MOLECULAR BREEDING METHOD FOR WHEAT FUSARIUM HEAD BLIGHT-RESISTANCE
20220346335 · 2022-11-03
Inventors
- JIANJUN LIU (JINAN CITY, CN)
- WENJING HU (YANGZHOU CITY, CN)
- HAOSHENG LI (JINAN CITY, CN)
- XUEYAN CHEN (HANZHONG CITY, CN)
- SHENGNAN ZHAI (JINAN CITY, CN)
- XINYOU CAO (JINAN CITY, CN)
- JIANMIN SONG (JINAN CITY, CN)
- JUN GUO (LINQU COUNTY, CN)
- CHENG LIU (CHENGDU, CN)
- AIFENG LIU (JINAN CITY, CN)
- DUNGONG CHENG (JINAN CITY, CN)
- XIUSHENG CHU (JINAN CITY, CN)
- FAJI LI (JINAN CITY, CN)
- RAN HAN (XIANYANG CITY, CN)
- YAN ZI (JINAN CITY, CN)
- XIAOLU WANG (JINAN CITY, CN)
Cpc classification
International classification
Abstract
Disclosed is a molecular marker polymerization wheat breeding method for Fusarium head blight-resistance. The method uses an intermediate material for Fusarium head blight-resistance as a resistance source, and excellent varieties (strains) in a northern part of Huanghuai wheat production area as agronomic parents, and uses molecular marker-assisted selection and conventional breeding techniques. The molecular markers are a linked marker LJJT-1 of a Fusarium head blight-resistant gene Fhb1 and linked markers LJJ-2 and LJJ-3 of a Fusarium head blight-resistant gene Fhb2, so as to create a semi-winter Fusarium head blight-resistant breeding material with outstanding target traits and excellent comprehensive traits, which lays a material foundation for cultivating Fusarium head blight-resistant wheat varieties suitable for planting in the Huanghuai wheat production area.
Claims
1-5. (canceled)
6. A molecular marker-assisted breeding method for wheat Fusarium head blight (FHB)-resistance, and the method comprising: S1: crossing a first wheat plant comprising a plurality of FHB-resistance genes with a second wheat plant with an average yield of more than 500 kilograms per 666.7 m.sup.2 to obtain a first-generation hybrid seed; wherein the plurality of FHB-resistance genes comprises: a FHB-resistance gene Fhb1 and a FHB-resistance gene Fhb2; S2: crossing the first-generation hybrid seed with a third wheat plant comprising a powdery mildew resistance gene to obtain a F.sub.1 generation; S3: propagating the F.sub.1 generation, and harvesting in a mixed way and threshing to obtain a F.sub.2 generation; S4: propagating the F.sub.2 generation, and selecting first individual plants with cold tolerance, powdery mildew resistance, and plant height, plant type, ear shape and grain color meeting target requirements; detecting and screening second individual plants being positive in a marker LJJ-1 of the FHB-resistance gene Fhb1 and markers LJJ-2 and LJJ-3 of the FHB-resistance gene Fhb2 in molecular marker detection from the first individual plants, and harvesting and threshing the second individual plants to obtain a F.sub.3 generation; S5: propagating the F.sub.3 generation in a field in a manner of same strains in a line, selecting first strains with same traits and phenotypes as a target wheat plant and with powdery mildew resistance, detecting and screening second strains being positive in the marker LJJ-1 of the FHB-resistance gene Fhb1 and the markers LJJ-2 and LJJ-3 of the FHB-resistance gene Fhb2 in molecular marker detection from the first strains, and mixing and threshing 3-5 homozygous-individual plants of each of the second strains to obtain a F.sub.4 generation, measuring grain yields of the F.sub.4 generation and selecting initial target strains with highest grain yield from the F.sub.4 generation; S6: propagating the initial target strains of the F.sub.4 generation in a field in a manner of same strains in a line, selecting third strains with same traits and phenotypes as the target wheat plant and with powdery mildew resistance, detecting and screening fourth strains being positive in the marker LJJ-1 of the FHB-resistance gene Fhb1 and the markers LJJ-2 and LJJ-3 of the FHB-resistance gene Fhb2 in molecular marker detection from the third strains, and mixing and threshing 3-5 homozygous-individual plants of each of the fourth strains to obtain a F.sub.5 generation, and measuring yields of the F.sub.5 generation and selecting top three strains with highest yield from the F.sub.5 generation; S7: performing inoculation on the top three strains of the F.sub.5 generation by using a single flower dripping method to obtain strains after the inoculation, and each of the top three strains being inoculated with 30 ears; measuring FHB resistance of the strains after the inoculation to obtain target strains with better FHB resistance than a target control group; wherein an average yield of each of the target strains is more than 500 kilograms (kg) per 666.7 m.sup.2; wherein primer sequences of the marker LJJ-1 of the FHB-resistance gene Fhb1 are shown in SEQ ID NO: 1 and SEQ ID NO: 2; primer sequences of the marker LJJ-2 of the FHB-resistance gene Fhb2 are shown in SEQ ID NO: 3 and SEQ ID NO: 4; and primer sequences of the marker LJJ-3 of the FHB-resistance gene Fhb2 are shown in SEQ ID NO: 5 and SEQ ID NO: 6.
