Vitamin B6-coupled poly(ester amine) as gene carrier and application in cancer gene therapy

Abstract

The present invention relates to a vitamin B6-coupled poly(ester amine) (VBPEA) as a gene carrier and a method for preparing the gene carrier. Moreover, the present invention relates to a gene delivery complex comprising a therapeutic gene coupled to the gene carrier and a pharmaceutical formulation for gene therapy, which comprises the gene delivery complex as an active ingredient. In addition, the present invention relates to gene therapy utilizing the gene carrier, the gene delivery complex or the pharmaceutical formulation. The VBPEA of the invention has a significantly high gene delivery rate compared to existing gene carriers and a complex of the VBPEA with DNA has little or no cytotoxicity and shows a very high in vivo transfection efficiency. In addition, a complex of the VBPEA with siRNA shows high gene silencing efficiency and can induce a high rate of cell death and the inhibition of cell proliferation in cancer cells, suggesting that it can be used for anticancer gene therapy. Thus, the gene carrier VBPEA of the invention can be used as an experimental gene carrier and can also be widely used in gene therapy against various diseases depending on the kind of therapeutic gene.

Claims

1. A gene delivery complex capable of targeting a cancer cell comprising a therapeutic gene coupled to vitamin B6-coupled poly(ester amine) (VBPEA) having the formula of Formula 1: ##STR00005## wherein n is an integer between 1 and 50, wherein the therapeutic gene inhibits expression of serine hydroxymethyltransferase 1 (SHMT 1), and the gene delivery complex is capable of delivering the therapeutic gene to a cancer cell; wherein the therapeutic gene and the VBPEA are coupled at a molar ratio of 1:5 to 1:40, and the therapeutic gene coupled to the VBPEA shows a zeta potential of 1 mV to 100 mV; and wherein the therapeutic gene comprises a polynucleotide selected from the group consisting of small interfering RNAs (siRNAs), small hairpin RNAs (shRNAs), endoribonuclease-prepared siRNAs (esiRNAs), and antisense oligonucleotides.

2. The gene delivery complex of claim 1, which has an average particle size of 100 to 250 nm.

3. The gene delivery complex of claim 1, which shows a zeta potential of 25 to 50 mV.

4. A pharmaceutical formulation for gene therapy cancer treatment, comprising the gene delivery complex of claim 1 as an active ingredient.

5. The formulation of claim 4, wherein the gene delivery complex is formulated as a form for administration by inhalation or injection.

6. A method for treating cancer by administration of the pharmaceutical formulation of claim 4 to a subject in need thereof.

7. The method of claim 6, wherein the cancer is selected from the group consisting of lung cancer, bone cancer, pancreatic cancer, skin cancer, head and neck carcinoma, melanoma, uterine cancer, ovarian cancer, rectal cancer, colorectal cancer, colon cancer, breast cancer, uterine sarcoma, fallopian tube carcinoma, endometrial cancer, cervical cancer, vaginal carcinoma, vulva cancer, esophageal cancer, small intestine cancer, thyroid cancer, parathyroid cancer, soft tissue sarcoma, urethral cancer, penis cancer, prostate cancer, chronic or acute leukemia, pediatric solid tumors, differentiated lymphoma, bladder cancer, renal cancer, renal cell carcinoma, renal pelvic carcinoma, primary central nervous system lymphoma, spinal cord tumor, brain stem glioma, and pituitary adenoma.

Description

DESCRIPTION OF DRAWINGS

(1) FIG. 1 shows a process for synthesizing a vitamin B6-coupled poly(ester amine) (VBPEA) gene carrier according to the present invention.

(2) FIG. 2a shows the results of reacting the vitamin B6-coupled poly(ester amine) (VBPEA) with DNA at various molar ratios in order to examine the capability of the vitamin B6-coupled poly(ester amine) (VBPEA) to condense a therapeutic gene.

(3) FIG. 2b shows the results of agarose gel electrophoresis conducted to examine whether a gene delivery complex obtained by reacting the vitamin B6-coupled poly(ester amine) (VBPEA) of the present invention with a therapeutic gene protects DNA when it is treated with DNAseI.

(4) FIGS. 2c and 2d show the results of measuring the particle size of the inventive gene delivery complexes prepared at various N/P ratios (5, 10, 20 and 30) under serum-free conditions (FIG. 2c) and the particle size of the inventive gene delivery complexes prepared in the presence of various concentrations (0%, 10%, 20% and 30%) of serum (FIG. 2d).

(5) FIG. 2e shows the results of measuring the zeta potential of the inventive gene delivery complexes prepared at various N/P ratios (5, 10, 20 and 30).

(6) FIGS. 3a to 3c show the cell viability of various cells treated with gene delivery complexes prepared at various N/P ratios (5, 10, 20, 30, 40 and 50 N/P) under serum-free conditions. Specifically, FIG. 3a shows the results for A549 cells, 3b shows the results for HeLa cells, and FIG. 3c shows the results for HepG2 cells.

(7) FIGS. 4a to 4c show the results of measuring transfection efficiency by the luciferase analysis of various cells treated with gene delivery complexes prepared at various N/P ratios (5, 10, 20, 30, 40 and 50 N/P) under serum-free conditions.

(8) FIG. 4a shows the results for A549 cells, FIG. 4b shows the results for HeLa cells, and FIG. 4c shows the results for HepG2 cells.

(9) FIG. 4d shows the results of measuring the transfection efficiency of the inventive complex (N/P: 20) by a luciferase assay for A549 cells treated with the inventive complex at a serum concentration of 0, 10, 20 or 30% in order to examine the influence of serum on the stability of the complex.

(10) FIG. 4e shows the results of analyzing the GFP expression of VBPEA in A549 cells by flow cytometry in order to examine the in vitro transfection efficiency of the vitamin B6-coupled poly(ester amine) (VBPEA).

(11) FIG. 4f shows the in vivo biodistribution of the vitamin B6-coupled poly(ester amine) (VBPEA) administered by aerosol delivery.

(12) FIG. 5 shows the results of analyzing the GFP expression of VBPEA in A549 cells by flow cytometry in order to examine the in vitro transfection efficiency of the vitamin B6-coupled poly(ester amine) (VBPEA).

(13) FIG. 6 shows the results of analyzing transfection efficiency after treatment with 4-deoxypyridoxine (a structural analogue of vitamin B6) in order to analyze the mechanism of transfection of the vitamin B6-coupled poly(ester amine) (VBPEA).

