Bifidobacterium Longum
20180016647 ยท 2018-01-18
Inventors
- Douwe Van Sinderen (Carrigrohane, IE)
- Jun Xu (Mason, OH)
- Wenzhu Zhao (Mason, OH)
- Raymond A. Grant (Fairfield, OH, US)
- Yuli Song (Cincinnati, OH, US)
- Charles Bascom (Liberty Township, OH, US)
- Duane Larry Charbonneau (Mason, OH, US)
- Liam O'Mahony (Cork, IE)
Cpc classification
C12P19/04
CHEMISTRY; METALLURGY
C12R2001/01
CHEMISTRY; METALLURGY
A61P29/00
HUMAN NECESSITIES
A23C9/1234
HUMAN NECESSITIES
A61P1/00
HUMAN NECESSITIES
A23C19/0323
HUMAN NECESSITIES
A23C19/062
HUMAN NECESSITIES
A23L33/135
HUMAN NECESSITIES
International classification
A23C19/032
HUMAN NECESSITIES
A23C19/06
HUMAN NECESSITIES
A23C9/123
HUMAN NECESSITIES
C12P19/04
CHEMISTRY; METALLURGY
Abstract
The multiple embodiments described herein comprise the genome of a probiotic Bifidobacterium longum bifidobacteria strain and genes encoded by the genome. Various novel Bifidobacterium longum are described.
Claims
1. A pharmaceutical ingestable carrier comprising more than 10.sup.6 CFU per gram of the ingestible carrier of an isolated strain of Bifidobacterium longum AH121A deposited at NCIMB with accession number NCIMB 41675, wherein the pharmaceutical ingestable carrier is a tablet, and wherein the strain induces a ratio of interleukin-10 to interleukin-12 of at least 10 in a peripheral blood mononuclear cell co-incubation assay.
2. A method of improving gastrointestinal health in a subject, the method comprising administering a composition comprising a therapeutically effective amount of the pharmaceutical ingestable carrier of claim 1.
3. A method for providing a probiotic to a subject, the method comprising administering a composition comprising a therapeutically effective amount of the pharmaceutical ingestable carrier of claim 1.
4. An ingestible carrier comprising a freeze dried powder comprising more than 10.sup.6 CFU per gram of the ingestible carrier of a viable isolated and purified Bifidobacterium longum strain, excluding Bifidobacterium longum strain 35624 (NCIMB 41003), wherein the strain: a) expresses an exopolysaccharide; and b) comprises nucleic acid sequences of SEQ ID NO. 96 and SEQ ID NO. 97; wherein the ingestible carrier is a tablet; wherein the strain induces a ratio of interleukin-10 to interleukin-12 of at least 10 in a peripheral blood mononuclear cell co-incubation assay.
5. The ingestible carrier of claim 4, wherein the strain does not comprise the nucleic acid sequence of SEQ ID No. 112.
6. The ingestible carrier of claim 4, wherein the strain comprises two nucleic acid sequences selected from the group consisting of SEQ ID No. 114 to SEQ ID No. 132 and nucleic acid sequences with at least 95% sequence homology thereto.
7. The ingestible carrier of claim 6, wherein the two nucleic acid sequences are selected from the group consisting of SEQ ID No. 131, SEQ ID No. 132, and nucleic acid sequences with at least 95% sequence homology thereto.
8. An ingestible carrier comprising a freeze dried powder comprising more than 10.sup.6 CPU per gram of the ingestible carrier of a viable isolated and purified Bifidobacterium longum strain, wherein the strain a. expresses an exopolysaccharide; and b. comprises nucleic acid sequences selected from the group consisting of SEQ ID NO. 96, SEQ ID NO. 97, SEQ ID No. 132, SEQ ID No. 131, and combinations thereof; wherein the ingestible carrier is a tablet; wherein the strain induces a ratio of interleukin-10 to interleukin-12 of at least 10 in a peripheral blood mononuclear cell co-incubation assay.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0063] The invention will be more clearly understood from the following description thereof given by way of example only with reference to the accompanying drawings in which;
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
DETAILED DESCRIPTION OF THE INVENTION
[0077] Disclosed herein is an isolated polynucleotide of SEQ ID No. 1. The polynucleotide of SEQ ID No. 1 encodes a strain of Bifidobacterium. The Bifidobacterium encoded by the isolated polynucleotide sequence has a number of unique genes. The unique genes encoded by the polynucleotide have a unique order in the sequence of SEQ ID No. 1. As used herein, the term unique genes, mean genes that are not found in the currently available sequences of Bifodobacterium. As used herein, the term unique order, means that the position/sequence of the genes in the polynucleotide is not found in the currently available sequences of Bifodobacterium. The unique genes present in the isolated polynucleotide may be interspersed with nucleic acid residues that code for other (known) genes or stretches of non-coding sequence but the overall order/sequence of the unique genes in the isolated polynucleotide is in itself unique compared to the order of genes found in the currently available sequences of Bifodobacterium.
[0078] The polynucleotide was isolated from a strain of the bacterial species Bifidobacterium longum biotype infantis with the strain designation UCC 35624. A deposit of Bifidobacterium longum biotype infantis strain UCC 35624 was made at the National Collections of Industrial and Marine Bacteria Limited (NCIMB) Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen, AB21 9YA, Scotland, UK on Jan. 13, 1999 and accorded the accession number NCIMB 41003.
[0079] A deposit of Bifidobacteria infantis strain BL1207 was made at the American Type Culture Collection (ATTC) 10801 University Boulevard, Manassas, Va. 20110-2209, USA on Nov. 14, 2008 and accorded the accession number PTA-9608.
[0080] A deposit of Bifidobacterium longum strain AH121A was made at the National Collections of Industrial and Marine Bacteria Limited (NCIMB) Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen, AB21 9YA, Scotland, UK on Nov. 5, 2009 and accorded the accession number NCIMB 41675.
[0081] A deposit of Bifidobacterium longum strain AH1714 was made at the National Collections of Industrial and Marine Bacteria Limited (NCIMB) Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen, AB21 9YA, Scotland, UK on Nov. 5, 2009 and accorded the accession number NCIMB 41676.
[0082] Given the size of the isolated polynucleotide it would not be uncommon for a point mutation or some other form of mutation to be present in the sequence. As such we encompass variants of SEQ ID No. 1 in the disclosure. As used herein, the term variants, means strains of Bifidobacteria that have a sequence identity of at least 99.5% or more with SEQ ID No. 1.
[0083] SEQ ID No. 1 contains a large number of open reading frames which represent the predicted genes. We have identified 1,836 protein coding regions or genes within this polynucleotide. As such, our disclosure encompasses fragments of the polynucleotide of SEQ ID No. 1. The fragments may correspond to portions of the polynucleotide sequence that encode one or more proteins. Alternatively, the fragments may correspond to portions of the polynucleotide sequence that specify part of a gene or genes for example the fragment may correspond to a portion of the polynucleotide sequence that spans a part of two or more genes.
[0084] The sequence of SEQ ID No. 1 is a DNA polynucleotide sequence, our disclosure encompasses sequences that are complementary to the DNA sequence for example complementary DNA (cDNA) or RNA sequences including messenger RNA (mRNA) and transfer RNA (tRNA) or protein sequences such as amino acid sequences encoded by the polynucleotide sequence.
[0085] The polynucleotide of SEQ ID No.1 and complementary sequences thereof may take many forms for example an isolated polynucleotide sequence; an isolated protein sequence; a biologically pure culture of a Bifidobacterial strain comprising the nucleic acid of SEQ ID NO. 1; a plasmid comprising the polynucleotide of SEQ ID No. 1; and the like. All of these forms of the sequence of SEQ ID No. 1 are encompassed in this disclosure.
[0086] As used herein, the term expresses an exopolysaccharide, may be interpreted to mean that a bacterial strain contains a DNA sequence encoding an exopolysaccharide for example a DNA sequence that encodes at least one gene from SEQ ID No. 2 and/or at least one gene from SEQ ID No. 3 or a functional fragment or variant thereof.
[0087] As used herein, the term sequence homology encompasses sequence homology at a nucleic acid and/or an amino acid (protein) level. Sequence homology is indicated as the overall percentage of identity across the nucleic acid and/or amino acid sequence. The sequence homology may be determined using standard techniques known to those skilled in the art. For example sequence homology may be determined using the on-line homology algorithm BLAST program, publicly available at http://www.ncbi.nlm.nih.gov/BLAST/. A sequence may have at least 85% or at least 86% or at least 87% or at least 88% or at least 89% or at lest 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% sequence homology with the nucleic acid sequences described herein or the amino acid (protein) encoded thereby.
[0088] The present invention is based on the whole genome sequence of Bifidobacterium longum biotype infantis UCC 35624. The genome sequence is listed in SEQ ID No. 1 of the attached sequence listing and comprises 2,264374 base pairs. Analysis of the genome sequence identified 1,836 genes having the open reading frames as set out in Table 1 below.
TABLE-US-00001 TABLE 1 Open reading frames of the genome of UCC 35624. GeneID Start End Strand Description BI00001 1667321 1667608 CRISPR-associated protein Cas2 BI00002 1667697 1668593 CRISPR-associated protein Cas1 BI00002a 1668725 1669423 CRISPR-associated protein Cas4 BI00003 1669465 1670313 CRISPR-associated protein, TM1801 family BI00005 1670320 1672275 CRISPR-associated protein, CT1133 family BI00006 1672281 1672982 CRISPR-associated protein, CT1134 family BI00007 1672992 1675427 hypothetical CRISPR-associated helicase Cas3 BI00008 1676109 1676426 COG3464: Transposase and inactivated derivatives BI00009 1677053 1680283 isoleucyl-tRNA synthetase BI00010 1680955 1682163 + aminotransferase, class I, putative BI00011 1682280 1683785 galactoside symporter BI00012 1684111 1687299 + beta-galactosidase, putative BI00013 1687365 1688372 sugar-binding transcriptional regulator, LacI family, putative BI00014 1688522 1689889 Putative antibiotic resistance protein (membrane protein) BI00015 1690007 1690906 hypothetical pfkB family carbohydrate kinase BI00016 1690909 1692111 alcohol dehydrogenase, iron-containing BI00017 1692111 1692794 hypothetical haloacid dehalogenase-like hydrolase BI00018 1692921 1693901 inosine-uridine preferring nucleoside hydrolase BI00019 1693960 1694913 hypothetical pfkB family carbohydrate kinase BI00020 1694909 1695553 hypothetical N-(5phosphoribosyl)anthranilate isomerase BI00021 1695603 1696415 ABC transporter, ATP-binding protein BI00022 1696415 1697242 conserved hypothetical protein BI00023 1697246 1698055 hypothetical Cobalt transport protein BI00024 1698062 1698712 conserved hypothetical protein BI00025 1698969 1700846 + transcriptional regulator, LacI family/carbohydrate kinase, PfkB family protein BI00026 1700977 1702989 ABC transporter, ATP-binding/permease protein BI00027 1702989 1704944 ABC transporter, ATP-binding protein BI00028 1704944 1705402 transcriptional regulator, MarR family, putative BI00029 1705699 1706610 COG1472: Beta-glucosidase-related glycosidases BI00030 1706029 1706937 + COG1309: Transcriptional regulator BI00031 1707015 1708373 unnamed protein product BI00032 1708509 1710902 xylosidase/arabinosidase [imported] BI00033 1710937 1711287 hypothetical protein BI00034 1711383 1712762 glutamate--cysteine ligase, putative BI00035 1712905 1718037 + conserved domain protein BI00036 1718044 1718883 + hypothetical protein BI00037 1719052 1724187 BadF/BadG/BcrA/BcrD ATPase family family BI00038 1724418 1725143 anaerobic ribonucleoside-triphosphate reductase activating protein BI00039 1725294 1727699 anaerobic ribonucleoside-triphosphate reductase BI00040 1728167 1729534 + exodeoxyribonuclease VII, large subunit BI00041 1729587 1729886 + exodeoxyribonuclease VII, small subunit BI00042 1730013 1730534 + NADP(H) oxidoreductase CC0205 [imported] BI00043 1730676 1732529 long-chain-fatty-acid--CoA ligase, putative BI00044 1732662 1732787 COG1970: Large-conductance mechanosensitive channel BI00045 1732765 1733166 hypothetical Large-conductance mechanosensitive channel, MscL BI00046 1733337 1733762 UNKNOWN PROTEIN, putative BI00047 1733887 1734102 COG0454: Histone acetyltransferase HPA2 and related acetyltransferases BI00048 1734587 1735696 + hypothetical transmembrane protein with unknown function BI00049 1735718 1736683 exopolyphosphatase, putative BI00050 1736864 1737967 aminotransferase, class I BI00051 1738178 1739230 + oxidoreductase, Gfo/Idh/MocA family, putative BI00052 1739267 1739779 patch repair protein [imported] BI00053 1739931 1740377 + acetyltransferase, GNAT family BI00054 1740356 1740841 conserved hypothetical protein BI00055 1741026 1745207 helicase, Snf2 family BI00056 1745285 1746367 + conserved hypothetical protein BI00057 1746358 1746504 hypothetical protein BI00058 1746604 1747620 + tetrahydrodipicolinate N-succinyltransferase (dapD) BI00059 1747840 1749129 citrate synthase I BI00060 1749406 1750242 methionine aminopeptidase, type I BI00061 1750378 1751355 membrane protein, putative BI00062 1751532 1753703 + belongs to peptidase family M13 BI00063 1753792 1754526 single-stranded DNA-binding protein (ssb) subfamily BI00064 1754805 1756616 prolyl-tRNA synthetase BI00065 1757008 1757361 + hypothetical protein BI00066 1757392 1758561 pflA BI00067 1758551 1760338 Protein of unknown function family BI00068 1760391 1761806 TPR domain protein BI00069 1761858 1762505 oligoribonuclease BI00070 1762676 1764259 inosine-5-monophosphate dehydrogenase BI00071 1764282 1765562 undecaprenyl-phosphate alpha-N-acetylglucosaminyltransferase BI00072 1765562 1766233 Sua5/YciO/YrdC/YwlC family protein BI00073 1766408 1767082 + maltose O-acetyltransferase BI00074 1767220 1767921 branched-chain amino acid ABC transporter, ATP-binding protein BI00075 1767924 1768781 branched chain amino acid ABC transporter, ATP-binding protein BI00076 1768781 1769854 branched-chain amino acid ABC transporter, permease protein BI00077 1769874 1770797 branched-chain amino acid ABC transporter, permease protein BI00078 1771042 1772226 branched-chain amino acid ABC transporter, amino acid-binding protein, putative BI00079 1772502 1773407 N-methylase PapM BI00080 1773473 1774492 peptide chain release factor 1 BI00003g 1774715 1774924 ribosomal protein L31 BI00081 1775256 1776482 transcription regulator ROK family VC2007 [imported], putative BI00082 1776702 1778219 + xylulokinase BI00083 1778416 1778760 + lipoprotein, putative BI00084 1778773 1779114 + hypothetical protein BI00085 1779393 1779737 possible sugar permease BI00086 1779656 1780930 transposase, Mutator family BI00087 1781199 1782545 xylose isomerase BI00088 1782842 1783072 + drug resistance transporter, EmrB/QacA subfamily BI00089 1783095 1783409 + drug resistance transporter, EmrB/QacA subfamily BI00090 1783425 1784222 conserved hypothetical protein BI00091 1785149 1785661 polypeptide deformylase BI00092 1785576 1786421 oxidoreductase, aldo/keto reductase family superfamily BI00093 1786497 1786673 COG0477: Permeases of the major facilitator superfamily BI00094 1786761 1787264 hypothetical COG0477: Permeases of the major facilitator superfamily BI00095 1787291 1787791 possible MarR-type transcriptional regulator BI00011g 1787998 1788333 hypothetical protein Blon021361 BI00096 1788358 1789572 sugar ABC transporter, permease protein BI00097 1789575 1791125 sugar ABC transporter, ATP-binding protein BI00098 1791229 1792383 sugar ABC transporter, periplasmic sugar-binding protein BI00099 1792462 1792608 hypothetical protein BI00100 1792854 1793801 + probable repressor protein in (NagC/XylR) family BI00101 1793842 1794705 + sugar ABC transporter, ATP-binding protein, putative BI00102 1794736 1795683 glucokinase, putative BI00103 1796537 1798192 + ATP binding protein of ABC transporter BI00104 1798507 1799409 + acyl-CoA thioesterase II BI00105 1799511 1800035 hypothetical membrane protein with unknown function BI00106 1800213 1801622 dihydroneopterin aldolase BI00107 1801736 1802608 dihydropteroate synthase BI00108 1802699 1803295 GTP cyclohydrolase I BI00109 1803391 1805478 cell division protein FtsH BI00110 1805478 1806038 hypoxanthine phosphoribosyltransferase BI00111 1806028 1807191 COG0037: Predicted ATPase of the PP-loop superfamily implicated BI00112 1807285 1808772 D-alanyl-D-alanine carboxypeptidase/ D-alanyl-D-alanine-endopeptidase BI00113 1808798 1810468 hypothetical transmembrane protein with unknown function BI00114 1810468 1811421 ATP-binding protein of ABC transporter system BI00115 1811519 1812739 glycosyl transferase domain protein, putative BI00116 1812742 1814496 hypothetical integral membrane protein in upfo118 BI00117 1814587 1815252 + probable glycosyltransferase BI00118 1815481 1816629 alcohol dehydrogenase, iron-containing BI00119 1817069 1818370 + cyclopropane-fatty-acyl-phospholipid synthase BI00120 1818383 1819687 + hypothetical COG0477: Permeases of the major facilitator superfamily BI00121 1820205 1821215 UDP-glucose 4-epimerase BI00122 1821585 1822400 + methyltransferase, putative BI00123 1822698 1823195 hypothetical protein BI00124 1823244 1823708 Orf2 BI00125 1823795 1824079 + hypothetical Helix-turn-helix BI00126 1824492 1824788 hypothetical protein BI00127 1825086 1826453 gp22 BI00128 1827148 1827699 hypothetical protein BI00170t 1827699 1828901 hypothetical Phage integrase family BI00129 1829429 1830229 + azlC protein, putative BI00130 1830229 1830558 + branched-chain amino acid permease BI00131 1830743 1831258 phosphotyrosine protein phosphatase, putative BI00132 1831385 1832044 dihydrofolate reductase BI00133 1832157 1832936 thymidylate synthase BI00134 1833154 1833564 + conserved hypothetical protein BI00135 1833629 1834663 demannu, putative BI00136 1834835 1835572 P60 extracellular protein, invasion associated protein Iap BI00137 1835733 1836476 NLP/P60 family domain protein BI00138 1836692 1837645 N-acetylmuramoyl-L-alanine amidase domain protein BI00139 1838255 1839178 + phosphoserine aminotransferase, putative BI00140 1839305 1839562 + conserved hypothetical protein BI00141 1839693 1840874 sensor histidine kinase, putative BI00142 1841128 1841745 + phosphate transport system regulatory protein PhoU, putative BI00143 1842110 1842847 phosphoglycerate mutase BI00144 1842910 1843872 1,4-dihydroxy-2-naphthoate octaprenyltransferase BI00145 1843937 1845412 lysyl-tRNA synthetase BI00146 1846534 1847304 + AraJ-like protein probably involved in transport of arabinose polymers BI00147 1847394 1849754 + TPR Domain domain protein BI00148 1849833 1850462 + conserved hypothetical protein BI00149 1850618 1852216 hypothetical membrane protein possibly involved in transport BI00150 1852325 1853029 conserved hypothetical protein BI00151 1853062 1854903 conserved hypothetical protein BI00152 1854930 1856174 + possible histidine kinase sensor of two component system BI00153 1856174 1856866 + transcription regulator, LuxR family NMB1250 [imported] BI00154 1856920 1857939 UDP-glucose 4-epimerase BI00155 1858012 1859556 galactose-1-phosphate uridylyltransferase BI00156 1859606 1860682 putative desulfatase possibly for mucin BI00157 1860713 1862965 conserved hypothetical protein BI00158 1863426 1864382 sugar ABC transporter, permease protein BI00159 1864382 1865278 sugar ABC transporter, permease protein, putative BI00160 1865546 1866859 solute binding protein of ABC transporter for sugars BI00161 1867217 1867369 hypothetical protein BI00162 1867867 1868856 seryl-tRNA