PROCESS FOR PRODUCING ITACONIC ACID UNDER ANAEROBIC CONDITIONS
20180016604 ยท 2018-01-18
Inventors
- Ruud Weusthuis (Wageningen, NL)
- Kiira Vuoristo (Wageningen, NL)
- Gerrit Eggink (Wageningen, NL)
- Johan Pieter Marinus Sanders (Wageningen, NL)
Cpc classification
International classification
Abstract
The present invention relates to a method for the production of itaconic acid, which method comprises fermenting a recombinant cell capable of producing itaconic acid in a suitable fermentation medium, thereby to produce itaconic acid, wherein: (a) the recombinant cell: (i) overexpresses cis-aconitate decarboxylase; and (ii) overexpresses a part of the citric acid cycle and/or has reduced activity of a native metabolic route to acetate and/or lactate; and, optionally, (b) the fermentation is carried out under anaerobic conditions.
Claims
1. A method for the production of itaconic acid, which method comprises fermenting a recombinant cell capable of producing itaconic acid in a suitable fermentation medium, thereby to produce itaconic acid, wherein: (a) the recombinant cell: (i) overexpresses cis-aconitate decarboxylase; and (ii) overexpresses a part of the citric acid cycle and/or has reduced activity of a native metabolic route to acetate and/or lactate, wherein overexpression of a part of the citric acid cycle is overexpression of a citrate synthase and/or overexpression of an aconitase and wherein reduced activity of a native metabolic route to acetate is reduced activity of a phosphate acetyltransferase and/or wherein reduced activity of a native metabolic route to lactate is reduced activity of a lactate dehydrogenase; and, optionally, (b) the fermentation is carried out under anaerobic conditions, wherein fermentation carried out under anaerobic conditions means a fermentation process run in the absence of oxygen or in which substantially no oxygen is consumed or a fermentation process run under oxygen limited, or micro-aerobical, conditions; and, optionally (c) wherein glutamate production is repressed, preferably wherein repression of glutamate production is carried out by carrying out the fermentation under nitrogen free conditions.
2. A method according to claim 1, wherein the cis-aconitate decarboxylase is one derivable from or found in Aspergillus terreus.
3. A method according to claim 1 wherein production of itaconic acid is accompanied by either ethanol and formate production or H.sub.2 and CO.sub.2 production.
4. A method according to any one of the preceding claim 1, wherein glutamate production is repressed.
5. A method according to claim 1, wherein the recombinant cell is a prokaryotic or a eukaryotic cell.
6. A method according to claim 5, wherein the cell is a bacterial cell, preferably E. coli, or a yeast cell, preferably S. cerevisiae.
7. A method according to claim 1 which comprises recovery of the itaconic acid.
8. A method for the production of a pharmaceutical, cosmetic, food, feed or chemical product which method comprises: (a) preparing itaconic acid by a method according to claim 1 and; (b) preparing the pharmaceutical, cosmetic, food, feed or chemical product using said itaconic acid.
9. A recombinant cell capable of producing itaconic acid, wherein the recombinant cell: (i) overexpresses cis-aconitate decarboxylase; and (ii) overexpresses a part of the citric acid cycle and/or has reduced activity of a native metabolic route to acetate and/or lactate.
10. A recombinant cell according to claim 9.
11. A method for the production of itaconic acid, which method comprises fermenting a recombinant cell capable of producing itaconic acid in a suitable fermentation medium, thereby to produce itaconic acid, wherein the recombinant cell is one according to claim 9.
12. A method according to claim 11, wherein the fermentation is carried out under anaerobic conditions.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
DESCRIPTION OF THE SEQUENCE LISTING
[0022] SEQ ID NO: 1 sets out the sequence of the ldhA flank F primer used for ldhA deletion.
[0023] SEQ ID NO: 2 sets out the sequence of the ldhA flank R primer used for ldhA deletion.
[0024] SEQ ID NO: 3 sets out the sequence of the ldhA check F primer used for PCR verification.
[0025] SEQ ID NO: 4 sets out the sequence of the ldhA check R primer used for PCR verification.
[0026] A description of the sequences is also set out in Table 2.
DETAILED DESCRIPTION OF THE INVENTION
[0027] Throughout the present specification and the accompanying claims, the words comprise, include and having and variations such as comprises, comprising, includes and including are to be interpreted inclusively. That is, these words are intended to convey the possible inclusion of other elements or integers not specifically recited, where the context allows.
[0028] The articles a and an are used herein to refer to one or to more than one (i.e. to one or at least one) of the grammatical object of the article. By way of example, an element may mean one element or more than one element.
[0029] The invention relates to a method for the production of itaconic acid, and optionally, glutamate, or to a method for the production of a fermentation broth comprising itaconic acid, and optionally glutamate, in which a recombinant cell capable of producing itaconic acid is fermented in a suitable fermentation medium. Fermentation of the recombinant cell may be carried out under conditions which lead to the production of itaconic acid. The invention also relates to the recombinant cell capable of producing itaconic acid itself. Herein, a recombinant cell indicates that the cell has been modified by the introduction of a heterologous nucleic acid or protein or the alteration of a native nucleic acid or protein, or that the cell is derived from a cell so modified.
[0030] Thus, for example, a recombinant cell of the invention may express a gene that is not found within the native (non-recombinant) form of the cell or express native genes that are otherwise abnormally expressed, under-expressed or not expressed at all. A recombinant cell may, in comparison to a non-recombinant form of the cell, under-express or not express at all a native gene, for example, such that it has reduced activity in a given metabolic pathway. That is to say, the enzyme encoded by a said native gene may be produced in a lesser amount, not produced at all and/or may have a lower or absent biological activity in comparison with a non-recombinant form of the cell. Thus, a recombinant cell of the invention/cell suitable for use in a method of the invention may overexpress a non-native or native gene and/or under-express a native gene
[0031] The recombinant cell of the invention/cell used in a method of the invention is one which:
[0032] (i) overexpresses cis-aconitate decarboxylase; and
[0033] (ii) overexpresses a part of the citric acid cycle and/or has reduced activity of a native metabolic route to acetate and/or lactate.