7. A molecular marker-assisted breeding method for wheat Fusarium head blight (FHB)-resistance, and the method comprising: S1: crossing a NMAS020 wheat plant comprising a plurality of FHB-resistance genes with a Jimai 22 wheat plant with an average yield of more than 500 kilograms per 666.7 m.sup.2 to obtain a first-generation hybrid seed; wherein the plurality of FHB-resistance genes comprises: a FHB-resistance gene Fhb1 being detectable by a marker LJJ-1 and a FHB-resistance gene Fhb2 being detectable by markers LJJ-2 and LJJ-3; S2: crossing the first-generation hybrid seed with a Shi H083-366 wheat plant comprising a powdery mildew resistance gene Pm21 to obtain a F.sub.1 generation; S3: propagating the F.sub.1 generation, and harvesting in a mixed way and threshing to obtain a F.sub.2 generation; S4: propagating the F.sub.2 generation, selecting first individual plants with cold tolerance, powdery mildew resistance, and plant height, plant type, ear shape and grain color meeting target requirements, detecting and screening second individual plants being positive in the marker LJJ-1 of the FHB-resistance gene Fhb1 and the markers LJJ-2 and LJJ-3 of the FHB-resistance gene Fhb2 in molecular marker detection from the first individual plants, and harvesting and threshing the second individual plants to obtain a F.sub.3 generation; S5: propagating the F.sub.3 generation, selecting first strains with same traits and phenotypes as Jimai 22 and with powdery mildew resistance, detecting and screening second strains being positive in the marker LJJ-1 of the FHB-resistance gene Fhb1 and the markers LJJ-2 and LJJ-3 of the FHB-resistance gene Fhb2 in molecular marker detection from the first strains, and mixing and threshing 3-5 homozygous-individual plants of each of the second strains to obtain a F.sub.4 generation, measuring grain yields of the F.sub.4 generation and selecting initial target strains with highest grain yield from the F.sub.4 generation; S6: propagating the initial target strains, selecting third strains with same traits and phenotypes as the Jimai 22 and with powdery mildew resistance, detecting and screening fourth strains being positive in the marker LJJ-1 of the FHB-resistance gene Fhb1 and the markers LJJ-2 and LJJ-3 of the FHB-resistance gene Fhb2 in molecular marker detection from the third strains, and mixing and threshing 3-5 homozygous-individual plants of each of the fourth strains to obtain a F.sub.5 generation, and measuring yields of the F.sub.5 generation and selecting top three strains with highest yield from the F.sub.5 generation; S7: performing inoculation on the top three strains of the F.sub.5 generation by using a single flower dripping method to obtain strains after the inoculation; measuring FHB resistance of the strains after the inoculation to obtain target strains with better FHB resistance than Zheng 9023; wherein an average yield of each of the target strains is more than 500 kilograms (kg) per 666.7 m.sup.2; wherein primer sequences of the linked marker LJJ-1 of the FHB-resistance gene Fhb1 are shown in SEQ ID NO: 1 and SEQ ID NO: 2; primer sequences of the linked marker LJJ-2 of the FHB-resistance gene Fhb2 are shown in SEQ ID NO: 3 and SEQ ID NO: 4; and primer sequences of the linked marker LJJ-3 of the FHB-resistance gene Fhb2 are shown in SEQ ID NO: 5 and SEQ ID NO: 6.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0030] In order to more clearly illustrate the specific embodiments of the application or the technical solutions in the prior art, the following briefly introduces the accompanying drawings required in the description of the specific embodiments.
