LENTIVIRUS PACKAGING SYSTEM, LENTIVIRUS PRODUCED BY THE SAME, CELL TRANSDUCED BY THE LENTIVIRUS, METHOD FOR IMPROVING LENTIVIRUS PRODUCTION IN A HOST CELL, AND METHOD OF USING THE CELL FOR TREATING CANCER
20220348956 · 2022-11-03
Inventors
- Wei-Chi LIN (Taipei City, TW)
- Ssu-Yu CHOU (Taipei City, TW)
- Yao-Cheng YANG (Taipei City, TW)
- Chien-Ting LIN (Taipei city, TW)
- CHEN-LUNG LIN (Kaohsiung City, TW)
Cpc classification
C12N7/00
CHEMISTRY; METALLURGY
C12N2740/16052
CHEMISTRY; METALLURGY
C12N2740/15043
CHEMISTRY; METALLURGY
A61K35/17
HUMAN NECESSITIES
C12N2740/16043
CHEMISTRY; METALLURGY
International classification
C12N15/86
CHEMISTRY; METALLURGY
A61K35/17
HUMAN NECESSITIES
C07K14/705
CHEMISTRY; METALLURGY
Abstract
Provided is a lentivirus packaging system, which comprises: a transfer plasmid comprising a nucleotide sequence of TAR-reserved-chimeric 5′ long terminal repeat (LTR); at least one packaging plasmid comprising a nucleotide sequence encoding TAR RNA binding protein, a nucleotide sequence of rev gene, a nucleotide sequence of gag gene, and a nucleotide sequence of pol gene; and an envelope plasmid. Due to the expression of gene of TAR RNA binding protein by the packaging plasmids, the produced lentivirus has higher virus titer and can improve the transduction rate and the gene delivery efficiency during cell transduction. The present invention further provides a method of improving lentivirus production in a host cell, which comprises using the lentivirus packaging system to transfect the host cell. The present invention further provides a cell transduced by the lentivirus and a method of using the cell for treating cancer.
Claims
1. A lentivirus packaging system, comprising: a transfer plasmid comprising a nucleotide sequence of trans-activation response (TAR) element-reserved chimeric 5′ long terminal repeat (TAR-reserved chimeric 5′-LTR); at least one packaging plasmid comprising a nucleotide sequence encoding TAR RNA binding protein, a nucleotide sequence of rev gene, a nucleotide sequence of gag gene and a nucleotide sequence of pol gene; and an envelope plasmid.
2. The lentivirus packaging system as claimed in claim 1, wherein the at least one packaging plasmid comprises a first packaging plasmid and a second packaging plasmid, wherein the first packaging plasmid comprises two of a nucleotide sequence encoding TAR RNA binding protein, a nucleotide sequence of rev gene, a nucleotide sequence of gag gene and a nucleotide sequence of pol gene, and the second packaging plasmid comprises the rest of the nucleotide sequence encoding TAR RNA binding protein, the nucleotide sequence of rev gene, the nucleotide sequence of gag gene and the nucleotide sequence of pol gene.
3. The lentivirus packaging system as claimed in claim 1, wherein the at least one packaging plasmid comprises a first packaging plasmid, a second packaging plasmid, a third packaging plasmid and a fourth packaging plasmid; wherein the first packaging plasmid comprises a nucleotide sequence encoding TAR RNA binding protein; the second packaging plasmid comprises a nucleotide sequence of rev gene; the third packaging plasmid comprises a nucleotide sequence of gag gene; and the fourth packaging plasmid comprises a nucleotide sequence of pol gene.
4. The lentivirus packaging system as claimed in claim 1, wherein the at least one packaging plasmid comprises a first packaging plasmid, a second packaging plasmid and a third packaging plasmid; wherein the first packaging plasmid comprises two of a nucleotide sequence encoding TAR RNA binding protein, a nucleotide sequence of rev gene, a nucleotide sequence of gag gene and a nucleotide sequence of pol gene; and the second packaging plasmid and the third packaging plasmid each comprise a respective one of the other two of the nucleotide sequence encoding TAR RNA binding protein, the nucleotide sequence of rev gene, the nucleotide sequence of gag gene and the nucleotide sequence of pol gene.
5. The lentivirus packaging system as claimed in claim 4, wherein the first packaging plasmid comprises the nucleotide sequence gag gene and the nucleotide sequence of pol gene; the second packaging plasmid comprises the nucleotide sequence encoding TAR RNA binding protein; and the third packaging plasmid comprises the nucleotide sequence of rev gene.