[0034] Overexpression of a part of the citric acid cycle implies that one or more of the genes encoding enzymes involved in a part of the citric acid cycle are overexpressed. Reduced activity of a native metabolic route to acetate and/or lactate implies that such a native metabolic route is down-regulated.
[0035] In the context of the present invention, a native metabolic route is down-regulated in a recombinant host cell when at least one gene involved in the metabolic route is abnormally expressed, under-expressed or not expressed at all so that the enzyme encoded by said gene is produced in a lesser amount, not produced at all and/or has a lower or absent biological activity in a given metabolic pathway in comparison to the non-recombinant form of the cell.
[0036] Thus, the recombinant cell of the invention/cell used in a method of the invention may be one which:
[0037] (i) overexpresses cis-aconitate decarboxylase; and
[0038] (iia) overexpresses a part of the citric acid cycle; or
[0039] (iib) has reduced activity of a native metabolic route to acetate and/or lactate; or
[0040] (iic) overexpresses a part of the citric acid cycle and has reduced activity of a native metabolic route to acetate and/or lactate.
[0041] Overexpression in the context of this invention indicates that a given nucleic acid sequence and/or amino acid sequence is expressed to a greater degree in a recombinant cell of the invention than a non-recombinant form of the cell, which may typically be a corresponding wild type cell (i.e. a wild type cell of the same species). A nucleic acid and/or polypeptide may be overexpressed in the sense that a nucleic acid and/or polypeptide expressed in the reference cell is expressed to a greater degree in a recombinant cell of the invention (the reference cell may not express the nucleic acid and/or polypeptide at all). Overexpression may occur, for example, via overexpression of a nucleic acid and/or polypeptide which is endogenous (or homologous) to the reference cell. Overexpression may occur, for example, via overexpression of a nucleic acid and/or polypeptide which is exogenous (or heterologous) to the reference cell. That is to say, overexpression may occur, for example, via overexpression of a nucleic acid and/or polypeptide which is natively occurs in the reference cell. Overexpression may occur, for example, via overexpression of a nucleic acid and/or polypeptide which is not present or not expressed at all in the reference cell.
[0042] A recombinant cell of the invention/recombinant cell for use in a method of the invention may overexpress at least one exogenous nucleic acid and/or polypeptide and overexpress at least one endogenous nucleic acid and/or polypeptide.
[0043] To increase the likelihood that an introduced enzyme(s) is/are expressed in active form in a eukaryotic cell of the invention, the corresponding encoding nucleotide sequence may be adapted to optimise its codon usage to that of the chosen eukaryote host cell. Several methods for codon optimisation are known in the art. A preferred method to optimise codon usage of the nucleotide sequences to that of the eukaryotic cell is a codon pair optimization technology as disclosed in WO2008/000632. Codon-pair optimization is a method for producing a polypeptide in a host cell, wherein the nucleotide sequences encoding the polypeptide have been modified with respect to their codon-usage, in particular the codon-pairs that are used, to obtain improved expression of the nucleotide sequence encoding the polypeptide and/or improved production of the polypeptide. Codon pairs are defined as a set of two subsequent triplets (codons) in a coding sequence.
[0044] In a recombinant cell of the invention/recombinant cell for use in a method of the invention, a cis-aconitate decarboxylase is typically overexpressed. A cis-aconitate decarboxylase (EC 4.1.1.6) is any enzyme that catalyzes the chemical reaction:
cis-aconitateitaconate+CO.sub.2
[0045] A suitable cis-aconitate decarboxylase may be one which is obtainable from, that is to say derivable from or found in, Aspergillus terreus (Dwiarti et al., J. Bioscience and Bioengineering, 94 (1):29-33, 2002 and WO 2009/014437).
[0046] In a recombinant cell of the invention/recombinant cell for use in a method of the invention, overexpression of a part of the citric acid cycle may be overexpression of a citrate synthase and/or overexpression of an aconitase.
[0047] A suitable citrate synthase (E.C. 2.3.3.1 [previously 4.1.3.7]) may be any enzyme that catalyzes the condensation reaction of the two-carbon acetate residue from acetyl coenzyme A and a molecule of four-carbon oxaloacetate to form the six-carbon citrate:
acetyl-CoA+oxaloacetate+H.sub.2O.fwdarw.citrate+CoA-SH
[0048] A suitable citrate synthase may be that encoded by the gltA gene from Corynebacterium glutamicum (eg. Gen Bank NP_600058.1).
[0049] An aconitase (aconitate hydratase; EC 4.2.1.3) is an enzyme that catalyses the stereo-specific isomerization of citrate to isocitrate via cis-aconitate in the tricarboxylic acid cycle, a non-redox-active process.
[0050] A suitable aconitase may be that encoded by the acnA gene from Corynebacterium glutamicum (eg. Gen Bank NP_600755.1).
[0051] A recombinant cell of the invention/recombinant cell for use in a method of the invention may have reduced activity of a native metabolic route to acetate and/or lactate. Reduced activity indicates that the recombinant cell is modified such that less acetate and/or lactate is produced in the recombinant cell as compared with a non-recombinant form of the cell.
[0052] Such reduced activity may be achieved by reducing the activity of one or more enzymes involved in the native metabolic route to acetate and/or lactate. Reduced activity in this sense indicates that a recombinant cell has been modified, preferably in its genome, to result in a deficiency in the production of one or more enzymes involved in the native metabolic route to acetate and/or lactate. Such a recombinant cell may be modified, preferably in its genome, to result in a phenotypic feature wherein the cell: a) produces less of the enzyme or produces substantially none of the enzyme and/or b) produces an enzyme having a decreased activity or decreased specific activity or an enzyme having no activity or no specific activity and combinations of one or more of these possibilities as compared to a non-modified form of the recombinant cell.