synthetase BI00163 1869384 1870562 + Diacylglycerol kinase catalytic domain (presumed) protein BI00164 1870573 1871409 transcription antiterminator, BglG family, putative BI00165 1871430 1873829 PTS system component, putative BI00166 1874293 1875843 + major facilitator family transporter CC0814 [imported], putative BI00167 1875934 1877607 + phosphoglucomutase, alpha-D-glucose phosphate-specific BI00222t 1878343 1879437 conserved hypothetical protein BI00168 1879668 1880087 + conserved hypothetical protein BI00169 1880224 1881837 + oxidoreductase, pyridine nucleotide-disulfide, class I BI00170 1882002 1882151 hypothetical protein BI00171 1882305 1883360 + RNase H BI00172 1883494 1884189 + ribose 5-phosphate isomerase BI00173 1884629 1885258 conserved hypothetical protein BI00174 1885386 1886921 + DNA repair protein RadA BI00175 1886942 1888063 riboflavin biosynthesis protein RibF BI00176 1888164 1889324 tRNA pseudouridine synthase B BI00177 1889329 1889799 ribosome-binding factor A BI00178 1889953 1892799 translation initiation factor IF-2 BI00179 1893150 1894214 N utilization substance protein A BI00180 1894422 1895147 + lipoprotein, putative BI00181 1895194 1896234 transcriptional regulator, LacI family, putative BI00182 1896528 1896629 hypothetical protein BI00183 1896770 1897798 hypothetical BI00184 1897936 1898568 alpha-L-arabinosidase BI00185 1899147 1899917 Transglutaminase-like superfamily domain protein BI00186 1900154 1902331 Domain of unknown function (DUF404) family BI00187 1902473 1902586 hypothetical protein BI00188 1902727 1903515 + tRNA pseudouridine synthase A BI00189 1903603 1904142 ribosomal protein L17 BI00190 1904245 1905237 RNA polymerases L/13 to 16 kDa subunit BI00191 1905321 1905716 ribosomal protein S11 BI00192 1905807 1906181 ribosomal protein S13p/S18e BI00193 1906333 1906443 ribosomal protein L36 BI00194 1906470 1906685 translation initiation factor IF-1 BI00195 1906865 1907422 adenylate kinase BI00196 1907595 1908722 preprotein translocase, SecY subunit BI00197 1909207 1909656 ribosomal protein L15 BI00198 1909662 1909844 ribosomal protein L30 BI00199 1909853 1910581 ribosomal protein S5 BI00200 1910581 1910991 ribosomal protein L18 BI00201 1910954 1911490 ribosomal protein L6 BI00202 1911511 1911906 ribosomal protein S8 BI00203 1911999 1912181 ribosomal protein S14p/S29e BI00204 1912186 1912755 ribosomal protein L5 VC2584 [imported] BI00205 1912755 1913087 ribosomal protein L24 BI00206 1913092 1913457 ribosomal protein L14 BI00207 1913555 1913812 ribosomal protein S17 BI00208 1913818 1914066 ribosomal protein L29 BI00209 1914069 1914485 ribosomal protein L16 BI00210 1914495 1915295 ribosomal protein S3 BI00211 1915301 1915657 ribosomal protein L22 BI00212 1915677 1915952 ribosomal protein S19 BI00213 1915971 1916798 ribosomal protein L2 BI00214 1916838 1917131 ribosomal protein L23 BI00215 1917140 1917793 ribosomal protein L4/L1 family BI00216 1917803 1918441 ribosomal protein L3 BI00217 1918461 1918766 ribosomal protein S10 BI00218 1919023 1920027 + membrane protein, putative BI00219 1920366 1923092 Unknown BI00220 1923607 1924797 + probable repressor in the Rok (NagC/XylR) family BI00221 1924797 1927334 + glycogen operon protein GlgX BI00222 1927431 1927919 ribosomal protein S9 BI00223 1927945 1928391 ribosomal protein L13 BI00224 1928792 1930954 4-alpha-glucanotransferase BI00225 1931125 1931931 hypothetical Leucine rich repeat variant BI00226 1931876 1932514 conserved hypothetical protein TIGR00257 BI00227 1932579 1933592 possible 2-hydroxyacid dehydrogenase BI00228 1933669 1935009 capA protein, putative BI00229 1935547 1936608 COG0697: Permeases of the drug/metabolite transporter (DMT) superfamily BI00230 1936648 1937991 + DNA-damage-inducible protein P BI00231 1938024 1939256 aminotransferase, putative BI00232 1939374 1939691 fdxC BI00233 1939755 1941278 possible cationic amino acid transporter BI00234 1941433 1942398 UDP-N-acetylenolpyruvoylglucosamine reductase BI00235 1942930 1943094 ribosomal protein L33 BI00236 1943529 1944245 + possible cystathionine gamma lyase BI00237 1944924 1945214 chaperonin, 10 kDa BI00238 1945390 1946604 conserved hypothetical protein BI00239 1946895 1947557 rimJ BI00240 1947644 1948360 + 5-formyltetrahydrofolate cyclo-ligase-related protein BI00241 1948527 1948709 + conserved hypothetical protein BI00242 1948950 1949516 + conserved hypothetical protein BI00243 1949617 1949814 hypothetical protein Blon021580 BI00244 1949820 1953440 conserved hypothetical protein BI00245 1953452 1954999 conserved hypothetical protein BI00246 1955200 1955577 ribosomal protein L7/L12 BI00247 1955689 1956207 ribosomal protein L10 BI00248 1956479 1957222 conserved hypothetical protein BI00249 1957561 1958952 + Unknown BI00250 1959385 1962123 polyribonucleotide nucleotidyltransferase BI00251 1962444 1962710 ribosomal protein S15 BI00252 1962882 1963562 conserved hypothetical protein BI00253 1963721 1963951 hypothetical protein BI00254 1964091 1966964 possible extracellular exo-xylanase BI00255 1967190 1969712 endo-1,4-beta-xylanase D BI00256 1970329 1971432 + IS30 family, transposase [imported] BI00257 1971591 1972274 conserved hypothetical protein BI00334t 1972174 1972389 + conserved hypothetical protein BI00258 1972411 1973094 hypothetical protein Blon021028 BI00259 1973553 1974914 possible cell surface protein BI00260 1974994 1977351 von Willebrand factor type A domain protein BI00261 1978150 1978326 hypothetical protein Blon021305 BI00262 1978353 1978820 phosphopantethiene protein transferase BI00263 1979459 1988974 MaoC like domain protein BI00264 1989016 1990635 propionyl-CoA carboxylase, beta chain BI00265 1990631 1992514 accA3 BI00266 1993105 1993701 + bioY protein BI00267 1993739 1994710 biotin--acetyl-CoA-carboxylase ligase BI00268 1994853 1996895 + membrane protein, putative BI00269 1996904 1997731 + conserved hypothetical protein BI00270 1997829 1998524 transcriptional regulator, putative BI00350t 1998629 1999459 hypothetical transcriptional regulator, IclR family BI00271 2011598 2011726 hypothetical protein BI00272 2011797 2012486 ribosomal protein L1 BI00273 2012505 2012933 ribosomal protein L11 BI00274 2013199 2014089 transcription termination/antitermination factor NusG BI00275 2014122 2014346 preprotein translocase SecE subunit BI00276 2014593 2015795 aspartate aminotransferase [imported] BI00277 2015889 2016986 glutamate 5-kinase BI00278 2017023 2018711 GTP-binding protein BI00279 2018783 2019028 ribosomal protein L27 BI00280 2019054 2019359 ribosomal protein L21 BI00281 2019502 2022534 hypothetical ribonuclease, Rne/Rng family BI00282 2022850 2024121 succinyl-diaminopimelate desuccinylase BI00283 2024159 2025100 + transporter, putative BI00284 2025282 2026727 permease, putative domain protein BI00285 2026727 2027818 ABC transporter, ATP-binding protein BI00286 2027996 2029441 Maf-like protein BI00287 2029581 2030690 homoserine kinase BI00288 2030800 2032113 homoserine dehydrogenase BI00289 2032276 2033865 diaminopimelate decarboxylase BI00290 2033871 2035541 arginyl-tRNA synthetase BI00291 2035944 2036606 + possible TetR-type transcriptional regulator BI00292 2036606 2037880 + permease, putative BI00293 2037742 2038899 + transcription regulator LysR family VC1588 [imported], putative BI00294 2038996 2040246 + probable aminotransferase BI00295 2040298 2041521 UDP-N-acetylglucosamine 1-carboxyvinyltransferase BI00296 2041869 2043212 + NADH oxidase BI00297 2043424 2044548 dihydroorotate dehydrogenase family protein, putative BI00298 2044591 2046468 CAAX amino terminal protease family protein family BI00299 2046594 2047283 3-isopropylmalate dehydratase small subunit BI00300 2047369 2048769 3-isopropylmalate dehydratase, large subunit BI00301 2049087 2049860 + transcriptional regulator, IclR family BI00302 2050021 2051391 Ser/Thr protein phosphatase family BI00303 2051896 2054130 + polyphosphate kinase BI00304 2054291 2055487 + mutT1 BI00305 2055480 2056298 + hypothetical protein Blon021115 BI00306 2056564 2057871 conserved hypothetical protein BI00307 2057963 2058121 hypothetical protein BI00308 2058175 2058813 + uracil phosphoribosyltransferase BI00309 2058864 2059340 + conserved hypothetical protein TIGR00246 BI00310 2059542 2060648 possible phosphodiesterase BI00311 2060677 2061747 glutamyl-tRNA synthetase domain protein BI00312 2061933 2064599 ATP-dependent Clp protease, ATP-binding subunit ClpB BI00313 2064821 2066371 histidine ammonia-lyase BI00314 2066617 2067489 + transcriptional regulator, IclR family, putative BI00315 2067489 2067662 + conserved hypothetical protein BI00316 2067741 2068559 possible 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase in the fumarylacetoacetate hydrolase family BI00317 2068665 2069873 hypothetical membrane protein with unknown function BI00318 2070097 2071272 UDP-galactopyranose mutase BI00319 2071426 2072670 + dTDP-glucose 4,6-dehydratase BI00320 2072827 2074311 + conserved hypothetical protein BI00321 2074367 2075068 + conserved hypothetical protein BI00423t 2075382 2075687 + putative transposase BI00322 2075763 2076530 IS1533, OrfB BI00323 2076530 2077987 transposase (25) BH3998 [imported], putative BI00324 2078280 2078996 glycosyltransferase, putative BI00325 2079313 2079666 sialic acid-specific 9-O-acetylesterase BI00326 2080049 2081173 + hypothetical Acyltransferase family BI00327 2081181 2082893 hypothetical membrane protein with unknown function BI00328 2082902 2085811 hypothetical Glycosyl transferase family 8 BI00329 2085935 2087170 hypothetical glycosyl transferase, group 2 family protein BI00330 2087259 2088509 polysaccharide ABC transporter, ATP-binding protein BI00331 2088515 2089351 polysaccharide ABC transporter, permease protein, putative BI00332 2089580 2091367 + hypothetical Glycosyl transferase family 8 BI00333 2091457 2092698 UDP-glucose 6-dehydrogenase BI00334 2092974 2093636 + hypothetical NAD dependent epimerase/dehydratase family BI00335 2093654 2094844 membrane protein, putative BI00336 2094847 2097099 conserved hypothetical protein BI00337 2097441 2098844 + hypothetical membrane protein with unknown function BI00338 2098844 2099962 + possible ATP binding protein of ABC transporter BI00339 2100089 2100790 + HDIG domain protein BI00340 2100871 2101728 conserved hypothetical protein BI00341 2101825 2104335 Kup system potassium uptake protein [imported] BI00342 2104481 2105188 hydrolase, TatD family BI00343 2105717 2106784 + Fic protein family family BI00344 2106816 2108621 ABC transporter, ATP-binding/permease protein BI00345 2108635 2110542 ABC transporter, ATP-binding/permease protein BI00346 2110935 2111099 hypothetical protein BI00347 2111297 2112703 possible alpha-galactosidase BI00348 2113077 2114231 + transcriptional regulator, LacI family, putative BI00349 2114409 2115356 probable AraC/XylS-type transcriptional regulator BI00350 2115401 2117626 conserved hypothetical protein BI00351 2117851 2119374 + aminopeptidase C BI00352 2119555 2120628 + conserved hypothetical protein BI00353 2121673 2123403 methionyl-tRNA synthetase BI00354 2123873 2124496 + conserved hypothetical protein BI00466t 2124496 2124864 + conserved hypothetical protein BI00355 2124897 2125922 conserved hypothetical protein TIGR00096 BI00356 2126487 2127902 possible symporter BI00357 2127864 2129027 + conserved hypothetical protein BI00358 2129186 2131012 ABC transporter, ATP-binding/permease protein BI00359 2131231 2133099 ABC transporter, ATP-binding/permease protein BI00360 2133289 2133684 transcriptional regulator, MarR family, putative BI00475t 2134267 2134506 + DNA-damage-inducible protein of Escherichia coli BI00361 2135008 2138841 LPXTG-motif cell wall anchor domain protein BI00362 2139056 2139151 hypothetical protein BI00363 2139209 2143594 secreted protein BI00364 2143901 2145394 ATP-dependent DNA helicase recG BI00365 2145737 2147257 amino acid permease BI00366 2147448 2151185 permease, putative BI00367 2151199 2151897 ABC transporter, ATP-binding protein BI00368 2152041 2152607 + probable TetR-like transcriptional regulator BI00369 2152832 2154310 + aromatic amino acid transport protein AroP BI00370 2154575 2155774 + putative invertase/transposase BI00371 2155961 2160952 hypothetical Glycosyl hydrolases family 43 BI00372 2161359 2164649 hypothetical BI00373 2164997 2168173 possible arabinosidase BI00374 2168529 2169131 conserved hypothetical protein BI00375 2169340 2170179 sugar ABC transporter, permease protein, putative BI00376 2170182 2171033 sugar ABC transporter, permease protein, putative BI00377 2171416 2172429 + transcription regulator, LacI family [imported], putative BI00378 2172690 2174015 possible solute binding protein of ABC transporter BI00379 2174424 2175134 phosphoglycerate mutase family protein BI00380 2175226 2175600 + hypothetical COG0531: Amino acid transporters BI00381 2175612 2176550 + hypothetical nitroreductase family protein BI00382 2176846 2179572 + phage infectio, putative BI00383 2179572 2181908 + phage infection protein, putative BI00384 2188511 2189263 + regulatory protein, SIR2 family BI00385 2189415 2190791 threonine dehydratase BI00386 2190928 2192745 glucan 1,6-alpha-glucosidase BI00387 2192872 2194731 hypothetical Raffinose synthase or seed imbibition protein Sip1 BI00388 2194766 2196433 alpha-amylase family protein BI00389 2196537 2197358 hypothetical abc transporter permease protein yurm. {bacillus BI00390 2197364 2198383 hypothetical Binding-protein-dependent transport systems inner membrane component BI00391 2198408 2199730 hypothetical Bacterial extracellular solute-binding protein BI00392 2199980 2201095 hypothetical protein Efae022644 BI00393 2201159 2202484 hypothetical Bacterial extracellular solute-binding protein BI00394 2202692 2203717 + transcription regulator, LacI family [imported], putative BI00395 2203838 2204854 + transcription regulator, LacI family [imported], putative BI00396 2204919 2205782 sugar ABC transporter, permease protein BI00397 2205804 2206730 sugar ABC transporter, permease protein BI00398 2206755 2208041 sugar ABC transporter, sugar-binding protein, putative BI00399 2208215 2209420 + transcription regulator ROK family VC2007 [imported], putative BI00400 2209591 2211894 alpha-galactosidase BI00401 2212017 2212445 hypothetical Cytidine and deoxycytidylate deaminase zinc-binding region BI00402 2212589 2214658 + Na+/H+ antiporter BI00403 2214858 2215613 serine esterase, putative BI00404 2215613 2215714 hypothetical protein BI00405 2215735 2216592 conserved hypothetical protein BI00406 2216949 2217527 + deoxycytidine triphosphate deaminase BI00407 2217593 2219320 + cell wall surface anchor family protein, putative BI00408 2219543 2222527 calcium E1-E2-type ATPase BI00409 2222713 2223447 protein probably involved in xylan degradation, possible xylan esterase BI00410 2223622 2225049 hypothetical major facilitator superfamily protein BI00411 2225005 2225994 + RNA methyltransferase, TrmH family, group 3 BI00412 2226107 2227516 conserved hypothetical protein BI00413 2227740 2228864 ATP binding protein of ABC transporter for sugars BI00414 2229226 2230419 glycosyl transferase domain protein BI00415 2230486 2231475 Ribonucleotide reductase, beta subunit BI00416 2231704 2233896 ribonucleoside-diphosphate reductase, alpha subunit BI00417 2234015 2234470 nrdI protein BI00418 2234470 2234733 COG0695: Glutaredoxin and related proteins BI00419 2235324 2235767 hypothetical Helix-turn-helix BI00420 2235958 2236635 conserved hypothetical protein BI00421 2236828 2237592 + ion transporter BI00422 2237788 2238891 + conserved hypothetical protein BI00423 2239035 2239349 beta-glucosidase-related glycosidase BI00424 2239828 2241951 + widely conserved protein with eukaryotic protein kinase domain BI00425 2242132 2243106 + conserved hypothetical protein BI00426 2243627 2245111 + conserved hypothetical protein BI00427 2245147 2246067 + dimethyladenosine transferase BI00428 2246067 2247014 + kinase, GHMP family, group 2 BI00429 2246860 2247690 + hypothetical protein BL0655 BI00430 2247781 2249193 pcnA BI00431 2249280 2250569 + NUDIX domain protein BI00432 2250569 2252836 + cell wall surface anchor family protein, putative BI00433 2252836 2254560 + conserved hypothetical membrane protein in MviN family BI00434 2254646 2256706 + conserved hypothetical protein BI00435 2256829 2257845 + thioredoxin reductase BI00436 2258158 2259516 chromosome partitioning protein ParB BI00437 2259519 2260487 Soj family protein BI00438 2260741 2261403 methyltransferase GidB BI00439 2261558 2262088 R3H domain protein BI00440 2262215 2263219 inner membrane protein, 60 kDa VC0004 [imported] BI00143g 2263219 2263533 conserved hypothetical protein TIGR00278 BI00576t 2263533 2264063 ribonuclease P protein component BI00441 2263925 2264056 ribosomal protein L34 BI00442 1 1500 + chromosomal replication initiator protein DnaA BI00443 2239 3360 + DNA polymerase III, beta subunit BI00444 3442 4626 + recF protein BI00445 4626 5093 + conserved hypothetical protein BI00446 5229 7364 + DNA gyrase, B subunit BI00447 7534 10083 + DNA gyrase, A subunit BI00448 10156 10719 + conserved hypothetical protein BI00449 11406 12116 + hypothetical protein BI00450 12179 13699 + hypothetical Pectinesterase BI00451 14103 15446 NADP-specific glutamate dehydrogenase BI00452 15768 16199 AsnC-type transcriptional regulator BI00453 16405 17736 + aspartate aminotransferase BI00454 17757 18746 hypothetical protein Blon021073 BI00455 19007 19600 + hypothetical protein BL0627 BI00456 19770 20462 + hypothetical protein Blon021075 BI00457 20579 20821 + Putative acrab operon repressor transcription regulator protein BI00599t 21403 21735 IS1557, transposase, putative BI00146g 21834 22397 conserved hypothetical protein BI00458 22130 23497 hypothetical COG1167: Transcriptional regulators containing a DNA-binding HTH domain and an aminotransferase domain (MocR family) and their eukaryotic orthologs BI00459 24132 25454 + aminotransferase, class III superfamily BI00460 25495 26397 + Zinc metalloprotease BI00461 26414 26509 hypothetical protein BI00462 26487 26849 + COG3265: Gluconate kinase BI00463 27114 28424 conserved hypothetical protein BI00464 28662 29138 Dps family protein, putative BI00465 29238 30608 CBS domain protein, putative BI00466 30841 31521 Prokaryotic-type carbonic anhydrases BI00467 31727 32287 + alkyl hydrogen peroxide reductase BI00468 32458 34371 + thioredoxin reductase BI00469 34494 35963 oxalate: formate antiporter BI00470 35948 36094 + hypothetical protein BI00471 36333 37328 + LacI-type transcriptional regulator BI00472 37558 40308 phosphoenolpyruvate carboxylase BI00473 40594 42471 + membrane protein, putative BI00474 42737 44344 + possible sodium/proline symporter BI00475 44680 45663 narrowly conserved hypothetical protein BI00476 45917 47533 + conserved hypothetical protein BI00477 47717 48805 tiyptophanyl-tRNA synthetase BI00478 49056 49325 + hypothetical protein BI00479 49437 49967 conserved hypothetical protein BI00480 49986 52505 + glycogen phosphorylase BI00481 52725 52940 hypothetical protein BL0595 BI00482 53195 53887 + Rhomboid family protein BI00483 54562 55029 conserved hypothetical protein BI00484 55119 55907 + conserved hypothetical protein BI00485 55907 57142 + hypothetical transmembrane protein with unknown function BI00486 57196 57837 + pabA BI00487 58067 60136 serine/threonine protein kinase BI00488 60136 60942 serine/threonine protein kinase BI00489 61083 62546 pbpA BI00490 62546 64204 Unknown, putative BI00491 64204 65895 possible phosphoprotein phosphatase BI00492 65903 66430 FHA-domain-containing proteins BI00493 66463 67161 FHA domain protein BI00494 67349 69790 dipeptidyl peptidase IV, putative BI00495 69951 70997 + lysophospholipase L2, putative BI00496 71080 72228 + von Willebrand factor type A domain protein BI00497 72231 72947 + conserved