vascularized, as well as vascularized tumors. The cancers may comprise non-solid tumors (such as hematological tumors, for example, leukemias and lymphomas) or may comprise solid tumors. Types of cancers to be treated with the CARs of the invention include, but are not limited to, carcinoma, blastoma, and sarcoma, and certain leukemia or lymphoid malignancies, benign and malignant tumors, and malignancies e.g., sarcomas, carcinomas, and melanomas. Adult tumors/cancers and pediatric tumors/cancers are also included.
[0467] Hematologic cancers are cancers of the blood or bone marrow. Examples of hematological (or hematogenous) cancers include leukemias, including acute leukemias (such as acute lymphocytic leukemia, acute myelocytic leukemia, acute myelogenous leukemia and myeloblastic, promyelocytic, myelomonocytic, monocytic and erythroleukemia), chronic leukemias (such as chronic myelocytic (granulocytic) leukemia, chronic myelogenous leukemia, and chronic lymphocytic leukemia), polycythemia vera, lymphoma, Hodgkin's disease, non-Hodgkin's lymphoma (indolent and high grade forms), multiple myeloma, Waldenstrom's macroglobulinemia, heavy chain disease, myelodysplastic syndrome, hairy cell leukemia and myelodysplasia.
[0468] Solid tumors are abnormal masses of tissue that usually do not contain cysts or liquid areas. Solid tumors can be benign or malignant. Different types of solid tumors are named for the type of cells that form them (such as sarcomas, carcinomas, and lymphomas). Examples of solid tumors, such as sarcomas and carcinomas, include fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteosarcoma, and other sarcomas, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, lymphoid malignancy, pancreatic cancer, breast cancer, lung cancers, ovarian cancer, prostate cancer, hepatocellular carcinoma, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, medullary thyroid carcinoma, papillary thyroid carcinoma, pheochromocytomas sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, Wilms' tumor, cervical cancer, testicular tumor, seminoma, bladder carcinoma, melanoma, and CNS tumors (such as a glioma (such as brainstem glioma and mixed gliomas), glioblastoma (also known as glioblastoma multiforme) astrocytoma, CNS lymphoma, germinoma, medulloblastoma, Schwannoma craniopharyogioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, menangioma, neuroblastoma, retinoblastoma and brain metastases).
[0469] The CAR-modified T cells of the invention may also be used as a type of vaccine for ex vivo immunization and/or in vivo therapy in a mammal. Preferably, the mammal is a human.
[0470] With respect to ex vivo immunization, at least one of the following occurs in vitro prior to administering the cell into a mammal: i) expansion of the cells, ii) introducing a nucleic acid encoding a CAR to the cells, and/or iii) cryopreservation of the cells. Ex vivo procedures are well known in the art and are discussed more fully below. Briefly, cells are isolated from a mammal (preferably a human) and genetically modified (i.e., transduced or transfected in vitro) with a vector expressing a CAR disclosed herein. The CAR-modified cell can be administered to a mammalian recipient to provide a therapeutic benefit. Tue mammalian recipient may be a human and the CAR-modified cell can be autologous with respect to the recipient. Alternatively, the cells can be allogeneic, syngeneic or xenogeneic with respect to the recipient.
[0471] The procedure for ex vivo expansion of hematopoietic stem and progenitor cells is described in U.S. Pat. No. 5,199,942, incorporated herein by reference, can be applied to the cells of the present invention. Other suitable methods are known in the art, therefore the present invention is not limited to any particular method of ex vivo expansion of the cells. Briefly, ex vivo culture and expansion of T cells comprises: (1) collecting CD34+ hematopoietic stem and progenitor cells from a mammal from peripheral blood harvest or bone marrow explants; and (2) expanding such cells ex vivo. In addition to the cellular growth factors described in U.S. Pat. No. 5,199,942, other factors such as flt3-L, IL-1, IL-3 and c-kit ligand, can be used for culturing and expansion of the cells. In addition to use a cell-based vaccine in terms of ex vivo immunization, the present invention also provides compositions and methods for use in in vivo immunization to elicit an immune response directed against an antigen in a patient.
[0472] Generally, the cells activated and expanded as described herein may be used in the treatment and prevention of diseases that arise in individuals who are immunocompromised. In particular, the CAR-modified T cells of the invention are used in the treatment of cancer. In certain embodiments, the cells of the invention are used in the treatment of patients at risk for developing cancer. Thus, the present invention provides methods for use in the treatment or prevention of cancer comprising administering to a subject in need thereof, a therapeutically effective amount of the CAR-modified T cells of the invention.
[0473] In one embodiment, the T cells modified to express the FAP CAR are used for administering as monotherapy. However, in another embodiment, the FAP CAR T cells are used for administering in a combination therapy, e.g. along with an antitumor vaccine as disclosed elsewhere herein.
[0474] The FAP CAR T cell of the present invention may be administered either alone, or as a pharmaceutical composition in combination with diluents and/or with other components such as IL-2 or other cytokines or cell populations. Briefly, pharmaceutical compositions of the present invention may comprise a target cell population as described herein, in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents or excipients. Such compositions may comprise buffers such as neutral buffered saline, phosphate buffered saline and the like; carbohydrates such as glucose, mannose, sucrose or dextrans, mannitol; proteins; polypeptides or amino acids such as glycine; antioxidants; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and preservatives. Compositions of the present invention are preferably formulated for intravenous administration.
[0475] Pharmaceutical compositions of the present invention may be administered in a manner appropriate to the disease to be treated (or prevented). The quantity and frequency of administration will be determined by such factors as the condition of the patient, and the type and severity of the patient's disease, although appropriate dosages may be determined by clinical trials.
[0476] When an immunologically effective amount, an anti-tumor effective amount, an tumor-inhibiting effective amount, or therapeutic amount is indicated, the precise amount of the compositions of the present invention to be administered can be determined by a physician with consideration of individual differences in age, weight, tumor size, extent of infection or metastasis, and condition of the patient (subject). It can generally be stated that a pharmaceutical composition comprising the T cells described herein may be administered at a dosage of 10.sup.4 to 10.sup.9 cells/kg body weight, preferably 10.sup.5 to 10.sup.6 cells/kg body weight, including all integer values within those ranges. T cell compositions may also be administered multiple times at these dosages. Tue cells can be administered by using infusion techniques that are commonly known in immunotherapy (see, e.g., Rosenberg et al., New Eng. J. Med 319 (1988), 1676). The optimal dosage and treatment regime for a particular patient can readily be determined by one skilled in the art of medicine by monitoring the patient for signs of disease and adjusting the treatment accordingly.
[0477] It may be desired to administer activated T cells to a subject and then subsequently redraw blood (or have an apheresis performed), activate T cells therefrom according to the present invention, and reinfuse the patient with these activated and expanded T cells. This process can be carried out multiple times every few weeks. In certain embodiments, T cells can be activated from blood draws of from 10 cc to 400 cc. In certain embodiments, T cells are activated from blood draws of 20 cc, 30 cc, 40 cc, 50 cc, 60 cc, 70 cc, 80 cc, 90 cc, or 100 cc. Not to be bound by theory, using this multiple blood draw/multiple reinfusion protocol may serve to select out certain populations of T cells.
[0478] The administration of the subject compositions may be carried out in any convenient manner, including by aerosol inhalation, injection, ingestion, transfusion, implantation or transplantation. The compositions described herein may be administered to a patient subcutaneously, intradermally, intratumorally, intranodally, intramedullary, intramuscularly, by intravenous (i.v.) injection, or intraperitoneally. Thus, T cell compositions of the present invention can be administered to a patient by intradermal or subcutaneous injection or by i.v. injection. The compositions of T cells may be injected directly into a tumor, lymph node, or site of infection.
