TREATMENT OF FACIOSCAPULOHUMERAL DYSTROPHY
20180016577 ยท 2018-01-18
Inventors
Cpc classification
A61K31/713
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
C12N2310/346
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The present invention relates to nucleic acids, compositions and methods for the treatment of facioscapulohumeral dystrophy.
Claims
1. A DUX4 nucleic acid decoy.
2. The DUX4 nucleic acid decoy according to claim 1, wherein said nucleic acid comprises one or more DUX4 binding sites.
3. The DUX4 nucleic acid decoy according to claim 1, comprising 1, 2, 3, 4, 5 or more than 5 DUX4 binding sites.
4. The DUX4 nucleic acid decoy according to claim 1, wherein the DUX4 binding site(s) is(are) of the sequence TAAYYBAATCA or TAAYBYAATCA respectively.
5. The DUX4 nucleic acid decoy according to claim 1, wherein the DUX4 binding site(s) is selected in the group consisting of TAACCCAATCA (SEQ ID NO:1), TAATTTAATCA (SEQ ID NO:2), TAATCCAATCA (SEQ ID NO:3) and TAATTGAATCA (SEQ ID NO:4).
6. The DUX4 nucleic acid decoy according to claim 1, which is an oligonucleotide.
7. The DUX4 nucleic acid decoy according to claim 6, wherein the oligonucleotide comprises or consists of the sequence shown in any one of SEQ ID NO:7 to 28, such as the sequence shown in any one of SEQ ID NO:7 to 22.
8. A vector comprising the DUX4 nucleic acid decoy according to claim 1, which is included in a vector, in particular a viral vector, more particularly a lentiviral vector.
9. The vector according to claim 8, which is a plasmid vector or a viral vector.
10. The vector according to claim 9, wherein the viral vector is a lentiviral vector or an AAV vector.
11. A pharmaceutical composition comprising the DUX4 nucleic acid decoy of.
12. A decoy according to claim 1, for use as a medicament.
13. A decoy according to claim 1, for use in a method for the treatment of FSHD.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0048]
[0049] The decoys are double strand DNA synthetized either as one single DNA strand (decoys 4-7) or as 2 oligonucleotides which are hybridized together (Decoys 1-3).
[0050] Chemical modifications are: * 2Omethyl modifications with phosphorothioate linkage. Underlined bases carry phosphorothioate linkage. The hexaethyleneglycol linkers are represented by gray brackets. Boxes indicate the minimal DUX4 binding sites. For decoy 3, mutated bases used to generate Decoy3-Mut are indicated by arrows.
[0051]
[0052] The injected decoy is represented. Arrows indicate the position of the mutated bases on upper strand introduced to create the Decoy-Mut. * representes 2Omethyl modifications with phosphorothioate linkage.
[0053] FSHD cells have been transfected in a dose dependent manner with either a DUX4-decoy (A) or mutated DUX4-decoy at day 2 of differentiation (B). 48 h post transfection, cells were harvested and total RNA extracted. RT was realized using a polydT oligonucleotides. A and B Expression levels of 3 genes downstream DUX4 was measured by qPCR. C: PCR allowing DUX4 mRNA detection was performed and run on an agarose gel (right). As expected, no modulation of DUX4 mRNA was observed since the decoy does not target mRNA. B2M was used as the reference gene.
[0054]
[0055] The injected decoy is represented. The bases underlined carry phosphorothioate linkage. FSHD cells have been transfected with 1 g of DNA. Four days after differentiation, cells were harvested and total RNA extracted. A: a RT-qPCR was performed to analyze the expression of 3 genes downstream DUX4 and 1 control gene (ZNF217). B: DUX4 expression was analyzed by PCR. B2M was used as the reference gene. The molecules are linear duplex DNAs with an interruption in the middle of one strand (arrow) The hexaethyleneglycol linkers are represented by gray brackets.