6. The lentivirus packaging system as claimed in claim 5, wherein a weight ratio of the transfer plasmid, the first packaging plasmid, the second packaging plasmid, the third packaging plasmid and the envelope plasmid is 3 to 12:3 to 7:1 to 4:1 to 4:0.8 to 6.
7. The lentivirus packaging system as claimed in claim 1, wherein the nucleotide sequence encoding TAR RNA binding protein is a nucleotide sequence of tat gene.
8. The lentivirus packaging system as claimed in claim 6, wherein the nucleotide sequence encoding TAR RNA binding protein is a nucleotide sequence of tat gene.
9. The lentivirus packaging system as claimed in claim 7, wherein the nucleotide sequence of tat gene comprises a nucleotide sequence of SEQ ID NO: 1.
10. The lentivirus packaging system as claimed in claim 1, wherein the envelope plasmid comprises a nucleotide sequence encoding vesicular stomatitis virus glycoprotein (VSV-G) or a nucleotide sequence encoding baboon endogenous virus envelope.
11. The lentivirus packaging system as claimed in claim 1, wherein the nucleotide sequence of TAR-reserved chimeric 5′-LTR has a nucleotide sequence of TAR, and the nucleotide sequence of TAR comprises a nucleotide sequence of SEQ ID NO: 2.
12. A lentivirus, produced by the lentivirus packaging system as claimed in claim 1.
13. An isolated cell, obtained from a nucleated cell transduced with a gene of interest by the lentivirus as claimed in claim 12.
14. The isolated cell as claimed in claim 13, wherein the nucleated cell comprises a T cell, a natural killer cell, a natural killer T cell or an adipose stem cell.
15. A method of increasing the yield of lentivirus in a host cell, comprising a step of using the lentivirus packaging system as claimed in claim 1 to transfect the host cell, wherein the host cell is a pkr knockout 293T cell.
16. A method of increasing the yield of lentivirus in a host cell, comprising a step of using the lentivirus packaging system as claimed in claim 1 to transfect the host cell.
17. The method of increasing the yield of lentivirus in the host cell as claimed in claim 16, wherein the host cell comprises a mammalian cell.
18. The method of increasing the yield of lentivirus in the host cell as claimed in claim 17, wherein the mammalian cell comprises Human Embryonic Kidney 293 Cells (HEK293) or 293T cell (HEK293T).
19. A method of increasing the yield of lentivirus in a host cell, comprising a step of using the lentivirus packaging system as claimed in claim 6 to transfect the host cell.
20. A method for treating cancer, comprising administering to a subject in need thereof a medicament comprising an effective amount of the isolated cell as claimed in claim 14.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0043] By taking reference to the drawings, the preparation examples and experimental examples, the technical means adopted by the present invention to achieve the desirable purpose of the invention are further illustrated as follows.
Preparation Example 1 (PE1): Constructing the Packaging Plasmid Comprising a Gene of TAR RNA Binding Protein
[0044] First, a DNA fragment containing the CMV promoter sequence prepared from pAll-Cas9-B2M_1-DP plasmid through the PspXI/AgeI restriction enzyme digestion was ligated into the XmaI/SalI linearized yTA-empty vector to obtain an yTA-CMV plasmid. Second, the nucleotide sequence encoding TAR RNA binding protein adopted in PE1 was a nucleotide sequence of tat gene without introns, i.e. that of SEQ ID NO: 1, which was prepared as follows: the DNA fragment containing the aforementioned SEQ ID NO: 1 sequence was amplified from the pCMVdeltaR8.91 plasmid (purchased from Academia Sinica RNAi Core facility), digested with NheI/BsrGI restriction enzyme, and then ligated with NheI/BsrGI linearized yTA-CMV plasmid to obtain the yTA-CMV-tat plasmid as shown in
Preparation Example 2 (PE2): Constructing the Transfer Plasmid Comprising CD19-BBz
[0045] The hPGK promoter and PAC gene of pLAS5w.Ppuro plasmid comprising a nucleotide sequence of TAR-reserved chimeric 5′-LTR and driven by RSV promoter (purchased from Academia Sinica RNAi Core facility, Product No. C6-8-39) were deleted to obtain a pLAS5w plasmid, which was provided by Genscript. A nucleotide sequence encoding CD19-BBz from Lenti-EF1a-CD19 plasmid was inserted into BstBI/NheI linearized pLAS5w plasmid (prepared by Creative Biolabs). The aforementioned nucleotide sequence of TAR in TAR-reserved chimeric 5′-LTR was shown as SEQ ID NO: 2.