[0479] Cells activated and expanded using the methods described herein, or other methods known in the art where T cells are expanded to therapeutic levels, can be administered to a patient in conjunction with (e.g., before, simultaneously or following) any number of relevant treatment modalities, including but not limited to treatment with agents such as antiviral therapy, cidofovir and interleukin-2, Cytarabine (also known as ARA-C) or natalizumab treatment for MS patients or efalizumab treatment for psoriasis patients or other treatments for PML patients. Furthermore, the T cells of the invention may be used in combination with chemotherapy, radiation, immunosuppressive agents, such as cyclosporin, azathioprine, methotrexate, mycophenolate, and FK506, antibodies, or other immunoablative agents such as CAMPATH, anti-CD3 antibodies or other antibody therapies, cytoxin, fludaribine, cyclosporin, FK506, rapamycin, mycophenolic acid, steroids, FR901228, cytokines, and irradiation. These drugs inhibit either the calcium dependent phosphatase calcineurin (cyclosporine and FK506) or inhibit the p70S6 kinase that is important for growth factor induced signaling (rapamycin) (Liu et al., Cell 66 (1991), 807-815; Henderson et al., Immun. 73 (1991), 316-321; Bierer et al., Curr. Opin. Immun. 5 (1993), 763-773). Furthermore, the cell compositions of the present invention can be administered to a patient in conjunction with (e.g., before, simultaneously or following) bone marrow transplantation, T cell ablative therapy using either chemotherapy agents such as, fludarabine, external-beam radiation therapy (XRT), cyclophosphamide, or antibodies such as OKT3 or CAMPATH. Moreover, the cell compositions of the present invention can be administered following B-cell ablative therapy such as agents that react with CD20, e.g., Rituxan. For example, subjects may undergo standard treatment with high dose chemotherapy followed by peripheral blood stem cell transplantation or, following the transplant, subjects receive an infusion of the expanded immune cells of the present invention. Expanded cells can be administered before or following surgery.
[0480] The dosage of the above treatments to be administered to a patient will vary with the precise nature of the condition being treated and the recipient of the treatment. Tue scaling of dosages for human administration can be performed according to art-accepted practices. Strategies for CAR T cell dosing and scheduling have been discussed; see, e.g., Ertl et al., Cancer Res 71 (2011), 3175-3181; Junghans, Journal of Translational Medicine 8 (2010), 55.
IX. Peptides with Specific FAP Epitopes
[0481] In a further aspect the present invention relates to peptides having an epitope of FAP specifically recognized by any antibody of the present invention NI-206.18H2, NI-206.82C2, NI-206.59B4, NI-206.22F7, NI-206.27E8, NI-206.12G4 and NI-206.17A6. Preferably, such peptide comprises or consists of an amino acid sequence as indicated in SEQ ID NOs: 30 to 37 and 60 as the unique linear epitope recognized by the antibody or a modified sequence thereof in which one or more amino acids are substituted, deleted and/or added, wherein the peptide is recognized by any antibody of the present invention, preferably by antibody NI-206.18H2, NI-206.82C2, NI-206.59B4, NI-206.22F7, NI-206.27E8, NI-206.12G4 and NI-206.17A6.
[0482] In one embodiment of this invention such a peptide may be used for diagnosing or monitoring a disease or disorder related to FAP species and/or fragment thereof in a subject comprising a step of determining the presence of an antibody that binds to a peptide in a biological sample of said subject, and being used for diagnosis of such a disease in said subject by measuring the levels of antibodies which recognize the above described peptide of the present invention and comparing the measurements to the levels which are found in healthy subjects of comparable age and gender. Furthermore, since the peptide of the present invention contains an epitope of a therapeutically useful antibody derived from a human such peptide can of course be used as an antigen, i.e. an immunogen for eliciting an immune response in a subject and stimulating the production of an antibody of the present invention in vivo. The peptide of the present invention may be formulated in an array, a kit and composition such as a vaccine, respectively, as described hereinbefore. In this context, the present invention also relates to a kit useful in the diagnosis or monitoring the progression of a FAP-related disease, said kit comprising at least one antibody of the present invention or a FAP-binding molecule having substantially the same binding specificities of any one thereof, the polynucleotide, the vector or the cell and/or the peptide as respectively defined hereinbefore, optionally with reagents and/or instructions for use.
X. Articles of Manufacture
[0483] In another aspect of the invention, an article of manufacture containing materials useful for the treatment, prevention and/or diagnosis of the disorders described above is provided. The article of manufacture comprises a container and a label or package insert on or associated with the container. Suitable containers include, for example, bottles, vials, syringes, IV solution bags, etc. The containers may be formed from a variety of materials such as glass or plastic. The container holds a composition which is by itself or combined with another composition effective for treating, preventing and/or diagnosing the condition and may have a sterile access port (for example the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle). At least one active agent in the composition is an antibody of the invention. The label or package insert indicates that the composition is used for treating the condition of choice. Moreover, the article of manufacture may comprise (a) a first container with a composition contained therein, wherein the composition comprises an antibody of the invention; and (b) a second container with a composition contained therein, wherein the composition comprises a further cytotoxic or otherwise therapeutic agent. The article of manufacture in this embodiment of the invention may further comprise a package insert indicating that the compositions can be used to treat a particular condition. Alternatively, or additionally, the article of manufacture may further comprise a second (or third) container comprising a pharmaceutically-acceptable buffer, such as bacteriostatic water for injection.
[0484] These and other embodiments are disclosed and encompassed by the description and Examples of the present invention. Further literature concerning any one of the materials, methods, uses, and compounds to be employed in accordance with the present invention may be retrieved from public libraries and databases, using for example electronic devices. For example the public database Medline may be utilized, which is hosted by the National Center for Biotechnology Information (NCBI) and/or the National Library of Medicine at the National Institutes of Health (NLM.NIH). Further databases and web addresses, such as those of the European Bioinformatics Institute (EBI), which is part of the European Molecular Biology Laboratory (EMBL) are known to the person skilled in the art and can also be obtained using internet search engines. An overview of patent information in biotechnology and a survey of relevant sources of patent information useful for retrospective searching and for current awareness is given in Berks, TIBTECH 12 (1994), 352-364.
[0485] The above disclosure generally describes the present invention. Unless otherwise stated, a term as used herein is given the definition as provided in the Oxford Dictionary of Biochemistry and Molecular Biology, Oxford University Press, 1997, revised 2000 and reprinted 2003, ISBN 0 19 850673 2. Several documents are cited throughout the text of this specification. Full bibliographic citations may be found at the end of the specification immediately preceding the claims. The contents of all cited references (including literature references, issued patents, published patent applications as cited throughout this application including the background section and manufacturer's specifications, instructions, etc.) are hereby expressly incorporated by reference; however, there is no admission that any document cited is indeed prior art as to the present invention. A more complete understanding can be obtained by reference to the following specific examples which are provided herein for purposes of illustration only and are not intended to limit the scope of the invention.
EXAMPLES
[0486] Human-derived antibodies targeting FAP were identified utilizing the method described in the international application WO 2008/081008 with modifications. In particular, human-derived antibodies targeting FAP were identified by high-throughput analyses of complements of the human memory B-cell repertoire derived from the clinically selected donors. For FAP antibody screening on directly coated target, 96-well microplates (Costar, Corning, USA) were coated overnight at 4 C. with recombinant human FAP (rFAP), cFAP (a mixture of peptides: 378-HYIKDTVENAIQITS-392, 622-GWSYGGYVSSLALAS-636 and 721-QVDFQAMWYSDQNHGL-736) or BSA (Sigma-Aldrich, Buchs, Switzerland) diluted to a concentration of 5 g/ml in carbonate buffer (15 mM Na.sub.2CO.sub.3, 35 mM NaHCO.sub.3, pH 9.4). For the capture ELISA, the microplates were coated with mouse anti-His monoclonal antibody (Clontech) diluted to a concentration of 3 g/ml in PBS, the plates were then blocked, rFAP or BSA were diluted to a concentration of 2 g/ml in PBS and added to the plates to be captured. Plates were then washed in PBS-T pH 7.6 and non-specific binding sites were blocked for 1 hr at RT with PBS/0.1% Tween-20 containing 2% BSA. B cell conditioned medium was transferred from memory B cell culture plates to ELISA plates and incubated for one hour at RT. ELISA plates were washed in PBS-T and binding was determined using horseradish peroxidase (HRP)-conjugated anti-human immunoglobulins polyclonal antibodies (Jackson ImmunoResearch, Newmarket, UK) followed by measurement of HRP activity in a standard colorimetric assay. Only B cell cultures which have shown binding of the antibodies contained in the medium to FAP (either rFAP directly coated or captured, or cFAP) but not to BSA were subjected to antibody cloning.