(14) FIG. 7A-C shows the results of experiments conducted to analyze the transfection mechanism of the vitamin B6-coupled poly(ester amine) (VBPEA). Specifically, FIG. 7A shows the results of analyzing the influence of treatment with vitamin B6 and treatment with the VBPEA gene carrier on the promotion of transfection. FIG. 7B shows a comparison of the transfection efficiency of a VBPEA/DNA complex in human or mouse lung cells or lung cancer cells. FIG. 7C shows the results of an experiment conducted to examine whether the use of the VBPEA gene carrier makes gene silencing possible.

(15) FIG. 8a schematically shows the influence of vitamin B6 on the transfection of the vitamin B6-coupled poly(ester amine) (VBPEA).

(16) FIG. 8b schematically shows the mechanism of transfection of the vitamin B6-coupled poly(ester amine) (VBPEA).

(17) FIG. 9 is a graph showing the results of analyzing the structure of a freeze-dried vitamin B6-coupled poly(ester amine) (VBPEA) by .sup.1H-nuclear magnetic resonance (.sup.1H-NMR; Avance 600, Bruker, Germany, 600 mHz).

(18) FIG. 10 shows the results of analyzing the cytotoxicity of the inventive vitamin B6-coupled poly(ester amine) (VBPEA) against human and mouse normal lung cells (16HBE-human, LA4-mouse) (n=3, error bar=SD).

(19) FIGS. 11a to 11c show the results of comparing transfection efficiency after inhibition of various endocytosis pathways in order to examine the uptake pathway of VBPEA. Specifically, caveolae-mediated uptake was inhibited by treatment with its inhibitor -methyl cyclodextrin (FIG. 11a) or genistein (FIG. 11b), and clathrin-mediated endocytosis was inhibited by treatment with its inhibitor Chlorpromazine (FIG. 11c) (n=3, error bar=SD) (*p<0.05; **p<0.01, ***p<0.001, one-way ANOVA).

(20) FIG. 12 shows the results of treating cells with bafilomycin A1 (vacuolar type H.sup.+ ATPase specific inhibitor, 200 nM) which is an endosome proton pump inhibitor, in order to examine whether the vitamin B6-coupped poly(ester amine) (VBPEA) has a transfection mechanism caused by the proton sponge effect (n=3, error bar=SD) (***p<0.001, one-way ANOVA).

(21) FIG. 13 shows the results of examining the cytotoxicity of a gene delivery complex coupled to siRNA (n=3, error bar=SD) (*p<0.05, one-way ANOVA).

(22) FIGS. 14a and 14b show the results of examining whether gene silencing is efficiently induced by the inventive gene delivery complex coupled with siRNA.

(23) FIG. 15 shows the results of microscopic observation conducted to examine whether gene silencing is efficiently induced by the inventive gene delivery complex coupled with siRNA.

(24) FIG. 16 shows the inhibition of cancer cell proliferation by siSHMT delivered to cancer cells by the inventive gene delivery complex.

(25) FIG. 17 shows the results of examining the SHMT gene silencing effect of siSHMT delivered by VBPEA in an in vivo experiment in a cancer-induced animal model (n=4 per group).

(26) FIG. 18 shows bioluminescence images measured at two-week intervals using IVIS imaging system 100 in an in vivo experiment in a cancer-induced animal model (n=4 per group) in order to determine the change in tumor volume by siSHMT delivered by VBPEA.

(27) FIG. 19 shows bioluminescence images measured at one-week intervals using IVIS imaging system 100 in an in vivo experiment in a cancer-induced animal model (n=4 per group) in order to determine the change in tumor volume by siSHMT delivered by VBPEA.

MODE FOR INVENTION

(28) Hereinafter, the present invention will be described in further detail with reference to examples. It is to be understood, however, that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention.

Examples 1: Reagents and Materials Used

(29) In the present invention, the vitamin B6-coupled poly(ester amine) (VBPEA) gene carrier of the present invention was prepared, and the following materials and reagents were used in the following examples and experimental examples: bPEI (branched poly(ester imine), Mn: 1.2 k and 25 k), DMSO (dimethyl sulfoxide), PLP (pyridoxal 5-phosphate), NaCNBH.sub.4 (sodium cyanoborohydride), genistein, Chlorpromazine, methyl--cyclodextrin, bafilomycin A1, MTT (3-(4,5-dimethyl thioazol-2-yl)-2,5-diphenyl tetra-zolium bromide) reagent and 4-4-deoxylpyridoxine hydrochloride were obtained from Sigma (St. Louis, Mo., USA). Moreover, a firefly (Photonus pyralis) luciferase-encoding luciferase reporter, a pGL3-vectoor and an enhancer were obtained from Promega (Madison, Wis., USA). GFP (green fluorescent protein) gene was obtained from Clontech (Palo Alto, Calif., USA). Confocal microscopic analysis was performed using TRITC (tetramethylrhodamine isothiocyanate) and YOYO-1 iodide (Molecular Probes, Invitrogen, Oregon, USA) dyes. Nonspecific scrambled siRNA (siScr) and luciferase siRNA shown in Table 1 below were purchased from Genolution Pharmaceuticals, Inc. (Seoul, Korea). All the compounds in the following examples and experimental examples were of analytical reagent grade.

(30) TABLE-US-00001 TABLE 1 siRNA sequence siRNA Sense (5->3) Antisense (5->3) siRNA scrambled CGUACGCGGAAUACUUCGAUU UCGAAGUAUUCCGCGUACGUU (siScr) (SEQ ID NO: 1) (SEQ ID NO: 2) siRNA Luciferase CUUACGCUGAGUACUUCGAUU UCGAAGUACUCAGCGUAAGUU (siLuc) (SEQ ID NO: 3) (SEQ ID NO: 4) siRNA Serine esiRNA Human SHMT1 hydroxymethyltransferase (esiRNA1, Cat No: EHU159081-50UG) (siSHMT) (Complex mixture having no specified sequence)

Example 2: Preparation of Vitamin B6-Coupled Poly(Ester Amine) Gene Carrier

(31) The vitamin B6-coupled poly(ester amine) (VBPEA) gene carrier according to the present invention was synthesized according to the Michael addition reaction that is a slight modification of the method described in Arote R B, et al., Bioconjug. Chem. 2009, 20(12): 2231-41) (FIG. 1).

(32) In brief, the VBPEA gene carrier was prepared by a two-step reaction comprising cross-linking low-molecular-weight bPEI with glycerol dimethacrylate (GDM) to prepare PEA (poly(ester amine), and coupling B6 (pyridoxal 5-phosphate (PLP) to the prepared PEA (poly(ester amine). The detailed process is as follows.