[0056]
[0057] FSHD cells were transduced by an empty lentiviral vector or carrying either (i) 5 times the sequence
TABLE-US-00010 (L1,SEQIDNO:21) TCGAGAATAACCCAATCAAATTAATTTAATCATAATCCAATCAAGATAAT TGAATCATGGTAATTGAATCAGGTAATTGAATCATGGTAATCCAATCAC
[0058] or (ii) the sequence
TABLE-US-00011 (L2,SEQIDNO:22) TCGAGTAATTTAATCAGCGTACGATAATCCCATGCGTAATCCAATCAGCG TACGATAATCCCATGCGTAATCCAATCAGCGTACGATAATCCCATGCGC.
[0059] Cells were harvested at day 3 and 4 after induction of differentiation. qPCR were performed to analyze expression of 3 genes downstream of DUX4. Expression of ZNF217 was used as a control. B2M was used as the reference gene.
[0060]
[0061] C57bL6 mice were electroporated with both a DUX4 expression plasmid (pSC2) and either the Decoy3 or Decoy3-Mut. Five days later, mice were sacrificed and expression levels of 3 murine genes downstream of DUX4 were analyzed. The reference gene was Psma2.
[0062]
[0063] The decoys are double strand DNA synthetized either as one single DNA strand (decoys 6-11, where double arrows indicate the position of the 5 and 3 ends of the oligonucleotide) or as 2 oligonucleotides which are hybridized together (Decoy 3). Chemical modifications are:
[0064] Italic: 2Omethyl modifications.
[0065] Underlined: bases carrying phosphorothioate linkage
[0066] The hexaethyleneglycol linkers are represented in decoys 6 and 9 as circles. Bold nucleotides indicate the minimal DUX4 binding sites.
[0067]
[0068] Tibialis anterior (TA) muscles were electrotransfered with pSC2 plasmid coding for DUX4. Expression levels of both DUX4 and Tm7sf4 were analyzed by pPCR. A multi parametric analysis of variance (MANOVA) and a Newman-Keuls post-hoc test was performed. A strong correlation between DUX4 and Tm7sf4 was observed (n=18 TA injected muscles; R.sup.2=0.8948; p=10e-8).
[0069]
[0070] Tibialis anterior muscles were first injected with either AAV D3 (n=8) or AAV GFP (n=8) (2,5 10e10 vg/TA). Two weeks later, TAs were electrotransfered with pCS2 plasmid. Expression levels of both DUX4 and Tm7sf4 were investigated by qPCR. *p<0.05 (T-test). All data represent mean-F standard deviation.
[0071]
[0072] TAs were electrotransfered with pCS2 alone (n=18) or pCS2+decoy (n=12 each). Expression levels of both DUX4 and Tm7sf4 were investigated by qPCR. All data represent mean+standard error of the mean.
[0073]
[0074] FSHD cells were transfected with different decoys. Cells were harvested at day 3 and 4 after induction of differentiation. qPCR were performed to analyze expression of 3 genes downstream of DUX4
EXAMPLES
[0075] Material and Methods
[0076] Decoy Preparation
[0077] The DNA sequences containing the putative DUX4 binding site (here after called decoy) were designed according to the DUX4-fl motif previously described (14). Four modified double strand oligonucleotides were synthetized:
TABLE-US-00012 Decoy-1 (forw:G*A*G*GTAATCCAATCATG*G*A; rev:U*C*C*ATGATTGGATTACC*U*C), Decoy-2 (Forw:U*G*CGTAATCCAATCAGCG*U. Rev:A*C*GCTGATTGGATTACGC*A), Decoy-3 (Forw:G*C*G*U*A*C*G*A*U*A*cctGTGGGAGGTAATCCAATCAT GGAGGCAGcctGTGGGAGGTAATCCAATCATGGAGGCAGA*A*U*C*C*C *A*U*G*C; Rev:G*C*A*U*G*G*G*A*U*U*CTGCCTCCATGATTGGATTACCTCC CACaggCTGCCTCCATGATTGGATTACCTCCCACaggU*A*U*C*G*U*A *C*G*C), and Decoy3-Mut (Forw:G*C*G*U*A*C*G*A*U*A*cctGTGGGAGGTACTCCTATGAT GGAGGCAGcctGTGGGAGGTACTCCTATGATGGAGGCAGA*A*U*C*C*C *A*U*G*C; Rev:G*C*A*U*G*G*G*A*U*U*CTGCCTCCATCATAGGAGTACCTCC CACaggCTGCCTCCATCATAGGAGTACCTCCCACaggU*A*U*C*G*U*A *C*G*C)
[0078] where * represents 2OMethyl ribonucleotides with phosphorotioate links.