[0487] The amino acid sequences of the variable regions of the above identified anti-FAP antibodies were determined on the basis of their mRNA sequences; see
[0488] Identification of the antibody clone with the desired specificity was performed by re-screening on ELISA upon recombinant expression of complete antibodies. Recombinant expression of complete human IgG1 antibodies was achieved upon insertion of the variable heavy and light chain sequences in the correct reading frame into expression vectors that complement the variable region sequence with a sequence encoding a leader peptide at the 5-end and at the 3-end with a sequence encoding the appropriate constant domain(s). To that end the primers contained restriction sites designed to facilitate cloning of the variable heavy and light chain sequences into antibody expression vectors. Heavy chain immunoglobulins were expressed by inserting the immunoglobulin heavy chain RT-PCR product in frame into a heavy chain expression vector bearing a signal peptide and the constant domains of human immunoglobulin gamma 1 or mouse immunoglobulin gamma 2a. Kappa light chain immunoglobulins were expressed by inserting the kappa light chain RT-PCR-product in frame into a light chain expression vector providing a signal peptide and the constant domain of human or mouse kappa light chain immunoglobulin. Lambda light chain immunoglobulins were expressed by inserting the lambda light chain RT-PCR-product in frame into a lambda light chain expression vector providing a signal peptide and the constant domain of human or mouse lambda light chain immunoglobulin.
[0489] Functional recombinant monoclonal antibodies were obtained upon co-transfection into HEK 293 or CHO cells (or any other appropriate recipient cell line of human or mouse origin) of an Ig-heavy-chain expression vector and a kappa or lambda Ig-light-chain expression vector. Recombinant human monoclonal antibody was subsequently purified from the conditioned medium using a standard Protein A column purification. Recombinant human monoclonal antibody can produced in unlimited quantities using either transiently or stably transfected cells. Cell lines producing recombinant human monoclonal antibody can be established either by using the Ig-expression vectors directly or by re-cloning of Ig-variable regions into different expression vectors. Derivatives such as F(ab), F(ab)2 and scFv can also be generated from these Ig-variable regions.
[0490] The framework and complementarity determining regions were determined by comparison with reference antibody sequences available in databases such as Abysis (http://www.bioinf.org.uk/abysis/), and annotated using the Kabat numbering scheme (http://www.bioinf.org.uk/abs/). The amino acid sequences of the variable regions of the subject antibodies NI-206-18H2, NI-206-20A8, NI-206-6D3, NI-206-14C5, NI-206-34C11, NI-206.82C2, NI-206.59B4, NI-206.22F7, NI-206.27E8, NI-206.12G4 and NI-206.17A6 including indication of the framework (FR) and complementarity determining regions (CDRs) are shown in
Example 1: Binding Specificity of FAP Antibodies
[0491] ELISA assays were performed with varying antibody concentrations to validate the binding of the exemplary antibodies of the present invention to FAP and to be able to determine their half maximal effective concentration (EC.sub.50). For the exemplary recombinant human NI-206-18H2, NI-206-20A8, NI-206-6D3, NI-206-14C5, NI-206-34C11, NI-206.82C2, NI-206.59B4, NI-206.22F7, NI-206.27E8, NI-206.12G4 and NI-206.17A6 antibodies, 96-well microplates (Costar, Corning, USA) were coated with FAP, with a mixture of the 3 peptides or with BSA (Sigma-Aldrich, Buchs, Switzerland) diluted to a concentration of 5 g/ml in carbonate ELISA coating buffer (15 mM Na.sub.2CO.sub.3, 35 mM NaHCO.sub.3, pH 9.4) for the direct ELISA. For the capture ELISA, the microplates were coated with mouse anti-His monoclonal antibody (Clontech) diluted to a concentration of 3 g/ml in PBS, the plates were then blocked, FAP or BSA were diluted to a concentration of 2 g/ml in PBS and added to the plates to be captured. The binding efficiency of the antibodies was then tested. The exemplary NI-206.82C2 antibody specifically and strongly binds to the captured FAP and less efficiently to the directly coated FAP. The exemplary NI-206.59B4 and NI-206.18H2 antibodies specifically, strongly and similarly bind to the captured FAP and to the directly coated FAP. In comparison to the aforementioned exemplary antibodies, the NI-206.20A8 antibody binds less efficiently to both the captured FAP and the directly coated FAP. No binding was observed to BSA. The exemplary antibody NI-206.6D3 strongly and similarly bind to the captured FAP and to the directly coated FAP, but especially in case of the captured FAP, at high antibody concentrations strong binding to BSA was observed as well; see
[0492] The EC.sub.50 values were estimated by a non-linear regression using GraphPad Prism (San Diego, USA) software. Recombinant human-derived antibodies NI-206.82C2, NI-206.59B4, NI-206.27E8, NI-206.17A6, NI-206.18H2 and NI-206.20A8 bound with a high affinity to the captured FAP (sFAP) with an EC.sub.50 of 0.014 nM, 0.044 nM, 3.36 nM, 50.2 nM, 0.272 nM and 1.33 nM respectively, whereas the antibody NI-206.6D3 showed a lower binding affinity with an EC.sub.50 of 118 nM. NI-206.22F7 did not show any binding to sFAP. The binding of NI-206.12G4 towards sFAP was not tested. Recombinant human-derived antibodies NI-206.82C2, NI-206.59B4, NI-206.27E8, NI-206.12G4, NI-206.17A6, NI-206.18H2 and NI-206.20A8 bound with a high affinity to the directly coated FAP (FAP) with an EC.sub.50 of 0.61 nM, 0.096 nM, 0.33 nM, 1.4 nM, 10.5 nM, 3.54 nM and 2.90 nM respectively, whereas the antibody NI-206.6D3 showed a lower binding affinity with an EC.sub.50 of 86.5 nM. NI-206.22F7 did not show any binding to directly coated FAP. Recombinant human-derived antibody NI-206.22F7 bound with a high affinity to the directly coated FAP peptides mixture (cFAP) with an EC.sub.50 of 0.12 nM. NI-206.82C2, NI-206.59B4, NI-206.27E8, NI-206.12G4, NI-206.17A6, NI-206.18H2, NI-206.20A8 and NI-206.6D3 did not show any binding to cFAP; see
Example 2: Determination of NI-206.82C2 Binding Kinetics
[0493] To address NI-206.82C2 kinetics, recombinant human FAP (rhuFAP, Sino Biologicals, 10464-H07H) was amine-coupled onto a GLC sensor chip (Biorad #176-5011), leaving one channel unmodified to provide an additional reference surface. This was achieved by varying the concentration of the activation reagents used in each channel. Three activation solutions were prepared using a threefold serial dilution of a stock mixture containing 0.4 M EDC+0.1 M sulfo-NHS and injected for 360 s. Then rhuFAP at 2.5 g/ml in coupling buffer (10 mM HEPES, 150 mM NaCl, 3.4 mM EDTA, 0.005% Tween 20, pH 5.2) was coupled for 1020 s at 25 L/min. Excess reactive esters were blocked for 600 s with 1 M ethanolamine hydrochoride. This created uniform strips of rhuFAP spanning final immobilized levels of 700 RU. A five-fold serial dilution of rhuFAP starting at 16 g/mL (106.7 nM) was injected for 400 s at 60 L/min. A single injection delivered a full concentration series, using buffer to complete a row of six samples and provide an in-line blank for double-referencing the response data. Association and dissociation phases were measured for 400 s and 3600 s, respectively. Immobilized rhuFAP was regenerated with 1.5 M glycine pH 3 for 30 s at 100 L/min after each binding cycle, and NI-206.82C2 were analyzed in duplicate injections within the same experiment to confirm cycle-to-cycle reproducibility; see
Example 3: Assessment of the Binding Epitope of the FAP Specific Antibodies