(33) 2-1: Step of Preparing PEA

(34) PEA was prepared by the Michael addition reaction between low-molecular-weight bPEI (1.2 k) and GDM. Specifically, each of GDM and low-molecular-weight bPEI was dissolved in anhydrous methanol, the low-molecular-weight bPEI solution was slowly added to the GDM solution at 60 C. and a constant stirring rate for 24 hours such that the stoichiometric ratio was 1:2. The reaction mixture was dialyzed in distilled water 4 C. for 24 hours using a Spectra/Por membrane (MW cutoff 3.5 k; Spectrum Medical Industries, Inc., LA, Calif., USA). The resulting material was freeze-dried and stored at 0 C.

(35) 2-2: Step of Preparing VBPEA

(36) In the presence of the PEA prepared in Example 2-1, 10 mol % of primary amine was reacted with pyridoxal 5-phosphate (PLP) to form a transient Schiff base. Then, the Schiff base was reduced with NaCNBH.sub.4 to obtain VBPEA. Specifically, 10 mL of PLP solution (25 mg/mL) was added dropwise to 50 mL of an aqueous solution containing 1 g of PEA and 100 mg of NaHCO.sub.3. The dropwise addition was performed with strong stirring at room temperature for 24 hours.

(37) Then, in order to reduce the produced Schiff base into secondary amine, 50 mg of NaCNBH.sub.4 was added thereto. The reaction mixture was dialyzed in distilled water 4 C. for 24 hours using a Spectra/Por membrane (MW cutoff 3.5 k; Spectrum Medical Industries, Inc., LA, Calif., USA). The resulting material was freeze-dried and stored at 0 C.

(38) As a result, the terminal amine of PEA reacted with the aldehyde group of vitamin B6 (pyridoxal 5-phosphate) to form an unstable transient Schiff base which was then reduced with NaCNBH.sub.4. For the produced VBPEA, the structure, the abilities to condense and protect DNA, the size, the zeta potential and the DNA complex shape were analyzed.

(39) 2-3. Analysis of Properties of Vitamin B6-Coupled Poly(Ester Amine)

(40) The structures of the freeze-dried vitamin B6-coupled poly(ester amine) (VBPEA) and PEA were analyzed by .sup.1H-nuclear magnetic resonance (.sup.1H-NMR) (Advanced 600, Bruker, Germany, 600 mHz). The absolute molecular weight of VBPEA was measured by gel permeation chromatography coupled with multiangle laser light scattering (GPC-MALLS) using Sodex OHpack SB-803 HQ (Phenomenex, Torrells, Calif., USA). The chromatography analysis was performed at a flow rate of 0.5 ml/min and a temperature of 25 C.

(41) When the structure of VBPEA was analyzed by .sup.1H-nuclear magnetic resonance, a strong peak appeared at 8.0 ppm, indicating a proton present on the pyridoxal ring of vitamin B6. The PEA backbone was confirmed by methyl peaks at 1.1 ppm and 2.4 ppm. The comparison of the NMR data of vitamin B6, PEA and VBPEA can be seen in FIG. 9. The content of vitamin B6 in VBPEA was about 9.77 mol % as determined by the NMR analysis (FIG. 10).

(42) In addition, the molecular weight of VBPEA was about 5000-6000 Da as measured by the GPC-MALLS. The above results are summarized in Table 2 below.

(43) TABLE-US-00002 TABLE 2 Structural properties of VBPEA Molecular weight Poly- (Da) of dispersity reactants PEA VB.sub.6 Molecular index Sample PEA VB.sub.6 (mol-%) (mol-%) weight (Da) (PDI) VBPEA 5000-5200 247 90.23 9.77 5000-6150 1.12

Example 3: Analysis of Properties of Vitamin B6-Coupled Poly(Ester Amine)/DNA Complex

(44) 3-1. DNA Condensation Capability of VBPEA

(45) One of the most properties of gene carriers is the capability to condense plasmid DNA by interaction therewith. Accordingly, the DNA condensation capability of the vitamin B6-coupled poly(ester amine) (VBPEA) prepared in Example 2 was analyzed by a gel retardation assay.

(46) Specifically, VBPEA was mixed with a pGL3 plasmid (5.3 kb, Promega) at various molar ratios (N/P ratios) of 0.5, 1, 3, 5 and 10, and the mixture was adjusted with a total volume of 20 ul with autoclaved water. Each of the solutions was lightly vortexed and incubated at room temperature for 30 minutes, and 1 loading dye (Biosesang, Korea) was added thereto. Then, each of the reaction solutions was electrophoresed (100 V) on 0.8% agarose gel, and the mobility of DNA was observed under UV light. As a control, the pGL3 plasmid alone was used without reacting with VBPEA.

(47) As a result, as can be seen in FIG. 2a, when the N/P ratio was 5, the migration of gel was completely retarded. This suggests that the VBPEA of the present invention had a high ability to bind to DNA and effectively condensed the plasmid DNA to form a gene delivery complex (VBPEA/DNA). Unreacted plasmid DNA as a control migrated through the gel without retardation. As can be seen from the above results, it is preferred to mix plasmid DNA with the VBPEA of the present invention at a N/P ratio of 5 or higher for effective formation of a gene delivery complex.

(48) 3-2. DNA Protecting Effect of VBPEA

(49) For effective gene expression, DNA in a gene delivery complex should be protected from enzymes such as DNase. To examine this DNA protecting effect, the vitamin B6-coupled poly(ester amine) (VBPEA) prepared in Example 2 and pGL3 plasmid DNA were mixed with each other at a molar ratio (N/P ratio) of 10:1 and reacted at room temperature for 30 minutes to prepare a gene delivery complex (VBPEA/DNA). To DNase/Mg.sup.2 lysis buffer (50 mM Tris Cl, pH 7.6, and 10 mM MgCl.sub.2) containing 4 l of the gene delivery complex solution or unreacted plasmid DNA, 1 l (50 units) of DNase I was added and the mixture was incubated with stirring at 37 C. for 30 minutes. Next, the reaction solution was treated with 4 l of EDTA (250 mM, 1N NaOH) at room temperature for 30 minutes to stop the enzymatic reaction, and then 5 l of 1% sodium dodecyl sulfate (pH 7.2) was added to the solution which was then incubated at 25 C. for 2 hours in order to break the ionic bond between VBPEA and DNA. After incubation, the solution containing the separated DNA was electrophoresed on 0.8% agarose gel at 100 V for 40 minutes using tris-acetate-EDTA buffer (1TAE running buffer).