[0079] The three linear duplex DNAs with one hexaethyleneglycol linker at both ends mimicking double strand DNA were synthetized:
TABLE-US-00013 Decoy-4 (TCCAATCATGGAGGCAG-CTGCCTCCATGATTGGATTACCTCCCAC-GT GGGAGGTAA); Decoy-5 (TACGCTGATTGGATTACGCATGGG--CCCATGCGTAATCCAATCAGCGT ACGAT--ATCG); Decoy-6 (CTGCCTCCATGATTGGATTACCTCCCACAGG-CCTGTGGGAGGTAATCC AATCATGGAGGCAGCCT--AGG).
[0080] where - represents the hexaethyleneglycol linker.
[0081] Two linear duplexes mimicking double strand DNA were synthetized:
TABLE-US-00014 Decoy7: A*A*ACTGCCTCCATGATTGGATTACCTCCCACAGGGTCTTTTGACCCTG TGGGAGGTAATCCAATCATGGAGGCAGTTTCCCTTTTG*G*G Decoy7-Mut: A*A*A*CTGCCTCCATCATAGGAGTACCTCCCACAGGGTCTTTTGACCCT GTGGGAGGTACTCCTATGATGGAGGCAGTTTCCCTTTTG*G*G
[0082] Further linear decoys mimicking double-stranded DNA were also synthesized and are represented in
[0083] Forward and reverse oligonucleotides for decoys 1, 2 and 3 were annealed at equimolar concentration in a final volume of 50 l and heated at 95 C. for 4 min. For decoys 4 to 11, a 1 g/l solution was heated at 95 C. during 4 min. The ligation was performed with the T4 ligase according to the manufacturer protocol (Biolabs).
[0084] For the lentiviral constructs, the oliqonucleotides for
TABLE-US-00015 DecoyL1 (Forw:TCGAGAATAACCCAATCAAATTAATTTAATCATAATCCAATCA AGATAATTGAATCATGGTAATTGAATCAGGTAATTGAATCATGGTAATCC AATCAC; Rev:TCGAGTGATTGGATTACCATGATTCAATTACCTGATTCAATTACC ATGATTCAATTATCTTGATTGGATTATGATTAAATTAATTTGATTGGGTT ATTC) and Decoy-L2 (Forw:TCGAGTAATTTAATCAGCGTACGATAATCCCATGCGTAATCCA ATCAGCGTACGATAATCCCATGCGTAATCCAATCAGCGTACGATAATCCC ATGCGC; Rev:TCGAGCGCATGGGATTATCGTACGCTGATTGGATTACGCATGGGA TTATCGTACGCTGATTGGATTACGCATGGGATTATCGTACGCTGATTAAA TTAC)
[0085] were annealed at equimolar concentration in a final volume of 50 l and heated at 95 C. for 4 min and then cloned into pBlue Script using the Xhol restriction site, thus allowing concatemer formation. This shuttle vector was then digested by Notl and Apal before to be cloned into pLL3.7 lentiviral vector digested by the same enzymes and previously modified to introduce a neomycine cassette by removing the GFP gene using the Nhel and EcoRI restriction sites.
[0086] Transfection and Transduction
[0087] The cells used for the transfection are immortalized FSHD cells isolated from a mosaic patients and previously described (15). The clones were cultivated in proliferation medium [4 vols of DMEM, 1 vol of 199 medium, FBS 20%, gentamycin 50 mg/ml (Life technologies, Saint Aubin, France)] supplemented with insulin 5 mg/ml dexamethasone 0.2 mg/ml, b-FGF 0.5 ng/ml, hEGF 5 ng/ml and fetuine 25 mg/ml. Differentiation medium was composed of DMEM supplemented with insulin (10 mg/ml). Myoblasts were plated at 25000 cell/cm.sup.2. Two days later, the proliferation medium was replaced by differentiation medium. The transfection was realized at day 2 of differentiation using lipofectamine RNAIMAX reagent according to the manufacturer protocol (Invitrogen) with a ratio of 1:5 between DNA and RNAIMAX. Cells were harvested 4 days after triggering differentiation.