[0494] To determine the binding epitope of the exemplary NI-206.82C2 and NI-206.18H2 antibodies, binding analyses were performed with overlapping peptides mapping the entire sequences of FAP. Binding capacity of the antibodies was tested on these peptides spotted onto a nitrocellulose membrane (JPT Peptide Technologies, Berlin, Germany) and using HRP-conjugated donkey anti-human IgG secondary antibody (Jackson immunoResearch, Newmarket, UK) followed by detection of HRP activity (
[0495] The antibody NI-206.82C2 recognizes the peptides 131 and 132 (line G, 11th and 12th spot) which correspond to the sequence 525-PPQFDRSKKYP-535 on FAP; see
[0496] To determine the minimum epitope region of antibody NI-206.82C2 peptides (from the N- and C-terminal) covering the epitope of antibody NI-206.82C2 were sequentially truncated by one amino acid (with spot 21 corresponding to the full length peptide and spots 22 to 33 to stepwise one amino acid truncations form the C-terminus and spots 34 to 45 corresponding to stepwise one amino acid truncations form the N-terminus), synthesized and spotted onto nitrocellulose membranes (JPT Peptide Technologies, Berlin, Germany). NI-206.82C2 binding to these spotted peptides was visualized as described above. The antibody NI-206.82C2 recognizes spots 21-28 and 34-41 which correspond to the sequence 528-FDRSK-532 (SEQ ID NO: 39) on FAP; see
[0497] To determine the amino acids essential for NI-206.82C2 binding, every single amino acid from 521-KMILPPQFDRSKKYPLLIQ-539 (SEQ ID NO: 38) of FAP was mutated sequentially into an alanine to determine the essential amino acids (i.e. those which cause a loss of NI-206.82C2 binding when mutated). These linear peptide sequences with single alanine-mutated linear epitopes were synthesized and spotted onto nitrocellulose membranes (JPT Peptide Technologies, Berlin, Germany). NI-206.82C2 binding to these spotted peptides was visualized as described in the example above, with an absence of binding to two spots (spot 10 and spot 13) in which the corresponding FAP peptide contained alanine substitutions at position 529 and 532, respectively, thus revealing that amino acids D-529 and K-532 of FAP are essential for NI-206.82C2 binding; see
Example 4: Determination of the Ability of Recombinant Human Monoclonal Antibodies to Inhibit FAP Enzymatic Activity
[0498] A black flat bottom standard 96-well ELISA plate was blocked for 1 hour at 37 C. using sterile blocking buffer: 5% bovine serum albumin (BSA) in phosphate buffered saline (PBS). The blocking buffer was removed and replaced with: 40 L of fresh blocking buffer, 40 L of antibody in PBS, 10 L of 20 nM active recombinant human FAP (Sino Biologicals, 10464-H07H) in PBS, and 10 L of DQ-Gelatin (Molecular Probes, D-12054) in PBS. Fluorescence intensity was measured at 485 nM excitation and 530 nM emission every 3 min over a total time of 45 min, while gently shaking the plate for twenty seconds before every measurement. To calculate the fractional activity, the steady state velocity ( 530 nM emission/ time) is divided by the velocity observed at each concentration of antibody. The results are shown in
Example 5: Determination of Competitive, Noncompetitive, or Uncompetitive Inhibition of rhuFAP-Mediated PEP (Z-Gly-Pro-AMC) Cleavage
[0499] A black flat bottom standard 96-well ELISA plate was blocked for 1 hr at 37 C. using sterile blocking buffer: 5% bovine serum albumin (BSA) in phosphate buffered saline (PBS). 10 L of recombinant human FAP solution: 0.4 nM recombinant human FAP (Sino Biologicals, 10464-H07H), in 225 mM Sodium phosphate buffer, pH 7.4) was added to each well. Then, 80 L of NI-206.82C2 at the indicated concentrations in PBS were added to the wells incubated for 1 hr at 37 C. Then, 10 L of fluorogenic substrate solution (Z-Gly-Pro-AMC in 40% methanol and 60% 25 nM PBS/10 nM EDTA) was added to each well. The fluorescence intensity was measured at 360 nM excitation and 460 nM emission every 3 min over a total reading time of 2 hr. The results are shown in
Example 6: Determination of the Binding Specificity of Antibodies NI-206.82C2, NI-206.18H2, NI-206.20A8 and NI-206.6D3
[0500] A mouse anti-6-histidine tag antibody (Clonetech) was coated at a concentration of 3 g/ml in PBS to a 96 well ELISA plate, the plates were then blocked with 5% BSA in PBS, and enzymatically active recombinant human FAP with an N-terminus 6 histidine tag was added to the plates to be captured. The binding efficiency of NI-206.82C2, NI-206.18H2, NI-206.20A8 and NI-206.6D3 (at 20 nM, 4 nM, and 0.8 nM) against sFAP and of NI-206.18H2, NI-206.20A8 and NI-206.6D3 against FAP as well was then tested by 1 hour incubation, followed by washing with PBS and detection with an HRP-labelled goat anti-human antibody (Jackson Immunoresearch) using a colormetric assay. To assess NI-206.82C2, NI-206.18H2, NI-206.20A8 and NI-206.6D3 binding other targets, recombinant human CD26 (only in case of NI-206.82C2) and fourteen other unrelated recombinant human proteins (A-N) were individually added to a 96-well ELISA plate in triplicate, and the binding efficacy of NI-206.82C2 was evaluated. (
[0501] To determine the binding efficiency and inhibitory ability of NI-206.82C2 against other members of the SB9 oligopeptidase family that have sequence similarity to FAP, indirect ELISA and inihibiton assays were performed on active enzyme targets. Active recombinant human enzymes evaluated in this assay include: Fibroblast Activation Protein (FAP; Sino Biologicals, 10464-H07H), Dipeptidyl Peptidase IV (DPPIV, BPS Bioscience 80040), Dipeptidyl Peptidase 8 (DPP8, BPS Bioscience 80080), Dipeptidyl Peptidase 9 (DPP9, BPS Bioscience 80080), and Prolyl Oligopeptidase/Prolyl Endopeptidase (POP/PREP, BPS Bioscience 80105). Each recombinant peptidase was expressed with a purification tag, and attached to the 96 well ELISA plate using either a mouse anti-Histidine antibody (CloneTech), or a mouse anti-Glutathione S-transferase (GST, Sino Biologicals, 111213-MM02) tag antibody. Each enzyme was validated to bind and remained active on the ELISA plate using enzyme specific fluorogenic substrates. H-Gly-Pro-AMC (ATT Bioquest, 13450) was used to validate the presence and activity of DPP4, DPP9, and DPP8. Z-Gly-Pro-AMC (BaChem, 11145) was used to evaluate the activity of FAP and POP/PREP. To determine the binding efficiency of NI-206.82C2 to each enzyme target, the antibody was labelled with HRP and added at concentrations of 400, 126.5, 40.1, 12.7, 4, 1.3, 0.4, 0.13, 0.04, 0.013, 0.004, and 0 nM in PBS. Following a washing step, bound antibody was detected using 3,3,5,5-Tetramethylbenzidine (TMB) substrate. The reaction was stopped after 10 minutes by adding 2N H.sub.2SO.sub.4 and the resulting change in optical density was quantified using an ELISA plate reader at 450 nM absorbance (
[0502] To determine the inhibitory ability of the antibody a black 96 well plate was blocked for 1 h with blocking buffer. NI-206.82C2 was pipetted at concentrations of 1000, 50, 10, 3.03, 1.01, 0.031, 0.001, and 0 nM in PBS into the according wells. The enzymes were added at a concentration of 0.2 nM. Finally, fluorgenic substrates were then added to the well at a concentration equal to the Michaelis constant (K.sub.m) and the velocity of the substrate cleavage was quantified by fluorescence at 360 nm excitation and 460 nm emission. H-Gly-Pro-AMC (AAT Bioquest, 13450) was used for DPP4, DPP9, and DPP8. Z-Gly-Pro-AMC (BaChem, 11145) was used to evaluate the activity of POP/PREP. FAP activity was assessed using DQ-gelatin (Life Technologies, D12054) and cleavage quantified at 495 nM excitation and 515 nM emission.