[0053] In a recombinant cell of the invention/recombinant cell for use in a method of the invention, reduced activity of a native metabolic route to acetate may be a result of reduced activity of a phosphate acetyltransferase, for example by deleting, disrupting or inactivating a gene encoding that enzyme such as the pta gene or homolog/ortholog of that gene depending on the species of the recombinant cell.
[0054] In a recombinant cell of the invention/recombinant cell for use in a method of the invention, reduced activity of a native metabolic route to acetate may be a result of reduced activity of a lactate dehydrogenase, for example by deleting, disrupting or inactivating a gene encoding that enzyme such as the ldhA gene or homolog/ortholog of that gene depending on the species of the recombinant cell.
[0055] In the method of the invention, production of itaconic acid may be accompanied by: ethanol and formate (or hydrogen gas and CO.sub.2) production; or succinate.
[0056] In the method of the invention, glutamate production may be repressed. Repression of glutamate indicates that steps are taken so that production of glutamate takes place in the method of the invention to a lesser extent that would the case in the absence of those steps. Such steps may be modifications to the recombinant cell or may be specific steps taken in the process itself to repress glutamate production. For example, a repression of glutamate production may be carried out by carrying out the fermentation under nitrogen free conditions.
[0057] The recombinant cell of the invention/recombinant cell for use in a method of the invention may be a prokaryotic, an archael cell or a eukaryotic host cell. A recombinant cell of the invention/recombinant cell for use in a method of the invention may be a prokaryotic cell. Preferably, the prokaryotic cell is a bacterial cell. The term bacterial cell includes both Gram-negative and Gram-positive microorganisms. Suitable bacteria may be selected from e.g. Escherichia, Anabaena, Caulobactert, Gluconobacter, Rhodobacter, Pseudomonas, Paracoccus, Bacillus, Brevibacterium, Corynebacterium, Rhizobium (Sinorhizobium), Flavobacterium, Klebsiella, Enterobacter, Lactobacillus, Lactococcus, Methylobacterium, Staphylococcus or Streptomyces. Preferably, the bacterial cell is selected from the group consisting of B. subtilis, B. amyloliquefaciens, B. licheniformis, B. puntis, B. megaterium, B. halodurans, B. pumilus, G. oxydans, Caulobactert crescentus CB 15, Methylobacterium extorquens, Rhodobacter sphaeroides, Pseudomonas zeaxanthinifaciens, Paracoccus denitrificans, E. coli, C. glutamicum, Staphylococcus carnosus, Streptomyces lividans, Sinorhizobium melioti and Rhizobium radiobacter.
[0058] A recombinant cell of the invention/recombinant cell for use in a method of the invention may be a eukaryotic cell. Preferably, the eukaryotic cell is a fungal, or algal cell.
[0059] A suitable fungal cell may be a yeast cell or a filamentous fungal cell.
[0060] Suitable yeast cells include those such as Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia strain. More preferably a Kluyveromyces lactis, Saccharomyces cerevisiae, Hansenula polymorpha, Yarrowia lipolytica or Pichia pastoris, or a filamentous fungal cell.
[0061] Suitable filamentous fungal cell include all filamentous forms of the subdivision Eumycota and Oomycota (as defined by Hawksworth et al., In, Ainsworth and Bisby's Dictionary of The Fungi, 8th edition, 1995, CAB International, University Press, Cambridge, UK). The filamentous fungi are characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by hyphal elongation. Filamentous fungal strains include, but are not limited to, strains of Acremonium, Agaricus, Aspergillus, Aureobasidium, Chrysosporium, Coprinus, Cryptococcus, Filibasidium, Fusarium, Geosmithia, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Piromyces, Panerochaete, Pleurotus, Rasamsonia, Schizophyllum, Talaromyces, Thermoascus, Thermomyces, Thielavia, Tolypocladium, and Trichoderma. For example, a species of Aspergillus niger, Acremonium alabamense, Acremonium chrysogenum, Aspergillus awamori, Aspergillus foetidus, Aspergillus sojae, Aspergillus fumigatus, Talaromyces emersonii, Talaromyces thermophilus, Thermomyces lanuginosus, Thermoascus thermophilus, Thermoascus aurantiacus, Thermoascus crustaceus, Rasamsonia emersonii, Rasamsonia byssochlamyoides, Rasamsonia argillacea, Rasamsonia brevistipitata, Rasamsonia cylindrospora, Aspergillus oryzae, Chrysosporium lucknowense, Fusarium oxysporum, Myceliophthora thermophila, Trichoderma reesei, Thielavia terrestris or Penicillium chrysogenum. Most preferred species are Aspergillus niger or Penicillium chrysogenum.
[0062] Several strains of filamentous fungi are readily accessible to the public in a number of culture collections, such as the American Type Culture Collection (ATCC), Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH (DSM), Centraalbureau Voor Schimmelcultures (CBS), and Agricultural Research Service Patent Culture Collection, Northern Regional Research Center (NRRL) Aspergillus niger CBS 513.88, Aspergillus oryzae ATCC 20423, IFO 4177, ATCC 1011, ATCC 9576, ATCC14488-14491, ATCC 11601, ATCC12892, P. chrysogenum CBS 455.95, Penicillium citrinum ATCC 38065, Penicillium chrysogenum P2, Talaromyces emersonii CBS 124.902, Acremonium chrysogenum ATCC 36225 or ATCC 48272, Trichoderma reesei ATCC 26921 or ATCC 56765 or ATCC 26921, Aspergillus sojae ATCC11906, Chrysosporium lucknowense C1, Garg 27K, VKM-F 3500 D, ATCC44006 and derivatives thereof.