[0031]
DETAILED DESCRIPTION OF THE EMBODIMENTS
[0032] Embodiments of the technical scheme of the application will be described in detail below with reference to the accompanying drawings. The following examples are only used to more clearly illustrate the technical schemes of the application, and are therefore only used as examples, and cannot be used to limit the protection scope of the application. It should be noted that, unless otherwise specified, the technical terms or scientific terms used in this application should be the usual meanings understood by those skilled in the art to which the application belongs.
Embodiment 1 Construction of Breeding Population of FHB Resistance and Breeding Method of Hybrid Variety
[0033] Hybrid F.sub.1 is obtained by crossing with NMAS020 as the female parent and Jimai 22 as the male parent. Hybrid F.sub.1 is used as the female parent, and Shi H083-366 containing the powdery mildew-resistant gene Pm21 is used as the male parent for multiple crossing. The main purpose of multiple crossing is to improve the powdery mildew resistance of hybrid variety. After multiple crossing, the pedigree method is used for selecting and breeding according to cold tolerance, plant height, plant type, ear traits, grain color and powdery mildew resistance. Molecular markers are used to track and detect FHB-resistant genes in individual plants and strains. For 53 strains with basically stable traits and excellent comprehensive traits, the single flower dripping method is used to identify FHB resistance, and Jimai 22 is the susceptible control.
[0034] The marker-specific primer sequences closely linked to FHB-resistant gene Fhb1, Fhb2 are shown in Table 1.
TABLE-US-00001 TABLE 1 Fhb1 and Fhb2 linked marker primer sequence information Annealing Linked Primer temperature Gene marker sequence (5′-3′) Serial number (°C.) Fhb1 LJJ-1-F ATTCCTACTAGCCGCCTGGT SEQ ID NO: 1 64 LJJ-l-R ACTGGGGCAAGCAAACATTG SEQ ID NO: 2 Fhb2 LJJ-2-F GGAGATTGACCGAGTGGAT SEQ ID NO: 3 60 LJJ-2-R CGTGAGAGCGGTTCTTTG SEQ ID NO: 4 LJJ-3-F ATGCCTGCTTGCTCACTG SEQ ID NO: 5 61 LJJ-3-R TCCTATGCGTTCGGTTGG SEQ ID NO: 6
[0035] To detect the corresponding linked marker LJJ-1 of the main gene Fhb1 for FHB-resistance, the PCR amplification is as follows: the PCR amplification system is 10 μL, including 1.0 μL of 30 ng/uL wheat genome DNA, 1.0 μL of 10×PCR buffer, 0.2 uL of 10 Mm dNTP, 1.0 μL of 10 Mm MgCl.sub.2, 0.2 uL of 5U Taq polymerase, 0.4 uL of 5 uM upstream primer, 0.4 uL of 5 uM downstream primer and 5.8 uL of sterile deionized water; the PCR amplification procedure is as follows: pre-denaturation for 5 min at 94° C.; denaturation for 30 s at 94° C., annealing for 30 s at 64° C., extension for 45 s at 72° C., 35 cycles; extension for 10 min at 72° C.; preservation at 4° C. LJJ-1 primers are used to detect the materials involved in this study together with their parents in 1% agarose electrophoresis solution. The target genotype is the same with NMAS020, which is the selected material.
[0036] The corresponding linked markers LJ2 and LJJ-3 of the main gene Fhb2 for FHB-resistance are detected by PCR amplification. The PCR amplification is as follows: the PCR amplification system is 10 μL, including 1.0 μL of 30 ng/uL wheat genome DNA, 1.0 μL of 10×PCR buffer, 0.2 uL of 10 Mm dNTP, 1.0 μL of 10 Mm MgCl.sub.2, 0.2 uL of 5U Taq polymerase, 0.4 uL of 5 uM upstream primer, 0.4 uL of 5 uM downstream primer and 5.8 uL of sterile deionized water; the PCR amplification procedure is as follows: (1) pre-denaturation for 8 min at 94° C., (2) denaturation for 30 s at 94° C., (3) LJJ-2 primer annealed at 60° C. for 40 s; LJJ-3 primer annealed at 61° C. for 40 s, (4) extension for 30 s at 72° C., 36 cycles, (5) extension for 10 min at 72° C.; (6) preservation at 4° C. Electrophoresis with LJJ-2 and LJJ-3 primers in 8% non-denatured polyacrylamide gel electrophoresis solution is carried out, arc: bis=19:1, 200 volts electrophoresis for 1 hour 40 min-2 h 30 min, and detect the materials involved in this research together with the parents. The target genotype, which is the same as NMAS020, is regarded as positive and the selected material.