Example 7: Determination of NI-206.82C2 Inhibitory Ability Against Active Recombinant Human FAP and Active Recombinant Mouse FAP Compared to Previously Tested FAP Inhibitors
[0503] To determine the inhibitory ability of NI-206.82C2 against active recombinant human FAP (Sino Biologicals, 10464-H07H) a black 96 well ELISA plate was blocked for 1 h at 37 C. with sterile 5% BSA in PBS. After removing the blocking solution, 40 uL of 12.5% BSA in PBS was added to each well. Then FAP-targeting agents (NI-206.82C2, F19, and Val-Boro-Pro (PT-100; Point therapeutics)) were added to the appropriate wells for a final concentration of 500, 10, 3.03, 1.01, 0.031, 0.001, and 0 nM. 10 uL of active recombinant human FAP was then added to all the wells for a final assay concentration of 20 nM. Finally, 10 L of DQ-gelatin solution was added to each well for a concentration of 60 g/mL. The fluorescent intensity was then measure at 485 nM excitation and 530 nM emission every 3 min for 45 min, gently shaking the plate for 20 min before each measurement. Using GraphPad Prism 6 software steady state velocity was then used to calculate fractional activity at each concentration compared to the steady-state concentration where no inhibitor was given, and fit to a three parameter variable fit model to calculate the IC.sub.50 (the concentration at which 50% of the maximum inhibition as achieved). (
[0504] To determine the inhibitory ability of NI-206.82C2 against active recombinant murine FAP, recombinant murine FAP was expressed in a HEK293 cell line without the transmembrane and intracellular domains and an N-terminal 6 histidine tag. A 96-well ELISA plate was then coated with 50 uL of murine anti-His tag antibody at 6 g/mL in PBS overnight at 4 C. The wells were then blocked with 60 L of 2% BSA in PBS for 1 h at room temperature, and 50 L of recombinant mouse FAP containing cell culture supernatant diluted 1:4 was added to the well and incubated overnight at 4C while gently shaking. Following three washing steps with PBS, 20 uL of sterile 12.5% BSA/PBS solution was added to all wells. FAP-targeting agents (NI-206.82C2, F19, and Val-Boro-Pro (PT-100; Point therapeutics) were then added to the appropriate wells for a final concentration of 500, 10, 3.03, 1.01, 0.031, 0.001, and 0 nM. Finally 5 L of DQ Gelatin solution in PBS was then added for a final assay concentration of 24 g/mL. DQ gelatin cleavage was then measured by the fluorescence intensity a 485 nM excitation and 530 nM emission every 3 min over a total time of 60 min, while gently shaking the plate for 20 seconds before each measurement. Using GraphPad Prism 6 software, steady state velocity was used to calculate fractional activity at each concentration, and to preform three parameter variable model regression to calculate the IC50 (the concentration at which 50% of the maximum inhibition as achieved) (
Example 8: Determination of NI-206.82C2 Binding to Human Carcinoma Cryosections by Confocal Immunofluorescence
[0505] NI-206.82C2 was labelled with Cyanine 3 for fluorescent imaging (Cy3 conjugation kit: Innova Biosciences, 340-0030) and antibody labelling was validated using a spectophotometer. Cryosections from human invasive ductal carcinoma tissues (
Example 9: Determination of NI-206.82C2 Binding to Human Breast Cancer Tissue Sections by Immunohistochemistry
[0506] Human breast cancer tissue sections were allowed to dry for 10 min at room temperature, and then fixed for 15 minutes in 4% paraformaldahyde, followed by washing three times 5 minutes in PBS. Slides were then incubated for 5 min in 0.3% H.sub.2O.sub.2 in PBS to block endogenous peroxidase activity, and subsequently washed 3 times 5 min in PBS. Endogenous biotin was then blocked using the Biotin-Blocking System (DAKO X0590), followed by times washing with PBS. Blocking of unspecific antibody binding and permeabilization of the tissue section was performed using blocking buffer (5% goat serum, 5% horse serum, 0.3M glycine, 5% BSA, and 0.5% Triton X100 in PBS). Tissue sections were then stained with a recombinantly engineered chimeric form of NI-206.82C2 with a murine constant domain and the human variable domain of the original antibody and a matched isotype control (43A11) at 10 g/mL in permeabilization buffer overnight at 4 C. Following three PBS washing steps, the sections were incubated with a biotinylated goat anti-mouse antibody for 1 h at room temperature. For amplifying the target antigen the VECTASTAIN ABC kit (Vector Labs) was used, followed by development with 3,3-diaminobenzidine (DAB) and counterstained with Mayer's haematoxylin blue. Samples were washed for 10 min in lukewarm running tapwater and mounted in an aqueous mounting medium before imaging with a histology slide scanner (Zeiss Mirax MIDI). The results are shown in
Example 10: Determination of NI-206.82C2 Binding to Murine Colorectal Cancer Tissues
[0507] NI-206.82C2 was prelabelled with Cyanine 5 antibody labeling kit (Innova Biosciences, 342-0010), and sufficient antibody labelling was validated with a photospectrometer. Cryosections of mouse livers containing syngeneic CT-26 liver metastasis were allowed to dry for 30 min at room temperature the fixed for 10 min in 4% formalin in PBS. Slides were then washed 3 times for 5 minutes in PBS and blocked for 1 hr at room temperature with 5% bovine serum albumin in PBS.
[0508] The slides were then incubated overnight at 4 C. with staining solution containing DAPI at 0.5 g/mL, and Alexa 547 phalloidin (Invitrogen) according to the manufacturer's instructions, and either Cy5 labelled NI-206.82C2 or a Cy5 labelled isotype-matched control antibody 3A1 at a concentration of 10 g/mL, in blocking solution with 0.5% Triton X100. Slides were then washed 3 times in PBS, mounted in Lisbeth's mounting medium, and imaged with an SP8 confocal microscope (Leica Microsystems). The results are shown in
Example 11: Determination of NI-206.82C2 Binding to Murine Multiple Myeloma Tissues
[0509] BALB/c mice were injected with 210.sup.6 of the murine multiple myeloma cell line MOPC315.4 intravenously. BALB/c mice were injected with a vehicle-only control. Bone tissue was harvested and fixed in 4% PFA, decalcified in 10% EDTA (pH 7.4), embedded in paraffin before being sectioned (4 m) and rehydrated. Then, CD138 mAb (Clone 281-2, BD Pharmingen) and Cy5 labelled NI-206.82C2 were used to identify MOPC315.BM.Luc cell infiltration, and NI-206.82C2 binding to these cells and surrounding stromal cells in the tissue sections. Stained tissue sections were then imaged using a fluorescent microscope (
Example 12: Determination of NI-206.82C2 Binding Human Atherosclerotic Plaque and Obstructive Coronary Thrombi by Confocal Immunofluorescence
[0510] NI-206.82C2 was labelled with Cyanine 3 for fluorescent imaging (Cy3 conjugation kit: Innova Biosciences, 340-0030) and antibody labelling was validated using a spectophotometer. Cryosections from myocardial infarction causing obstructive human coronary thrombi (
Example 13: Determination of the Role of NI-206.82C2 in Blood Coagulation Using Rotational Thromboelastometry (ROTEM)
[0511] Two batches of peripheral blood were taken from a single healthy subject in sodium citrate tubes and platelet-free blood plasma was prepared by centrifugation. Blood plasma from each tube was pooled and immediately aliquoted for storage at 80 C. The plasma has an FAP level of 130 ng/ml by ELISA. Plasma samples were treated with NI-206.82C2 (n=3) against FAP or 43A11 control (n=3) diluted in sterile saline and added to fresh fast thawed plasma such that the final concentration of antibody in the sample was 0.000667 nM, 0.00667 nM, 0.0667 nM, 0.667 nM 6.667 nM of plasma. Following 1 hr incubation with the antibody at 37 C., NATEM analysis was performed according to the manufacturer's instructions by using STAR-TEM reagent to observe the native blood clotting process after an incubation time with the antibodies of 1 h at 37 C. with the antibody before starting measurement. Statistical analysis was performed using a two-way ANOVA (*p<0.05, ** p<0.01, *** p<0.005, **** p<0.001). The results are shown in
Example 14: Determination of FAP Clearance from Human Plasma Using NI-206.82C2 Based Immunoprecipitation
[0512] 100 L of PureProteome G Magnetic Beads (Millipore LSKMAGG02) were suspended in 500 L of 25 mM TRIS, 0.15M NaCl, and 0.1% Tween 20. Human plasma was diluted 1:5 in PBS to an end volume of 125 L, separated into four tubes, and incubated for 30 min at RT with rotation. Beads were then collected with a magnetic stand, and the pre-cleared supernatant was transferred to a new tube containing magnetic beads coated with 82C2, 43A11, or 3A1. Antibody-conjugated beads were incubated with the plasma dilution overnight at 4 C. while rotating. Beads were then collected with a magnetic stand and the supernatant was removed of analysis of 2AP-AMC cleavage activity. To determine 2AP-AMC activity in the supernatants, a half area black 96 well plate was blocked with sterile filtered 5% BSA at 37 C. for 1 h. Then 40 L of PBS was added to all the wells, 5 L of the supernatant solutions to the appropriate wells, and 5 L of 2AP-AMC solution in methanol was added for a final assay concentration of 10 M. The fluorescence intensity (cleaved AMC) was measured at 360 nM excitation and 460 nM emission every 3 min over a total time of 30 min and the reaction velocity was calculated using Graphpad Prism 6 software. The results are shown in
Example 15: Characterization of a Sandwich ELISA to Measure the Levels of NI-206.82C2 Antigen
[0513] To quantify the levels of NI-206.82C2 antigen in human samples, a clear 96-well plate was coated with 30 L of F19 (CRL-2733) at 8 g/mL in carbonate coating buffer for 2-4 hours at room temperature. The coating solution was removed and the plate was blocked with 40 L 2% BSA in PBS blocking buffer for 1 h at room temperature and then discarded. 30 uL sample solution was then added. Sample solutions included recombinant human FAP standard (
Example 16: Anti-FAP Antibody NI-206.82C2 is Capable of Prolonging Arterial Occlusion Times in a Murine Thrombosis Model
[0514] The carotid artery photochemical injury-induced thrombosis model begins with anesthesia by intraperitoneal injection of sodium pentobarbital (87 mg/kg body weight). After slight tail warming (using warm water) rose bengal (10 mg/mL in PBS) is injected into the tail vein in a volume of 0.12 mL at a concentration of 50 mg/kg. Mice will then be secured in a supine position (with the head pointing towards the operator) and placed on a heating pad (rectal temperature will be monitored) under a dissecting microscope. Following a (2.5-3 cm) midline cervical incision and a small incision of the larynx to provide a tracheostoma, by blunt preparation the right common carotid artery is exposed and cleared of connective tissue. A surgical stitch is employed to fix the sternocleidomastoid muscle aside to the right and increase access area to the right carotid artery. Care must be taken to avoid excessive vessel manipulation during procedures. Curved-tip tweezers will be employed to slide under the vessel (from the left side) and gently lift it so as to place the probe under and around it. The probe will be placed as proximal as the access area allows it to be and its connection wire should then be placed on a micromanipulator to fine-adjust its position. (The probe should be perfectly aligned with the vessel so as not to cause any resistance to flow). Little surgical ultrasonic gel should be applied on top of the probe to increase signal quality. Within 6 minutes of Rose Bengal injection, a laser beam will be aimed at the carotid artery and kept at fixed distance of 6 cm for 60 minutes. Flow will be measured during these 60 minutes and for further 60 minutes (max time elapse 120 minutes) or until occlusion occurs. Occlusion is considered as a constant (1 min) flow below 0.1 ml/min. Mice are euthanized by an overdose of pentobarbital immediately (25 mg) after the occlusion analysis is completed.