[0063] The method of the invention for the preparation of itaconic acid or for the preparation of a fermentation broth comprising itaconic acid comprises fermenting a recombinant cell, for example a recombinant prokaryotic cell or recombinant eukaryotic cell, as described herein in the presence of a suitable fermentation medium under anaerobic conditions. Suitable fermentation media are known to the person skilled in the art. Fermentation of the recombinant cell may be carried out under conditions which lead to the production of itaconic acid. The method of the invention may be carried out in the presence or absence of oxygen. Typically, the method is carried out under anaerobic conditions.
[0064] For the purposes of this invention, an anaerobic fermentation process may be herein defined as a fermentation process run in the absence of oxygen or in which substantially no oxygen is consumed, preferably less than 5, 2.5 or 1 mmol/L/h, and wherein organic molecules serve as both electron donor and electron acceptors. The fermentation process according to the present invention may also first be run under aerobic conditions and subsequently under anaerobic conditions. Anaerobic conditions are typically used in the production phase (production of the itaconic acid).
[0065] The fermentation process of the invention may also be run under oxygen-limited, or micro-aerobic, conditions which are, for the purposes of this invention, considered to be anaerobic processes. Alternatively, the fermentation process may first be run under aerobic conditions and subsequently under oxygen-limited conditions. An oxygen-limited fermentation process is a process in which the oxygen consumption is limited by the oxygen transfer from the gas to the liquid. The degree of oxygen limitation is determined by the amount and composition of the ingoing gasflow as well as the actual mixing/mass transfer properties of the fermentation equipment used.
[0066] The process for the production of itaconic acid according to the present invention may be carried out at any suitable pH between 1 and 9. Preferably, the pH in the fermentation broth is between 2 and 7. It may be advantageous to be able to carry out the process according to the present invention at a low pH, for example at a pH equal to or below the pKa, typically the lowest pKa, of itaonic acid, since this may help to prevent bacterial contamination. In addition, since the pH drops during itaconic acid production, a lower amount of titrant is needed to keep the pH at a desired level.
[0067] A suitable temperature at which the process according to the present invention may be carried out is between 5 and 60 C., preferably between 10 and 50 C., more preferably between 15 and 35 C., more preferably between 18 C. and 30 C. The person skilled in the art knows which optimal temperatures are suitable for fermenting a specific yeast cell.
[0068] In a method of the invention for the production of itaconic acid, the acid may be secreted into the fermentation broth and/or present in the recombinant cell used in the invention. Thus, the invention also provides a fermentation broth comprising itaconic acid obtainable by a method according to the invention. The broth may comprise: itaconic acid which has been secreted from a recombinant cell: itaconic acid comprised within a recombinant cell of the invention; itaconic acid which has been released from a recombinant cell following treatment of the cell to cause disruption of the cell and release of itaconic acid; or a mixture of any thereof.
[0069] Preferably, in the method of the invention, the itaconic acid is recovered from the fermentation broth by a suitable method known in the art, for instance by extraction or crystallisation. A recombinant cell of the invention may need to be disrupted to allow for release of itaconic acid.
[0070] Preferably, the itaconic acid or an ester of itaconic acid that is prepared in the process according to the present invention is further converted into a desirable product, such as a pharmaceutical, cosmetic, food, feed or chemical product. In particular, itaconic acid may be further converted into a polymer.
[0071] Thus, the invention provides a method for the production of a pharmaceutical, cosmetic, food, feed or chemical product which method comprises: (a) preparing itaconic acid by a method according to the invention and; (b) preparing the pharmaceutical, cosmetic, food, feed or chemical product using said itaconic acid.
[0072] Standard genetic techniques, such as overexpression of enzymes in host cells, genetic modification of host cells, or hybridisation techniques, are known methods in the art, such as described in Sambrook and Russel (2001) Molecular Cloning: A Laboratory Manual (3.sup.rd edition), Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, or F. Ausubel et al, eds., Current protocols in molecular biology, Green Publishing and Wiley Interscience, New York (1987). Methods for transformation, genetic modification etc. of fungal host cells are known from e.g. EP-A-0 635 574, WO 98/46772, WO 99/60102 and WO 00/37671, WO90/14423, EP-A-0481008, EP-A-0635 574 and U.S. Pat. No. 6,265,186. Accordingly, preparation of a recombinant cell suitable for use in the invention is well known to those skilled in the art.