[0037] Tightly linked marker-specific primers and amplification of Fhb4 and Fhb5 refer to the article (Xue S L, LiG Q, Jia H Y, et al. Fine mapping Fhb4, a major QTL conditioning resistance to Fusarium infection in bread wheat (Triticum aestivum L.) [J]. Theoretical & Applied Genetics, 2010, 121 (1):147-156. Xue S L, Xu F, Tang M Z, et al. Predise mapping Fhb5, a major QTL conditioning resistance to Fusarium infection in bread wheat (Triticum aestivum L.) [J]. Theoretical & Applied Genetics, 2011, 123 (6):1055-1063.).
[0038] Fifty-three strains and the control Jimai 22 are planted in 15 fields of the Crop Institute of Shandong Academy of Agricultural Sciences, arranged in sequence, and one identification is repeated in a plot of six rows with plot length of 4 m and width of 1.5 m, mechanical sowing in drill and 150,000 basic seedlings/666.7 m.sup.2. For the investigation of agronomic traits such as seedling habit, plant type, grain type and plant height, refer to the Technical Specification for Regional Tests of Crop Varieties—Wheat (NY/T 1301-2007).
[0039] The culture for the identification of Fusarium head blight is F.g (Fusarium graminearum) 15-A DON type, by Jiangsu Academy of Agricultural Sciences Institute of Food Quality Safety and Testing, which was donated by the Institute of Food Quality, Safety and Testing, Jiangsu Academy of Agricultural Sciences, and was propagated and provided by Chu Xiusheng, Institute of Crops, Shandong Academy of Agricultural Sciences, and was identified by artificial inoculation by single-flower drip method; using a micropipette to take 20 μL of meristem suspension and injecting it into the florets just bloomed on the middle spikelet of the wheat ear; inoculating 5 ears of each variety, inoculating the wheat ear with a fresh-keeping bag for 3 days, and investigating the number of diseased spikelets and the total number of spikelets of each inoculated ear 21 days after inoculation, and calculating the average number of diseased spikelets and the average diseased spikelet rate (%) as the evaluation index of Fusarium head blight-resistant. Breeding practice shows that although the FHB-resistant materials such as Sumai NO. 3 and Wangshuibai and their derived strains have good FHB-resistance, their agronomic traits, resistance to other diseases and high yield are not satisfactory. The gene linkage relationship often leads to the loss of the target gene for FHB-resistance during comprehensive trait selection. The multiple crossing breeding population for FHB-resistant of the present application finally retains 53 strains after continuous multi-generation field selection of excellent individual plants and strains for agronomic traits. According to molecular marker detection of FHB-resistance, 33 out of 56 strains contained 1-3 disease-resistant genes, accounting for 62.3%; there are 20 genes without any loci, accounting for 37.7% (Table 2). Although each generation of hybrids has been tested for molecular markers, and 15 gene combination types (including 4 gene combination types, Fhb1+Fhb2+Fhb4+Fhb5) appeared in the early generation, it may be due to the selection of comprehensive agronomic traits in the field, and only 7 types of gene combinations appeared.