[0515] Mice will be placed on a heating pad, to avoid a drop of body temperature. Heart rate (probe measuring the blood flow will also measure the heart rate) will be monitored during the surgery. Anethesia depth will be checked before starting the surgery and during the experiment by pedal withdrawal reflex (animals hind limb will be extended and the interdigital webbing of the foot will firmly pinched by the use of an atraumatic forceps; if there is no withdrawal reaction to the toe pinch, animals will be judged deep enough).
[0516] The chosen dose of anesthesia sodium pentobarbital (87 mg/kg body weight) is sufficient to keep the animal in deep anesthesia for the whole duration of the experiment. No second dosing is necessary. 20 mg/kg of NI-206.82C2 in Phosphate buffered saline (pH 7) vehicle is anticipated to saturate the mouse and negate any effects of pharmacokinetics (Tabrizi et al., Development of Antibody-Based Therapeutics, Chapter 8, 218-219). Phosphate buffered saline (pH 7) alone is administered as the vehicle only control. The results are shown in
Example 17: Anti-FAP Antibody NI-206.82C2 is Capable of Abrogating Orthotopic Tumor Growth in a Syngeneic Colorectal Cancer Mouse Model
[0517] CJ57/BL6 mice were anesthetized by isofluorane inhalation, and the hepatic portal vein was accessed by median laparotomy (from xiphoid 4 cm caudally). Mice were injected with 1 million murine MC38 colorectal cancer cells. The origin of these cell is described in Science 19 Sep. 1986. MC-38 tumors were allowed to form for 7 days before treatment. Mice were treated with either PBS or NI-206.82C2 (20 mg/kg by intraperitoneal injection) every 72 hours for 5 treatment cycles, before being anesthetized by isofluourane inhalation. Small animal MRI imaging was performed using a Bruker 4.7 Tesla MRI to aquire images of liver metastases. Tumor images were analyzed on Myrian Software (Intrasense) to quantify tumor metastases and cumulative tumor diameter overall tumor burden. The results are shown in
Example 18: NI-206.82C2, NI-206.59B4, NI-206.27E8, NI-206.12G4, NI-206.18H2 and NI-206.6D3 Binding to Transmembrane FAP is pH Dependent
[0518] To evaluate the binding of NI-206.82C2, NI-206.59B4, NI-206.27E8, NI-206.12G4, NI-206.18H2 and NI-206.6D3 to transmembrane human FAP, an FAP expressing HEK293 cell line was received from the National Institutes of Health, Bethesda, Md. The generation of this FAP expressing HEK293 cells is described in: J. Exp. Med. 2013 Vol. 210 No. 6 1125-1135. HEK293 cells were transduced with retrovirus encoding full length human FAP cDNA. Cloning was performed using Fast Cloning Pack and FastDigest restriction enzymes (both from Fermentas). Transient retroviral supernatants were generated by transfecting 293GP cells with the FAP plasmid using Lipofectamine 2000 (Invitrogen). Retroviral supernatants were collected at 48 h after transfection and centrifuged onto Retronectin-coated (10 g/ml; Takara), non-tissue culture-treated 6-well plates at 2,000 G for 2 h at 32 C. These retroviral supernatants where then used to transduce HEK293 cells overnight. Transduced FAP-HEK293 cells were selected with 1 mg/ml G418 (CellGro).
[0519] To generate fluorescently labelled antibodies for fluorescence active flow cytometry, NI-206.82C2, NI-206.59B4, NI-206.27E8, NI-206.12G4, NI-206.18H2 and NI-206.6D3 as well as isotype matched biologically inactive control antibody 43A11 were labelled with a Cyanine Dye 5 dye (Cy5) using a Lightning-Link Cy5 Antibody Labeling Kit (Novus Biologicals) according to the manufacturer's instructions.
[0520] 500000 FAP-HEK293 cells were incubated for 1 hr at 4 C. either with Cy5 labelled NI-206.82C2, NI-206.59B4, NI-206.27E8, NI-206.12G4, NI-206.18H2 or NI-206.6D3 or with Cy5 labelled 43A11 at four different antibody concentrations (0.1, 1, 10, and 100 nM) in seven different pH-adjusted PBS buffers (pH 7.4, 6.8, 6.6, 6.5, 6.4, 6.3 and 6.2). PBS buffers were adjusted to using MES monohydrate (Sigma Aldrich). Following incubation, cells were washed 3 times with 200 uL in matched pH-adjusted PBS, spun at 400G for 4 min, and resuspended in 200 L of pH adjusted buffer.
[0521] To analyze antibody binding, fluorescent activated flow cytometry was performed using a BD Fortesa device for forward scatter, side scatter, and the mean fluorescent intensity (MFI) of the Cy5 channel was recorded using a 633 nM laser excitation and 600/20 filter. Viable cells were gated by forward and side scatter, and singlets/doublet exclusion, and the MFI for Cy5 was quantified using FlowJo software Version 10.1. The MFI signal for Cy5 labelled 43A11 was subtracted from Cy5 labelled 82C2, 59B4, 27E8, 12G4, 18H2 and 6D3 to calculate MFI at pH 7.4, 6.8, 6.6, 6.5, 6.4, 6.3 and 6.2 revealing increased paratope-specific 82C2, 59B4, 27E8, 18H2 and 6D3 avidity under acidic conditions vs. at pH 7.4 (
Example 19: NI-206.82C2 Tumor Engagement In-Vivo
[0522] Anti-FAP antibody NI-206.82C2, and a biologically inactive isotype matched control antibody 43A11 were fluorescently labeled with Alexa 680 dye using Alexa Fluor 680 Antibody Labeling Kit (Thermo Fischer A20188) according to the manufacturer's instructions. These antibodies are designated as A680-82C2 (Alexa 680 labelled 82C2) and A680-43A11 (Alexa 680 labelled 43A11).
[0523] A murine cancer model was generated by the injection of 100000 4T1 cultured breast tumor cells orthotopically into the 2nd left breast of Balb/c immunocompetent mice and allowed to grow for 7 days. Prior to in vivo imaging, the animals were shaved and de-epilated to remove fur for minimal absorbance and scattering of the incident optical light. In-vivo imaging was performed with the Maestro 500 imaging system (Cambridge Research Inc, Woburn, USA). For A680-82C2 detection, a band pass filter from 615 nm-665 nm and a highpass filter over 700 nm were used for excitation and emission light respectively, and fluorescence was detected by a CCD camera (cooled to 11 C.). A series of images were acquired at different wavelengths and then subjected to spectral unmixing (deconvolution of collected optical spectra; this enabled the unmixing of the Alexa680 fluorescence pattern from tissue auto-fluorescence and other spectral contributions).