hypothetical protein BI00498 72947 73348 + hypothetical protein Blon021556 BI00654t 73348 73497 + hypothetical protein Blon021556 BI00499 73873 74724 + tellurite resistance protein BI00500 75108 75608 + heat shock protein, Hsp20 family BI00501 75938 76891 + Probable transmembrane protein BI00502 77065 77520 conserved hypothetical protein BI00503 77753 79132 + COG0627: Predicted esterase BI00504 79132 81702 + COG2898: Uncharacterized BCR BI00505 82241 83212 + peptide methionine sulfoxide reductase BI00506 83218 83304 + hypothetical protein BL0567 BI00668t 83341 83496 + COG0463: Glycosyltransferases involved in cell wall biogenesis BI00507 83506 86709 helicase-related protein BI00509 86785 87195 mutator MutT protein, putative BI00510 87337 88587 + hypothetical Domain of unknown function BI00511 88678 89139 + acetyltransferase, GNAT family family BI00512 89226 90080 hypothetical BI00513 90187 90420 hypothetical protein BI00514 90480 90842 + conserved hypothetical protein BI00515 91329 92639 queuine tRNA-ribosyltransferase BI00516 93056 95065 + heat shock protein HtrA BI00517 95480 97636 + cation-transporting ATPase, E1-E2 family BI00684t 97816 98862 + transcriptional regulator, LacI family BI00518 98874 99131 hypothetical mttA/Hcf106 family BI00519 99136 100215 Sec-independent protein translocase TatC BI00687t 100215 100730 hypothetical twin-arginine translocation protein, TatA/E family BI00520 101182 103581 + hypothetical Tat (twin-arginine translocation) pathway signal sequence BI00521 103674 106151 + hypothetical BI00522 106547 107707 conserved hypothetical protein BI00523 107911 109359 + ferredoxin/ferredoxin--NADP reductase, putative BI00524 109452 110450 + heat shock protein HtpX BI00525 110667 111731 fructose-bisphosphate aldolase, class II BI00526 111947 113230 + adenylosuccinate synthetase BI00527 113524 114837 + chloride channel BI00528 115027 116094 + CrcB-like protein family BI00700t 116097 116489 + protein with similarity to CrcB BI00529 116581 116691 + hypothetical protein BI00530 116767 117849 + sugar-binding transcriptional regulator, LacI family, putative BI00531 118274 119842 + Kup system potassium uptake protein [imported] BI00532 120262 121806 + alpha-L-arabinofuranosidase BI00533 121981 123012 + transcription regulator, LacI family [imported], putative BI00534 123104 124012 glycosyl hydrolase, family 31 BI00535 124149 124370 IS861, transposase OrfB BI00711t 124604 125803 + probable integrase/recombinase BI00712t 125878 126765 + probable integrase/recombinase BI00536 126765 127817 + integrase/recombinase XerC, probable [imported], putative BI00537 127910 128956 IS3 family transposase BI00538 129291 130814 + sucrose phosphorylase BI00539 131035 132669 + hypothetical transmembrane protein with unknown function BI00540 132736 133776 + sugar-binding transcriptional regulator, LacI family, putative BI00541 134407 135771 + major facilitator family transporter BI00542 135971 137020 + ketol-acid reductoisomerase BI00543 137452 138501 + ketol-acid reductoisomerase BI00544 138689 140500 alpha-amylase family protein BI00545 140663 141694 transcription regulator, LacI family [imported], putative BI00546 142008 144242 4-alpha-glucanotransferase BI00547 144506 144784 hypothetical protein Blon021648 BI00548 144856 145482 + conserved hypothetical protein BI00549 145500 146507 transcription regulator, LacI family [imported], putative BI00550 146777 147490 + sugar ABC transporter, permease protein BI00551 147605 150139 + glycosyl hydrolase, family 31 BI00552 151125 153002 + dnaK protein BI00553 153005 153658 + co-chaperone GrpE BI00554 153753 154769 + DnaJ protein [imported] BI00555 154787 155371 + hspR BI00556 155647 156996 + xanthine permease, putative BI00557 157036 158154 + possible acyl protein synthase/acyl-CoA reductase-like protein BI00558 158144 159640 + possible acyl-CoA reductase BI00559 159715 160497 + 3-oxoacyl-acyl carrier protein reductase BI00560 160553 161281 + beta-phosphoglucomutase, putative BI00561 161435 162157 + DedA protein BI00749t 162383 163330 + conserved hypothetical protein BI00562 163340 164404 + trbB BI00751t 164410 165060 + conserved hypothetical protein BI00752t 165060 165659 + hypothetical membrane protein with unknown function BI00563 165947 166231 + hypothetical protein BL0505 BI00754t 166240 166614 + conserved hypothetical protein BI00564 166715 167041 + conserved hypothetical protein BI00565 167093 168220 + BmrU protein, putative BI00566 168424 169020 possible TetR-type transcriptional regulator BI00567 169297 172125 + DNA polymerase III, tau/gamma subunit BI00568 172154 172753 + recombination protein RecR BI00569 172756 173886 sortase family protein BI00570 174774 176054 + conserved hypothetical protein BI00571 176649 177179 + hypothetical Amino acid kinase family BI00572 177262 177801 + aspartokinase, alpha and beta subunits BI00573 177889 178980 aspartate-semialdehyde dehydrogenase BI00574 179055 179765 + conserved hypothetical protein BI00575 179774 181351 Ser/Thr protein phosphatase family BI00576 182040 183953 + 2-isopropylmalate synthase BI00577 184031 186493 penicillin-binding protein, putative BI00578 186772 187959 + possible pre-pilin peptidase BI00579 188086 191169 + DNA topoisomerase I BI00580 191549 192067 + thymidylate kinase BI00581 192067 193215 + DNA polymerase III, delta subunit BI00582 193337 193888 + conserved hypothetical protein TIGR00481 BI00583 194034 195632 + Unknown BI00584 195767 197281 + formate--tetrahydrofolate ligase BI00585 197684 198028 conserved hypothetical protein BI00586 198149 198763 + narrowly conserved hypothetical membrane protein BI00587 198817 200226 hypothetical membrane protein with unknown function BI00588 200521 201177 + phosphoglycerate mutase family protein BI00589 201278 202228 + conserved hypothetical protein BI00590 202352 203224 + transglycolase, epimerase BI00591 203348 204496 extensin precursor (cell wall hydroxyproline-rich glycoprotein) BI00790t 204684 204866 + hypothetical protein BL0470 BI00592 205053 206570 + glutamyl-tRNA synthetase BI00593 207503 207988 + hypothetical protein Blon021299 BI00594 207946 208221 hypothetical protein BL0466 BI00595 208388 214285 + cell wall surface anchor family protein, authentic frameshift BI00596 214390 215208 hypothetical BI00597 216652 218460 + conserved hypothetical integral membrane protein BI00598 218637 219317 + membrane antigen, putative BI00599 219470 220744 + Integral membrane protein BI00600 220769 222070 + possible permease protein of ABC transporter system BI00601 222107 223327 + possible permease protein of ABC transporter system BI00602 223346 224140 + ABC transporter, ATP-binding protein BI00603 224259 224819 + lipoprotein, putative BI00604 224831 225427 transcriptional regulator, TetR family, putative BI00605 225545 227704 phage infection protein, putative BI00606 227704 230250 phage infection protein, putative BI00607 230686 231969 + membrane protein, putative BI00608 232037 233602 + 6-phosphogluconate dehydrogenase, decarboxylating BI00609 233756 234595 6-phosphogluconolactonase BI00610 234825 235847 oxppcycle protein OpcA BI00611 235847 237499 glucose-6-phosphate 1-dehydrogenase BI00612 237652 239337 + Unknown BI00613 239417 240448 Glycosyltransferase involved in cell wall biogenesis BI00614 240475 241311 transcriptional regulator, TetR family BI00615 241407 242675 + signal recognition particle-docking protein FtsY BI00616 243046 244338 + ammonium transporter BI00617 244343 244678 + Nitrogen regulatory protein P-II BI00618 244832 246613 + protein-pII, uridylyltransferase BI00619 246653 248095 DNA-damage-inducible protein F, putative BI00620 248301 249827 + replicative DNA helicase BI00621 249830 251299 + UDP-N-acetylmuramyl tripeptide synthase BI00622 251405 252154 + cobyric acid synthase BI00623 252306 252590 + conserved hypothetical protein BI00624 252590 254407 + ABC1 family family BI00625 254428 255447 transcriptional regulator, LacI family BI00626 255933 257255 + solute binding protein of ABC transporter system BI00627 257546 258469 + sugar ABC transporter, permease protein, putative BI00628 258493 259308 + ABC transporter, permease protein, MalFG family BI00629 259473 261446 + conserved hypothetical protein BI00630 262147 267966 + hypothetical BI00631 268074 271778 + cell wall surface anchor family protein, putative BI00632 271911 272741 + conserved hypothetical protein TIGR00044 BI00633 272825 273835 prsA BI00634 273960 274439 hypothetical COG3210: Large exoproteins involved in heme utilization or adhesion BI00635 274604 274891 + ribosomal protein S6 BI00636 274951 275604 + hypothetical single-strand binding protein BI00637 275668 275913 + ribosomal protein S18 BI00638 275936 276379 + ribosomal protein L9 BI00639 276769 277026 + ptsH BI00640 277029 278705 + phosphoenolpyruvate-protein phosphotransferase BI00641 278942 279673 + glycerol uptake facilitator protein BI00642 279763 282468 copper-translocating P-type ATPase BI00643 282580 282858 + COG1937 family protein BI00644 283012 284325 + Uncharacterized BCR, YigN family, COG1322 family BI00645 284325 284951 + conserved hypothetical protein BI00646 285048 285893 + COG0566: rRNA methylases BI00647 285787 286359 + glutamyl-tRNA(Gln) amidotransferase, C subunit BI00648 286366 287904 + glutamyl-tRNA(Gln) amidotransferase, A subunit BI00649 287933 289429 + glutamyl-tRNA(Gln) amidotransferase, B subunit BI00650 289728 290789 + possible acetyltransferase BI00651 290803 291114 + conserved hypothetical protein BI00652 291501 293141 + conserved hypothetical protein BI00653 293363 294973 + BarJ BI00654 295245 297248 + transcription termination factor Rho BI00655 297358 297501 + hypothetical protein BI00656 297559 297945 + chorismate mutase BI00657 298070 300151 + cell wall surface anchor family protein, putative BI00658 300383 303220 valyl-tRNA synthetase, putative BI00659 303262 304686 ABC transporter, periplasmic substrate-binding protein, putative BI00660 304850 305533 endonuclease III BI00661 305595 306374 transcriptional regulator BI00662 306556 307212 membrane protein, putative BI00663 307369 307950 integral membrane protein in the upf0059 BI00664 308187 308678 inorganic pyrophosphatase BI00665 308908 311145 alpha-amylase family protein BI00666 311386 313377 + conserved hypothetical protein BI00667 313988 315019 + homoserine O-succinyltransferase BI00668 315484 316293 + ATP synthase F0, A subunit BI00669 316400 316624 + ATP synthase F0, C subunit BI00670 316684 317199 + ATP synthase F0, B subunit BI00671 317237 318070 + ATP synthase F1, delta subunit BI00672 318149 319777 + ATP synthase F1, alpha subunit BI00673 319784 320704 + ATP synthase F1, gamma subunit BI00674 320716 322185 + ATP synthase F1, beta subunit BI00675 322188 322478 + ATP synthase F1, epsilon subunit, putative BI00676 322539 323336 + Predicted nuclease of the RecB family BI00677 323388 324374 possible secreted peptidyl-prolyl cis-trans isomerase protein BI00678 324455 325531 + conserved hypothetical protein BI00679 325534 326538 + conserved hypothetical protein BI00680 326790 327761 + thioredoxin [imported], putative BI00681 327850 328473 Adenylate cyclase BI00682 329012 329398 + endoribonuclease L-PSP, putative BI00683 329536 330498 + Acyltransferase domain protein BI00684 330595 331593 + glycerol-3-phosphate dehydrogenase, NAD-dependent BI00685 331783 332967 + D-ala D-ala ligase BI00686 333223 334386 + ABC transporter, periplasmic substrate-binding protein BI00687 334206 335348 + spermidine/putrescine ABC transporter, permease protein, putative BI00688 335348 336199 + spermidine/putrescine ABC transporter, permease protein, putative BI00689 336207 337481 + spermidine/putrescine ABC transporter, ATP-binding protein BI00690 337788 338828 + CAAX amino terminal protease family protein family BI00691 338873 339667 Mechanosensitive ion channel family BI00692 339751 341181 aspartate ammonia-lyase BI00693 341302 342030 transcriptional regulator, TetR family domain protein BI00694 342124 343527 conserved hypothetical protein BI00695 343852 344400 methylated-DNA--protein-cysteine methyltransferase BI00696 345228 346055 + hypothetical protein with helix turn helix motif BI00697 345928 347202 MFS transporter family protein, putative BI00698 347393 348406 ribokinase [imported] BI00939t 348735 349001 + ribosomal protein L28 BI00699 349116 351944 + ATP-dependent DNA helicase RecG BI00700 352204 352782 + methyltransferase, putative BI00701 352812 353624 tRNA (guanine-N1)-methyltransferase BI00702 353623 355341 + Unknown BI00703 355422 356399 + conserved hypothetical protein BI00704 356482 357354 + 4-diphosphocytidyl-2C-methyl-D-erythritol synthase, putative BI00705 357367 358041 + pyrrolidone-carboxylate peptidase, putative BI00706 358303 359766 + IgA-specific serine endopeptidase, putative BI00707 359884 361224 + aminopeptidase C BI00708 361519 362649 + phospho-2-dehydro-3-deoxyheptonate aldolase BI00709 362781 364010 + phospho-2-dehydro-3-deoxyheptonate aldolase BI00710 364141 364845 + MTA/SAH nucleosidase BI00711 365444 366427 + hypothetical ATPase, histidine kinase-, DNA gyrase B-, and HSP90-like domain protein BI00712 366563 367330 + DNA-binding response regulator RegX3 BI00713 367583 368713 + phosphate ABC transporter, phosphate-binding protein BI00714 368927 369877 + pstC2 BI00715 369997 370875 + phosphate ABC transporter, permease protein BI00716 370931 371707 + phoT BI00717 372005 372580 + lemA protein BI00718 372647 374902 + conserved hypothetical protein BI00719 374971 375831 + oxidoreductase, aldo/keto reductase family BI00720 375932 376981 + inosine-uridine preferring nucleoside hydrolase BI00721 377109 377729 16S rRNA processing protein RimM BI00722 377755 377985 KH domain protein BI00723 378009 378467 ribosomal protein S16 BI00724 378703 379809 Endonuclease/Exonuclease/phosphatase family family BI00725 379889 381634 signal recognition particle protein BI00726 381843 382748 + cation efflux family protein superfamily BI00727 382773 384488 cysteinyl-tRNA synthetase BI00728 384518 385363 + possible amidotransferase BI00729 385627 387687 + ABC transporter, ATP-binding protein BI00730 387746 388162 plasmid stability protein StbB BI00731 388175 388450 hypothetical protein BI00732 388609 389160 acetolactate synthase, small subunit BI00733 389180 391144 acetolactate synthase, large subunit, biosynthetic type BI00734 391308 392033 ribonuclease III BI00735 392189 392380 ribosomal protein L32 BI00736 392472 393098 Uncharacterized ACR, COG1399 BI00737 393191 394078 conserved hypothetical protein BI00738 394089 394586 pantetheine-phosphate adenylyltransferase BI00739 394860 395150 + conserved hypothetical protein BI00740 395198 396205 K+ channel, beta subunit BI00741 396379 396804 + transcription regulator, MerR family NMB1303 [imported], putative BI00742 396910 397533 hypothetical transmembrane protein with unknown function BI00743 397764 399083 + nicotinate phosphoribosyltransferase, putative BI00744 399381 400142 + ribonuclease PH BI00745 400189 400944 + Ham1 family BI00746 401106 402659 + hypothetical FemAB family BI00747 402736 404043 + FemAB family protein, putative BI00748 404096 405373 + beta-lactam resistance factor, putative BI00749 405462 406460 membrane protein, putative BI00750 407182 408879 + glucose-6-phosphate isomerase BI00751 409515 409877 + ribosomal protein L19 BI00752 410047 410901 + lepB BI00753 411024 411860 + ribonuclease HII BI00754 411990 413102 + transcription regulator, LacI family [imported] BI00755 413261 414904 + probable sugar kinase BI00756 414992 415681 + sugar isomerase BI00757 416114 417430 + L-arabinose isomerase BI00758 417620 418240 trp-G type glutamine amidotransferase/dipeptidase BI00759 418178 420178 + membrane protein, putative BI00760 420330 421694 + permease, putative BI00761 421694 422914 + transmembrane protein Vexp1, putative BI00762 422930 423562 + Vexp2 BI00763 423886 425706 long-chain-fatty-acid--CoA ligase, putative BI00764 425820 426098 + fragment of arabinose permease BI00765 426765 429890 + hypothetical ABC transporter BI00766 430170 430436 major facilitator family transporter CC0814 [imported], putative BI00767 431272 432618 + solute binding protein of ABC transporter system BI00768 432750 433799 + sugar ABC transporter, permease protein, putative BI00769 433820 434809 + Unknown BI00770 435125 437128 + beta-D-galactosidase, putative BI00771 437175 438227 + transcription regulator, LacI family [imported], putative BI00772 438426 441116 + arabinogalactan endo-1,4-beta-galactosidase, putative BI00773 441755 442621 + oxidoreductase, aldo/keto reductase family BI00774 442628 443368 + conserved hypothetical protein BI00775 443378 444745 conserved hypothetical protein BI00776 445003 446367 + transport protein, NRAMP family BI00777 446472 448073 drug resistance transporter, EmrB/QacA subfamily BI00778 448424 450007 + glycosyl transferase CpsE BI00779 450302 452029 + COG0840: Methyl-accepting chemotaxis protein BI00780 452064 453566 + possible Etk-like tyrosine kinase involved in Eps biosynthesis BI00781 453760 454725 + hypothetical glycosyl transferase, group 1 family protein BI00782 454725 456065 + putative glycosyltransferase protein BI00783 456065 457126 + NAD dependent epimerase/dehydratase family protein BI00784 457201 458448 + UDP-glucose 6-dehydrogenase BI00785 458489 459550 + hypothetical glycosyl transferase, group 1 family protein BI00786 459581 460408 + hypothetical Eps11I BI00787 460446 460952 + hypothetical Bacterial transferase hexapeptide (three repeats) BI00788 460985 461998 + hypothetical Capsular polysaccharide synthesis protein BI00789 462020 463360 + hypothetical protein BI00790 463363 464292 + Eps9K BI00791 464362 465753 + hypothetical Polysaccharide biosynthesis protein BI00792 465789 466280 + hypothetical Bacterial transferase hexapeptide (three repeats) BI00793 466366 467514 NAD-dependent epimerase/dehydratase family protein, putative BI00794 467785 468363 transposase, degenerate BI00795 468615 468770 hypothetical COG2963: Transposase and inactivated derivatives BI00796 469189 470208 + dTDP-glucose 4,6-dehydratase BI00797 470347 471303 + dTDP-4-dehydrorhamnose 3,5-epimerase BI00798 471349 472245 + glucose-1-phosphate thymidylyltransferase BI00799 472858 473046 hypothetical protein BI00800 473371 473802 conserved hypothetical protein BI00801 474083 474640 hypothetical Low molecular weight phosphotyrosine protein phosphatase BI00802 474825 475331 hypothetical protein BI00803 475655 475867 hypothetical Helix-turn-helix BI00804 475860 476042 hypothetical protein BI00805 475971 476312 + hypothetical protein BI00806 476415 477422 conserved hypothetical protein BI00807 477471 478751 + narrowly conserved hypothetical protein BI00808 477495 477866 thioredoxin BI00809 478880 479734 + 3-oxoadipate enol-lactonase, putative BI00810 479747 481036 + MutT/nudix family protein BI00811 481065 481475 + glycine cleavage system H protein BI00812 481547 482875 + conserved hypothetical protein BI00813 482973 485453 + protease II BI00814 485521 486549 + 3-isopropylmalate dehydrogenase BI00815 486610 487692 + lipoate-protein ligase a BI00817 487934 488650 + probable transcriptional regulator with cyclic nucleotide-binding domain BI00818 488757 491069 + ponA, putative BI00819 491264 492634 + NADH-dependent flavin oxidoreductase, putative BI00820 492807 493955 dihydroorotate dehydrogenase, putative BI00821 494409 495122 + glycerol-3-phosphate regulon repressor BI00822 495118 496365 + galactose-1-phosphate uridylyltransferase BI00823 496241 497632 + galactokinase BI00824 497718 497987 + ACT domain protein BI00825 498201 499487 + similar to unknown proteins BI00826 499800 500516 spoU BI00827 500612 501463 + mutY BI00828 501531 502250 + conserved hypothetical protein BI00829 502633 505968 + DNA-directed RNA polymerase, beta subunit BI00830 506139 510173 + DNA-directed RNA