TABLE-US-00002 TABLE 2 Number of strains with different genes and combinations Average Average diseased number of spikelet Number of diseased rate Amplitude of Gene strains spikelets (%) variation None 20 16.0 85.2 41.9-100.0 Fhh1 3 9.6 49.0 14.0-91.2 Fhb2 2 14.4 83.5 67.0-100.0 Fhh4 8 9.9 54.8 34.9-91.8 Fhb5 1 15.2 75.8 — Fhbl + Fhb2 3 2.1 10.2 5.1-16.5 Fhbl + Fhb4 5 6.2 33.8 12.0-100.0 Fhb1 + Fhb2 + 11 1.6 9.9 4.8-26.2 Fhb5
[0040] In general, the average number of diseased spikelets and the average diseased spikelet rate with different numbers of FHB-resistant genes are significantly different. The average number of diseased spikelets and the average rate of diseased spikelets with three FHB-resistant genes are significantly lower than those with two FHB-resistant genes, those with two FHB-resistant genes are significantly lower than those with one FHB-resistant gene, and those with one FHB-resistant gene are significantly lower than the strain without any FHB-resistant genes and control variety Jimai 22 (Table 3). According to the grading standard and evaluation standard for the severity of FHB (agricultural industry standard), the variety containing 1 disease-resistant main gene can reach the level of moderate susceptibility, the variety containing 2 genes can reach the level of moderate resistance and above, and the variety containing 3 disease-resistant genes can reach the level of high resistance. Varieties (strains) without any main gene (including the control Jimai 22) show high susceptibility to FHB. Therefore, the combination of FHB-resistant genes (Fhb1+Fhb2) is selected as the molecular selection marker in FHB-resistant breeding.
TABLE-US-00003 TABLE 3 Average performance of FHB in strains with different numbers of disease-resistant genes Average diseased Number of disease- Average number of spikelet rate resistant genes diseased spikelets (%) 0 16.0 85.2 1 12.3 65.8 2 5.8 32.0 3 1.6 9.9 Control (Jimai 22) 15.3 84.4
Embodiment 2
[0041] S1: in April of the first year, using the intermediate material NMA S020 carrying multiple FHB-resistant genes as the female parent, and the large-area popularized variety Jimai 22 with an average yield of more than 500 kg/666.7 m.sup.2 as the male parent in the greenhouse to hybridize into hybrid F.sub.1 and obtain hybrid F.sub.1 seeds;
[0042] S2: in April of the second year, continuously using hybrid F.sub.1 as the female parent in the greenhouse, and the intermediate material Shi H083-366 with excellent agronomic properties containing powdery mildew-resistant gene Pm21 as the male parent to hybridize into F.sub.1 generation in the greenhouse, and harvesting the seeds.
[0043] S3: in April of the third year, continuously propagating F.sub.1 generation in the greenhouse, mixing, harvesting and threshing to produce F.sub.2 generation.
[0044] S4: in October of the fourth year, performing propagation of F.sub.2 generation in the field, selecting individual plants with excellent comprehensive agronomic traits mainly according to cold tolerance, plant height, plant type, ear traits, grain color and powdery mildew-resistance, etc., detecting and screening individual plants, selecting individual plants which are positive in molecular marker detection, and harvesting and threshing the selected single plants to produce F.sub.3 generation;
[0045] Wherein the marker-specific primer sequences closely linked to the FHB-resistant gene Fhb1, Fhb2 are shown in Table 3.
[0046] S5: in October of the fifth year, propagating F.sub.3 generation in the field in a manner of same strains in a line, and setting the reference variety Jimai 22 in the Huanghuai wheat production area as the reference for agronomic traits; selecting strains with consistent traits and phenotypes and with good comprehensive disease-resistant and agronomic traits, detecting and screening individual plants with the linked marker LJJT-1 of the FHB-resistant gene Fhb1 and the linked markers LJJ-2 and LJJ-3 of Fhb2 according to the aforementioned amplification steps, selecting individual plants that are positive in molecular marker detection, and harvesting the 3-5 homozygous individual plants of each of the selected strains, mixing and threshing to produce F.sub.4 generation, measuring the grain yield, and screening the strains with high yields.
[0047] S6: propagating the selected F.sub.4 strain in the field in three rows in October of the sixth year, and setting the Huanghuai wheat production area control variety Jimai 22 as a reference for agronomic traits; selecting strains with consistent traits and phenotypes and with good comprehensive disease-resistant and agronomic traits; detecting and screening individual plants with the linked marker LJJT-1 of the FHB-resistant gene Fhb1 and the linked markers LJJ-2 and LJJ-3 of Fhb2 according to the aforementioned amplification steps, selecting individual plants that are positive in molecular marker detection, harvesting, mixing and threshing the 3-5 homozygous individual plants of each of the selected strains to produce F.sub.5 generation, measuring the spot yield, and screening 3 strains with the highest yield.