Embodiments of the Invention
[0073] 1. A method for the production of itaconic acid, which method comprises fermenting a recombinant cell capable of producing itaconic acid in a suitable fermentation medium, thereby to produce itaconic acid, wherein: [0074] (a) the recombinant cell: (i) overexpresses cis-aconitate decarboxylase; and (ii) overexpresses a part of the citric acid cycle and/or has reduced activity of a native metabolic route to acetate and/or lactate; and, optionally, [0075] (b) the fermentation is carried out under anaerobic conditions. [0076] 2. A method according to embodiment 1, wherein the cis-aconitate decarboxylase is one obtainable from, such as derivable from or found in or isolated from, Aspergillus terreus. [0077] 3. A method according to embodiment 1 or 2, wherein overexpression of a part of the citric acid cycle is overexpression of a citrate synthase and/or overexpression of an aconitase. [0078] 4. A method according to any one of embodiments 1 to 3, wherein reduced activity of a native metabolic route to acetate is reduced activity of a phosphate acetyltransferase. [0079] 5. A method according to any one of embodiments 1 to 4, wherein reduced activity of a native metabolic route to lactate is reduced activity of a lactate dehydrogenase. [0080] 6. A method according to any one of embodiments 1 to 5, wherein production of itaconic acid is accompanied by ethanol and formate (or hydrogen gas and CO.sub.2) production. [0081] 7. A method according to any one of embodiments 1 to 6, wherein glutamate production is repressed, preferably wherein Repression of glutamate production is achieved by taking steps so that production of glutamate takes place in the method to a lesser extent that would the case in the absence of those steps, more preferably wherein repression of glutamate production is carried out by carrying out the fermentation under nitrogen free conditions. [0082] 8. A method according to any one of embodiments 1 to 7, wherein the recombinant cell is a prokaryotic or a eukaryotic cell. [0083] 9. A method according to embodiment 8, wherein the cell is a bacterial cell, such as E. coli, or a yeast cell, such as S. cerevisiae. [0084] 10. A method according to any one of the preceding embodiments which comprises recovery of the itaconic acid. [0085] 11. A fermentation broth comprising itaconic acid obtainable by a method according to any one of embodiments 1 to 10. [0086] 12. A method for the production of a pharmaceutical, cosmetic, food, feed or chemical product which method comprises: (a) preparing itaconic acid by a method according to any one of embodiments 1 to 10 and; (b) preparing the pharmaceutical, cosmetic, food, feed or chemical product using said itaconic acid. [0087] 13. A recombinant cell capable of producing itaconic acid, wherein the recombinant cell: (i) overexpresses cis-aconitate decarboxylase; and (ii) overexpresses a part of the citric acid cycle and/or has reduced activity of a native metabolic route to acetate and/or lactate. [0088] 14. A recombinant cell according to embodiment 13 as defined in any one of embodiments 1 to 5, 8 or 9. [0089] 15. A method for the production of itaconic acid, which method comprises fermenting a recombinant cell capable of producing itaconic acid in a suitable fermentation medium, thereby to produce itaconic acid, wherein the recombinant cell is one according to embodiment 13 or 14. [0090] 16. A method according to embodiment 15, wherein the fermentation is carried out under anaerobic conditions, preferably wherein fermentation carried out under anaerobic conditions means a fermentation process run in the absence of oxygen or in which substantially no oxygen is consumed or a fermentation process run under oxygen limited, or micro-aerobical, conditions.
[0091] A reference herein to a patent document or other matter which is given as prior art is not to be taken as an admission that that document or matter was known or that the information it contains was part of the common general knowledge as at the priority date of any of the claims.
[0092] The disclosure of each reference set forth herein is incorporated herein by reference in its entirety.
[0093] The present invention is further illustrated by the following Examples:
Examples
Methods
Bacterial Strains and Plasmids
[0094] The bacterial strains and plasmids used in this study are listed in Table 1.
Deletion of Phosphate Acetyltransferase (pta) and Lactate Dehydrogenase (ldhA) Genes
[0095] The gene encoding lactate dehydrogenase (ldhA) was inactivated in E. coli BW25113 pta by using the Lambda red-mediated gene replacement method described by (Datsenko and Wanner (2000), Proceedings of the National Academy of Sciences of the United States of America 97(12):6640-6645). Shortly, E. coli BW25113 pta was transformed with pKD46 and cultured in the presence of L-arabinose to induce -red recombinase expression, which is an inducer for recombination. The target gene ldhA was replaced by a kanamycin resistance gene flanked by flippase recognition target (FRT) sites. For this, a deletion cassette containing a kanamycin resistance gene with FRT sites was amplified from pKD4 by using Phusion High Fidelity DNA Polymerase (Thermo Scientific) and primers that contain 50 bp targeting flanks to the ldhA region in the genome (Table 2) and transformed into E. coli BW25113 pta (pKD46). Transformants were screened for their proper genotype by selecting for kanamycin resistance and colony PCR (GoTaq Green polymerase, Promega) using primers that flank the target gene. The phenotype was verified in liquid cultures. The kanamycin resistance gene was subsequently eliminated by using the temperature-sensitive helper plasmid pCP20 encoding the flippase (FLP), followed by curing of the temperature sensitive plasmids by culturing strains at 42 C. for 16 hours.
Site-Specific Integration of the DE3 Prophage
[0096] Site-specific integration of the DE3 prophage into E. coli BW25113 and into its derivative E. coli BW25113 pta ldhA was done using the DE3 Lysogenization Kit (Novagen). The integration of the DE3 prophage and expression of T7 polymerase in strains were verified according to the protocol in the kit. Besides, the functional expression of T7 polymerase was confirmed by transforming the strains with pET101/D/lacZ. The transformants were able to cleave 5-bromo-4-chloro-3-indolyl--D-galactopyranoside (X-gal) after induction with isopropyl-beta-D-thiogalactopyranoside (IPTG).
Construction of pACYC Expression Vectors
[0097] The expression vector pACYCDuet-1 (Novagen) was used to express the genes cadA (NCBI Reference Sequence ID: BAG49047.1), acnA (ID: NP_600755.1), and gltA (ID: NP_600058.1) under the transcriptional control of the T7 promoter. All genes were codon-optimized according to the algorithm of OptimumGene (GenScript) and synthesized by GenScript, USA. The sequences of the codon-optimized cadA, acnA, and gltA can be retrieved from GenBank (ID: KM464677, ID: KM464678, ID: KM464679, respectively. cadA was ligated between the NcoI-HindIII restriction sites in MCS1 of pACYCDuet-1, yielding pKV-C. acnA and gltA were respectively ligated between the NdeI-XhoI and XhoI-PacI sites in MCS2 of pKV-C, yielding pKV-CGA, Table 1. An additional ribosomal binding site (rbs), identical to those in pACYCDuet-1, was introduced upstream of gltA gene. The expression vector pKV-GA was derived from pKV-CGA by cloning the acnA and gltA containing part of pKV-CGA in pACYCDuet-1.
Cultivation Conditions
Culture Media
[0098] For plasmid construction and gene expression analysis, E. coli strains were cultured on Luria-Bertani (LB) agar plates or in LB liquid medium at either 30 C. or 37 C. Recombinants harbouring temperature-sensitive plasmids were cultured at either 30 C. for cultivation or 42 C. to cure the selection markers. Expression of IacZ was detected by blue/white screening in agar plates on top of which 40 l of 20 mg/ml X-gal in dimethyl sulfoxide and 40 l of 1 M IPTG were spread on top of the plates. When needed, medium and plates were supplemented with ampicillin (50 g/mL) or chloramphenicol (35 g/mL). Induction of gene expression in liquid cultures was started by the addition of 1 mM of IPTG when the optical density at 600 nm (OD.sub.600) of the culture reached approximately 0.4.