polymerase, beta-prime subunit BI00831 510338 510967 FHA domain protein BI00832 510986 511498 hypothetical protein Blon020438 BI00833 511528 512457 possible phosphoprotein phosphatase BI00834 512457 514967 membrane protein, putative BI00835 514967 516187 Protein of unknown function family BI00836 516215 517585 moxR2 BI00837 517599 523580 cell wall surface anchor family protein, putative BI00838 523750 525168 serine/threonine protein kinase, putative BI00839 525300 529592 + hypothetical COG0210: Superfamily I DNA and RNA helicases BI00840 529427 533620 + UvrD/REP helicase domain protein BI00841 533962 535152 + possible transport protein BI00842 535527 536243 + dihydrodipicolinate reductase BI00843 536388 537311 + dihydrodipicolinate synthase BI00844 537585 539246 + metallo-beta-lactamase superfamily protein BI00845 539291 541897 + Peptidase family M1 domain protein BI00846 542078 542971 + hypothetical transmembrane protein with unknown function BI00847 543164 543502 + conserved hypothetical protein BI00848 543954 545336 + phosphoglucosamine mutase BI00849 545362 546012 + polypeptide deformylase BI00850 546072 547472 + conserved hypothetical protein BI00851 547492 547620 + hypothetical protein BI00852 547858 548979 + peptide chain release factor 2 BI00853 548991 550121 + ftsE BI00854 550135 551055 + cell division ABC transporter, permease protein FtsX, putative BI00855 551161 552519 + autolysin, putative BI00856 552673 553146 + SsrA-binding protein BI00857 553192 554265 + amino acid ABC transporter, permease protein BI00858 554479 555420 + amino acid ABC transporter, permease protein BI00859 555554 556546 + amino acid ABC transporter, permease protein BI00860 556566 557393 + glutamine ABC transporter, ATP-binding protein BI00861 557604 559493 + glucosamine--fructose-6-phosphate aminotransferase, isomerizing BI00862 559699 560271 + COG0564: Pseudouridylate synthases, 23S RNA-specific BI00863 560313 560525 hypothetical protein Blon020898 BI00864 560565 561548 transcriptional regulator, LacI family, putative BI00865 561794 562717 + sugar ABC transporter, permease protein, putative BI00866 562776 563780 + Unknown BI00867 563975 566047 + beta-D-galactosidase BI00868 566259 567185 + transcriptional regulator, LacI family, putative BI00869 567311 569008 alpha-L-arabinofuranosidase BI00870 569168 570517 + solute binding protein of ABC transporter system BI00871 570852 572192 + probable solute binding protein of ABC transporter system for sugars BI00872 572449 573729 + sugar binding protein Sbp BI00873 573795 574562 transcription activator, probable Baf family [imported] BI00874 574688 576304 + ABC transporter, periplasmic substrate-binding protein, putative BI00875 576372 577346 + membrane protein, putative BI00876 577346 578245 + peptide ABC transporter, permease protein, putative BI00877 578245 579033 + ABC transporter, nucleotide binding/ATPase protein BI00878 579029 579811 + ABC transporter, ATP-binding protein BI00879 580296 581360 + cystathionine beta-synthase BI00880 581455 582636 + cystathionine beta-lyase BI00881 582780 584501 ErfK/YbiS/YcfS/YnhG family BI00882 584781 586613 + ATP-dependent DNA helicase RecQ BI00883 586729 587220 + autoinducer-2 production protein LuxS BI00884 587453 587917 + acetyltransferase, GNAT family, putative BI00885 588181 589638 hypothetical protein Blon020876 BI00886 589890 591347 amino acid permease BI00887 591542 592891 + alanine racemase BI00888 593087 594370 + deoxyguanosinetriphosphate triphosphohydrolase, putative BI00889 594546 596642 + DNA primase, putative BI00890 596961 597710 + pyridoxine biosynthesis protein BI00891 597799 598434 + SNO glutamine amidotransferase family superfamily BI00892 598495 600156 + aminotransferase, class I, putative BI00893 600514 601443 + asparaginase family protein BI00894 601476 601607 + hypothetical protein Blon020867 BI00895 601574 601897 hypothetical protein BI00896 601995 603179 + possible transport protein BI00897 603210 603467 hypothetical protein Blon020865 BI00898 603634 603723 + hypothetical protein BI00899 603651 605795 similar to alpha-L-arabinofuranosidase A BI00900 605923 606921 + EF0065, putative BI00901 607014 608087 conserved hypothetical protein BI00902 608687 609373 + ABC transporter, ATP-binding protein BI00903 609373 610545 + conserved hypothetical protein BI00904 610560 612116 + ABC transporter, ATP-binding protein BI00905 612106 614304 1-deoxyxylulose-5-phosphate synthase BI00906 614478 615467 + oxidoreductase, zinc-binding, putative BI00907 615572 616069 + phosphoribosylaminoimidazole carboxylase, catalytic subunit BI00908 616095 617231 + phosphoribosylaminoimidazole carboxylase, ATPase subunit BI00909 617243 617668 + furB BI00910 617709 617954 conserved hypothetical protein BI00911 618183 619103 + possible solute binding protein of ABC transporter system BI00912 619367 621439 + membrane protein, putative BI00913 621563 623197 + aldehyde dehydrogenase BI00914 623577 624842 phosphoribosylamine--glycine ligase BI00915 624872 625702 phosphoribosylformylglycinamidine cyclo-ligase BI00916 626029 627537 amidophosphoribosyltransferase BI00917 627944 628726 glutamine ABC transporter, ATP-binding protein BI00918 628726 629610 amino acid ABC transporter, permease protein BI00919 629723 630583 amino acid ABC transporter, periplasmic amino acid-binding protein BI00920 630788 631255 conserved hypothetical protein BI00921 631328 632698 Atz/Trz family protein, putative BI00922 632741 634240 S-adenosyl-L-homocysteine hydrolase, NAD binding domain BI00923 634405 635991 + structural gene for ultraviolet resistance BI00924 635991 636206 + hypothetical protein Blon020836 BI00925 636246 637220 K+ channel, beta subunit BI00926 637331 638293 transcriptional regulator, HTH_1 family, putative BI00927 638512 640023 + Na+/H+ antiporter, putative BI00928 640043 640699 membrane protein, putative BI00929 640699 642066 conserved hypothetical protein BI00930 642042 643337 possible carboxylesterase or lipase BI00931 643478 647209 phosphoribosylformylglycinamidine synthase BI00932 647275 648024 phosphoribosylaminoimidazole-succinocarboxamide synthase BI00933 648113 648232 hypothetical protein BI00934 648420 649754 phosphoribosylglycinamide formyltransferase 2 VC1228 [imported] BI00935 649928 651085 + type 1 capsular polysaccharide biosynthesis protein J (capJ) BI00936 651238 652260 conserved hypothetical protein BI00937 652822 653880 + transporter BI00938 654695 654967 + ribosomal protein S12 BI00939 654976 655443 + ribosomal protein S7 BI00940 655478 657598 + translation elongation factor G BI00941 657774 658970 + translation elongation factor Tu BI00942 659184 659909 + conserved hypothetical protein BI00943 660169 660864 + transcriptional regulator, LysR family, putative BI00944 661085 662098 + membrane protein, putative BI00945 662161 662637 COG2246: Predicted membrane protein BI00946 662721 663083 CrcB protein BI00947 663086 663619 protein with similarity to CrcB BI00948 663706 663987 + hypothetical protein BI00949 664023 665063 + alcohol dehydrogenase, zinc-containing BI00950 665437 665625 + hypothetical protein BI00951 665652 667028 conserved hypothetical protein BI00952 667295 667462 possible MarR-type transcriptional regulator BI00953 667902 670487 + excinuclease ABC, subunit A BI00954 670548 671903 + MATE efflux family protein, putative BI00955 671914 672603 + endonuclease III, putative BI00956 672783 673076 hypothetical protein Blon020400 BI00957 673098 673766 + Unknown BI00958 673782 674042 hexapeptide-repeat containing-acetyltransferase BI00959 674207 675292 + possible integral membrane permease protein BI00960 675273 675902 + hypothetical Glycosyl hydrolases family 2, TIM barrel domain BI00961 676090 677316 glutamine synthetase, type I BI00962 677846 678625 narrowly conserved hypothetical transmembrane protein BI00963 678712 680199 dihydrolipoamide dehydrogenase BI00964 680351 680971 conserved hypothetical protein BI00965 681063 682427 + widely conserved protein in peptidase or deacetlylase family BI00966 682730 683326 + conserved hypothetical protein BI00967 683329 684801 + ABC transporter, ATP-binding protein, putative BI00968 684801 685625 + possible permease, protein of ABC transporter for cobalt BI00969 685824 686699 + spoU rRNA methylase family protein [imported] BI00970 686891 687820 + phenylalanyl-tRNA synthetase, alpha subunit BI00971 687831 690437 + phenylalanyl-tRNA synthetase, beta subunit BI00972 690471 691154 + conserved hypothetical protein BI00973 691385 692347 + N-acetyl-gamma-glutamyl-phosphate reductase BI00974 692434 693519 + arginine biosynthesis bifunctional protein ArgJ BI00013g 693503 693979 hypothetical protein Magn025872 BI00975 693809 694612 + acetylglutamate kinase BI00976 694605 695897 + acetylornithine aminotransferase BI00977 695944 696906 + ornithine carbamoyltransferase BI00978 696906 697415 + arginine repressor BI00979 697501 698736 + argininosuccinate synthase BI00980 699184 700653 + argininosuccinate lyase BI01326t 701005 701196 + thiamine biosynthesis protein ThiS BI00981 701211 702077 + thiG protein BI00982 702157 702963 + moeB BI00983 703023 703376 + rhodanese-like domain protein BI00984 703541 704071 + HD domain protein BI00985 703978 704835 + hypothetical BI00986 704964 706283 + tyrosyl-tRNA synthetase BI00987 706314 708086 + hypothetical protein BL1050 BI00988 708098 709135 + Predicted sugar phosphatases of the HAD superfamily BI00989 709395 710165 + hemolysin A BI00990 710153 710719 conserved hypothetical protein BI00991 710729 710881 + hypothetical protein BI00992 710965 711624 similar to a bacterial K(+)-uptake system BI00993 711678 713141 Cation transport protein domain protein BI00994 713388 714407 + poly(P)/ATP-NAD kinase BI00995 714410 716233 + DNA repair protein RecN BI00996 716266 716910 + hydrolase, haloacid dehalogenase-like family, putative BI00997 717154 717525 + transcriptional regulator, GntR family BI00998 717550 718467 + ABC transporter, ATP-binding protein BI01351t 718477 719091 + membrane protein, putative BI00999 719985 722768 calcium-translocating P-type ATPase, PMCA-type BI01000 722966 723238 + hypothetical protein BL1037 BI01001 723291 724778 threonine synthase BI01356t 725001 725699 + serine hydroxymethyltransferase BI01002 726028 727116 + gamma-glutamyl phosphate reductase BI01003 727134 727694 + conserved hypothetical protein BI01004 727694 728476 + nicotinate (nicotinamide) nucleotide adenylyltransferase BI01005 728580 729857 glycosyl hydrolase, family 3, putative BI01006 729952 733203 + Uncharacterized ACR BI01007 733340 733834 + phosphinothricin acetyltransferase BI01008 734033 734629 + peptidyl-tRNA hydrolase BI01009 734622 738203 + transcription-repair coupling factor BI01010 738346 739290 + oxidoreductase, putative BI01011 739444 740739 + enolase BI01012 740809 741423 + hypothetical Septum formation initiator BI01013 741423 741986 + conserved hypothetical protein BI01014 742052 743050 + possible exopolyphosphatase-like protein BI01015 743578 744711 + IS30 family, transposase [imported] BI01016 744846 747062 + L-serine dehydratase 1 BI01018 747207 747611 + peptidyl-prolyl cis-trans isomerase, FKBP-type BI01019 747713 748189 + transcription elongation factor GreA BI01020 748250 749191 hemolysin, putative BI01021 749361 750086 + conserved hypothetical protein BI01022 750474 751736 + histidine kinase-like protein BI01023 751815 752090 hypothetical Transcription factor WhiB BI01024 752207 753922 diarrheal toxin BI01025 754203 755633 Transcriptional regulator BI01389t 755884 756180 + whiB1 BI01026 756350 759319 + membrane protein, putative BI01027 759319 760857 + LPXTG-motif cell wall anchor domain protein, putative BI01028 760966 761391 conserved hypothetical protein BI01029 761660 762283 + conserved hypothetical protein BI01030 762332 763015 + Phosphoribosyl transferase domain protein BI00019g 762937 763509 hypothetical Peptidase family S24 BI01031 763391 764464 sensory box histidine kinase, putative BI01032 764464 765183 DNA-binding response regulator MtrA BI01033 765222 767432 1,4-alpha-glucan branching enzyme BI01034 767649 768239 + possible transcriptional regulator BI01035 768351 768872 + 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase BI01036 768930 769760 zinc ABC transporter, permease protein, putative BI01037 769830 770834 ABC transporter, ATP-binding protein BI01038 770893 772419 possible solute binding protein of ABC transporter system BI01039 772190 773062 + methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase BI01040 773185 774657 + ribosomal protein S1 [imported] BI01041 774834 775448 + dephospho-CoA kinase BI01042 775463 777571 + excinuclease ABC, B subunit BI01043 777887 778726 + TerC family protein [imported] BI01044 778897 780336 + pyruvate kinase BI01045 780490 781086 possible NTP pyrophosphatase in MutT family BI01046 781432 782214 + response regulator BI01047 782278 785127 + DNA polymerase I BI01048 785291 786217 + conserved hypothetical protein TIGR00486 BI01049 786266 786937 + MutT/nudix family protein, putative BI01050 787135 789132 + glycogen operon protein GlgX BI01424t 789186 789413 + hypothetical protein with helix turn helix motif BI01051 789420 790067 + conserved hypothetical protein BI01052 790243 790794 DNA-3-methyladenine glycosylase I BI01053 791884 792942 hypothetical protein BI01054 793226 793780 + hypothetical protein BI01055 793761 794246 hypothetical protein BI00021g 794049 794498 + transposase B BI00020g 794300 794749 + IS1601-D BI01056 794665 794844 + transposase subunit B BI01057 794937 795989 integrase/recombinase XerC, probable [imported], putative BI01434t 795989 796876 probable integrase/recombinase BI01058 796951 798150 probable integrase/recombinase BI01059 798284 799564 IS3-Spn1, transposase BI01060 799635 800477 putative transposase subunit BI01061 800762 802579 hypothetical Protein of unknown function DUF262 BI01062 802742 803464 hypothetical protein BI01063 803748 804065 conserved hypothetical protein BI01064 804058 804405 hypothetical protein BI01065 804667 808221 + DNA polymerase III, alpha chain VC2245 [imported] BI01066 808312 808743 + conserved hypothetical protein BI01067 808952 810826 + antigen, 67 kDa BI01068 810916 811413 + NH2-acetyltransferase BI01069 817553 818377 oxidoreductase, aldo/keto reductase family BI01070 818538 819956 + sugar kinase, FGGY family, putative BI01451t 819972 820262 + Acylphosphatase BI01071 820382 821761 + histidinol dehydrogenase BI01072 821761 822918 + histidinol-phosphate aminotransferase BI01073 823007 823603 + imidazoleglycerol-phosphate dehydratase BI01074 823606 824397 + hypothetical protein Blon020586 BI01075 824435 825079 + imidazole glycerol phosphate synthase, glutamine amidotransferase subunit BI01076 825152 825874 + bifunctional HisA/TrpF protein BI01077 825984 826103 narrowly conserved hypothetical protein BI01463t 826039 827637 conserved hypothetical protein BI01078 827738 828898 + Glutamine synthetase, catalytic domain BI01079 829137 829604 + transporter, putative BI01080 829657 830625 conserved hypothetical protein BI01081 830625 834758 ATP-dependent helicase HrpA BI01082 834751 835404 conserved hypothetical protein BI01083 835647 837065 + GTP-binding protein BI01084 837405 838208 + L-lactate dehydrogenase BI01085 838356 839291 cation efflux system protein BI01086 839460 840182 LexA repressor BI01087 840333 840680 + LysM domain protein BI01088 840736 841173 + conserved hypothetical protein TIGR00244 BI01089 841314 842510 D-3-phosphoglycerate dehydrogenase BI01090 842524 844800 COG3973: Superfamily I DNA and RNA helicases BI01091 845133 845651 + conserved hypothetical protein TIGR00242 BI01092 845654 846730 + S-adenosyl-methyltransferase MraW BI01093 846740 847186 + hypothetical protein Blon020568 BI01094 847186 848985 + penicillin-binding protein, putative BI01095 849015 849884 + conserved hypothetical protein BI01096 849936 851384 + UDP-N-acetylmuramoylalanyl-D-glutamyl-2,6-diami- nopimelate--D-alanyl-D-alanyl ligase BI01097 851453 852535 + phospho-N-acetylmuramoyl-pentapeptide-transferase BI01098 852593 854035 + UDP-N-acetylmuramoylalanine--D-glutamate ligase BI01099 854025 855239 + cell division protein, FtsW/RodA/SpoVE family, putative BI01100 855258 856436 + UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase BI01101 856651 858075 + UDP-N-acetylmuramate--alanine ligase BI01102 858078 859139 + hypothetical Cell division protein FtsQ BI01103 859565 860983 + hypothetical Appr-1-p processing enzyme family BI01104 861241 861813 + unknown BI01105 861640 861885 hypothetical protein BI01106 861906 862391 + D-tyrosyl-tRNA(Tyr) deacylase BI01107 862494 863735 glucose/galactose transporter, putative BI01108 863844 864230 hypothetical glyoxalase family protein BI01109 864308 865201 fructokinase, putative BI01110 865277 866488 transcription regulator ROK family VC2007 [imported], putative BI01111 866715 867626 + glucokinase, putative BI01112 867792 868913 NagC/XylR-type transciptional regulator BI01113 869251 870060 + glucosamine-6-phosphate isomerase BI01114 870119 871393 + N-acetylglucosamine-6-phosphate deacetylase BI01115 871646 873307 + dipeptide ABC transporter, dipeptide-binding protein BI01116 873480 874568 + oligopeptide ABC transporter, permease protein BI01117 874714 875739 + dipeptide ABC transporters, permease protein BI01118 875746 877452 + ATP binding protein of ABC transporter BI01119 877508 878026 MutT/nudix family protein BI01120 878078 879670 Xaa-Pro aminopeptidase I BI01121 879977 880954 conserved hypothetical protein BI01122 882044 883672 + folC BI01123 883736 887410 + SMC family, C-terminal domain family BI01124 887535 888527 conserved hypothetical protein BI01125 888652 890202 UDP-N-acetylmuramoylalanyl-D-gluta- mate-2,6-diaminopimelate ligase BI01126 890377 891126 + RNA polymerase sigma-70 factor, ECF subfamily BI01127 891129 891446 + conserved hypothetical protein BI01128 891719 892660 Aldose 1-epimerase superfamily BI01129 892788 893741 Aldose 1-epimerase superfamily BI01130 894032 895021 + hydroxymethylbutenyl pyrophosphate reductase BI01131 895067 895573 transcriptional regulator, putative BI01132 895670 896725 glyceraldehyde-3-phosphate dehydrogenase, type I BI01133 896968 897690 Thiamin pyrophosphokinase, catalytic domain family BI01134 897586 898923 + hypothetical Spermine/spermidine synthase BI01135 899364 899930 + Translation initiation factor IF-3, C-terminal domain BI00041g 899764 900105 + ribosomal protein L35 BI01136 900161 900541 + ribosomal protein L20 BI01137 900605 901537 + Integrase BI01138 901668 904511 + ABC transporter, ATP-binding protein BI01139 904656 905612 + Soj family protein BI01140 905634 906545 + Uncharacterised ACR, COG1354 BI01141 906675 907274 + conserved hypothetical protein TIGR00281 BI01142 907409 908233 + MutT/nudix family protein BI01143 908296 909573 + quinolinate synthetase complex, A subunit BI01144 909668 911296 + L-aspartate oxidase BI01145 911303 912193 + nicotinate-nucleotide pyrophosphorylase BI01146 912292 913443 + possible pyridoxal-phosphate-dependent aminotransferase BI01147 913478 914824 + major facilitator family transporter BI01148 915142 917070 + GTP-binding protein TypA BI01149 917197 917616 + conserved hypothetical protein BI01150 917699 918673 + prephenate dehydratase, putative BI01151 918670 919734 + prephenate dehydrogenase BI01152 919947 920201 + conserved hypothetical protein BI01153 920239 921303 + phage integrase family protein BI01154 921559 923196 + solute binding protein of ABC transporter system possibly for peptides BI01155 923500 924423 + dppB BI01156 924445 925446 + dppC BI01157 925505 927478 + ABC-type transporter, duplicated ATPase component BI01158 927793 928650 exodeoxyribonuclease III BI01159 928775 929626 + conserved hypothetical protein BI01160 929645 930400 + narrowly conserved hypothetical transmembrane protein