[0088] The pLL3.7-Decoy vectors (L1 and L2) were produced in human embryonic kidney 293 cells by quadri-transfection of plasmids encoding gag-pol proteins, Rev protein, envelop proteins (VSVg) and the transgene using PEI. 48 and 72 h later; the viral vector is filtered (0.22 mm) before being directly used to transduce myoblasts. Transduced cells were selected during 15 days using G418 (0.5 g/l final concentration). The transduced cells were primary FSHD cells isolated from either a fetal quadriceps (16 weeks of development carrying 4 D4Z4 repeats) or and adult trapezius (25 years old carrying 4.4 D4Z4 repeats). Cells were then plated at 25000 cell/cm.sup.2 and 2 days later, proliferation medium was replaced by differentiation medium. Cells were harvested at day 4 of differentiation.
[0089] In Vivo Experiments
[0090] Tibialis anterior (TA) of 6- to 8-week-old female C57BI6 mice were electrotransferred (Mode: LV; voltage: 200V/cm; P. length: 20 msec; Pulses: 8; Interval: 500 ms; Polarity: unipolar) with 2 g of pCS2-mkgDUX4 expression plasmid (Addgene #21156) and 10 g of either Decoy-3 or Decoy-3-Mut in a final volume of 40 l. Five days after electrotransfer, mice were sacrificed and TA muscles were frozen in liquid nitrogen. RNAs were extracted using the FastPrep kit (MP biomedicals) according to manufacturer instructions.
[0091] RNA Extraction and PCR
[0092] Trizol was directly added on either cells or mouse muscles and RNA extraction was performed according to the manufacturer protocol (Life technologies, Saint Aubin,
[0093] France). RNA concentration was determined using a nanodropND-1000 spectrophotometer (Thermo Scientific, Wilmington, USA). The RT was carried out on 1 g of total RNA with Roche Transcriptor First Strand cDNA Synthesis Kit (Roche, Meylan, France) at 50 C. for 60min with 1 l of oligo dT in a final volume of 10 l. Quantitative PCRs were performed in a final volume of 9 ml with 0.4 l of RT product, 0.18 l of each forward and reverse primers 20 pmol/l (Table 1), and 4.5 l of SYBR Green mastermix 2 (Roche, Meylan, France). The qPCR was run in triplicates on a LightCycler 480 Real-Time PCR System (Roche, Meylan, France). The qPCR cycling conditions were 94 C. for 5 min, followed by 50 cycles at 95 C. for 30 s and 60 C. for 15 s and 72 C. for 15 s. The PCR for DUX4 were performed as previously described (16). B2M was used a normalized.
[0094] AAV Transduction Experiments:
[0095] For the AAV constructs (pAAV-decoy), the oligonucleotides Forward (CCTGTGGGAGGTAATCCAATCATGGAGGCAGCCTGTGGGAGGTAATCCAATCA TGGAGGCAG) and reverse (CTGCCTCCATGATTGGATTACCTCCCACAGGCTGCCTCCATGATTGGATTACCT CCCACAGG) were annealed at equimolar concentration in a final volume of 20 l and heated at 95 C. for 4 min and then cloned into pGG2 plasmid which was previously digested by Xbal and Hpal restriction enzymes (blunted using klenow). AAV vectors were produced in human embryonic kidney 293 cells by triple-transfection method using the calcium phosphate precipitation technique with the pAAV-decoy plasmid, the pXX6 plasmid coding for the adenoviral sequences essential for AAV production, and the pRepCAp plasmid coding for AAV-1 capsid. The virus is then purified by one cycle of iodixanol gradient and washed and concentrated using Amicon Ultra column. The final viral preparations were kept in PBS solution at 80 C. The particle titer (number of viral genomes) was determined by quantitative PCR. The injections of TA were performed on 6-8 week-old female C57BI6 mice with 2.5.10.sup.e10 AAV viral genomes.