(50) As a result, as can be seen in FIG. 2b, the untreated plasmid DNA as the control was completely degraded by DNase I (lane 2), whereas the DNA in the gene delivery complex (VBPEA/DNA) of the present invention was effectively protected from degradation by DNase I (lane 4). Such results indicate that the gene delivery complex of the present invention can effectively deliver DNA into cells while protecting DNA from the attack of DNase.

(51) 3-3. Morphological Analysis of VBPEA Gene Carrier/DNA Complex

(52) The morphology of the gene delivery complex (VBPEA/DNA), prepared in Example 3-1 by reacting the vitamin B6-coupled poly(ester amine) with pGL3 plasmid DNA at a molar ratio N/P ratio) of 20:1, was observed with a transmission electron microscope (LIBRA 120, Carl Zeiss, Germany). Specifically, a VBPEA/DNA complex (N/P: 20) and a PEI25k/DNA complex (N/P: 10) as a control were prepared, loaded onto a carbon grid and stained with 1% uranyl acetate for 10 seconds, followed by washing with distilled water. Next, the samples were dried for 10 minutes, and then observed with an electron microscope.

(53) As a result, as can be seen in FIG. 2d, the VBPEA/DNA complex of the present invention had a nano-scale particle size suitable for cell uptake.

(54) 3-4. Measurement of Surface Charge of VBPEA Gene Carrier/DNA Complex

(55) The positive surface charge of the gene delivery complex is essential for binding to the anionic cell surface and facilitates the intracellular internalization of the complex. Accordingly, the zeta potentials of gene delivery complexes (VBPEA/DNA), formed by reacting the vitamin B6-coupled poly(ester amine) of the present invention with plasmid DNA at various molar ratios, and a PEA/DNA complex and a PEI25k/DNA complex as controls, were measured using a dynamic light scattering spectrometer (DLS-8000, Otsuka Electronics, Osaka, Japan) at 25 C. and at scattering angles of 90 and 20. Each of the samples was incubated at N/P ratios of 5, 10, 20 and 30 in such a manner that the final concentration of DNA in a total volume of 1 mL was 40 g/mL. In order to examine the influence of serum protein on the stability of the VBPEA/DNA complex (N/P: 20) compared to those of the PEA/DNA complex (N/P: 20) and the PEI25k/DNA complex (N/P: 10), the particles sizes of the gene delivery complexes were measured in the presence of various concentrations (0%, 10%, 20% and 30%) of serum.

(56) The results of observation with the dynamic light scattering spectrometer (DLS) indicated that the size of the VBPEA/DNA complex decreased as the N/P ratio or the concentration of serum increased. However, it was shown that the VBPEA/DNA complex of the present invention showed an increase in zeta potential from 35 mV to 41 mV with an increase in the N/P ratio, even though this increase was insignificant compared to that of the PEA/DNA or PEI25k/DNA complex (FIG. 2f). The gene delivery complex prepared by the VBPEA of the present invention with plasmid DNA at a molar ratio of 20:1 showed the highest positive zeta potential. This positive surface charge indicates that the positively charged DNA is completely encapsulate in the gene delivery complex. Also, this positive surface charge has advantages in that it facilitates the intracellular internalization of the gene delivery complex and causes an electrostatic repulsive force between the complex particles to reduce the aggregation of the particles.

(57) After a specific aggregation limit (110 nm; N/P: 20) was reached, the particle size started to increase again, probably because of the electrostatic repulsive force in the complex. Meanwhile, the insignificant increase in zeta potential compared to that of the PEA/DNA complex is believed to be because of coupling with vitamin B6. In addition, the continuous increase in size of the PEI25k/DNA complex by aggregation with serum protein according to the increase in the concentration of serum suggests that the PEI25k/DNA complex is not suitable for cell uptake. However, it was shown that there was little or no change in the size of the VBPEA/DNA complex according to the concentration of serum. This is believed to be because the coupling between the hydroxyl group of the PEA backbone and vitamin B6 interferes with the binding between the positive charge of the PEA backbone and serum protein.

(58) In addition, EF-TEM images showed that the VBPEA/DNA complex had a uniform particle size distribution (120 nm or less) (FIG. 2c). Particularly, it was shown that the VBPEA/DNA complex had a spherical shape readily distinguishable from that of the PEI25k/DNA complex and did not aggregate, suggesting that it can be easily internalized into cells.

Example 4: Analysis of In Vitro Transfection Efficiency of Vitamin B6-coupled poly(ester amine)

(59) 4-1. Isolation and Culture of Mouse Primary Lung Cells

(60) A human lung adenocarcinoma cell line (A549) and a mouse lung epithelial cell line (LA-4) were cultured in RPMI-1640 medium. A human cervical cancer cell line (HeLa) and a human hepatoma cell line (HepG2) were cultured in DMEM (low glucose) medium. A human bronchial epithelial cell line (16HBE) was cultured in DMEM/Ham's F12 medium (FBS, HyClone, Logan, Utah, USA) containing 10% heat-inactivated fetal bovine serum and 1% penicillin/streptomycin. All the cells were cultured in a standard culture environment at 37 t under 5% CO.sub.2.

(61) To obtain a lung single cell suspension, lungs were extracted from mice (6 weeks old) and stored in DMEM/F-12 medium containing 0.5 mg/mL collagenase D (Roche Applied Science, Indianapolis, Ind., USA) and 100 g/mL of DNase I (Sigma-Aldrich). The tissue was cut with scissors, incubated at 37 C. for 1 hours, and then passed through a 70 m Falcon cell strainer (BD Labware). RBC lysis was performed by centrifugation (800 rpm, 10 min) using ACK lysis buffer (Gibco). The cell pellets were resuspended in DMEM/Ham's F-12 medium (containing 10% FBS and 1% antibiotic), and the cells were counted and seeded in a 24-well plate.

(62) 4-2. Cytotoxicity of Vitamin B6-Coupled Poly(Ester Amine)

(63) To examine the cytotoxicity of the vitamin B6-coupled poly(ester amine) (VBPEA), various cells were treated with gene delivery complexes, prepared from various molar ratios (5, 10, 20, 30, 40 and 50 N/P) of DNA and VBPEA under serum-free conditions, and the cell viability was analyzed by an MTT assay. The cell viability was compared with those of cells treated with PEA and PEI25k.