BI01161 930393 931658 + RNA methyltransferase, TrmA family BI01162 931673 932365 + lipoprotein, putative BI01163 932483 935032 + cation-transporting ATPase, E1-E2 family BI01164 935156 937852 + aconitate hydratase 1 BI01165 938001 938360 + Ribbon-helix-helix protein, copG family domain protein BI01166 938363 938851 + PIN domain, putative BI01167 938917 941019 Protein of unknown function DUF262 family BI01168 941112 941777 acetyltransferase, GNAT family family BI01169 941793 942608 DNA-binding response regulator, putative BI01170 942553 943935 atypical histidine kinase sensor of two-component system BI01171 944117 944959 + conserved hypothetical protein BI01172 945143 946039 + membrane protein, putative BI01173 946326 947195 + membrane protein, putative BI01174 947234 948073 GTP pyrophosphokinase [imported] BI01175 948115 949554 + tRNA-i(6)A37 thiotransferase enzyme MiaB BI01176 949568 950551 + tRNA delta(2)-isopentenylpyrophosphate transferase BI01177 950591 951517 Fic protein family family BI01178 951663 954437 + cell division protein FtsK BI01179 954635 955267 + CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase BI01180 955282 955812 + competence/damage-inducible protein CinA domain protein BI01181 955881 956387 + possible DNA binding protein BI01182 956502 956732 + conserved hypothetical protein BI01183 957036 958226 + recA protein BI01184 958232 958822 + regulatory protein RecX BI01185 959702 960361 + S30AE family protein BI01186 960556 963417 + preprotein translocase, SecA subunit BI00044g 963734 963970 COG3464: Transposase and inactivated derivatives BI01187 963974 964096 COG3464: Transposase and inactivated derivatives BI00045g 964219 964602 + hypothetical protein BL0497 BI01188 964674 965717 + anthranilate phosphoribosyltransferase BI01189 965964 966686 hypothetical transmembrane protein with unknown function BI01190 966447 967418 + hypothetical Acyltransferase BI01191 967476 969722 serine/threonine protein kinase, putative BI01192 969893 970858 idsA2 BI01193 971179 971838 + conserved hypothetical protein BI01194 972002 973465 + RNA polymerase principal sigma factor, sigma 70 BI01195 973526 975799 + DNA gyrase, subunit B BI01196 975969 977192 + membrane protein, putative BI01197 977269 978228 + ribokinase BI01198 978247 982977 + DEAD/DEAH box helicase domain protein BI01199 982994 983779 DNA-binding response regulator TcrA, putative BI01200 983927 986953 DNA gyrase A subunit BI01201 986925 988169 + conserved hypothetical protein BI01202 988185 989189 conserved hypothetical protein BI01203 989432 989722 + conserved hypothetical protein BI01204 989725 990198 + deoxyuridine 5triphosphate nucleotidohydrolase BI01205 990335 992656 + GTP pyrophosphokinase BI01206 992780 993058 orfB BI01207 993226 994425 + probable integrase/recombinase BI01640t 994500 995387 + probable integrase/recombinase BI01208 995387 996439 + integrase/recombinase XerC, probable [imported], putative BI01209 996532 997095 COG2801: Transposase and inactivated derivatives BI00053g 997107 997619 ASOPSNART-11OSRSI BI01210 997719 998264 possible peptidyl-prolyl cis-trans isomerase BI01211 998331 999296 COG3391: Uncharacterized conserved protein BI01212 999519 999623 hypothetical protein BI01213 999683 1000615 membrane protein, putative BI01214 1000747 1001295 + Hypothetical cytosolic protein BI01215 1001329 1002621 conserved hypothetical protein BI01216 1002648 1003532 + possible phosphoglycerate mutase BI01217 1003650 1004597 + magnesium transporter, CorA family BI01218 1004615 1005538 + glnH, putative BI01219 1005776 1008544 + leucyl-tRNA synthetase BI01220 1008708 1009484 + competence protein ComEA helix-hairpin-helix repeat region domain protein BI01221 1009553 1011235 + conserved hypothetical transmembrane protein related to ComA BI01222 1011378 1012721 + possible prolidase (X-Pro dipeptidase) or chlorohydrolase BI01223 1012791 1013759 + conserved hypothetical protein BI01224 1013783 1014346 + conserved hypothetical protein TIGR00150 BI01225 1014411 1015289 + conserved hypothetical protein BI01226 1015308 1015859 + ribosomal-protein-alanine acetyltransferase BI01227 1015859 1016899 + O-sialoglycoprotein endopeptidase BI01228 1017438 1017539 hypothetical protein BI01229 1017569 1018501 + probable integrase/recombinse BI01230 1018564 1018887 conserved hypothetical protein BI01231 1018909 1019787 conserved hypothetical protein BI01232 1019849 1020361 conserved hypothetical protein BI01233 1020474 1021376 Fic protein family family BI01234 1021357 1021929 hypothetical protein BL1463 BI01235 1021949 1023763 conserved hypothetical protein BI01236 1023782 1024864 conserved hypothetical protein BI01237 1024893 1025600 conserved hypothetical protein BI01238 1025761 1026843 possible TraG-related protein BI01239 1026843 1027799 hypothetical protein Blon020262 BI01240 1027799 1028164 hypothetical protein Blon020261 BI01242 1028379 1028669 + hypothetical protein Blon020260 BI01241 1028588 1030942 + DNA topoisomerase III BI01243 1030771 1031448 + hypothetical protein Blon020258 BI01244 1031753 1032193 + COG1758: DNA-directed RNA polymerase, subunit K/omega BI01245 1032161 1032553 hypothetical protein Blon020256 BI01246 1032621 1033400 Fic protein family family BI01247 1033518 1034822 + MC38, putative BI01248 1034848 1036128 PUTATIVE HIPA TRANSCRIPTION REGULATOR PROTEIN BI01249 1036128 1036439 hypothetical protein Blon020251 BI01250 1036545 1037675 conserved hypothetical protein BI01251 1038618 1040387 MC40 BI01252 1040507 1041145 conserved hypothetical protein BI01253 1041250 1042281 conserved hypothetical protein BI01254 1042389 1042865 conserved hypothetical protein BI01255 1043244 1044842 ATP binding protein-like protein BI01256 1044857 1046341 conserved hypothetical protein BI01257 1046369 1048195 lipoprotein, putative BI01258 1048370 1048669 conserved hypothetical protein BI01259 1048710 1049189 MC47, putative BI01713t 1049183 1050538 + hypothetical protein BL1487 BI01260 1049206 1050405 hypothetical protein BI01261 1050435 1051070 hypothetical protein Blon020236 BI01262 1051396 1056213 hypothetical COG2217: Cation transport ATPase BI01263 1056508 1057458 hypothetical protein Blon020231 BI01264 1057844 1058440 hypothetical COG1192: ATPases involved in chromosome partitioning BI01265 1059167 1059430 COG1192: ATPases involved in chromosome partitioning BI01266 1059569 1060042 possible WhiB-like transcription factor BI01267 1060036 1061400 conserved hypothetical protein BI01727t 1061400 1061597 hypothetical protein Blon020220 BI01268 1061748 1061894 hypothetical protein BI01730t 1061882 1062055 hypothetical protein Blon020217 BI01269 1062779 1062997 conserved hypothetical protein BI01270 1063127 1063546 + Helix-turn-helix domain protein BI01733t 1064092 1064778 + conserved hypothetical protein BI01271 1064862 1066490 lipoprotein, putative BI01272 1066742 1067959 isocitrate dehydrogenase, NADP-dependent BI01273 1068051 1069208 + IMP dehydrogenase family protein BI01274 1069373 1069861 + hypothetical protein Blon020211 BI01275 1069955 1072039 + long-chain-fatty-acid--CoA ligase, putative BI01276 1072049 1072534 + polypeptide deformylase BI01277 1072876 1073736 + ribosomal protein S2 BI01278 1073818 1074666 + translation elongation factor Ts BI01279 1074978 1075580 + uridylate kinase BI01280 1075660 1076208 + ribosome recycling factor BI01281 1076309 1077217 + phosphatidate cytidylyltransferase BI01282 1077557 1078597 + radical SAM enzyme, Cfr family BI01283 1078604 1079149 protease I BI01284 1079324 1080091 + imidazoleglycerol phosphate synthase, cyclase subunit BI01285 1080228 1080620 + phosphoribosyl-AMP cyclohydrolase BI01286 1080704 1082257 + anthranilate synthase component I BI01287 1082328 1082564 conserved hypothetical protein BI01288 1082576 1084174 + ATP binding protein of ABC transporter BI01289 1084221 1084925 + oxidoreductase, short-chain dehydrogenase/reductase family, putative BI01290 1084999 1085364 + narrowly conserved protein with unknown function BI01291 1085423 1086091 conserved hypothetical protein BI01292 1086091 1087701 ABC transporter, ATP-binding protein BI01293 1087704 1088600 possible ABC transporter permease for cobalt BI01294 1088405 1089049 narrowly conserved protein with unknown function BI01295 1089261 1090877 + conserved hypothetical protein BI01296 1090916 1091548 + conserved hypothetical protein BI01297 1091551 1095093 + hypothetical myosin-like protein with unknown function BI01298 1095170 1096351 + conserved hypothetical protein BI01299 1096680 1097084 + hypothetical protein BL0701 BI01300 1097367 1100384 + excinuclease ABC, A subunit BI01301 1100532 1102895 + excinuclease ABC, C subunit BI01302 1103007 1103975 + aroE BI01303 1103978 1104961 + Predicted P-loop-containing kinase BI01304 1105247 1106110 + Uncharacterized BCR, COG1481 BI01305 1106282 1107484 + phosphoglycerate kinase BI01306 1107546 1108346 + triosephosphate isomerase BI01307 1108365 1108658 + preprotein translocase, SecG subunit BI01308 1108763 1109710 + L-lactate dehydrogenase BI01309 1109710 1110558 + Cof family protein BI01310 1110672 1112225 + aminotransferase, class I BI01311 1112360 1113466 membrane protein, putative BI01312 1113642 1114943 branched-chain amino acid transport system II carrier protein BI01313 1115108 1116208 transaldolase BI01314 1116332 1118392 transketolase BI01315 1118812 1119927 + heat-inducible transcription repressor HrcA BI01316 1119986 1121128 + dnaJ protein BI01317 1121180 1121968 COG3001: Uncharacterized BCR BI01318 1122113 1122994 + undecaprenol kinase, putative BI01319 1123157 1124146 conserved hypothetical protein BI01320 1124807 1126837 + threonyl-tRNA synthetase BI01321 1127061 1127561 + HIT family protein BI01322 1127703 1128455 + conserved hypothetical protein TIGR01033 BI01323 1128464 1129045 + crossover junction endodeoxyribonuclease RuvC BI01324 1129106 1129729 + Holliday junction DNA helicase RuvA BI01325 1129732 1130793 + Holliday junction DNA helicase RuvB BI01326 1130876 1131292 + preprotein translocase, YajC subunit BI01327 1131359 1131937 + adenine phosphoribosyltransferase BI01328 1132037 1133236 + succinyl-CoA synthetase, beta subunit BI01329 1133239 1134147 + succinyl-CoA synthase, alpha subunit BI01330 1133954 1135546 + membrane protein, putative BI01331 1135497 1137131 + phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase BI01332 1137280 1137579 + hypothetical protein BI01333 1137484 1138449 aquaporin Z, putative BI01334 1138645 1139412 + ribosomal large subunit pseudouridine synthase B BI01335 1139514 1141538 + possible GTP-binding protein BI01336 1141896 1143422 + UDP-glucose pyrophosphorylase BI01337 1143565 1145475 + conserved hypothetical protein BI01338 1145489 1145803 + hypothetical protein Blon020144 BI01339 1145819 1148407 + helY BI01340 1148524 1148868 + conserved hypothetical protein BI01341 1149001 1149717 + hydrolase, haloacid dehalogenase-like family BI01833t 1149744 1149995 + conserved hypothetical protein BI01342 1150135 1150497 hypothetical protein Blon020140 BI01343 1150673 1151302 COG0789: Predicted transcriptional regulators BI01344 1151406 1151846 possible signal transduction protein BI01345 1151856 1152596 conserved hypothetical protein BI01346 1152693 1153022 small basic protein BI01347 1153025 1153999 conserved hypothetical protein BI01348 1153992 1154684 CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase, putative BI01349 1154623 1155471 ATP phosphoribosyltransferase BI01350 1155486 1155746 phosphoribosyl-ATP pyrophosphohydrolase BI01351 1155812 1156477 ribulose-phosphate 3-epimerase BI01352 1156556 1157500 prolipoprotein diacylglyceryl transferase BI01353 1157614 1158480 tryptophan synthase, alpha subunit BI01354 1158507 1160591 tryptophan synthase, beta subunit BI01355 1161120 1161968 endonuclease IV BI00066g 1161414 1162400 + amino acid permease BI01356 1162340 1162834 + amino acid permease BI01357 1162503 1162667 + amino acid permease BI01358 1163206 1164216 hypothetical membrane protein with unknown function BI01359 1164333 1164536 hypothetical protein BI01360 1164570 1164860 abortive infection protein AbiGI, putative BI01361 1164981 1165262 + hypothetical protein BI01362 1165260 1165715 lin2984 BI01363 1165903 1166406 + acetyltransferase, GNAT family, putative BI01364 1166567 1166746 + lin0863 BI01365 1166793 1167323 acetyltransferase, GNAT family BI01366 1167392 1167961 acetyltransferase, GNAT family BI01367 1168315 1168992 hypothetical protein BI01368 1169017 1169823 hypothetical protein BI01369 1169832 1170527 ABC transporter, ATP-binding protein BI01370 1170352 1171263 + hypothetical Response regulator receiver domain BI01371 1171317 1172225 + hypothetical protein BI01372 1172194 1172631 hypothetical Integral membrane protein BI01373 1172956 1173576 hypothetical protein BI01374 1173576 1174301 hypothetical protein BI01873t 1174309 1174962 bacteriocin ABC transporter, ATP-binding protein, putative BI01375 1175274 1176518 + IS30 family, transposase [imported] BI01376 1176714 1177379 DNA-binding response regulator BI01377 1177379 1179001 hypothetical ATPase, histidine kinase-, DNA gyrase B-, and HSP90-like domain protein BI01378 1179039 1179881 hypothetical permease, putative BI01379 1180057 1180956 ABC transporter, ATP-binding protein BI01380 1181077 1181259 + hypothetical protein BI01381 1181154 1181684 hypothetical protein BI01382 1182016 1182315 + BlsA BI01383 1182321 1182662 + hypothetical protein BI01384 1182847 1183050 hypothetical protein BI01385 1183324 1183446 + hypothetical protein BL0771 BI01386 1183489 1183932 + hypothetical protein Blon020116 BI01387 1183955 1184314 COG0388: Predicted amidohydrolase BI01388 1184376 1184531 hypothetical protein BI01389 1184840 1185853 inner membrane protein, 60 kDa VC0004 [imported] BI01390 1186097 1186555 hypothetical protein BI01391 1186942 1187067 + hypothetical protein BI01392 1187122 1188783 + amino acid permease BI01393 1188993 1189640 Signal peptidase I BI00067g 1189800 1190303 + conserved hypothetical protein BI01394 1189721 1190146 hypothetical protein Blon020104 BI01395 1190467 1191420 + lin0466 BI01396 1191479 1191799 + narrowly conserved hypothetical protein BI01397 1191887 1192165 + narrowly conserved hypothetical protein BI01398 1192540 1193727 + Unknown, putative BI01399 1193770 1195530 + YjeF family protein, putative BI01400 1195635 1196261 + possible alpha beta hydrolase BI01401 1196417 1197286 + transcriptional regulator, LysR family BI01402 1197447 1198565 conserved hypothetical protein BI01403 1198783 1198932 hypothetical protein BI01404 1199044 1199736 orotate phosphoribosyltransferase BI01405 1199748 1200716 dihydroorotate dehydrogenase BI01406 1200722 1201543 dihydroorotate dehydrogenase, electron transfer subunit BI01407 1201682 1202632 orotidine 5-phosphate decarboxylase BI01408 1202653 1203939 dihydroorotase BI01921t 1204146 1204562 Aspartate carbamoyltransferase regulatory chain, allosteric domain BI01409 1204565 1205524 aspartate carbamoyltransferase BI01410 1205669 1208896 glutamate-ammonia ligase adenylyltransferase family BI01411 1208955 1209905 EF0040 BI01412 1210042 1210893 5,10-methylenetetrahydrofolate reductase BI01413 1210955 1213255 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase BI01414 1213369 1213923 phosphohistidine phosphatase SixA, putative BI01415 1214024 1215091 conserved hypothetical protein BI01416 1215168 1215803 + serine esterase, putative BI01417 1215850 1216806 oxidoreductase, aldo/keto reductase 2 family BI01418 1217063 1217995 + lipC, putative BI01419 1218234 1219178 + hypothetical oxidoreductase, zinc-binding dehydrogenase family BI01420 1219340 1219642 probable ATP binding protein of ABC transporter BI01421 1220459 1221484 + transposase (25) BH3998 [imported], putative BI00069g 1221277 1221948 + hypothetical protein BI01422 1221948 1222706 + Tpase2 BI01423 1222896 1223972 + hypothetical protein BI01424 1224236 1224811 + hypothetical protein BI01425 1224888 1225190 transcriptional regulator, HTH_3 family BI01426 1225221 1226144 hypothetical protein BI01427 1226238 1227140 hypothetical protein BI01428 1227158 1228765 hypothetical protein BI01429 1229279 1230097 hypothetical ADP-ribosylglycohydrolase BI01430 1231271 1231726 hypothetical protein BI01431 1232085 1232906 + conserved hypothetical protein BI01432 1233000 1233539 bcp BI01433 1233681 1234511 probable amidase [imported] BI01434 1234511 1235365 hydrolase, haloacid dehalogenase-like family, putative BI01435 1235520 1236365 amino acid transport protein BI01436 1236462 1237709 possible glycosyltransferase BI01437 1237841 1238302 conserved hypothetical protein BI01438 1238382 1239917 gltD BI01439 1239922 1244265 Conserved region in glutamate synthase family BI01440 1244835 1245116 + transcription regulator, LacI family [imported] BI01441 1245175 1246197 conserved hypothetical protein BI01442 1246656 1246979 + conserved hypothetical protein BI01443 1247042 1247227 hypothetical protein BI01444 1247493 1248536 transcriptional regulator, LacI family, putative BI01445 1249246 1250073 + conserved hypothetical protein BI01446 1250275 1250571 hypothetical protein BI00071g 1250541 1250888 conserved hypothetical protein BI01447 1250658 1250807 + hypothetical protein BI01448 1251252 1252538 + MATE efflux family protein, putative BI01449 1252678 1252794 hypothetical protein BI01450 1253083 1254216 + IS30 family, transposase [imported] BI01451 1254323 1255327 glycerate kinase BI01452 1255679 1256734 + transcriptional regulator, LacI family, putative BI01453 1256820 1258094 oxygen-independent coproporphyrinogen III oxidase, putative BI01454 1258229 1259890 GTP-binding protein LepA BI01455 1260253 1260510 + ribosomal protein S20 BI01456 1260768 1261556 conserved hypothetical transmembrane protein with unknown function BI01457 1261807 1262703 transcriptional regulator, MazG family BI01458 1262903 1264027 branched-chain amino acid aminotransferase BI01459 1264254 1264871 ribosomal 5S rRNA E-loop binding protein Ctc/L25/TL5 BI01460 1265298 1266332 + conserved hypothetical protein BI01461 1266474 1267895 NAD(P) transhydrogenase, beta subunit [imported] BI01462 1267898 1268200 NAD(P) transhydrogenase, alpha subunit BI01463 1268219 1269379 NAD(P) transhydrogenase, alpha subunit [imported] BI01464 1269798 1271828 + long-chain-fatty-acid--CoA ligase BI01465 1271887 1272948 GTP-binding protein Era BI01466 1272953 1274383 CBS domain protein BI01467 1274462 1275052 conserved hypothetical protein TIGR00043 BI01468 1275000 1276172 PhoH family protein BI01469 1276194 1276529 Hit family protein BI01470 1276581 1277375 conserved hypothetical protein TIGR00046 BI01471 1277619 1278494 + spoU rRNA methylase family protein BI01472 1278758 1279939 + glucose-1-phosphate adenylyltransferase BI01473 1280035 1280532 mrp protein homolog BI01474 1280635 1281171 SUF system FeS assembly protein, NifU family BI01475 1281201 1282472 aminotransferase, class-V BI01476 1282614 1283390 FeS assembly ATPase SufC BI01477 1283419 1284651 FeS assembly protein SufD BI01478 1284660 1286156 FeS assembly protein SufB BI01479 1286383 1287849 conserved hypothetical protein BI01480 1288225 1289883 CTP synthase BI01481 1290032 1291585 dipeptidase, putative BI01482 1291684 1292127 3-dehydroquinate dehydratase, type II BI01483 1292294 1293835 3-dehydroquinate synthase BI01484 1293999 1295132 chorismate synthase BI01485 1295247 1295717 + COG0477: Permeases of the major facilitator superfamily BI01486 1295891 1297003 Uncharacterized BCR, YceG family COG1559 BI01487 1297083 1297535 conserved hypothetical protein TIGR00250 BI01488 1297550 1300228 alanyl-tRNA synthetase BI01489 1300359 1300592 hypothetical protein Blon020010 BI01490 1300595 1300990 conserved hypothetical protein BI01491 1301196 1301921 phosphoglycerate mutase BI01492 1302158 1304008 + Acyltransferase family domain protein BI01493 1304105 1304728 