[0524] The 4T1-breast tumor bearing Balb/c mice (3-4 in each group) were then injected on day 7 after innoculation with 2 mg/kg of A680-82C2 or A680-43A11. Whole mice images were acquired at the following timepoints: before antibody injection, immediately after antibody injection, 6 h, 24 h, 48 h, and 6 d after antibody injection. The intensity data were then normalized to auto-fluorescence and compared between the two groups and it was found that the antibody concentration peaks in the animals from 6 h to 48 h post antibody injection and that A680-82C2 antibody has significantly higher tumor uptake than the control antibody A680-43A11. The results are shown in
Example 20: 82C2-41BB-CD (Anti-FAP) Chimeric Antigen Receptor (CAR) Construction
[0525] A chimeric antigen receptor (CAR) with the FAP-binding 82C2-derived ScFv and the 4-1BB costimulatory domain as well as the CD3 endodomain is constructed (82C2-41BB-CD). The variable heavy domain (V.sub.H) of 82C2 is fused with a linker sequence, using PCR-driven overlap extension, and cloned into the Sfi1 and Pme1 sites of the pUKBK vector (Heckman and Pease, Nat. Protoc. 2 (2007), 924-923; Kohli et al., Proteome Res. 11 (2012), 4075-4090). Using PCR-based cloning, the variable light domain (V.sub.L) of 82C2 is inserted into the Pme1 site after the linker, giving rise to pUKBK-FAP-ScFv. The Pme1 site at the 3-end of the V.sub.L is preserved by using a reverse primer with 5-ACCC extension. T2A-eGFP is amplified from Addgene plasmid #69536 by PCR and cloned into the Pm1 site of this vector. The Pme1 site at the 3-end of the V.sub.L is preserved by using a forward primer with 5-GTTT extension. The sequence of the CD8hinge-41BB-CD3 is obtained from U.S. Pat. No. 8,906,682 B2, synthesized by Thermo Fischer, and cloned into the Pme1 site of this vector. The Pme1 site at the 3-end of the V.sub.L is preserved by using a forward primer with 5-GTTT extension. The thus obtained construct, 82C2-CD8hinge-41BB-CD3 fused in frame to T2a and eGFP, is transferred to the pRRL lenti virus backbone (Addgene plasmid 74922), and subsequently named 82C2-41BB-CD.
[0526] For control experiments, a second CAR is constructed by cloning the ScFv of the FAP-binding antibody Sibrotuzumab (Sibro-41BB-CD). Sibrotuzumab V.sub.H and V.sub.L sequence is obtained from the US Patent Application US 2003/0103968 A1, synthesized with interconnecting linker (Thermo Fischer), and cloned into Sfi1 and Pme1 of pUKBK. The Sibrotuzumab-derived ScFV is cloned to the lenti viral plasmid 82C2-41BB-CD using Sf1 and Pme1 sites, giving thus rise to Sibro-41BB-CD.
[0527] For control experiments, a third CAR with the 82C2-derived ScFv and a truncated endodomain is prepared (82C2-). The sequence of the CD8hinge is obtained from U.S. Pat. No. 8,906,682 B2, is synthesized by Thermo Fischer, and cloned into the Pme1 of PUKBK.FAP-ScFV-T2A-eGFP. The thus obtained construct is transferred to the pRRL lenti virus backbone, and subsequently named 82C2-.
[0528] Lenti viral plasmids used for CAR expression with EF1 promoter are chosen because of their high and prolonged expression in T cells compared to other routinely used promoters, as reported previously; see, Milone et al., Mol. Ther. 17 (2009), 1453-1464. For simple evaluation of CAR expression efficiency the bicistronic expression of eGFP is chosen.
[0529] All constructs are sequenced using Microsynth sequencing service.
Example 21: 82C2-41BB-CD Lenti Virus and 82C2-CAR T-Cell Production
[0530] Delivery of CARs to human T cells by lenti virus is an efficient and clinically validated procedure; see, Dotti et al., Immunol. Rev. 257 (2014), 107-126. 82C2-41BB-CD CAR lenti virus plasmid or control plasmid are used to produce CAR lenti virus. HEK293T cells are purchased from DSMZ (Deutsche Sammlung von Mikroorganismen and Zellkulturen) and cultivated in DMEM (Invitrogen), supplemented with 10% FCS (Gibco) at 37 C. and 5% CO.sub.2. For maintenance, confluent cells are washed with PBS (Gibco), dissociated with trypsin/EDTA (Gibco), and plated at a 1:10 dilution in fresh media. HEK293 are transfected with virus and helper plasmid using 25 kDA polyethylenimine (PEI; Polysciences). 48 hours after transfection virus-containing supernatants are transferred to Falcon tubes and centrifuged for 15 min at 500 rcf to remove cellular debris. Virus-containing medium is aliquoted and stored at 80 C.
[0531] Primary T-cells are transduced with 82C2-41BB-CD lenti virus to produce 82C2-CAR Ts. Blood from healthy volunteer donors is obtained according to the respective regulations. T-cells are extracted from PBMC by negative selection using a pan T Cell isolation kit (Miltenyi Biotec), according to the manufacturer's instructions and T-cells proliferated as described previously; see, Carpenito et al., Proc. Natl. Acad. Sci. USA 106 (2009), 3360-3365. Primary T-cells are transduced with 82C2-41BB-CD expressing lenti virus 24 hours after activation. eGFP expression is analyzed by flow cytometry approximately 24 hours after transduction. Transduction efficiency is expected to reach more than 75%, as shown previously (Carpenito et al., Proc. Natl. Acad. Sci. USA 106 (2009), 3360-3365). These cells are labeled hereinafter 82C2-CAR Ts.
[0532] Control CAR T cells are generated by transduction of primary T cells with Sibro-41BB-CD or 82C2- and are expected to have similar transduction efficiency. These cells are labeled hereinafter Sibro-CAR Ts and 82C2--CAR Ts, respectively.
Example 22: Determination of 82C2-CAR Ts Specific Binding to Coated Recombinant FAP and Release of Effector Cytokines
[0533] To determine the effector function of 82C2-CAR Ts, cytokine release upon 82C2-CAR Ts' target engagement is measured. Release of cytokines upon binding of CAR-Ts to target epitopes, which is leading to damage of cancer cells and its environment, is one mechanism of anti-tumor effects of CAR T cells.
[0534] 96-well flat bottom plates are coated with mouse anti-His antibody (Clonetech) overnight. Recombinant human FAP with 6His N-terminal purification tag is purchased from Sino Biologics, applied to antibody coated plates for 4 hours diluted at 1 g/ml in PBS, and plates washed three times with PBS. 10,000 82C2-CAR Ts are plated per well on coated 96-well plates and incubated for 2 hours at 37 C. Cell medium supernatants are harvested and transferred to ELISA plates. IFN and TNF ELISA kits are purchased from Thermo Scientific and used according to the manufacturer's instructions. Samples are measured on a Tecan absorbance reader. It is expected that stimulation with recombinant human FAP results in strong production of IFN and TNF in 82C2-CAR Ts, as demonstrated previously; see, Tran et al., J. Exp. Med. 210 (2013), 1125-1135.
[0535] To show that cytokines are released specifically in response to 82C2-CAR T interaction with human FAP, 82C2-CAR T are plated on 96-well flat bottom plates that are not coated with FAP. It is expected that cultivation of 82C2-CAR Ts in absence of human FAP does not lead to cytokine production, i.e., that cytokine production is specifically released after interaction with FAP.
[0536] To show that effector endodomain function is necessary for 82C2-CAR Ts cytokine release, 82C2--CAR Ts are plated on recombinant FAP-coated plates as described above. It is expected that 82C2--CAR Ts do not show significant production of cytokines.
Example 23: Determination of 82C2-CAR Ts Binding to Human FAP-Expressing Cells and Release of Cytokines Under Normal pH Conditions
[0537] To obtain a human FAP-expressing plasmid, PCR is done on a human FAP encoding cDNA. The PCR product is cloned between the Asc1 and Sfi1 sites of the pUKBK-C vector, thus allowing the expression of FAP from a CMV promoter and with a C-terminal HA tag (Kohli et al., Proteome Res. 11 (2012), 4075-4090). The correctness of the FAP-HA construct is verified using Microsynth sequencing service.