(64) Specifically, before treatment with the complexes, each of A549 cells, HeLa cells and HepG2 cells was seeded into each well of a 24-well plate at 110.sup.5 cells/mL and cultured to a confluence of 80% in a 5% CO.sub.2 incubator at 37 C. The vitamin B6-coupled poly(ester amine) of the present invention or PEI and DNA were mixed at various N/P ratios to prepare gene delivery complexes, and the medium of the cells cultured as described above was replaced with serum-free medium, followed by incubation for 3 hours. Then, the medium was replaced with serum-containing medium. After incubation for 36 hours, each well was treated with 500 l of MTT reagent (0.5 mg/mL in 1PBS) and incubated for 3 hours. After removing medium, formazan in each well was dissolved with DMSO, and the colored solution was transferred to a 96-well plate, and the optical density at 540 nm was measured with VERSAmax tunable microplate reader (Sunnyvale, USA). All the experiments were repeated three times.

(65) The results of the MTT assay indicated that the cytotoxicity of the VBPEA/DNA complex of the present invention was significantly lower than that of the PEA/DNA or PEI25k/DNA complex (FIG. 3). Specifically, the VBPEA/DNA complex of the present invention showed a cell viability of 98% or higher in A549 cells, HeLa cells and HepG2 cells. However, the PEA/DNA complex showed a cell viability of 85-90%, and the PEI25k/DNA complex showed a cell viability of 70%.

Example 5: Analysis of In Vitro and In Vivo Transfection Efficiencies of Vitamin B6-Coupled Poly(Ester Amine)

(66) 5-1. Analysis of In Vitro Transfection by Luciferase Assay

(67) In order to examine the transfection efficiency of the vitamin B6-coupled poly(ester amine) (VBPEA) of the present invention in the presence or absence of serum, a transfection experiment was performed in various cell lines.

(68) Specifically, each of the A549 cell line, the HeLa cell line and the HepG2 cell line was seeded into each well of a 24-well plate at a density of 110.sup.5 cells/well. The cells were grown to a confluence of 80%, and then treated with VBPEA/pGL3 plasmid, PEA/pGL3 plasmid or PEI25k/pGL3 plasmid complexes, prepared at various molar ratios (5, 10, 20, 30, 40 and 50 N/P) under serum-free conditions. After 3 hours, the medium was replaced, and the cells were incubated for 24 hours under standard incubation conditions. Then, the cells were subjected to a luciferase assay according to the manufacturer's protocol. Relative light units (RLU) were measured using a chemiluminometer (Autolumat, LB953; EG&G Berthold, Germany) and normalized to protein concentrations using a BCA protein assay kit (Perice Biotechnology, Rockford, Ill., USA).

(69) Meanwhile, in order to examine the influence of serum on the stability of the complexes, the A549 cell line in a 24-well culture dish was transfected with each of complexes (prepared at a N/P ratio of 20) at various serum concentrations of 0, 10, 20 and 30%. Then, a luciferase assay was performed in the same manner as described above. The transfection efficiency was measured as RLU/mg (protein), and the experiment was repeated three times.

(70) As a result, as can be seen in FIG. 4, the transfection efficiency (luciferase expression) of the VBPEA/DNA complex of the present invention was 5-20 times higher than that of the PEA/DNA complex and 12-30 times higher than that of the PEI25k/DNA complex.

(71) 5-2. Analysis of In Vitro Transfection by Flow Cytometry

(72) In order to examine the in vitro transfection efficiency of the vitamin B6-coupled poly(ester amine) (VBPEA) of the present invention, the GFP expression of VBPEA in A549 cells was analyzed by flow cytometry.

(73) Specifically, the VBPEA of the present invention and the plasmid pcDNA3.1/CT-GFP (6.1 kb, Invitrogen) expressing green fluorescent protein (GFP) were mixed with each other at a molar ratio of 10 to prepare a gene delivery complex (VBPEA/tGFP). A549 cells were transfected with the prepared VBPEA/tGFP complex, after which the cells washed with PBS and treated with trypsin. 10,000 cells were analyzed using FACS Calibur System (Becton-Dickinson, San Joes, Calif., USA), and the percent (%) of cells expressing GFP was recorded to evaluate transfection efficiency.

(74) As a result, as can be seen in FIGS. 4e and 5, the PEA/DNA complex showed a transfection efficiency of 30-35% and the PEI25k/DNA complex showed a transfection efficiency of 10-13%, whereas the VBPEA/DNA complex showed a transfection efficiency of 40-45%.

(75) 5-3. Analysis of In Vivo Biodistribution

(76) The VBPEA/pGL3 complex was injected intravenously into Balb/c mice (4 animal per group), and the in vivo biodistribution of the complex was analyzed. The animals were purchased form Orient Bio Inc. (Korea) and housed in an animal facility at a temperature of 232 C. and a relative humidity of 5020% with 12-hr light/12-hr dark cycles. All the experimental procedures in this study were approved by the Animal Care and Use Committee at Seoul National University (SNU-120409-3).

(77) Specifically, each of VBPEA and PEA was coupled with 30 g of a pGL3 plasmid at a N/P ratio of 20 and adjusted to a final volume of 100 l with normal saline. As a control, DNA alone in normal saline was used. Each of the complexes and the control was injected intravenously into the tail veins of 6-week-old Balb/c mice by a 40 U insulin syringe (0.38 mm needle, 1 mL). At 4 days after injection of the complexes, the mice of each group were sacrificed by cervical dislocation, and all the organs were extracted. The organs were washed with cold saline, weighed, crushed, suspended in 2.5 cell lysis buffer (Promega, USA) at a concentration of 25%, and homogenized. Then, the suspension was centrifuged at 4 C. at 10,000 rpm for 10 minutes to collect the cell lysate. 100 l of the cell lysate collected from each sample was subjected to a luciferase assay using a chemiluminometer.

(78) As a result, it was shown that luciferase activity was higher in the order of the spleen, the lung, the brain, the liver, the kidney and the heart (FIG. 4f). It was found that the cell uptake of the complex of the present invention was promoted by vitamin B6 in the liver, lung and brain in which the expression levels of genes are generally low due to limited uptake of medicaments. Immediately after intravenous injection, the complex showed a tendency to aggregate with blood cells and serum components, indicating that the composite particles were accumulated in the capillary blood vessels of the lung. This is believed to be because the size of the complex particles that were leaked from the blood vessels was 60 nm or more, suggesting that the complex particles did flow out of lung tissue. Slightly greater complex particles were found in liver cells at high concentrations. This is believed to be because the liver metabolizes vitamin B6. Thus, when VBPEA was used, luciferase activity was found in the liver, unlike the use of PEA.

Example 6: Study on Transfection Mechanism of VBPEA

(79) In order to example a mechanism by which the high transfection efficiency of the inventive VBPEA as described in Example 5 is achieved, the following experiment was performed.