ribosomal protein S4 BI01494 1304930 1305895 ABC transporter, ATP-binding protein BI01495 1305900 1307114 hypothetical transmembrane protein with unknown function BI01496 1307208 1307603 conserved hypothetical protein BI01497 1307751 1310450 hypothetical UvrD/REP helicase BI01498 1310567 1311145 + xanthine phosphoribosyltransferase BI01499 1311199 1312560 + xanthine/uracil permease family protein BI01500 1312696 1312902 transcription regulator, Cro/CI family [imported]-related protein BI01501 1312912 1313169 hypothetical protein BI01502 1313326 1314144 hydrolase, alpha/beta fold family, putative BI01503 1314432 1315367 + conserved hypothetical protein BI01504 1315462 1315860 glyoxalase family protein BI01505 1316019 1316630 + isochorismatase BI01506 1316885 1318360 + conserved hypothetical protein BI01507 1318371 1319780 membrane protein, putative BI01508 1319770 1321005 membrane protein, putative BI01509 1321109 1322089 daunorubicin resistance ATP-binding protein BI01510 1322192 1322296 hypothetical protein BI01511 1322475 1323824 + histidine kinase sensor of two-component system BI01512 1323917 1324477 + DNA-binding response regulator BI01513 1324667 1325287 Protein of unknown function subfamily BI01514 1325308 1326324 phosphate transporter family protein BI01515 1326480 1326674 conserved hypothetical protein BI01516 1326735 1329005 carbon starvation protein A BI01517 1329406 1330668 + glycosyl hydrolase, family 13, putative BI01518 1330703 1331404 transcriptional regulator, TetR family, putative BI01519 1331486 1333669 possible ATP-dependent RNA helicase BI01520 1334052 1335338 uracil-xanthine permease BI01521 1335446 1336273 phosphoglycerate mutase family domain protein BI01522 1336327 1336905 conserved hypothetical protein BI01523 1337061 1337612 + conserved hypothetical protein BI01524 1337738 1338898 conserved hypothetical protein BI01525 1339275 1340816 conserved hypothetical protein BI01526 1341250 1341687 + hypothetical COG0653: Preprotein translocase subunit SecA (ATPase, RNA helicase) BI01527 1341752 1343449 + Protein kinase domain protein BI01528 1343493 1344980 permease, putative BI01529 1345295 1347565 drug resistance transporter, EmrB/QacA subfamily BI01530 1347576 1347776 hypothetical protein BI01531 1347947 1348309 + hypothetical Domain of unknown function (DUF307) BI01532 1348405 1349910 hypothetical protein BI01533 1349906 1351072 hypothetical protein BI01534 1351166 1351474 hypothetical protein BI02085t 1351280 1351477 + hypothetical protein Blon021394 BI01535 1351807 1352478 + COG4186: Predicted phosphoesterase or phosphohydrolase BI01536 1352565 1354004 + conserved hypothetical protein BI01537 1354044 1354253 + hypothetical protein BL0925 BI01538 1354253 1354612 + hypothetical protein BL0925 BI01539 1354729 1355193 + hypothetical protein BI01540 1355496 1356380 hypothetical protein BI01541 1356380 1357450 hypothetical Phage integrase family BI01542 1357650 1358675 + transposase (25) BH3998 [imported], putative BI00076g 1358468 1359139 + hypothetical protein BI01543 1359139 1359897 + Tpase2 BI01544 1360305 1361546 GTP-binding protein YchF BI01545 1361533 1362351 pyrroline-5-carboxylate reductase BI01546 1362416 1363891 proline iminopeptidase BI01547 1363977 1366433 + histidine kinase sensor of two-component system BI01548 1366551 1367345 + DNA-binding response regulator BI01549 1367384 1370233 possible transport protein BI01550 1370265 1371176 ABC transporters, ATP-binding protein BI01551 1371528 1372841 O-acetylhomoserine sulfhydrylase BI01552 1373315 1374184 + pyridoxal kinase, putative BI01553 1374424 1374924 + conserved hypothetical protein TIGR00252 BI01554 1374983 1376515 + Mg chelatase-related protein BI01555 1376515 1378212 + DNA processing protein DprA, putative BI01556 1378272 1380134 + sdhA BI01557 1380233 1381195 + sdhB BI01558 1381277 1381954 + probable methyltransferase BI01559 1382006 1382944 conserved hypothetical protein TIGR00730 BI01560 1383180 1384595 Na+/H+ antiporter [imported] BI01561 1385070 1386485 ATP-dependent Clp protease, ATP-binding subunit ClpX BI01562 1386610 1387308 ATP-dependent Clp protease, proteolytic subunit ClpP BI01563 1387317 1387907 ATP-dependent Clp protease, proteolytic subunit ClpP BI01564 1388046 1388423 hypothetical protein Blon021418 BI01565 1388538 1390001 voltage-gated chloride channel family protein, putative BI01566 1390189 1391565 trigger factor BI01567 1391623 1392921 3-5 exonuclease domain protein BI01568 1392921 1393730 COG0477: Permeases of the major facilitator superfamily BI01569 1393622 1394500 pyruvate formate-lyase 1 activating enzyme BI01570 1394613 1396985 formate acetyltransferase BI01571 1397254 1397475 conserved hypothetical protein BI01572 1397531 1399093 NH(3)-dependent NAD+ synthetase BI01573 1399577 1400725 Peptidase, M20/M25/M40 family BI01574 1400817 1401500 permease protein of ABC transporter system BI01575 1401500 1402702 ABC transporter, ATP-binding protein BI01576 1402839 1403816 lipoprotein, YaeC family BI01577 1404020 1404847 + hydrolase, haloacid dehalogenase-like family BI01578 1404975 1407449 D-xylulose 5-phosphate/D-fructose 6-phosphate phosphoketolase BI01579 1407895 1409454 + GMP synthase BI01580 1409723 1410304 + COG0798: Arsenite efflux pump ACR3 and related permeases BI01581 1410343 1410720 + arsenical resistance protein/arsenate reductase BI01582 1411265 1411771 + hypothetical Transposase IS66 family BI00078g 1411579 1412214 + hypothetical protein Blon021471 BI01583 1412111 1413136 + transposase (25) BH3998 [imported], putative BI00079g 1412929 1413600 + hypothetical protein BI01584 1413600 1414358 + Tpase2 BI01585 1414423 1414911 + hypothetical COG3436: Transposase and inactivated derivatives BI02159t 1415037 1416323 COG0477: Permeases of the major facilitator superfamily BI01586 1416510 1417160 + putative ATP-binding protein BI01587 1417164 1418444 + Uncharacterized conserved protein BI01588 1418440 1418820 + hypothetical protein Blon021466 BI01589 1418965 1420548 + conserved hypothetical protein BI01590 1420796 1422598 + acyltransferase, putative BI01591 1422687 1423706 + prsA BI01592 1423991 1425370 + UDP-N-acetylglucosamine pyrophosphorylase BI01593 1425377 1425787 + iojap-related protein BI01594 1425942 1426637 + phosphoglycerate mutase, putative BI01595 1427363 1428961 + phosphate acetyltransferase BI01596 1429099 1429695 + acetate kinase BI01597 1429811 1430326 + hypothetical COG0282: Acetate kinase BI01598 1430503 1431867 3-phosphoshikimate 1-carboxyvinyltransferase BI01599 1431867 1433036 membrane protein, putative BI01600 1433757 1434125 hypothetical COG2217: Cation transport ATPase BI01601 1434688 1436172 galactoside symporter BI01602 1436515 1439583 + beta-galactosidase, putative BI01603 1440389 1441246 + hypothetical protein BI01604 1441301 1441966 hypothetical protein Blon020709 BI01605 1442167 1442559 hypothetical protein BI01606 1442574 1442990 hypothetical protein BI01607 1442990 1444792 hypothetical protein BI01608 1444688 1445566 + COG3757: Lyzozyme M1 (1,4-beta-N-acetylmuramidase) BI01609 1445667 1445948 + hypothetical protein BI01610 1446119 1446796 + hypothetical protein BI01611 1447212 1448801 + hypothetical C-5 cytosine-specific DNA methylase BI01612 1448804 1449997 hypothetical protein Psyc022392 BI01613 1450130 1450393 + hypothetical protein BI01614 1450514 1450891 hypothetical protein BI01615 1451253 1452203 hypothetical protein BI01616 1452503 1452802 TnpB BI01617 1452909 1453127 + IS861, transposase OrfB BI01618 1453248 1453586 + putative transposase subunit BI01619 1455179 1455604 cell division protein FtsZ BI01620 1455752 1459864 hypothetical UvrD/REP helicase BI01621 1459861 1463163 COG3857: ATP-dependent nuclease, subunit B BI01622 1463295 1465877 hypothetical DNA polymerase III, alpha subunit BI01623 1466012 1467055 + conserved hypothetical protein BI01624 1467089 1467886 narrowly conserved hypothetical membrane protein BI01625 1468160 1468507 hypothetical protein BL0124 BI01626 1468949 1469908 Pseudouridylate synthases, 23S RNA-specific BI01627 1469911 1470456 lipoprotein signal peptidase BI01628 1470481 1471857 conserved hypothetical protein BI01629 1472000 1472299 COG0762: Predicted integral membrane protein BI01630 1472424 1472900 conserved hypothetical protein BI01631 1472916 1473830 hypothetical Tubulin/FtsZ family, C-terminal domain BI01632 1474239 1475480 TIM-barrel protein, NifR3 family BI01633 1475628 1476938 glycyl-tRNA synthetase BI01634 1477533 1478474 + hydroxyethylthiazole kinase BI01635 1478743 1481310 + thiamine biosynthesis protein ThiC BI01636 1481353 1481679 hypothetical protein BI01637 1481820 1482626 + phosphomethylpyrimidine kinase BI01638 1482680 1483054 + COG0011: Uncharacterized ACR BI01639 1483563 1484939 + permease, putative BI02235t 1485571 1485978 + conserved hypothetical protein BI01640 1486039 1487433 + Serpin (serine protease inhibitor) superfamily BI01641 1487717 1488517 + transcriptional regulator, LacI family, putative BI01642 1488728 1490068 + sucrose transport protein BI01643 1490082 1491635 + sucrose-6-phosphate hydrolase, putative BI01644 1491833 1492612 + ABC transporter, permease protein, cysTW family, putative BI01645 1492927 1493943 + pyrimidine precursor biosynthesis enzyme, putative BI02246t 1494070 1495254 + inosine-uridine preferring nucleoside hydrolase BI01646 1495416 1496207 undecaprenyl diphosphate synthase BI01647 1496207 1496923 DNA repair protein RecO BI01648 1496975 1498684 conserved hypothetical protein BI01649 1498808 1500028 1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate synthase BI01650 1500028 1501215 1-deoxy-D-xylulose 5-phosphate reductoisomerase BI01651 1501215 1502915 conserved hypothetical protein BI01652 1503387 1503809 conserved hypothetical protein BI01653 1503919 1504797 PDZ domain family protein BI01654 1505129 1506760 + conserved hypothetical protein BI01655 1506836 1508407 ATP-dependent DNA helicase PcrA BI01656 1508553 1510205 + conserved hypothetical protein BI01657 1510357 1510578 + putative ATP-binding protein BI01658 1510645 1511535 PHP domain N-terminal region family BI01659 1511673 1512407 + narrowly conserved hypothetical transmembrane protein BI01660 1512419 1513309 diaminopimelate epimerase BI01661 1513417 1514208 + glutamate racemase BI01662 1514340 1515182 + Patatin family BI01663 1515255 1516151 Unknown BI01664 1516314 1516580 trans-sulfuration enzyme BI00087g 1516749 1517024 ABC transporter, ATP-binding protein, putative BI00086g 1517139 1517573 + conserved hypothetical protein in upf0074 BI01665 1517692 1517940 conserved hypothetical protein BI01666 1518187 1519422 cystathionine beta-lyase BI01667 1519661 1520560 glutamine ABC transporter, periplasmic glutamine-binding protein (glnH) BI01668 1520629 1521417 amino acid ABC transporter, ATP-binding protein BI01669 1521413 1521952 amino acid ABC transporter, permease protein SP0710 [imported] BI01670 1522074 1522730 amino acid ABC transporter, permease protein BI01671 1522793 1523605 + hypothetical Phospholipase/Carboxylesterase BI01672 1523620 1525872 Tn916, tetracycline resistance protein, putative BI01673 1526091 1526723 + DNA polymerase III, epsilon subunit BI01674 1526731 1527318 guanylate kinase BI01675 1527501 1528418 orotidine 5-phosphate decarboxylase, putative BI01676 1528421 1531801 carbamoyl-phosphate synthase, large subunit BI01677 1531806 1533176 carbamoyl-phosphate synthase, small subunit BI01678 1533219 1533788 transcription antitermination factor NusB BI01679 1533846 1534154 Elongation factor P (EF-P) BI01680 1534514 1535248 + Unknown, putative BI01681 1535248 1536033 + conserved hypothetical protein TIGR00245 BI01682 1536066 1536770 Unknown BI01683 1536878 1539436 hypothetical EAL domain BI01684 1539444 1540751 Probable hydrolase transmembrane protein BI01685 1541332 1543257 + glycosyltransferase BI01686 1543387 1543551 hypothetical protein BI01687 1543710 1544600 3-hydroxyacyl-CoA dehydrogenase BI01688 1544959 1546782 alpha-xylosidase BI01689 1546897 1547199 hypothetical COG1653: ABC-type sugar transport system, periplasmic component BI01690 1547359 1549491 possible beta-hexosaminidase A BI01691 1549605 1550417 ABC transporter, permease protein, MalFG family BI01692 1551035 1551862 + conserved hypothetical protein BI01693 1552142 1553254 mrp BI01694 1553434 1556193 DNA ligase, NAD-dependent BI01695 1556261 1559881 conserved hypothetical protein BI01696 1560102 1562237 + membrane protein, putative BI01697 1562555 1564141 + hypothetical protein Blon021196 BI01698 1564204 1564977 ABC transporter, ATP-binding protein, putative BI01699 1565037 1566299 aminotransferase, class I, putative BI01700 1566573 1567337 ROK family protein BI01701 1567583 1568365 + Nitroreductase family protein BI01702 1568413 1569423 probable glycosyltransferase BI01703 1569675 1570325 + conserved hypothetical protein BI01704 1570459 1572888 + ABC transporter, ATP-binding protein, putative BI01705 1572963 1573265 + Predicted RNA-binding protein containing KH domain BI01706 1573370 1573732 conserved hypothetical protein BI01707 1573842 1574456 + hypothetical TM2 domain BI01708 1574885 1575301 + hypothetical protein Blon021592 BI01709 1575432 1576415 D-isomer specific 2-hydroxyacid dehydrogenase family protein BI01710 1576714 1578168 + drug resistance transporter, EmrB/QacA family, putative BI01711 1578399 1579418 ribose ABC transporter, permease protein VCA0129 [imported], putative BI01712 1579418 1580485 ribose ABC transporter, permease protein VCA0129 [imported], putative BI01713 1580490 1582028 ATP binding protein of ABC transporter BI01714 1582172 1583152 ribose ABC transporter, periplasmic D-ribose-binding protein BI01715 1583472 1585199 lipoprotein, putative BI01716 1585199 1586752 sensor histidine kinase MtrB BI01717 1586893 1587837 hypothetical Response regulator receiver domain BI01718 1587674 1589005 conserved ATP/GTP binding protein BI01719 1589136 1591535 COG0513: Superfamily II DNA and RNA helicases BI01720 1591837 1592907 Domain of unknown function (DUF344) family BI02350t 1592976 1593215 conserved hypothetical protein BI01721 1593208 1593801 COG0737: 5-nucleotidase/2,3-cyclic phosphodiesterase and related esterases BI01722 1593841 1595364 hypothetical secreted protein with probable acid phosphatase domain BI01723 1595471 1596568 glutamine ABC transporter, glutamine-binding protein/permease protein, putative BI01724 1596577 1597251 glutamine ABC transporter, permease protein BI01725 1597254 1598090 amino acid ABC transporter, amino acid-binding protein, putative BI01726 1598125 1598964 amino acid ABC transporter, ATP-binding protein BI01727 1599401 1600468 + conserved hypothetical protein BI01728 1600932 1602728 aspartyl-tRNA synthetase BI01729 1602767 1604107 histidyl-tRNA synthetase BI01730 1604264 1605721 + conserved hypothetical protein BI01731 1605933 1607723 5-nucleotidase family protein, putative BI01732 1607898 1608653 creatinine amidohydrolase, creatininase BI01733 1608742 1610115 proline/betaine transporter BI01734 1610158 1610328 + hypothetical protein BI01735 1610308 1611378 hypothetical protein weakly similar to putative transcriptional regulator from Streptomyces BI01736 1611950 1613266 + N-acyl-D-amino-acid deacylase family protein, putative BI01737 1613452 1616058 ATP-dependent Clp protease, ATP-binding subunit ClpC BI01738 1616208 1617170 + demannu, putative BI01739 1617288 1618208 hypothetical protein Blon021510 BI01740 1618484 1618870 cspB BI01741 1618943 1620931 sensor histidine kinase BI01742 1620965 1621738 DNA-binding response regulator BI01743 1621689 1622492 conserved hypothetical protein BI01744 1622567 1622854 + conserved hypothetical protein BI01745 1622957 1624579 chaperone BI01746 1624820 1625056 cold-shock domain family protein BI01747 1625289 1625870 hypothetical protein Blon020592 BI01748 1626163 1626771 + uracil-DNA glycosylase BI01749 1626814 1627890 + ATPase, MoxR family BI01750 1628022 1628837 + Protein of unknown function family BI01751 1628840 1629388 + conserved hypothetical protein BI01752 1629388 1630443 + conserved hypothetical protein BI01753 1630443 1631471 + conserved hypothetical protein BI01754 1631444 1632070 + platelet binding protein GspB, putative BI01755 1632316 1632660 + conserved hypothetical protein BI01756 1632660 1634261 + conserved hypothetical protein BI01757 1634531 1634893 + conserved hypothetical protein BI01758 1635034 1635672 hypothetical membrane protein with unknown function BI01759 1635805 1637238 + adenylosuccinate lyase VC1126 [imported] BI01760 1637373 1639931 + narrowly conserved hypothetical membrane protein BI01761 1640080 1640358 + DNA-binding protein HU BI01762 1640480 1641937 possible DNA-binding protein BI01763 1641940 1642203 hypothetical Protein of unknown function (DUF797) BI01764 1642234 1643133 possible inositol monophosphatase BI01765 1643139 1644803 hypothetical proteasome-associated protein BI01766 1644828 1646390 cell division control protein 48, AAA family BI01767 1646454 1647149 DedA family protein BI01768 1647410 1647919 + phosphoserine phosphatase SerB BI01769 1648166 1650271 + primosomal protein N BI01770 1650333 1651034 + possible alpha beta hydrolase BI01771 1651061 1652044 + methionyl-tRNA formyltransferase BI01772 1652142 1653908 dihydroxy-acid dehydratase BI01773 1654203 1654484 + DNA-directed RNA polymerase, omega subunit BI01774 1654765 1655982 + S-adenosylmethionine synthetase BI02420t 1656352 1657425 + hypothetical protein CV1232
[0089] The Open reading frames (ORF) listed in Table 1 are defined by their position in the genomic sequence of SEQ ID No. 1. For example BI00001 is defined by the nucleotide sequence of base numbers 1667321 and 1667608 (inclusive) of SEQ ID No. 1.
EXAMPLES
[0090] The following examples further describe and demonstrate embodiments within the scope of the invention. The examples are given solely for the purpose of illustration and are not to be construed as limitations of the present invention, as many variations thereof are possible without departing from the spirit and scope of the invention.
Example 1Isolation of Bifidobacterium longum Biotype infantis UCC 35624
[0091] Appendices and sections of the large and small intestine of the human G.I.T., obtained during reconstructive surgery, were screened for probiotic bacterial strains. All samples were stored immediately after surgery at 80 C. in sterile containers. Frozen tissues were thawed, weighed and placed in cysteinated (0.05%) one quarter strength Ringers' solution. Each sample was gently shaken to remove loosely adhering microorganisms. Following transfer to a second volume of Ringers' solution, the sample was vortexed for 7 min to remove tightly adhering bacteria. In order to isolate tissue embedded bacteria, samples were also homogenised in a Braun blender. The solutions were serially diluted and spread-plated (1000 on to the following agar media: RCM (reinforced clostridial media) and RCM adjusted to pH 5.5 using acetic acid; TPY (trypticase, peptone and yeast extract), Chevalier, P. et al. (1990). MRS (deMann, Rogosa and Sharpe); ROG (acetate medium (SL) of Rogosa); LLA (Liver-lactose agar of Lapiere); BHI (brain heart infusion agar); LBS (Lactobacillus selective agar) and TSAYE (tryptone soya agar supplemented with 0.6% yeast extract). All agar media was supplied by Oxoid Chemicals with the exception of TPY agar. Plates were incubated in anaerobic jars (BBL, Oxoid) using CO.sub.2 generating kits (Anaerocult A, Merck) for 2-5 days at 37 C.
[0092] Gram positive, catalase negative rod-shaped or bifurcated/pleomorphic bacteria isolates were streaked for purity on to complex non-selective media (TPY). Isolates were routinely cultivated in TPY medium unless otherwise stated at 37 C. under anaerobic conditions. Presumptive Bifidobacteria species were stocked in 40% glycerol and stored at 20 and 80 C.