[0099] The other cultivations were done in M9 Minimal medium (MM), which contained per 1 liter: 200 mL 5M9 Minimal Salts (BD Difco) supplemented with 50 mmoles of glucose, 2 mmoles of MgSO4, 0.1 mmoles of CaCl.sub.2, 15 mg of thiamine, and 0.30 mg of selenite. Medium was buffered with 0.1 M 3-(N-morpholino) propanesulfonic acid (MOPS) and the pH was adjusted to 6.9 with NaOH.
Cultivation in Bioreactors (Aerobic)
[0100] E. coli BW25113 (DE3) and E. coli BW25113 (DE3) pta-ldhA containing either pEV, pKV-C or pKV-CGA were cultivated at 30 C. in 0.5 L Mini Bioreactors, connected to myControl controller units (Applikon, The Netherlands) with a working volume of 400 ml. The pH was maintained at 6.9 by the automated addition of 2 M NaOH. Cultures were continuously stirred at 1200 rpm and sparged with medical air at 400 mL/min. Bioreactors were inoculated with 5% (v/v) of a pre-culture that was grown in a 250 mL Erlenmeyer flasks with 50 mL of MM at 250 rpm and 30 C. for 24 hours. Samples of 2 mL were regularly taken to determine the OD.sub.600 of the cultures and the concentrations of substrate and products.
Cultivation in Bioreactors (Anaerobic)
[0101] E. coli BW25113 (DE3) and E. coli BW25113 (DE3) pta-ldhA containing either pEV, pKV-C or pKV-CGA were cultivated at 30 C. in 0.5 L Mini Bioreactors, connected to myControl controller units (Applikon, The Netherlands) with a working volume of 400 ml. The pH was maintained at 6.9 by the automated addition of 2 M NaOH. Cultures were stirred at 400 rpm and sparged with nitrogen at 16 mL/min for 17 hours, after which the stirring speed was increased to 800 rpm and the sparging rate was increased to at 35 mL/min. Bioreactors were inoculated with 5% (v/v) of a pre-culture that was grown at 30 C. in a 250 mL Erlenmeyer flasks with 50 mL of MM at 250 rpm for 24 hours. Samples of 2 mL were regularly taken to determine the OD.sub.600 of the cultures and the concentrations of substrate and products.
Enzymatic Assays
[0102] For enzymatic assays, 50 mL of bioreactor culture was harvested by centrifugation (5 min, 7745g) after 17 hours of cultivation in the presence of IPTG and washed with MM. Cell free extracts (CFE) were made according to the Y-PER Yeast Protein Extraction Reagent kit instructions (Thermo Scientific). Protein concentrations were determined by using the Total Protein Kit, Micro Lowry, Peterson's Modification (Sigma Aldrich).
[0103] The activity of cis-aconitate decarboxylase (CadA) was measured by using a method adapted from (Dwiarti et al. (2002) Journal of Bioscience and Bioengineering 94(1):29-33) and (Li et al. (2011) Fungal genetics and biology 48(6)): CFE's were incubated with 17 mM of cis-aconitate in 200 mM sodium phosphate buffer (pH 6.2) for 10 min at 30 C. Reactions were terminated by adding 1 M HCl. Supernatants were analyzed for itaconate formation by HPLC.
[0104] The activity of aconitase was measured by monitoring the formation of cis-aconitate at 240 nm in a UV-Vis Spectrophotometer (UV-1650PC SHIMADZU) using an extinction coefficient for cis-aconitate of 3.5 mM.sup.1 cm.sup.1 (Baumgart and Bott 2011). The assays were performed at 30 C. in 100 mM Tris-HCl buffer (pH 8.0) and 20 mM trisodium citrate as a substrate.
[0105] Citrate synthase activity was determined by monitoring the hydrolysis of the thioester of acetyl coenzyme A (acetyl-CoA), which results in the formation of CoA. The thiol group of CoA reacts with 5,5-dithiobis-(2-nitrobenzoic acid (DTNB) in the reaction mixture to form 5-thio-2-nitrobenzoicacid (TNB). The formation of TNB was measured at 412 nm by using 13.6 mM.sup.1 cm.sup.1 as extinction coefficient at 30 C. according to (Morgunov and Srere 1998) with minor adjustments. The reaction mixture contained 0.31 mM acetyl-CoA, 0.5 mM oxaloacetate, 0.1 mM DTNB, and ca. 0.25% Triton X-100 in 100 mM Tris-HCl (pH 8.0).
Analytical Methods
[0106] The cell density was determined by measuring the OD.sub.600 by using a spectrophotometer (Dr. Lange XION 500).
[0107] The concentrations of glucose and organic acids were determined by using HPLC by using a Dionex Ultimate 3000 (Thermo Fisher) equipped with an RI detector (Shodex, RI-101) and a UV detector (Dionex, 3400 RS at 210 nm). The samples were separated on a Micro Guard Cation H pre-column (304.6 mm, Biorad) and an Aminex HPX-87H column (3007.8 mm, Biorad) at 35 C., using 0.6 mL/min of 5 mM H.sub.2SO.sub.4 as an eluent.
[0108] The concentrations of glutamate and alanine were determined by using UPLC Dionex RSLC system with an UltiMate 3000 Rapid Separation pump as described by Meussen et al. (2014, Food Analytical Methods, 7:1047-1055).
[0109] The concentrations of CO.sub.2 and H.sub.2 in the off-gas of the bioreactors were determined by using BlueSens Off-Gas Sensors (Gas Sensor, GmbH).