(80) 6-1. Competitive Inhibition Experiment Using 4-Deoxypyridoxine

(81) In order to examine the role of vitamin B6 in the transfection of VBPEA of the present invention, a competitive inhibition experiment was performed using 4-deoxypyridoxine that is a structural analogue of vitamin B6. Specifically, A549 cells cultured to a confluence of 80% were treated with 0, 1, 2, 5, 10 or 20 mM of 4-deoxypyridoxine and treated with the VBPEA/DNA or PEA/DNA complex for 10 minutes. After 24 hours, the cells were collected and subjected to an in vitro luciferase assay.

(82) As shown in FIG. 6A, when the cells were treated with 4-deoxypyridoxine (1 mM) that is a structural analogue of vitamin B6, the transfection efficiency of the VBPEA/DNA complex significantly decreased to that of the PEA/DNA complex. This suggests that the high transfection efficiency of the VBPEA/DNA complex occurs because vitamin B6 binds to VTC (VB6 transporting membrane carrier). In other words, this suggests that the vitamin B6 of VBPEA increases the accessibility of the VBPEA/DNA complex to the cell membrane through VTC to thereby increase the transfection efficiency of the complex.

(83) 6-2. VBPEA Inhibition Experiment Using Confocal Microscope

(84) The signal of TRITC-labeled VBPEA and YOYO-1-labeled DNA in the intracellular trafficking of A549 cells was observed with an inverted laser scanning confocal microscope (Zeiss LSM 710, Carl Zeiss) in the presence or absence of 4-deoxypyridoxine.

(85) Specifically, TRITC (25 l, 1 mg/100 l DMF) was added to VBPEA (1 ml, 10 mg/mL H.sub.2O) (blocked about 1% of total amine) and stirred overnight. Unreacted TRITC was removed by washing three times with ethyl acetate (2 mL), and the remaining material was freeze-dried and resuspended in water. pDNA (1 g) was labeled with YOYO-1 iodide (2 l, 1 mM in DMSO) by stirring these materials in a dark place at 251 C. for 2 hours. It was stored at 20 C. A549 cells were seeded into each well of a 6-well culture dish at a density of 210.sup.5 cells/well and transfected with the double-labeled VBPEA/DNA in the presence or absence of 4-deoxypyridoxine. After 120 minutes, the cells were washed three times with 1PBS, and then fixed with 4% paraformaldehyde at 4 C. for 10 minutes. The nuclear DNA was counter-stained with DAPI, and the cells were imaged with a confocal microscope.

(86) As a result, as described in Example 6-1, the confocal microscope images showed that the VBPEA/DNA complex of the present invention reduced the accessibility of VBPEA to VTC in the presence of 4-deoxypyridoxine, and thus the cell uptake thereof significantly decreased (FIG. 6B).

(87) 6-3. Analysis of Influence of Free or Coupled Vitamin B6 on Gene Transfection

(88) In order to analyze the influences of vitamin B6 alone and VBPEA on the promotion of transfection, the following experiment was performed.

(89) Specifically, A549 cells were treated with 0, 5, 20, 50 or 100 M of vitamin B6 together with a PEA/pGL3 plasmid complex (N/P: 20), and the transfection efficiency of the PEA/pGL3 plasmid complex was compared with that of a VBPEA/pGL3 plasmid complex (N/P: 20).

(90) As a result, as can be seen in FIG. 7A, the VBPEA/DNA complex showed high transfection efficiency compared to the PEA/DNA complex used together with free vitamin B6, and the PEA/DNA complex did not show a significant difference in transfection efficiency even when the concentration of free vitamin B6 increased. This suggests that the transfection of PEA is achieved by a mechanism separate from free vitamin B6.

(91) 6-4. Analysis of the Ability of VBPEA to Bind to Cancer Cells and Normal Cells

(92) Mouse primary lung cells were seeded into a 24-well culture dish at a concentration of 110.sup.5 cells/well, and then washed with PBS and transfected with the VBPEA/DNA complex (N/P: 20) under serum-free conditions. After 3 hours, the medium was replaced with DMEM/F-12 complete medium. Similarly, human lung adenocarcinoma LA-4 cells, human lung adenocarcinoma A549 cells and human bronchial epithelial 16HBE cells were also transfected. After 24 hours, the degree of luciferase expression was analyzed and compared between the normal cells and the cancer cells. In addition, in order to verify that the VBPEA/DNA complex is not toxic in normal cells, an MTT assay was performed in the same manner as described above.

(93) As a result, as can be seen in FIG. 7B, the transfection efficiency of the VBPEA/DNA complex was significantly higher in human or mouse lung cancer cells (A549 cells and LA-4 cells) than in human or mouse primary lung cells. This indicates that VBPEA/DNA is highly efficiently internalized into cancer cells compared to normal cells, because the requirement for vitamin B6 is high in cancer cells whose growth and proliferation actively occur. Meanwhile, it was shown that the VBPEA/DNA complex of the present invention showed no toxicity in normal cells (FIG. 10).

(94) 6-5. Comparison of Endocytosis Mechanism Between PEA and VBPEA

(95) In order to examine the VBPEA uptake pathway, various endocytosis pathways were inhibited, and then the comparison of transfection efficiency was performed. To study clathrin-mediated endocytosis, A549 cells were treated with 1, 2 and 3 g/mL of chlorpromazine for about 1 hour, and then the VBPEA/DNA complex (N/P: 20) was added thereto. Similarly, the caveolae-mediated uptake was inhibited by treatment with 2.5, 6.5 or 10 mg/mL of its inhibitor -methyl cyclodextrin or 100, 200 or 300 M of genistein. After treatment with the inhibitors for 1 hour, the A549 cells transfected, and after 24 hours, the expression of luciferase was measured.

(96) It was shown that, when the cells were treated with the caveolar inhibitors -methyl cyclodextrin and genistein, the VBPEA-mediated or PEA-mediated transfection efficiency decreased in a concentration-dependent manner. This suggests that the two gene carriers use the caveolar uptake pathway. On the other hand, the inhibition of clathrin-mediated endocytosis by chlorpromazine reduced the transfection efficiency of the VBPEA/DNA complex, but did not change the transfection efficiency of the PEA/DNA complex (FIG. 11). This suggests that, in transfection with PEA, no transporter is involved, and thus clathrin-mediated endocytosis does not occur, whereas in transfection with VBPEA, clathrin-mediated endocytosis occurs due to the involvement of vitamin B6 transporter.