[0093] Approximately fifteen hundred catalase negative bacterial isolates from different samples were chosen and characterised in terms of their Gram reaction, cell size and morphology, growth at 15 C. and 45 C. and fermentation end-products from glucose. Greater than sixty percent of the isolates tested were Gram positive, homofermentative cocci arranged either in tetrads, chains or bunches. Eighteen percent of the isolates were Gram negative rods and heterofermentative coccobacilli.
[0094] The remaining isolates (twenty-two percent) were predominantly homofermentative coccobacilli. Thirty eight strains were characterised in more detail. All thirty eight isolates tested negative both for nitrate reduction and production of indole from tryptophan.
[0095] Bifidobacterium longum biotype infantis strain 35624 was chosen for full genome sequencing from this group of strains due to its proven anti-inflammatory activity in murine models of colitis (McCarthy et.al., 2004) and its immunomodulatory effects following oral consumption by Irritable Bowel Syndrome (IBS) patients (O'Mahony et al., 2005).
Example 2Sequencing the Genome of Bifidobacterium longum infantis 35624
[0096] The Bifidobacterium longum biotype infantis strain 35624 genome sequence was determined using a whole shotgun approach. For this purpose two libraries were constructed: a small insert library (insert size ranging between 2 and 4 kb) employing pGEM-T easy vector (Promega) and a large insert (insert size ranging between 40 and 45 kb) cosmid library (Epicentre Technologies). Sequence sampling from these banks generated just over 26,828,618 base pairs of useable sequence data, which represented about 11.9-fold coverage of the Bifidobacterium longum biotype infantis strain 35624 genome (performed by MWG-Biotech, Ebersberg, Germany) Sequence reads were assembled using Phrap (Green) into 11 contigs. Gap closure and quality improvement of the initial sequence assembly was achieved by additional primer-directed sequencing using pre-identified clones from the libraries resulting in a single contig, which represented a circular chromosome of 2,264,374 bp long. Based on the final consensus quality scores, we estimate an overall error rate of <1 per 410.sup.5 bases
Example 3Analysing the Genome of Bifidobacterium longum Biotype infantis 35624
[0097] Protein-encoding open reading frames (ORFs) were predicted using a combination of the methods Glimmer (Delcher et al., 1999b; Salzberg et al., 1998) and GeneBuilder (Internally developed software), as well as comparative analysis involving BLASTX (Altschul et al., 1997)
[0098] Results from the gene finder programs were manually combined, and preliminary identification of ORFs was made on the basis of BLASTP (Altschul et al., 1997) analysis against a non-redundant protein database provided by the National Centre for Biotechnology Information (Wheeler et al., 2005). Artemis (Rutherford et al., 2000), was used to inspect the identified ORFs and its associated BLASTP results. A manual inspection was performed in order to verify or, if necessary, redefine the start and stop of each predicted coding region. Annotation made use of the GC frame plot feature of Artemis, ribosome-binding site information obtained from RBSfinder (Suzek et al., 2001), alignments with similar ORFs from other organisms and G+C content analysis.
Example 4Identifying Unique Genes in the Genome of Bifidobacterium longum infantis 35624
[0099] Assignment of protein function to predicted coding regions of the Bifidobacterium longum biotype infantis strain 35624 genome was performed using internally developed software and manual inspection. Primary functional classification of the Bifidobacterium longum biotype infantis strain 35624 gene products was performed according to the Riley rules (Riley, 1998a; Riley, 1993). The COG assignment was performed using XUGNITOR (Tatusov). HMMER (Eddy) was used to assign PFAM (Bateman et al., 2002) classification to the predicted proteins. TMHMM (Krogh et al., 2001) was used to predict transmembrane sequences, and SignalP (Bendtsen et al., 2004) was used for the prediction of signal peptides. Ribosomal RNA genes were detected on the basis of BLASTN searches and annotated manually. Transfer RNA genes were identified using tRNAscan-SE (Lowe and Eddy, 1997). Miscellaneous-coding RNAs were identified using the Rfam database (Griffiths-Jones et al., 2005) utilizing the INFERNAL software package (Eddy, 2002). Insertion sequence elements were identified using Repeatfinder (Volfovsky et al., 2001), Reputer (Kurtz & Schleiermcher, 1999) and BLAST (Altschul et al., 1990) and annotated manually. IS families were assigned using ISFinder (http://www-is.biotoul.fr/is.html). Carbohydrate-active enzymes were identified based on similarity to the carbohydrate-active enzyme (CAZy) database entries (Coutinho & Henrissat, 1999), and COG and PFAM classes annotated with carbohydrate enzyme activity. Transporter classification was performed according to the TC-DB scheme (Busch & Saier, 2002).
[0100] We identified a region from base numbers 44824 to 472245 (inclusive) of SEQ ID No. 1 that we designated exopolysaccharide (EPS) region 1 (SEQ ID No. 2). The EPS region 1 encodes the following genes:
TABLE-US-00002 TABLE 2 Open reading frames of EPS region 1 of the UCC 35624 genome Gene ID Strand Description DNA sequence Protein sequence BI00778 + glycosyl transferase CpsE SEQ. ID No. 93 SEQ. ID No. 133 BI00779 + COG0840: Methyl-accepting chemotaxis protein SEQ. ID No. 94 SEQ. ID No. 134 BI00780 + possible Etk-like tyrosine kinase involved in Eps biosynthesis SEQ. ID No. 95 SEQ. ID No. 135 BI00781 + hypothetical glycosyl transferase, group 1 family protein SEQ. ID No. 96 SEQ. ID No. 136 BI00782 + putative glycosyltransferase protein SEQ. ID No. 97 SEQ. ID No. 137 BI00783 + NAD dependent epimerase/dehydratase family protein SEQ. ID No. 98 SEQ. ID No. 138 BI00784 + UDP-glucose 6-dehydrogenase SEQ. ID No. 99 SEQ. ID No. 139 BI00785 + hypothetical glycosyl transferase, group 1 family protein SEQ. ID No. 100 SEQ. ID No. 140 BI00786 + hypothetical Eps11I SEQ. ID No. 101 SEQ. ID No. 141 BI00787 + hypothetical Bacterial transferase hexapeptide (three repeats) SEQ. ID No. 102 SEQ. ID No. 142 BI00788 + hypothetical Capsular polysaccharide synthesis protein SEQ. ID No. 103 SEQ. ID No. 143 BI00789 + hypothetical protein SEQ. ID No. 104 SEQ. ID No. 144 BI00790 + Eps9K SEQ. ID No. 105 SEQ. ID No. 145 BI00791 + hypothetical Polysaccharide biosynthesis protein SEQ. ID No. 106 SEQ. ID No. 146 BI00792 + hypothetical Bacterial transferase hexapeptide (three repeats) SEQ. ID No. 107 SEQ. ID No. 147 BI00793 NAD-dependent epimerase/dehydratase family protein, putative SEQ. ID No. 108 SEQ. ID No. 148 BI00794 transposase, degenerate SEQ. ID No. 109 SEQ. ID No. 149 BI00795 hypothetical COG2963: Transposase and inactivated derivatives SEQ. ID No. 110 SEQ. ID No. 150 BI00796 + dTDP-glucose 4,6-dehydratase SEQ. ID No. 111 SEQ. ID No. 151 BI00797 + dTDP-4-dehydrorhamnose 3,5-epimerase SEQ. ID No. 112 SEQ. ID No. 152 BI00798 + glucose-1-phosphate thymidylyltransferase SEQ. ID No. 113 SEQ. ID No. 153
[0101] We also identified a region from base numbers 2071426 to U.S. Pat. No. 2,097,099 (inclusive) of SEQ ID No. 1 that we designated EPS region 2 (SEQ ID No. 3). The EPS region 2 encodes the following genes:
TABLE-US-00003 TABLE 3 Open reading frames of EPS region 2 of the UCC 35624 genome Gene ID Strand Description DNA sequence Protein sequence BI00319 + dTDP-glucose 4,6-dehydratase SEQ. ID No. 114 SEQ. ID No. 154 BI00320 + conserved hypothetical protein SEQ. ID No. 115 SEQ. ID No. 155 BI00321 + conserved hypothetical protein SEQ. ID No. 116 SEQ. ID No. 156 B100423t + conserved putative transposase SEQ. ID No. 117 SEQ. ID No. 157 BI00322 IS1533, OrfB SEQ. ID No. 118 SEQ. ID No. 158 BI00323 transposase (25) BH3998 [imported], putative SEQ. ID No. 119 SEQ. ID No. 159 BI00324 glycosyltransferase, putative SEQ. ID No. 120 SEQ. ID No. 160 BI00325 conserved sialic acid-specific 9-O-acetylesterase SEQ. ID No. 121 SEQ. ID No. 161 BI00326 + hypothetical Acyltransferase family SEQ. ID No. 122 SEQ. ID No. 162 BI00327 conserved> hypothetical membrane protein with unknown function SEQ. ID No. 123 SEQ. ID No. 163 BI00328 hypothetical Glycosyl transferase family 8 SEQ. ID No. 124 SEQ. ID No. 164 BI00329 hypothetical glycosyl transferase, group 2 family protein SEQ. ID No. 125 SEQ. ID No. 165 BI00330 polysaccharide ABC transporter, ATP-binding protein SEQ. ID No. 126 SEQ. ID No. 166 BI00331 polysaccharide ABC transporter, permease protein, putative SEQ. ID No. 127 SEQ. ID No. 167 BI00332 + hypothetical Glycosyl transferase family 8 SEQ. ID No. 128 SEQ. ID No. 168 BI00333 UDP-glucose 6-dehydrogenase SEQ. ID No. 129 SEQ. ID No. 169 BI00334 + hypothetical NAD dependent epimerase/dehydratase family SEQ. ID No. 130 SEQ. ID No. 170 BI00335 membrane protein, putative SEQ. ID No. 131 SEQ. ID No. 171 BI00336 conserved hypothetical protein SEQ. ID No. 132 SEQ. ID No. 172
Example 5 Isolation and Screening of EPS-Producing Bifidobacterial Strain from Fecal Samples
Fecal Sample Preparation
[0102] Fecal samples were collected by the subjects using a Kendall precision commode specimen collection system. The collected samples were stored chilled in a cold pack prior to sample processing. Only samples that are less than twenty four hours old were used in the evaluations.
[0103] A 10.0 gm sample of mixed fecal material was placed into a plastic stomaching bag containing 90 ml of saline. The suspension was stomached for 2 minutes. The suspension was filtered through a gauze pad contained within a disposable funnel. Following the filtration, 45 ml of the filtered fecal homogenate was transferred to a 50 ml disposable centrifuge tube. This fecal suspension was further used for DNA extraction or for bacterial isolation.
Screening Fecal Samples Using Three TaqMan Real-Time PCR Assays.
[0104] Fecal Sample DNA Preparation.
[0105] A 2.0 ml aliquot of the fecal homogenate was pelleted using a microcentrifuge. The pellets were resuspended in 20 mg/ml lysozyme, for 2 hours at 37 C. DNA was extracted using a QIAamp DNA Stool Mini Kit (Qiagen). The DNA concentration was measured by Pico Green assay (Molecular Probes). Once the DNA concentration was measured, the DNA was stored at 4 C.
[0106] TaqMan Real-Time PCR Reactions.
[0107] The test samples were diluted to a concentration of DNA of 2 ng/ul so that 5 l contained a total of 10 ng DNA. Samples were assayed by a total of three separate assays.
The following reaction mix was made:
TABLE-US-00004 Water 15.75 l 10 M forward primer 1.5 l (300 nM final concentration) 10 M reverse primer 1.5 l (300 nM final concentration) 10 M TaqMan probe 1 l (200 nM final concentration) BSA (20 mg/ml) 0.25 l (0.1 ug/ml final concentration) TaqMan Universal 25 l Master Mix
[0108] A bulk mix was made for the number of samples to be assayed. A 45 l aliquot was dispensed into each well of a 96 well microtitre plate, then 5 l DNA was added to each well. The plate was spun briefly, and placed into the thermocycler (ABI 7900 HT). The standard TaqMan thermocycling protocol was used.
[0109] TaqMan RT-PCR Program.
[0110] The standard TaqMan quantitative PCR thermocycling protocol is as follows:
[0111] Step 1: 95 C. for 10 minutes (to activate the AmpliTaq Gold polymerase)
[0112] Step 2: 95 C. for 15 seconds (the denaturation step)
[0113] Step 3: 60 C. for 60 seconds (the priming/polymerization step)
[0114] Steps 2 and 3 are repeated 40 times. Fluorescent data is collected at step 3.
Primers and Probes for Three TaqMan RT-PCR Assays.
[0115] The fecal sample DNAs were screened using a EPS gene-specific assay and two B. infantis 35624 Unknown gene-specific assays (Unknown genes UNK1 and UNK2). The specific genes used and their TaqMan primer sets are shown in Table 4 below.
TABLE-US-00005 TABLE4 UCC35624PrimersetforTaqManPCR TaqMan Target Genome Genome Probe Gene Name Sequence5-3 start end label BI01615 UNK1- CCATGAGCGGTTTCA 1451446 1451428 5 6- (UNK-1) F1 CGAA FAM3 (SEQIDNo.4) NFQ- UNK1- TTGGACGGTGCCTGT 1451393 1451412 MG R1 GATTA (SEQIDNo.5) UNK1- CGGGCAATCAAC 1451426 1451415 MGB1 (SEQIDNo.6) BI02420t UNK2- ACTTGACGTACCGTT 1656479 1656503 5 6- (UNK-2) F1 TTGAGATTTC FAM3 (SEQIDNo.7) NFQ- UNK2- CTAAGCATGGCAAGG 1656562 1656540 MGB R1 CTGATAGT (SEQIDNo.8) UNK2- TGCGACCAACACGC 1656525 1656538 MGB1 (SEQIDNo.9) BI00783 EPS- GGGTCCAATAAGAAG 456491 456515 5 6- (EPS) F1 GTTCCATATT FAM3 (SEQIDNo.10) TAMR EPS- GCATGTGCCAACAGC 456591 456572 R1 TCATC (SEQIDNo.11) EPS- CGGATGACAAGGTAG 456519 456553 TAMRA ATAATCCAGTGAGCC TATAC (SEQIDNo.12)
[0116] The fecal samples which showed high DNA concentration by the B. infantis 35624 EPS gene-specific assay, but negative reactions by using B. infantis 35624 Unknown gene-specific assays, were further used for the isolation of potential EPS-producing bacteria.
Example 6Isolation and Characterization of BL1207 from Fecal Samples
[0117] One milliliter of bacterial suspension (see Example 5 above) was transferred to 9.0 ml of sterile phosphate-buffered saline which constituted the 10.sup.1 dilution. One milliliter of this 10.sup.1 dilution was transferred to 9.0 ml of sterile phosphate-buffered saline which was the 10.sup.2 dilution. This process was continued until the 10.sup.10 dilution was prepared. Then, 0.1 ml of each dilution was plated onto the surfaces of Reinforced Clostridial Agar (RCA) plates (BD or equivalent) and Lactobacillus Man-Rogosa Sharpe agar (MRSA) plates (BD or equivalent). The plates were incubated under anaerobic condition (COY anaerobic Chamber) at 33 C.2 C. for 48-72 hours.
[0118] Following incubation, single colonies (a total of approximately 100 colonies) were picked from RCA and MRSA plates and further streaked on new plates for isolate purification. The plates with the streaked colonies were incubated under anaerobic conditions (COY anaerobic Chamber) at 33 C.2 C. for 48 to 72 hours. After incubation, the pure colonies observed on plates were then submitted for DNA extraction.
Screening Fecal Isolates Using Three TaqMan Real-Time PCR Assays
[0119] The bacterial DNA was extracted using the Preman Ultra Sample Preparation Reagent and Protocol (Applied Biosystems). The DNA was further analyzed using three TaqMan RT-PCR assays (EPS gene-specific assay [EPS-1] and two B. infantis 35624 Unknown gene-specific assays [UNK1 and UNK2] as described above in Example 5. Only one isolate showed B. infantis 35624 EPS gene-specific assay positive, but B. infantis 35624 Unknown gene-specific assays-negative. This isolate was further identified using 16S rDNA sequencing.
Identification of Potential EPS Producing Strain by 16S rDNA Sequencing.
[0120] The 16S rRNA gene fragment was amplified and sequenced using ABI Full Gene PCR kit (Applied Biosystems, Foster City, Calif.).
(1). 16S rRNA Gene Amplification:
[0121] PCR amplification was carried out on a GeneAmp PCR System 9700 thermal cycler with the following program: [0122] Initial Hold: 95 C. for 10 minutes [0123] 30 Cycles: 95 C. for 30 seconds (Denaturing) [0124] 60 C. for 30 seconds (Annealing) [0125] 72 C. for 45 seconds (Extension) [0126] Final Extension: 72 C. for 10 minutes
(2). 16S rRNA Gene Sequencing:
[0127] Sequencing was further performed on the thermal cycler using the following program: [0128] 25 Cycles: 96 C. for 10 seconds (Denaturing) [0129] 50 C. for 5 seconds (Annealing) [0130] 60 C. for 4 minutes (Extension) [0131] Final step Hold at 4 C.
[0132] The sequencing PCR product was further purified using DyeEX 2.0 spin kit and sequenced using 3130 xl Genetic Analyzer (Applied Biosystems, Foster City, Calif.).
(3) Sequence Data Analysis:
[0133] Comparison of the consensus sequences with GenBank sequences was done by using Basic Local Alignment Search Tool (BLAST). The GenBank search indicated that the B. infantis 35624 EPS gene-specific positive, but B. infantis 35624 Unknown gene-specific negative strain is Bifidobacterium longum. This strain is designated BL1207.
Example 7Isolation and Screening of EPS-Expressing Bifidobacterial longum Strains
Isolation of Bacterial Strains
[0134] Bacteria were isolated from bowel tissue and/or fecal samples using the methodology described in Example 1 above. In particular, Bifidobacterium longum strain AH121a was isolated from feline bowel tissue and Bifidobacterium longum strain AH1714 was isolated from colonic biopsy tissue from healthy human subjects.
EPS Gene Cluster Screen
[0135] Bacterial strains were screened for the presence of genes from EPS cluster 1 (Table 2 above) and EPS cluster 2 (Table 3 above) using the primers listed in Tables 5 and 6 below. Briefly, the following methodology was used for the PCR EPS cluster gene screen:
[0136] 10 ml Modified Rogosa broth media (+0.05% cysteine) was inoculated aseptically with a freshly grown colony of the bacterial strain and incubated anaerobically at 37 C. until turbid (about 16 to about 24 hours). The broth cultures were centrifuged and DNA was isolated from the resultant pellet using a Sigma extraction procedure. A nanodrop was used to ascertain the concentration of DNA in the sample and samples were diluted using DEPC water to a final concentration of 50 ng/l DNA per sample. The template DNA samples were used in individual PCR reactions with the primer sets listed in Tables 5 and 6 below under the following conditions:
TABLE-US-00006 Step Temp ( C.) Time (sec) 1 95 240 2 95 45 3 60 45 4 72 45 repeat steps 2 to 4, 25 times 5 4 hold
The primers were specifically designed to amplify a PCR product of approximately 500 base pair for the 40 genes of EPS clusters 1 and 2. PCR products were visualised following agarose gel electrophoresis with an appropriate DNA ladder for reference sizing. The presence (YES) or absence (NO) of a 500 bp PCR product is indicated in Tables 7 and 8 below.