Itaconate Production in Absence of Ammonium
[0110] To monitor itaconate production in the absence of ammonium, 50 mL of bioreactor culture was harvested by centrifugation (5 min, 7745g) after 32 hours of cultivation in the presence of IPTG. The culture was washed and resuspended in 40 mL nitrogen-free phosphate buffer (NF-PB), which consisted of 50 mM sodium phosphate (pH 7.0) with 100 mM MOPS and 60 mM glucose. Control samples were washed and resuspended in 40 mL MM with 50 mM glucose. Cultures were transferred to anaerobic serum bottles and cultured at 150 rpm and 30 C. for 24 hours. Samples of 2 mL were regularly taken to determine the OD.sub.600 of the cultures and the concentrations of substrate and products.
TABLE-US-00001 TABLE 1 E. coli strains and plasmids used in this study Strains BW25113 laclq rrnBT14 lacZ WJ16 hsdR514 ara BADAH33 rha BADLD78 CGSC.sup.1 BW25113 (DE3) BW25113 DE3 T7 RNA polymerase This study BW25113 pta BW25113 pta - 779::kan CGSC BW25113 (DE3) pta ldhA BW25113 pta ldhA DE3 T7 RNA polymerase This study Plasmids pET101/D/lacZ pBR322 ori lacl T7 AmpR Invitrogen pKD46 AmpR plasmid with temperature-sensitive replication and arabinose CGSC induction of -red recombinase pKD4 KanR plasmid with R6K- replicon CGSC pCP20 AmpR and CmR plasmid with temperature-sensitive replicon and CGSC thermal induction of FLP synthesis pEV pACYCDuet-1 overexpression vector using T7 promoter capable to Novagen carry two multiple cloning sites, CmR pKV-C pACYCDuet-1 derivative, synthetic cadA gene This study pKV-CGA pACYCDuet-1 derivative, synthetic cadA, acnA, and gltA genes This study pKV-GA pACYCDuet-1 derivative, synthetic acnA and gltA genes This study .sup.1The Coli Genetic Stock Center at Yale University
TABLE-US-00002 TABLE2 Listofprimersusedinthisstudy Nameand description Sequence ForIdhAdeletion IdhAflankF (SEQIDNO:1)aaatattttt agtagcttaaatgtgattcaacatcactgg agaaagtcttgtgtaggctggccatggtcc IdhAflankR (SEQIDNO:2)attggggatt atctgaatcagctcccctggaatgcagggg agcggcaagaatgggaattagccatggtcc ForPCRverifications IdhAcheckF (SEQIDNO:3)aaatattttt agtagcttaaatgtg icdcheckR (SEQIDNO:4)attggggatt atctgaatcagctcc
Example 1. Heterologous Expression of cadA, acnA, and gltA
[0111] Gene cadA from A. terreus was codon optimized and expressed in E. coli to enable itaconate production. Small amounts of itaconate were produced (below 10 mg/L) when E. coli BW25113 (DE3) (pKV-C) was cultivated in LB in shake flask cultures at 37 C., but no detectable CadA activity was found in CFE of these cultures. SDS-PAGE analysis showed that almost all CadA was present in the form of inclusion bodies (data not shown). As inclusion bodies are often associated with fast and high-level expression of heterologous proteins (Jurgen et al. 2010 Microbial Cell Factories 9(1)), two measures were taken to reduce these rates: cultivation in MM instead of LB and cultivation at lower temperatures. When E. coli BW25113 (DE3) (pKV-C) was grown in MM in pH-controlled bioreactors at 37, CadA could be detected in CFE with a specific activity of 0.03 U/mg. The activity was further increased to 0.38 U/mg when the cultivation temperature was lowered to 30 C. (
[0112] To channel more acetyl-CoA to itaconate, the codon optimized genes encoding citrate synthase (gltA) and aconitase (acnA) from C. glutamicum were overexpressed in E. coli together with cadA, yielding E. coli BW25113 (DE3) (pKV-CGA). The expression levels of the heterologous genes were determined by measuring the activities of the corresponding enzymes in CFE of E. coli BW25113 (DE3) strains containing either pEV, pKV-C or pKV-CGA. The activities of citrate synthase and aconitase in CFE's of E. coli BW25113 (DE3) (pKV-CGA) increased 4 and 40 times, respectively, compared to the native activities measured in E. coli BW25113 (DE3) (pKV-C) (
Example 2. Itaconate Production in E. coli BW25113 (DE3)
[0113] Itaconate production by E. coli BW25113 (DE3) containing either pEV, pKV-C, or pKV-CGA was monitored in pH-controlled bioreactors in MM at 30 C. for 72 hours. Itaconate was produced up to 1.9 mM with both E. coli BW25113 (DE3) (pKV-C) and BW25113 (DE3) (pKV-CGA), but not in the control strain (
[0114] During growth on glucose, acetate was observed in all cultures after 1 day of cultivation, which accumulated up to 55 mM. When glucose was depleted from the medium, the cells started consuming acetate. In addition, low concentrations (below 5 mM) of ethanol, citrate, pyruvate, lactate, succinate and formate were detected in the medium during cultivation of all strains, and some cis-aconitate (<5 mM) was formed by E. coli BW25113 (DE3) (pKV-C) and BW25113 (DE3) (pKV-CGA) (data not shown). Most of these compounds were only intermediary products and disappeared over time.
Example 3. Itaconate Production in E. coli BW25113 (DE3) pta-ldhA
[0115] To increase the availability of precursors, E. coli BW25113 (DE3) was made deficient in acetate and lactate production. Deletion of pta, encoding phosphate acetyltransferase, is known to result in accumulation of pyruvate in the cells, which may be redirected to itaconate. As pta strains have been reported to convert pyruvate to lactate (Castano-Cerezo et al. 2009 Microbial Cell Factories 8 doi:54 10.1186/1475-2859-8-54), this conversion was eliminated as well by deleting ldhA. To test the effect of these eliminations, the resulting strain E. coli BW25113 (DE3) pta-ldhA, containing either pEV, pKV-C, or pKV-CGA, was cultivated in pH-controlled bioreactors in MM at 30 C.