(97) 6-6. Examination of Proton Sponge Effect of PEI in VBPEA

(98) It is known that the relatively high transfection effect of PEI is attributable to its ability to escape from endosomes by the proton sponge effect. It is known that this effect is because PEI acts as a buffer during the acidification of endosomes by the introduction of protons and Cl.sup. and the resulting swelling and hemolysis of endosomes. In order to examine whether the vitamin B6-coupled poly(ester amine) (VBPEA) according to the present invention also has the same proton sponge effect, and the buffer ability of the VBPEA was examined.

(99) Specifically, A549 cells were seeded into a 24-well plate at a density of 1.010.sup.5 cells/well and cultured to a confluence of 80%, and then cultured for 10 minutes in serum-free medium supplemented with the endosome proton pump inhibitor bafilomycin A1 (vacuolar type H.sup.+ ATPase specific inhibitor, 200 nM) diluted in DMSO. Then, the cells were treated with each of the VBPEA/DNA complex (N/P: 20) of the present invention and PEI25K/DNA (N/P: 10) as a control, and after 24 hours, the expression of luciferase was measured in the same manner as described above.

(100) When the vacuolar-type proton pump was inhibited with bafilomycin A1 as described above, transfection with VBPEA decreased by about 1000 times. This suggests that the transfection of VBPEA is promoted by the acidification of endosomes (FIG. 12). The inhibitor prevented the acidification of endosomes and inhibited bursting for release of the gene carrier.

Example 7: Silencing with VBPEA

(101) 7-1. Efficiency of siRNA with VBPEA

(102) In order to examine whether the use of the VBPEA gene carrier of the present invention makes gene silencing possible, an experiment on the transfection of siRNA was performed.

(103) Specifically, A549 cells were transfected with a Lipofectamine/pGL3 plasmid complex under serum-free conditions, and after 3 hours, the medium was replaced, and the cells were treated with a VBPEA/siLuc (si Luciferase) or siScr (si Scrambled) complex or a PEA/siLuc or siScr complex (N/P: 20). Herein, the siRNAs were used at a concentration of 50, 75, 100 or 150 M. The cells were additionally cultured for 3 hours, and then the medium was replaced with 10% serum-containing complete medium. After 24 hours, the expression of luciferase was measured by the same luciferase assay as described above and was normalized to protein concentration. Luciferase silencing efficiency was calculated relative to the luciferase level of control cells not treated with the luciferase-specific siRNA.

(104) As a result, silencing efficiency by the VBPEA/siLuc complex increased by 94% compared to that in the use of the PEA/siLuc complex. Silencing activity was stabilized when the concentration of siRNA was 100 M higher. The use of the gene carrier/non-specific Scrambled siRNA (siScr, control) complex or the use of the siLuc plasmid alone showed an insignificant silencing effect (FIG. 7c).

(105) 7-2. Measurement of Cytotoxicity of siRNA with VBPEA

(106) An MTT assay showed that the VBPEA/siLuc complex had no cytotoxicity. Specifically, the cytotoxicity of the VBPEA/siRNA or PEA/siRNA complex (N/P: 20) comprising various concentrations (50, 100 and 150 M) of siRNA was measured in A549 cells. After 36 hours, an MTT assay was performed in the same manner as described above.

(107) As a result, it was shown that the VBPEA-mediated gene silencing of the VBPEA/siRNA complex was improved due to low cytotoxicity compared to that of the control (PEA/siRNA) (FIG. 13). Such results suggest that VBPEA can be effectively used for the silencing of vitamin B6-dependent enzymes that are involved in cancer cell proliferation, indicating that it can be use as an anticancer agent.

Example 8: Effect of VBPEA-Mediated Gene Silencing on Inhibition of Cancer Cell Proliferation

(108) As confirmed in Example 7, the use of the VBPEA of the present invention efficiently caused gene silencing. Accordingly, it was believed that the VBPEA would be particularly efficient for silencing of vitamin B6-dependent enzymes, and based on the fact that vitamin B6 can play as an important coenzyme in cancer cell proliferation, the effect of VBPEA-mediated gene silencing on cancer cell proliferation was examined.

(109) 8-1. Measurement of Serine Hydroxymethyltransferase Silencing Efficiency

(110) First, using esiRNA (esiRNA Human SHMT1, Sigma, Cat No: EHU159081-50UG)) against serine hydroxymethyltransferase (SHMT) that is a vitamin B6-dependent enzyme playing an important role in cancer cell proliferation, the gene silencing efficiency of VBPEA was analyzed by real time-qPCR and reverse transcriptase (RT)-PCR (FIG. 14b).

(111) As a result, it was shown that the gene silencing efficiency of VBPEA was significantly higher than those of other control gene carriers. Specifically, the expression of the SHMT gene decreased by 9.7 times in the use of VBPEA compared to the negative control, 6.8 times in the use of PEI25k, and 5.6 times in the use of PEA (FIGS. 14a and 14b).

(112) 8-2. Measurement of Cancer Cell Death Induction

(113) Whether the VBPEA-mediated silencing of SHMT gene in cancer cells induces cell death was examined. As siSHMT for silencing the SHMT gene, esiRNA human SHMT1 (Sigma Aldrich, Cat No: EHU159081-50UG) was used.

(114) Specifically, A549 cells were treated with VBPEA/siSHMT, PEA/siSHMT or VBPEA/siScr, and a positive or negative control group was prepared. DNA cleavage that is the characteristic of cell death was analyzed by green fluorescence (fluorescence-dUTP), and cell death was measured by a TUNEL assay (FIG. 15).

(115) As a result, as can be seen in FIG. 15, the frequency of cell death was significantly high in cells treated with VBPEA/siSHMT.

(116) 8-3. Measurement of Inhibitory Effect on Cancer Cell Proliferation

(117) Whether the VBPEA-mediated silencing of the SHMT gene in cancer cells has an inhibitory effect on cancer cell proliferation was examined. Specifically, A549 cells were treated with VBPEA/siSHMT, PEA/siSHMT or VBPEA/siScr, and an untreated negative control group was prepared. The proliferation of the cells was measured over 0-4 days. The proliferation rate of the cells was analyzed by a WST assay (FIG. 16).

(118) The WST assay uses a mechanism in which tetrazolium salt WST-1 is cleaved to formazan by mitochondrial dehydrogenase having activity in living cells. In this assay, the concentration of formazan that is produced only in viable cells is determined by measuring the absorbance at 450 nm, thereby determining the number of viable cells.