[0096] Results
[0097] In Vitro Experiments-Use of Oligonucleotide Decoys
[0098] In order to select the most efficient trap for DUX4, several decoys were designed according to the DUX4-fl motif previously described (14). In this article, the authors have identified 2 motifs, TAAYYBAATCA and TAAYBYAATCA (according to DNA IUB Code), respectively corresponding to MaLR-associated sites and sites not associated with repeats, leading to 18 possible sequences. We selected 1 of them: TAATCCAATCA to design our decoys. we designed several decoys (
[0099] DUX4 expression level was next examined in the transfected cells. Since the decoys trap DUX4, no variation in DUX4 mRNA was expected. As shown in
[0100] In Vitro Experiments-Use of Viral Vectors
[0101] One decoy was also vectorized and decoy-L1 and L2 were introduced into the FSHD myoblasts using a lentiviral vector. The presence of either decoys L1 or L2 in these cells induced a downexpression of the genes downstream of DUX4 (TRIM43, MBD3L2, DEFB103 and ZSCAN4) but no down-regulation of ZNF217 was observed (as expected, ZNF217 is not one of the DUX4 footprint genes). This experiment was performed 3 times (
[0102] In Vivo Experiments
[0103] The capability of decoy-3 to trap DUX4 was also investigated in vivo. We co-transfected a DUX4 expression plasmid and the Decoy-3 or Decoy-3-Mut in the tibialis anterior (TA) of 6- to 8-week-old female C57BI6 mice. As shown in
[0104] In Vivo Experiments-Further Validation of the Approach
[0105] In vivo experiments were further conducted (
[0106] First, the correlation between DUX4 expression and a DUX4 target gene (mTm7sf4) was verified in mouse TA muscles, after electrotransfert of the pSC2 plasmid coding for DUX4.
[0107] Then, AAV vectors carrying in their genome two DUX4 binding sites as represented in
[0108] The decoy oligonucleotides were also directly electrotransfered into the TA muscles of mice in the presence of a DUX4-coding plasmid (
[0109]
[0110] Altogether, these data show that DUX4 decoys are powerful tools for achieving DUX4 target genes repression. Therefore, these decoys, whether administered as oligonucleotides or as part of a viral genome, represent invaluable tools for the treatment of FSHD.
REFERENCES
[0111] 1. van der Maarel, S. M., Miller, D. G., Tawil, R., Filippova, G. N. and Tapscott, S. J. (2012) Facioscapulohumeral muscular dystrophy: consequences of chromatin relaxation. Curr Opin Neurol, 25, 614-620.
[0112] 2. van Deutekom, J. C., Wijmenga, C., van Tienhoven, E. A., Gruter, A. M., Hewitt, J. E., Padberg, G. W., van Ommen, G. J., Hofker, M. H. and Frants, R. R. (1993) FSHD associated DNA rearrangements are due to deletions of integral copies of a 3.2 kb tandemly repeated unit. Human molecular genetics, 2, 2037-2042.
[0113] 3. Lunt, P. W., Noades, J. G., Upadhyaya, M., Sarfarazi, M. and Harper, P. S. (1988) Evidence against location of the gene for facioscapulohumeral muscular dystrophy on the distal long arm of chromosome 14. J Neurol Sci, 88, 287-292.
[0114] 4. Lemmers, R. J., Tawil, R., Petek, L. M., Balog, J., Block, G. J., Santen, G. W., Amell, A. M., van der Vliet, P. J., Almomani, R., Straasheijm, K. R. et al. (2012) Digenic inheritance of an SMCHD1 mutation and an FSHD-permissive D4Z4 allele causes facioscapulohumeral muscular dystrophy type 2. Nature genetics, 44, 1370-1374.
[0115] 5. Lemmers, R. J., van der Vliet, P. J., Klooster, R., Sacconi, S., Camano, P., Dauwerse, J. G., Snider, L., Straasheijm, K. R., van Ommen, G. J., Padberg, G. W. et al. (2010) A unifying genetic model for facioscapulohumeral muscular dystrophy. Science, 329, 1650-1653.