[0116] E. coli BW25113 (DE3) pta-ldhA (pKV-CGA) produced three times more itaconate than its wild type equivalent. Overexpression of gltA and acnA was essential to improve itaconate production, as production was not enhanced in E. coli BW25113 (DE3) pta-ldhA (pKV-C) (
[0117] The results show that the simultaneous elimination of pta and ldhA and the heterologous expression of gltA and acnA increased the flux through CadA, resulting in higher itaconate titers of up to 690 mg/L, which corresponds to an itaconate yield from glucose of 0.09 mol/mol,
Example 4: Effect of pta-ldhA on Growth Under Anaerobic Conditions
[0118] E. coli BW25113 (DE3) (pEV) and E. coli BW25113 (DE3) pta-ldhA (pEV) were grown on MM in pH-controlled bioreactors under anaerobic conditions with glucose as carbon source. The main fermentation products of E. coli BW25113 (DE3) (pEV) were lactate, ethanol, formate and acetate (
[0119] E. coli BW25113 (DE3) pta-ldhA (pEV), in which pta, encoding phosphate acetyltransferase, and ldhA, encoding lactate dehydrogenase were eliminated, still produced acetate in comparable amounts as E. coli BW25113 (DE3) (pEV), but lactate was no longer formed (
Example 5: Itaconate Production Under Anaerobic Conditions
[0120] E. coli BW25113 (DE3) and E. coli BW25113 (DE3) pta-ldhA containing pKV-C or pKV-CGA were grown on MM in pH-controlled bioreactors under anaerobic conditions. pKV-C and pKV-CGA both express codon-optimized cadA, which encodes the cis-aconitate decarboxylase from Aspergillus terreus that was previously shown to enable the production of itaconate in E. coli. pKV-CGA also expresses citrate synthase (gltA) and aconitase (acnA) from Corynebacterium glutamicum. These genes enhanced the production of itaconate in E. coli BW25113 (DE3) pta-ldhA under aerobic conditions (see Examples 1 to 4).
[0121] Expression of cadA did not result in itaconate production in E. coli BW25113 (DE3) (pKV-C) (
[0122] The fermentation products that were formed by the strains carrying either pKV-C or pKV-CGA were similar to those formed by the strains carrying pEV. However, the carbon recovery for strain E. coli BW25113 (DE3) pta-ldhA (pKV-CGA) was initially much lower (84%) than for the other strains, indicating that unidentified products were formed. Amino acid analysis of the culture supernatants showed that this strain accumulated significant amounts of glutamate and alanine. Alanine was also produced by all other strains but glutamate was only produced in large amounts by strain E. coli BW25113 (DE3) pta-ldhA (pKV-CGA). This indicates that expression of gltA and acnA increased the flux through the citric acid cycle, resulting in more itaconate and the accumulation of glutamate (
TABLE-US-00003 TABLE 3 Product distribution in % Cmol in culture supernatants of E. coli BW25113 (DE3) and E. coli BW25113 (DE3) pta-ldhA containing pEV, pKV-C, pKV-CGA or pKV-GA after 66 hours in pH-controlled bioreactors on MM at 30 C. C-recovery formate ethanol acetate succinate lactate pyruvate itaconate citrate glutamate alanine biomass CO.sub.2 % E. coli BW25113 (DE3) pta-ldhA pEV 15.8 20.4 12.8 6.8 26.7 1.4 0.0 0.0 0.0 1.7 3.0 0.9 89.5 pKV-C 14.3 26.2 11.4 5.3 33.5 2.3 0.0 0.5 0.0 1.5 2.2 1.4 98.6 pKV-CGA 13.5 18.7 9.2 5.9 37.9 1.9 0.1 0.0 2.5 2.3 2.0 1.1 95.0 pKV-GA 17.9 27.4 13.0 7.0 25.9 1.1 0.0 0.0 1.7 2.2 2.4 0.9 99.4 E. coli BW25113 (DE3) pta-ldhA pEV 0.0 23.0 10.4 18.0 0.1 20.2 0.0 2.7 0.2 3.7 1.8 14.4* 94.4 pKV-C 0.0 29.7 5.2 17.6 0.1 36.0 0.1 1.5 0.3 3.5 3.2 13.2 110.3 pKV-CGA 0.0 29.8 3.3 12.1 0.8 17.9 1.2 4.0 13.0 3.6 2.8 16.4 104.9 pKV-GA 0.1 24.9 3.7 11.0 0.3 13.8 0.0 5.1 19.5 4.2 3.2 15.4 101.2 *based on theoretical CO.sub.2 production
Example 6: Glutamate Production Under Anaerobic Conditions
[0123] To further investigate the production of glutamate under anaerobic conditions, gltA and acnA were expressed without cadA in E. coli BW25113 (DE3) and E. coli BW25113 (DE3) pta-ldhA. The latter strain produced eight times more glutamate than the former one, resulting in the production of 8.6 mM of glutamate. This accounts for 19.5% of the carbon that was added to the culture.
Example 7: Itaconate Production Under Nitrogen Free Conditions
[0124] An option to prevent glutamate formation is to limit the availability of ammonium, as it is required for glutamate synthesis. For this, E. coli BW25113 (DE3) pta-ldhA containing pKV-C, pKV-CGA or pKV-GA was pre-cultured on MM in bioreactors for 48 hours. The cultures were washed and incubated in anaerobic serum bottles in nitrogen-free phosphate buffer (NF-PB) containing 60 mM glucose. The consumption of glucose and the formation of fermentation products were monitored in time. Glutamate production was completely absent in all the strains, which resulted in an increase in itaconate production up to 5.4 mM in E. coli BW25113 (DE3) pta-ldhA pKV-CGA (