(119) As a result, as can be seen in FIG. 16, the proliferation of the cells treated with VBPEA/siSHMT was significantly inhibited compared to that of the cells treated with PEA/siSHMT or VBPEA/siScr. Particularly, on days 1 and 2, the cancer cells did not proliferate, and the number of the cells was smaller than the original cell number due to the cell death effect of VBPEA/siSHMT.

Example 9: Examination of Effect of VBPEA-Mediated Gene Silencing on Inhibition of Cancer Cells Proliferation in Animal Model

(120) As shown in Example 8, the use of the VBPEA of the present invention induced silencing of the cancer-related gene (serine hydroxymethyltransferase (SHMT)) and showed an inhibitory effect on cancer cell proliferation in the in vitro experiment. Accordingly, the inhibitory effect of VBPEA-mediated gene silencing on cancer cell proliferation was examined by an in vivo experiment in a cancer-induced animal (mouse) model.

(121) 9-1. Construction of Cancer-Induced Animal Model and Therapeutic Method

(122) Human lung adenocarcinoma A549 cells (310.sup.6 cells, 100 l) that stably express luciferase were injected subcutaneously into 5-week-old male nude mice (Balb/c, 4 animals per group) to construct a cancer-induced animal model. The animals were purchased from Orient Bio Inc. (Korea) and housed in an animal facility at a temperature of 232 C. and a relative humidity of 5020% with 12-hr light/12-hr dark cycles. All the experimental procedures in this study were approved by the Animal Care and Use Committee at Seoul National University (SNU-120409-3).

(123) One month after injection with the A549 cells, the tumor volume reached about 800-1000 mm.sup.3, and then cancer treatment with siSHMT was initiated.

(124) Specifically, a solution of the VBPEA/siSHMT (30 g) complex (N/P: 20), the PEA/siSHMT complex (N/P: 20) or the PEI25k/siSHMT complex (N/P: 10) in saline was administered to the animals at 48-hour intervals for one month. As a negative control, an empty vector, siSHMT gene (naked siSHMT) or VBPEA/siScr was administered.

(125) During one month of the administration, the tumor size was measured using IVIS Imaging system 100 (Xenogen), and after one month, the animal were sacrificed and the expression level of SHMT protein in the tumor tissue was measured.

(126) 9-2. Measurement of Expression Level of SHMT in Cancer Tissue

(127) The expression level of SHMT in the cancer tissue extracted from mice sacrificed in Example 9-1 was measured by Western blotting.

(128) Specifically, the mice of each group were sacrificed by cervical dislocation, and the cancer tissue was extracted. The organs were washed with cold saline, weighed, crushed, suspended in 2.5 cell lysis buffer (Promega, USA) at a concentration, and homogenized. Then, the suspension was centrifuged at 4 C. at 10,000 rpm for 10 minutes to collect the cell lysate. The concentration of protein in the cell lysate was measured, and 25 g of the protein was separated by SDS-PAGE and transferred to a nitrocellulose membrane, followed by immunoblotting (FIG. 17).

(129) As a result, as can be seen in FIG. 17, treatment with the VBPEA/siSHMT complex showed an excellent effect on the inhibition of SHMT expression compared to treatment with the PEA/siSHMT or PEI25k/siSHMT complex (FIG. 17).

(130) 9-3. Measurement of Tumor Volume

(131) During one month of administration in Example 9-1, the tumor volume was measured once a week using IVIS imaging system 100 (Xenogen). The tumor volume was calculated using the following equation:
Tumor volume (mm.sup.3)=0.5ab.sup.2
wherein a is the smallest diameter, and b is the longest diameter.

(132) The results of measurement using the IVIS imaging system 100 are shown in Table 3 below and FIG. 19, and bioluminescence images measured at 2-week intervals are shown in FIG. 18.

(133) TABLE-US-00003 TABLE 3 Results of tumor volume measurement with vernier caliper during administration (1-week intervals) Untreated naked VBPEA/ VBPEA/ PEA/ PEI/ Period of group siSHMT siScr siSHMT siSHMT siSHMT administration (mm.sup.3) (mm.sup.3) (mm.sup.3) (mm.sup.3) (mm.sup.3) (mm.sup.3) Before 961.4 24.7 889.4 38.4 1000.5 31.8 1066.6 31.1 1138.4 40.5 1166.4 40.5 administration 1 week 2016.5 66.4 1608.2 69.5 1846.0 85.6 956.3 52.9 1241.9 93.9 1203.6 76.9 2 weeks 2740.8 49.2 2282.8 68.6 2794.8 20.7 802.1 79.0 1283.5 56.5 1405.9 56.1 3 weeks 3662.0 49.2 3187.1 60.9 3593.7 51.6 590.5 45.6 1488.4 64.9 1583.5 45.0 4 weeks 4428.9 66.6 4397.7 53.2 4763.0 173.2 471.5 25.0 1504.6 14.1 1884.9 77.1

(134) As can be seen in Table 3 above and FIGS. 18 and 19, only the group administered with the VBPEA/siSHMT complex showed a substantial decrease in the tumor volume, and the tumor volume in this group significantly decreased to 50% or less of the original tumor volume.

(135) In comparison with this, in the case in which siSHMT was delivered using the other gene carrier PEA or PEI, the rate of increase in the tumor volume significantly decreased, but the growth of the tumor was not inhibited, and in the case of the naked siSHMT-treated group administered with siSHMT alone without a gene carrier or the group treated with the VBPEA/siRNA (siScr) complex, the tumor volume increased to a level similar to that in the untreated group.

(136) In other words, the results of the experiment in the cancer-induced animal model showed that the in vivo anticancer gene therapy using VBPEA was more efficient than the case of use of other gene carriers. In addition, it was shown that the therapeutic effect of the use of VBPEA is not a defensive level corresponding to a decrease in the tumor growth rate, but is a positive level corresponding to the removal of tumors.

(137) Putting the above-described results together, it can be seen found that VBPEA has a significantly high gene delivery rate compared to existing gene carriers and that the complex of VBPEA with DNA has little or no cytotoxicity and shows a very high in vivo transfection efficiency. In addition, the complex of VBPEA with siRNA shows high gene silencing efficiency and can induce a high rate of cell death and the inhibition of cell proliferation in cancer cells and cancer-induced animal models, suggesting that it can be used for anticancer gene therapy.

(138) Although the preferred embodiments of the present invention have been described for illustrative purposes, those skilled in the art will appreciate that various modifications, additions and substitutions are possible, without departing from the scope and spirit of the invention as disclosed in the accompanying claims. Pandey et al., Biomaterials 34:3716-3728, 2013, is incorporated herein in its entirety for all purposes.