[0116] 6. Lemmers, R. J., van der Vliet, P. J., van der Gaag, K. J., Zuniga, S., Frants, R. R., de Knijff, P. and van der Maarel, S. M. (2010) Worldwide population analysis of the 4q and 10q subtelomeres identifies only four discrete interchromosomal sequence transfers in human evolution. Am J Hum Genet, 86, 364-377.
[0117] 7. Lemmers, R. J., Wohlgemuth, M., van der Gaag, K. J., van der Vliet, P. J., van Teijlingen, C. M., de Knijff, P., Padberg, G. W., Frants, R. R. and van der Maarel, S. M. (2007) Specific sequence variations within the 4q35 region are associated with facioscapulohumeral muscular dystrophy. Am J Hum Genet, 81, 884-894.
[0118] 8. Scionti, I., Greco, F., Ricci, G., Govi, M., Arashiro, P., Vercelli, L., Berardinelli, A., Angelini, C., Antonini, G., Cao, M. et al. (2012) Large-scale population analysis challenges the current criteria for the molecular diagnosis of fascioscapulohumeral muscular dystrophy. Am J Hum Genet, 90, 628-635.
[0119] 9. Thomas, N. S., Wiseman, K., Spurlock, G., MacDonald, M., Ustek, D. and Upadhyaya, M. (2007) A large patient study confirming that facioscapulohumeral muscular dystrophy (FSHD) disease expression is almost exclusively associated with an FSHD locus located on a 4qA-defined 4qter subtelomere. J Med Genet, 44, 215-218.
[0120] 10. Gabriels, J., Beckers, M. C., Ding, H., De Vriese, A., Plaisance, S., van der Maarel, S. M., Padberg, G. W., Frants, R. R., Hewitt, J. E., Collen, D. et al. (1999) Nucleotide sequence of the partially deleted D4Z4 locus in a patient with FSHD identifies a putative gene within each 3.3 kb element. Gene, 236, 25-32.
[0121] 11. Dixit, M., Ansseau, E., Tassin, A., Winokur, S., Shi, R., Qian, H., Sauvage, S., Matteotti, C., van Acker, A. M., Leo, O. et al. (2007) DUX4, a candidate gene of facioscapulohumeral muscular dystrophy, encodes a transcriptional activator of PITX1. Proc Natl Acad Sci USA, 104, 18157-18162.
[0122] 12. Yao, Z., Snider, L., Balog, J., Lemmers, R. J., Van Der Maarel, S. M., Tawil, R. and Tapscott, S. J. (2014) DUX4-induced gene expression is the major molecular signature in FSHD skeletal muscle. Human molecular genetics.
[0123] 13. Ferreboeuf, M., Mariot, V., Furling, D., Butler-Browne, G., Mouly, V. and Dumonceaux, J. (2014) Nuclear protein spreading: implication for pathophysiology of neuromuscular diseases. Human molecular genetics.
[0124] 14. Geng, L. N., Yao, Z., Snider, L., Fong, A. P., Cech, J. N., Young, J. M., van der Maarel, S. M., Ruzzo, W. L., Gentleman, R. C., Tawil, R. et al. (2012) DUX4 Activates Germline Genes, Retroelements, and Immune Mediators: Implications for Facioscapulohumeral Dystrophy. Dev Cell, 22, 38-51.
[0125] 15. Krom, Y. D., Dumonceaux, J., Mamchaoui, K., den Hamer, B., Mariot, V., Negroni, E., Geng, L. N., Martin, N., Tawil, R., Tapscott, S. J. et al. (2012) Generation of isogenic D4Z4 contracted and noncontracted immortal muscle cell clones from a mosaic patient: a cellular model for FSHD. The American journal of pathology, 181, 1387-1401.
[0126] 16. Ferreboeuf, M., Mariot, V., Bessieres, B., Vasiljevic, A., Attie-Bitach, T., Collardeau, S., Morere, J., Roche, S., Magdinier, F., Robin-Ducellier, J. et al. (2014) DUX4 and DUX4 downstream target genes are expressed in fetal FSHD muscles. Human molecular genetics, 23, 171-181.