TABLE-US-00007 TABLE5 Primersforscreeningbacterialstrains forthepresenceofgenesfromEPScluster1 Primer GeneID name LRFR Sequence SEQIDNO. BI00778 1.01 L tatgttgccggcatttatca SEQIDNo.13 BI00778 1.01 R tgcgcgttcatgtcaataat SEQIDNo.14 BI00779 1.02 L ggcgtagcaagttcaaggag SEQIDNo.15 BI00779 1.02 R aataaccgctgcaggaacac SEQIDNo.16 BI00780 1.03 L gtgcaggacggtaatggagt SEQIDNo.17 BI00780 1.03 R gcttcgggtctggatcatta SEQIDNo.18 BI00781 1.04 L tgctgacaagtggagtctgg SEQIDNo.19 BI00781 1.04 R ccacgtctacgagcaactca SEQIDNo.20 BI00782 1.05 L gaaagcgaagagtggtctgg SEQIDNo.21 BI00782 1.05 R ccggctgatttgatgagatt SEQIDNo.22 BI00783 1.06 L tgccgctgtactggtcac SEQIDNo.23 BI00783 1.06 R gcatgtgccaacagctca SEQIDNo.24 BI00784 1.07 L ccaacacgtatctggcactg SEQIDNo.25 BI00784 1.07 R tcggagccaaagaaggtaga SEQIDNo.26 BI00785 1.08 L ataccgcgtatgctttggac SEQIDNo.27 BI00785 1.08 R aaacggtaaccactcgcttg SEQIDNo.28 BI00786 1.09 L atgggatcgatgcatgaaat SEQIDNo.29 BI00786 1.09 R ttctcggcaataaaccgttc SEQIDNo.30 BI00787 1.10 L ccagcggttatttcgttgtt SEQIDNo.31 BI00787 1.10 R ggtggcatgatccttatgct SEQIDNo.32 BI00788 1.11 L gctatcttcaccgcattggt SEQIDNo.33 BI00788 1.11 R ccagtcagggaaggtcacat SEQIDNo.34 BI00789 1.12 L tgaaatacacgcaacccgta SEQIDNo.35 BI00789 1.12 R aatgcgtcaaaaccgatacc SEQIDNo.36 BI00790 1.13 L ggaaagcaatgaggaagctg SEQIDNo.37 BI00790 1.13 R gatttgatgcaaagcaagca SEQIDNo.38 BI00791 1.14 L gtgagtaccgtttccgcaat SEQIDNo.39 BI00791 1.14 R ttccttggttcccgtgatag SEQIDNo.40 BI00792 1.15 L gctgggattttggaagtgaa SEQIDNo.41 BI00792 1.15 R tgttacccccggcataataa SEQIDNo.42 BI00793 1.16 L accggtaacgttcagattgc SEQIDNo.43 BI00793 1.16 R gcaataccgccttgacctta SEQIDNo.44 BI00794 1.17 L ttgtaccaccacacgtaccg SEQIDNo.45 BI00794 1.17 R cgcgagttcaatggctatg SEQIDNo.46 BI00795 1.18 L acatcgacctccatctccag SEQIDNo.47 BI00795 1.18 R atacgtaacagcggctccac SEQIDNo.48 BI00796 1.19 L aagtacgatgtgcgctacca SEQIDNo.49 BI00796 1.19 R catcacggtcaggatgtcac SEQIDNo.50 BI00797 1.20 L cgaatacacggacatcaacg SEQIDNo.51 BI00797 1.20 R gagaatcgagcagctggaac SEQIDNo.52 BI00798 1.21 L tgggagaggagttcatcgac SEQIDNo.53 BI00798 1.21 R gtatccagccatgcgtaacc SEQIDNo.54
TABLE-US-00008 TABLE6 Primersforscreeningbacterialstrains forthepresenceofgenesfromEPScluster2 Primer GeneID name LRFR Sequence SEQIDNO. BI00319 2.01 L acggactcaaaaccaccatc SEQIDNo.55 BI00319 2.01 R accctgcttccggtactttt SEQIDNo.56 BI00320 2.02 L gcctacgcaagaccttatgc SEQIDNo.57 BI00320 2.02 R cgttatacgcgtgcttgaga SEQIDNo.58 BI00321 2.03 L tggaacgcaatattcaacga SEQIDNo.59 BI00321 2.03 R ccaagtatggctccacgaat SEQIDNo.60 BI00423t 2.04 L acgcctgtctatggttggaa SEQIDNo.61 BI00423t 2.04 R cggtaggactcgttctcgtc SEQIDNo.62 BI00322 2.05 L tcgaggttcgaggtgaagat SEQIDNo.63 BI00322 2.05 R cctgttcgagaaggagaacg SEQIDNo.64 BI00323 2.06 L atggaagcatgtggtccttc SEQIDNo.65 BI00323 2.06 R atttcctggtggtgtcgttc SEQIDNo.66 BI00324 2.07 L atggcgaaactgttggactc SEQIDNo.67 BI00324 2.07 R gctaccgtgccttctcattc SEQIDNo.68 BI00325 2.08 L gccgaatcgcttttgaaata SEQIDNo.69 BI00325 2.08 R aaatcctcatcggggaaaac SEQIDNo.70 BI00326 2.09 L gtttattttcgccgtgccta SEQIDNo.71 BI00326 2.09 R aattccaatggcttttgctg SEQIDNo.72 BI00327 2.10 L atgtgcgaatccgacataca SEQIDNo.73 BI00327 2.10 R tgcttatctcgtccccattc SEQIDNo.74 BI00328 2.11 L gcaaaatgcttggcttcttc SEQIDNo.75 BI00328 2.11 R ctggattccgatgatgcttt SEQIDNo.76 BI00329 2.12 L ctgcacgtatcgggattttt SEQIDNo.77 BI00329 2.12 R ctcggcagaggacaggatag SEQIDNo.78 BI00330 2.13 L gatcatcgacacgcaatgac SEQIDNo.79 BI00330 2.13 R taaggccatcctcatcaagg SEQIDNo.80 BI00331 2.14 L tctggggaaagcaggttatg SEQIDNo.81 BI00331 2.14 R ctgtgcggtacctgtttgtg SEQIDNo.82 BI00332 2.15 L aattacgtcccgatgctcac SEQIDNo.83 BI00332 2.15 R caatacaccggcttggaagt SEQIDNo.84 BI00333 2.16 L tgtagaccttgtcgctcacg SEQIDNo.85 BI00333 2.16 R gcatcggtgacggctataat SEQIDNo.86 BI00334 2.17 L gtgctcgacaagctgacgta SEQIDNo.87 BI00334 2.17 R gtgttccgcataccaatcg SEQIDNo.88 BI00335 2.18 L ggcgagtgcaccaaataaat SEQIDNo.89 BI00335 2.18 R cgattccgtctattggttcg SEQIDNo.90 BI00336 2.19 L ataagtccggtggcaatcag SEQIDNo.91 BI00336 2.19 R caatggatgatacggtgctg SEQIDNo.92
TABLE-US-00009 TABLE 7 Results of EPS cluster 1 gene screen B. longum B. longum B. longum B. longum Gene ID Primer set 35624 1207 AH121A 1714 BI00778 1.01 YES YES NO YES BI00779 1.02 YES YES NO YES BI00780 1.03 YES YES NO YES BI00781 1.04 YES YES YES YES BI00782 1.05 YES YES YES YES BI00783 1.06 YES YES YES YES BI00784 1.07 YES YES YES YES BI00785 1.08 YES YES YES YES BI00786 1.09 YES YES YES YES BI00787 1.10 YES YES YES YES BI00788 1.11 YES YES YES NO BI00789 1.12 YES YES YES YES BI00790 1.13 YES YES YES YES BI00791 1.14 YES YES YES YES BI00792 1.15 YES YES YES YES BI00793 1.16 YES YES NO YES BI00794 1.17 YES YES NO YES BI00795 1.18 YES YES NO YES BI00796 1.19 YES YES YES YES BI00797 1.20 YES NO NO NO BI00798 1.21 YES YES YES YES In which YES indicates the presence and NO indiates the absence of a 500 bp PCR product.
TABLE-US-00010 TABLE 8 Results of EPS cluster 1 gene screen B. longum B. longum B. longum B. longum Gene ID Primer set 35624 1207 AH121A 1714 BI00319 2.01 YES NO NO NO BI00320 2.02 YES NO NO NO BI00321 2.03 YES NO NO NO BI00423t 2.04 YES NO NO NO BI00322 2.05 YES NO NO NO BI00323 2.06 YES NO NO NO BI00324 2.07 YES NO NO NO BI00325 2.08 YES NO NO NO BI00326 2.09 YES NO NO NO BI00327 2.10 YES NO NO NO BI00328 2.11 YES NO NO NO BI00329 2.12 YES NO NO NO BI00330 2.13 YES NO NO NO BI00331 2.14 YES NO NO NO BI00332 2.15 YES NO NO NO BI00333 2.16 YES NO NO NO BI00334 2.17 YES NO NO NO BI00335 2.18 YES YES NO YES BI00336 2.19 YES YES YES YES In which YES indicates the presence and NO indiates the absence of a 500 bp PCR product.
Congo Red Agar Screen
[0137] A Congo red agar screen was used to phenotypically screen for EPS expressing bacterial strains. Briefly, 10 ml Modified Rogosa broth media (+0.05% cysteine) was inoculated aseptically with a freshly grown colony of the bacterial strain and incubated anaerobically at 37 C. until turbid (about 16 to about 24 hours). The broth cultures were aseptically streaked onto Congo Red Agar plates and incubated anaerobically at 37 C. for 48 hours. It is believed that EPS produced as a by-product of the growth and/or metabolism of certain strains prevents the uptake of the Congo red stain resulting in a cream/white colony morphology. Stains that produce less EPS take up the Congo red stain easily, resulting in a pink/red colony morphology. Strains that do not produce an EPS stain red and look almost transparent in the red agar background.
Referring to
TABLE-US-00011 TABLE 9 Colony morphologies from Congo red agar screen Bacterial Strain Colony morphology B. longum 35624 (FIG. 6) Convex, mucoid, bright white colonies B. longum AH121A (FIG. 7) Convex, mucoid, bright white colonies B. logum AH1714 (FIG. 8) Convex, mucoid, bright white colonies B. longum AH0119 (FIG. 9) Convex, mucoid, pale pink/off white colonies B. breve UCC2003 (FIG. 10) Convex, mucoid, pale pink/off white colonies L. rhamnosus AH308 (FIG. 11) Flat, semi-mucoid, pale pink/off white colonies L. salivarius UCC1 (FIG. 12) Flat, non-mucoid, clear/transparent colonies
Example 8B. infantis 35624 and BL1207 Induce Nearly Identical Cytokine Profiles in PBMCs
[0138] Peripheral blood mononuclear cells (PBMCs) were isolated from fresh human peripheral blood using BD Vacutainer CPT tubes (BD catalog 362761), as per the manufacturer's instructions. PBMCs were washed and resuspended in Dulbecco's MEM (Gibco catalog 10569-010) plus 25 mM HEPES, 10% fetal bovine serum (Sigma catalog F4135), and 1% penicillin/streptomycin (Sigma catalog P0781). 210.sup.5 PBMCs (in 200 l of DMEM) were plated into each well of a 96-well culture plate.
[0139] Bacteria were grown in Difco MRS media and harvested just after entering into stationary phase. All cells were grown under anaerobic conditions at 37 C. Growth curves (OD vs # of live cells) were constructed for each growth condition, and washed cells were normalized by cell number before addition to the PBMCs.
[0140] Bacteria (20 l in phosphate buffered saline (PBS)) were added to each well of PBMCs to give the total number of bacteria as indicated for each experiment. Three different amounts of bacteria were tested: 1.25E+07, 6.25E+06, and 3.13E+06 were added to separate wells of PBMCs. A no-bacteria control also was run. All assays were done in triplicate. After a 2-day incubation at 37 C., the plates were spun at 300g, and the supernatants were removed and stored frozen at 80 C. until analysis.
[0141] Cytokines in the culture supernatants were assayed using a 96-well assay kit from Meso Scale Discovery (Gaithersburg, Md.; catalog K15008B-1). Human Interleukin-1 beta (I1-1b), Interleukin 10 (I1-10), Interleukin 12p70 (I112p70), and Tumor Necrosis Factor alpha (TNFa) were quantitated and reported as picograms per milliliter. Each sample was assayed in duplicate.
[0142]
Example 9Bifidobacteria with Similar EPS Genes and High EPS Production Induce a Significantly Elevated IL-10:IL-12 Ratio Compared to Strains Lacking these Genes
[0143] Peripheral blood mononuclear cells (PBMCs) were isolated from healthy human peripheral blood using BD Vacutainer CPT tubes (BD catalog 362761), as per the manufacturer's instructions. PBMCs were washed and resuspended in Dulbecco's Modified Eagle Medium-Glutamax (Glutamax (Glutamine substitute)+pyruvate+4.5 g/l glucose (Gibco catalog 10569-010) 10% fetal bovine serum (Sigma catalog F4135), and 1% penicillin/streptomycin (Sigma catalog P0781). PBMCs were incubated (210.sup.5 cells per well) in flat-bottomed 96-well plates and 20 L of a bacterial suspension (at a concentration of 110.sup.7 CFU/mL) was added. PBMCs were co-incubated with bacteria for 48 hours at 37 C./5% CO.sub.2 in an incubator. After the 2 day incubation period, the plates were centrifuged at 300g, and the supernatants were removed and stored frozen at 80 C. until analysis. Interleukin-10 (IL-10) and Interleukin-12p70 (IL-12p70) levels in the culture supernatants were quantified using a 96-well assay kit from Meso Scale Discovery (Gaithersburg, Md.; catalog K15008B-1)
[0144] Bacteria were prepared for co-culture experiments in two formats. (a) Freshly grown bacteria were grown in Difco MRS media and harvested just after entering into stationary phase. All cells were grown under anaerobic conditions at 37 C. (b) Bacteria were grown under anaerobic conditions at 37 C. in Difco MRS media and harvested just after entering into stationary phase. Freeze dried powders were generated for each of these bacteria and stored at 80 C. in pre-aliquoted 100 mg vials Immediately prior to their use, one aliquot of each strain was removed from the freezer and allowed to reach room temperature. Each strain was washed 3 times in 10 ml ringers followed by centrifugation. A fresh vial was used on each occasion. Growth curves (OD vs number of live cells) were constructed for each growth condition, and washed cells were normalized by cell number before addition to the PBMCs. A no-bacteria control was also included in all experiments. All assays were done in triplicate.
[0145] The Bifidobacteria which contained many of the EPS genes exhibited a similar effect on IL-10:IL-12 induction while bacterial strains which do not contain the EPS genes induced a significantly lower IL-10:IL-12 ratio (
[0146] The control of inflammatory diseases is exerted at a number of levels. The controlling factors include hormones, prostaglandins, reactive oxygen and nitrogen intermediates, leukotrienes and cytokines. Cytokines are low molecular weight biologically active proteins that are involved in the generation and control of immunological and inflammatory responses. A number of cell types produce these cytokines, with neutrophils, monocytes and lymphocytes being the major sources during inflammatory reactions due to their large numbers at the injured site.
[0147] Multiple mechanisms exist by which cytokines generated at inflammatory sites influence the inflammatory response. Chemotaxis stimulates homing of inflammatory cells to the injured site, whilst certain cytokines promote infiltration of cells into tissue. Cytokines released within the injured tissue result in activation of the inflammatory infiltrate. Most cytokines are pleiotropic and express multiple biologically overlapping activities. As uncontrolled inflammatory responses can result in diseases such as IBD, it is reasonable to expect that cytokine production has gone astray in individuals affected with these diseases.
[0148] Interleukin-10 (IL-10) is an anti-inflammatory cytokine which is produced by many cell types including monocytes, macrophages, dendritic cells, mast cells and lymphocytes (in particular T regulatory cells). IL-10 down-regulates the expression of pro-inflammatory Th1 cytokines, MHC class II antigens, and co-stimulatory molecules on antigen presenting cells. It also enhances B cell survival, proliferation, and antibody production. This cytokine can block NF-B activity, and is involved in the regulation of the JAK-STAT signaling pathway. Murine knock-out studies have demonstrated the essential role for IL-10 in immunoregulation as IL-10K0 mice develop severe colitis. In addition, bacteria which are potent inducers of IL-10 have been shown to promote T regulatory cell differentiation in vivo thus contributing to immunological homeostasis (O'Mahony et al., AJP 2006; O'Mahony et al., PLoS Pathogens 2008).
[0149] Interleukin-12 (IL-12) is a pro-inflammatory cytokine associated with polarisation of Th1 effector T cell responses and stimulates the production of other pro-inflammatory Th1 cytokines, such as interferon-gamma (IFN-) and tumor necrosis factor-alpha (TNF-), from T and natural killer (NK) cells. High levels of IL-12 expression is associated with autoimmunity. Administration of IL-12 to people suffering from autoimmune diseases was shown to worsen disease symptoms. In contrast, IL-12 knock-out mice or treatment of mice with IL-12 neutralising antibodies ameliorated the disease.
[0150] Cytokine cascades and networks control the inflammatory response, rather than the action of a particular cytokine on a particular cell type. The relative levels of expression, or balance, of two cytokines (such as IL-10 and IL-12) is more informative than the expression of a single cytokine. In these studies, we stimulated human PBMCs with a range of different bacterial strains. All strains induced IL-10 and all strains induced IL-12. However, examination of the ratio between IL-10 and IL-12 induction revealed that some bacterial strains induced a higher ratio (i.e. more IL-10 with less IL-12) compared to other strains. This is a meaningful observation as it is the balance between each of these opposing signals that ultimately determines the immunological outcome. It is anticipated that a high IL-10:IL-12 ratio would promote an anti-inflammatory response associated with appropriate immunoregulatory activity while a low IL-10:IL-12 ratio would contribute to Th1 polarisation of the immune response. Thus, the PBMC IL-10:IL-12 ratio is a important selection criterion for identification of bacterial strains with immunoregulatory properties.
[0151] The dimensions and values disclosed herein are not to be understood as being strictly limited to the exact numerical values recited. Instead, unless otherwise specified, each such dimension is intended to mean both the recited value and a functionally equivalent range surrounding that value. For example, a dimension disclosed as 40 mm is intended to mean about 40 mm
[0152] All documents cited in the Detailed Description of the Invention are, in relevant part, incorporated herein by reference; the citation of any document is not to be construed as an admission that it is prior art with respect to the present invention. To the extent that any meaning or definition of a term in this document conflicts with any meaning or definition of the same term in a document incorporated by reference, the meaning or definition assigned to that term in this document shall govern.
[0153] While particular embodiments of the present invention have been illustrated and described, it would be obvious to those skilled in the art that various other changes and modifications can be made without departing from the spirit and scope of the invention. It is therefore intended to cover in the appended claims all such changes and modifications that are within the scope of this invention.
REFERENCES
[0154] Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D. J. (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25, 3389-3402. [0155] Altschul S. F., Gish W., Miller W., Myers E. W. and Lipman D. J. (1990) Basic local alignment search tool. J Mol Biol. 215: 403-410. [0156] Bateman, A., Birney, E., Cerruti, L., Durbin, R., Etwiller, L., Eddy, S. R., Griffiths-Jones, S., Howe, K. L., Marshall, M., and Sonnhammer, E. L. (2002). The Pfam protein families database. Nucleic Acids Res 30, 276-280. [0157] Bendtsen J. D., Nielsen H., von Heijne G. and Brunak S. (2004) Improved prediction of signal peptides: SignalP 3.0. J Mol Biol. 340: 783-795. [0158] Bouhnik Y Survival And Effects Of Bacteria Ingested In Fermented Milk In Man Lait 73 (2): 241-247 1993 [0159] Busch W, Saier M H The Transporter Classification (TC) system, 2002 Critical Reviews In Biochemistry And Molecular Biology 37 (5): 287-337 2002 [0160] Chevalier, P. et al. (1990) J. Appl. Bacteriol 68, 619-624) [0161] Coutinho & Henrissat, 1999 [0162] Delcher A L, Harmon D, Kasif S, White O, Salzberg SL Improved microbial gene identification with GLIMMER Nucleic Acids Research 27 (23): 4636-4641 Dec. 1, 1999 [0163] Eddy, S. R. The HMMER software tools. (http://hmmer.janelia.org/). http://hmmerjaneliaorg/. [0164] Eddy S R A memory-efficient dynamic programming algorithm for optimal alignment of a sequence to an RNA secondary structure BMC BIOINFORMATICS 3: Art. No. 18 2002 Green, P. The Phred/Phrap/Consed system home page (http://www.phrap.org). http://wwwphraporg. [0165] Griffiths-Jones S, Moxon S, Marshall M, Khanna A, Eddy S R, Bateman A Rfam: annotating non-coding RNAs in complete genomes Nucleic Acids Research 33: D121-D124 Sp. Iss. SI Jan. 1, 2005 [0166] Krogh A, Larsson B, von Heijne G, Sonnhammer E L L., Predicting transmembrane protein topology with a hidden Markov model: Application to complete genomes Journal Of Molecular Biology 305 (3): 567-580 Jan. 19, 2001 [0167] Kurtz S, Schleiermacher C REPuter: fast computation of maximal repeats in complete genomes Bioinformatics 15 (5): 426-427 MAY 1999 [0168] Lowe T M, Eddy S R tRNAscan-SE: A program for improved detection of transfer RNA genes in genomic sequence Nucleic Acids Research 25 (5): 955-964 Mar. 1, 1997 [0169] Liu M, van Enckevort F H, Siezen R J, Genome update: lactic acid bacteria genome sequencing is booming Microbiology 2005, vol 151 pp 3811-3814 [0170] McCarthy et al., 2004 [0171] O'Mahony L, McCarthy J, Kelly P, Hurley G, Luo F, Chen K, O'Sullivan G C, Kiely B, Collins J K, Shanahan F, Quigley E M.:Lactobacillus and bifidobacterium in irritable bowel syndrome: symptom responses and relationship to cytokine profiles.
Gastroenterology. 2005 March; 128(3):541-51.
[0172] O'Mahony et al., AJP 2006 [0173] O'Mahony et al., PLoS Pathogens 2008 [0174] Riley, 1993 [0175] Riley, 1998a [0176] Rutherford, K., Parkhill, J., Crook, J., Horsnell, T., Rice, P., Rajandream, M. A., and Barrell, B. (2000). Artemis: sequence visualization and annotation. Bioinformatics 16, 944-945. [0177] Salzberg S, Delcher A L, Fasman K H, Henderson J. A decision tree system for finding genes in DNA Journal Of Computational Biology 5 (4): 667-680 WIN 1998 [0178] Suzek, B. E., Ermolaeva, M. D., Schreiber, M., and Salzberg, S. L. (2001). A probabilistic method for identifying start codons in bacterial genomes. Bioinformatics 17, 1123-1130. [0179] Tatusov, R. L., The XUGNITOR software ftp://ftp.ncbi.nih.gov/pub/COG/old/util/xugnitor.c. [0180] Volfovsky et al., 2001 [0181] Wheeler et al., 2005