[0538] It was previously shown, using RT-PCR and flow cytometry, that the human lung cancer cell line A549 does not express FAP; see, Kakarla et al., Mol Ther 21 (2013), 1611-1620. A549 are purchased from ATCC and maintained in F-12K medium according to the manufacturer's instructions. 200*10.sup.3 are plated per well in 24-well cell culture dishes and transfected the next day using 1 g FAP-HA DNA and lipofectamin 2000 (Thermo Fischer) according to the manufacturer's instructions. 1 g/ml G418 selective antibiotic (Invitrogen) is supplemented to cell culture medium one day after lipofection for selection of A549 cells transfected with the FAP plasmid. After approximately two week of maintenance in selection media, a mixed stable cell line expressing FAP is obtained, from hereinafter labeled A549-FAP. To verify stable expression of human FAP in this cell line, immunocytochemical staining with anti-HA antibody is done. 80*103 A549-FAP cells per well are plated on 4-well glass chamber slides (LabTek). 24 hours after plating, cells are fixed with 4% paraformaldehyde (Sigma-Aldrich), incubated with anti-HA antibody (1:100; Roche) for 2 hours, incubated with secondary Cy3 anti-rat (1:250; Jackson Immuno Research), and mounted using Mowiol (Sigma). Cells are imaged using a Leica SP8 confocal microscope as described previously (Gersbacher et al., PLoS One August 2013), e69363). Due to the usage of the CMV promoter a strong FAP expression (i.e., fluorescence signal) is expected in A549-FAP cells. Due to the selection procedure, it is expected that FAP expression (i.e., fluorescence signal) is observed in more than 90% of A549-FAP cells. The A549 parental cell line serves as negative for HA staining, which are expected to show no significant fluorescence signal.
[0539] To assess the effector functions of 82C2-CAR Ts, co-culture with A549-HA cells is prepared and cytokine secretion measured. 3,000 A549-FAP cells are plated per well in round-bottom 96-well plate in 50 l medium. 50 l medium containing 82C2-CAR Ts at different densities are then added to labeled A549-FAP cells to obtain 82C2-C Ts to A549-FAP cell ratios of 1:1, 10:1, 20:1, 30:1, 40:1, and 50:1. After 4 hours medium is transferred to an ELISA plates and production of IFN- and TNF- measured as described previously. It is expected that co-culture of 82C2-CAR Ts with A549-FAP cells results in no (i.e., none significant) production of the two measured cytokines. Additionally, it is expected that ratio of effector (82C2-CAR Ts) and target (A549-FAP) does not have an influence on the cytokine production.
[0540] In contrast, co-culture of Sibro-CAR Ts with A549-FAP cells, as described above, is expected to result in significant production of cytokines in a dose-dependent manner. Co-culture of Sibro-CAR Ts with nave A549 cells is expected to show no significant production of cytokines.
Example 24: Determination of 82C2-CAR Ts Binding to Human FAP Expressing Cells and Release of Cytokines Under Low pH Conditions
[0541] The tumor microenvironment is documented to have an acidic environment due to the Warburg effect. The anticipated advantage of the 82C2 variable domains, compared to other documented anti FAP antibody variable domains, is selective avidity to membrane associated FAP under low pH, versus relatively lower avidity to membrane associated FAP under neutral pH.
[0542] To test a pH dependent binding of 82C2-CAR Ts, CAR Ts are co-cultured with A549-FAP cells at pH 6.3. 3,000 A549-FAP cells per well are plated in round-bottom 96-well plate in 50 l medium (pH 6.3) together with 50 l medium (pH 6.3) containing 82C2-CAR Ts in different densities to obtain 82C2-C Ts to A549-FAP cell ratios of 1:1, 10:1, 20:1, 30:1, 40:1, and 50:1. Supernatants are transferred to ELISA plates and cytokine production measured as described above. It is expected that co-culture of 82C2-CAR Ts with A549-FAP cells results in strong production of cytokines and that the production is dose-dependent.
[0543] To show that cytokines are released specifically in response to 82C2-CAR T interaction with human FAP, 82C2-CAR Ts are co-cultured with nave A549 cells under low pH (pH 6.3) at the previously used effector-to-target cell ratios. It is expected that co-culture of 82C2-CAR Ts and naive A549 cells does not lead to a significant production of cytokines at any given effector-to-target cell ratio.
[0544] To show that effector endodomain function is necessary for the cytokine production of 82C2-CAR Ts, 82C2--CAR Ts are co-cultured with A549-FAP cells under low pH (pH 6.3) at the previously used effector-to-target cell ratios. It is expected that co-culture of 82C2--CAR Ts and A549-FAP cells does not lead to a significant production of cytokines at any given effector-to-target cell ratio.
[0545] To monitor the anticipated advantage of 82C2-derived CAR Ts over other anti-FAP CAR Tswhich is its selective avidity to membrane associated FAP under low pH, versus relatively lower avidity to membrane associated FAP under neutral pHa comparison of effector cytokine release of 82C2-CAR Ts and Sibro-CAR Ts at various pH conditions is done (pH range from 6.3 to 7.4 in 2.875 steps). A549-FAP cells are co-cultured with either 82C2-CAR Ts or Sibro-CAR Ts at an effector-to-target cell ratio of 20:1, as described above. It is expected that the lysis efficiency of Sibro-CAR Ts will be independent of the pH. In contrast, 82C2-CAR Ts are expected to have low (or non-significant) lysis efficiency at pH 7.4, but lysis efficiency is expected to increase with decreasing pH.
Example 25: Determination of 82C2-CAR Ts Specific Cytolytic Activity Towards Human FAP-Expressing Cells Under Different pH Conditions
[0546] To determine the cytolytic activity of 82C2-CAR Ts we use a standard .sup.51Cr (Chromium) release assay. To label A549-FAP cells, 2*10.sup.6 cells are washed and incubated with 20 l of Chromium-51 (5 mCi/ml; Perkin Elmer) for one hour at 37 C. Cells are then washed twice with RPMI medium (Life Technologies) and 3,000 cells plated per well in round-bottom 96-well plate in 50 l medium with pH 6.3. 50 l medium (RPMI, pH 6.3) containing 82C2-CAR Ts in different densities are then added to labeled A549-FAP cells to obtain 82C2-C T to A549-FAP cell ratios of 1:1, 10:1, 20:1, 30:1, 40:1, and 50:1. Co-cultures are incubated for 4 hours at 37 C., supernatants harvested, and .sup.51Cr release measured on a -particle counter. Lysis in % is calculated according the following formula:
((Sample.sup.51Cr release)(Spontaneous.sup.51Cr release))/((Maximum.sup.51Cr release)(Spontaneous.sup.51Cr release))
[0547] Under the described low pH conditions (pH 6.3), a dose-dependent and efficient lysis of A549-FAP by 82C2-CAR Ts is expected.
[0548] To show that cytolytic activity of 82C2-CAR Ts is dependent on specific interaction with human FAP, nave A549 are labeled with Chromium-51 and co-cultured with 82C2-CAR Ts as described above. It is expected that 82C2-CAR Ts do not lead to a significant cell lysis of nave A549 cells. To show that effector endodomain function is necessary for the cytolytic function of 82C2-CAR Ts, 82C2--CAR Ts are co-cultured with Cromium-51-labeled A549-FAP cells under low pH (pH 6.3) as described above. It is expected that 82C2--CAR Ts do not lead to a significant cell lysis of A549-FAP cells.
[0549] To monitor the anticipated advantage of 82C2-derived CAR Ts over other anti-FAP CAR Ts which is its selective avidity to membrane associated FAP under low pH, versus relatively lower avidity to membrane associated FAP under neutral pHa comparison of cytolysis function of 82C2-CAR Ts and Sibro-CAR Ts at various pH conditions is done (pH range from 6.3 to 7.4 in 2.875 steps). A549-FAP cells are labeled with Chromium-51 and co-cultured with either 82C2-CAR Ts or Sibro-CAR Ts as described above. It is expected that the lysis efficiency of Sibro-CAR Ts will be independent of the pH. In contrast, 82C2-CAR Ts are expected to have low (or non-significant) lysis efficiency at pH 7.4, but lysis efficiency is expected to increase with decreasing pH.