[0048] S7: in October of the seventh year, planting the selected F.sub.5 strains in the Datiancheng evaluation nursery according to the plot, setting the reference variety Jimai 22 in the Huanghuai wheat production area as the reference for agronomic traits, identifying the yield and quality comprehensively, and repeating once in a plot of six rows with plot length of 4 m and width of 1.5 m, mechanical sowing in drill and 150,000 basic seedlings/666.7 m.sup.2; For the investigation of agronomic traits such as seedling habit, plant type, grain type and plant height, referring to the Technical Specification for Regional Tests of Crop Varieties—Wheat (NY/T 1301-2007). Inoculating selected strains by single-flower drip method. Inoculating each strain with 30 ears to identify the resistance of FHB. Jimai 22 is the susceptible control, Sumai NO. 3 is disease-resistant control, and Zheng 9023 is the medium resistance control; obtaining the strains Jimai 8681 and Jimai 8775 (Table 1,
[0049] The culture for identifying FHB is F.g (Fusarium graminearum) 15-A DON type, which was donated by the Institute of Food Quality, Safety and Testing, Jiangsu Academy of Agricultural Sciences, and was propagated and provided by Chu Xiusheng, Institute of Crops, Shandong Academy of Agricultural Sciences, and was identified by artificial inoculation with the single-flower drip method; a micropipette is used to take 20 μL of meristem suspension and inject it into the florets just blooming on the middle spikelet of the wheat ear; inoculating 5 ears of each variety, inoculating the wheat ear with a fresh-keeping bag for 3 days, and investigating the number of diseased spikelets and the total number of spikelets of each inoculated ear 21 days after inoculation, and calculating the average number of diseased spikelets and the average diseased spikelet rate (%) as the evaluation index of FHB-resistance (Xue S L, Xu F, Tang M Z, et al. Predise mapping Fhb5, a major QTL conditioning resistance to Fusarium infection in bread wheat (Triticum aestivum L.) [J]. Theoretical&Applied Genetics, 2011, 123 (6):1055-1063).
TABLE-US-00004 TABLE 4 Detection results of FHB resistance of Jimai 8681 and Jimai 8775 Average Average number of diseased diseased spikelet Name of variety F Fhb spikelets rate Jimai 8681 + + 2.2 10.5 Jimai 8775 + + 2.0 9.5 Jimai 22 (susceptible control) − − 12.5 67.9 Zheng 9023 (medium resistance control) − − 5.2 25.8 Sumai No. 3 (disease-resistant control) + + 1.0 5.0
[0050] Jimai 8681 has better comprehensive agronomic traits (
[0051] Jimai 8775 has better comprehensive agronomic traits (
TABLE-US-00005 TABLE 5 Comprehensive agronomic traits of Jimai 8681 and Jimai 8775 height/ Type, cold Thousand-grain Fusarium Variety Growing period cm tolerance weight/g head blight Yield Jimai Compared with the control Jimai 22, the 78 Compact, 45 Medium 530.1 kg/666.7 m.sup.2, 8681 heading stage is about 5 days earlier, and good cold resistance an increase of 3.29% the maturity stage is 3 days earlier, and resistance compared with the is a mid-early maturing variety control Jimai 22. Jimai Heading stage is 5 days earlier than control 81 Compact, 42 Medium 520.9 kg/666.7 m.sup.2, 8775 Jimai 22, and the maturity stage is 3 days good cold resistance an increase of 0.85% earlier, and is a mid-early maturing variety resistance compared with the control Jimai 22. Jimai mid-lately maturing variety; the maturity 75 Compact, 40.4 Susceptible 518.1 kg/666.7 m.sup.2 22 stage is 1 day longer than that of control poor cold Shi 4185 resistance
[0052] To sum up, according to the molecular marker polymerization breeding method for FHB-resistance in wheat of the present application, the linked marker LJJT-1 of the molecular markers FHB-resistant gene Fhb1 and the linked markers LJJ-2 and LJJ-3 of Fhb2 are used in the breeding generation using molecular marker-assisted selection and conventional breeding techniques, so as to create a semi-winter FHB-resistant breeding materials Jimai 8681 and Jimai 8775 with outstanding target traits and excellent comprehensive traits, which has laid a material foundation for cultivating FHB-resistant wheat varieties suitable for planting in Huanghuai wheat production area.
[0053] Unless specifically stated otherwise, the numerical values set forth in these examples do not limit the scope of the disclosure. In all examples shown and described herein, unless stated otherwise, any specific value should be construed as merely exemplary and not as limiting, as other examples of exemplary embodiments may have different values.