Experimental Example 1: Preparing Lentivirus
[0046] The 293T cells were cultured in the Dulbecco's Modified Eagle Medium (DMEM) (Gibco, 11965-092) containing 10% Fetal Bovine Serum (FBS) at 37° C. under 5% CO.sub.2 for 3 days in a T875 culture flask (large scale) with an original cell number of 1.5×10.sup.7 cells and in 10 cm culture dish (small scale) with an original cell number of 1×10.sup.6 cells. Then, the 293T cells were transfected in DMEM containing 10% FBS by using PolyJet™ transfection reagent (SignaGen Laboratories) and plasmids of the second-generation lentivirus packaging system serving as Comparative Example 1 (CE1), the third-generation lentivirus packaging system serving as Comparative Example 2 (CE2), or the lentivirus packaging system of the present invention serving as Example 1 or 2 (E1 or E2). The weight ratios between the packaging plasmids in E1 and E2 are different. The lentivirus of CE2 and E1 were prepared both in a large scale and a small scale. The lentivirus of CE1 and E2 were only prepared in a small scale. The aforementioned operation was in accordance with the operation manual of PolyJet™ transfection reagent. The second-generation lentivirus packaging system (purchased from Academia Sinica RNAi Core facility) in CE1 and the third-generation lentivirus packaging system (purchased from Aldevron) in CE2 were known technology. The next day, the culture medium of Opti-MEM (51985-034, Gibco) was substituted for DMEM containing 10% FBS, and was harvested for the first time after 24 hours to obtain a supernatant containing lentivirus particles. Fresh Opti-MEM medium was supplemented for culturing for another 24 hours and was harvested for the second time to obtain another supernatant containing lentivirus particles. After all harvesting processes were completed, all supernatants containing lentivirus particles were mixed together, and the total volume was then concentrated 100-fold by using Lenti-X Concentrator (Takara Bio).
TABLE-US-00001 TABLE 1 the plasmid combinations of the packaging system for preparing lentivirus 10 cm culture dish T875 culture flask (small scale) (large scale) Amount Total amount Amount Total amount Packaging system Plasmids (μg) (μg) (μg) (μg) The second-generation The transfer plasmid comprising CD19-BBz (driven 2.5 5 N/A N/A lentivirus packaging by RSV promoter) recited in PE2 system (CE1) pCMV deltaR8.91 (purchased from Academia Sinica 2.25 N/A N/A RNAi Core facility) pMD.G (purchased from Academia Sinica RNAi 0.25 N/A N/A Core facility) The third-generation The transfer plasmid comprising CD19-BBz recited 2.5 8 50 160 lentivirus packaging in PE2 system (CE2) The plasmid comprising a nucleotide sequence of 2.5 50 gag gene and a nucleotide sequence of pol gene (driven by CMV promoter) (purchased from Aldevron, pALD-Lenti (Ampicillin resistance)) The plasmid comprising a nucleotide sequence of rev 1 20 gene (driven by OG-RSV promoter) (purchased from Aldevron, pALD-Lenti (Ampicillin resistance)) The envelope plasmid comprising a nucleotide 2 40 sequence encoding VSV-G (driven by PGK/CMV Fusion promoter) (purchased from Aldevron, pALD- Lenti (Ampicillin resistance)) E1: the lentivirus The transfer plasmid comprising CD19-BBz recited 2.5 9 50 180 packaging system of in PE2 (As shown in FIG. 2A, LTR is segmented into the present invention the U3, R and U5 regions, wherein the R region has (As shown in FIG. 2B) TAR sequence (TAR-reserved), and ΔU3 refers to the truncated U3 region. The plasmid comprising a nucleotide sequence of 2.5 50 gag gene and a nucleotide sequence of pol gene (driven by CMV promoter) (purchased from Aldevron, pALD-Lenti (Ampicillin resistance)) The plasmid of yTA-CMV-tat of PE1 (driven by 1 20 CMV promoter) The plasmid comprising a nucleotide sequence of rev 1 20 gene (driven by OG-RSV promoter) (purchased from Aldevron, pALD-Lenti (Ampicillin resistance)) The envelope plasmid comprising a nucleotide 2 40 sequence encoding VSV-G (driven by PGK/CMV Fusion promoter) (purchased from Aldevron, pALD- Lenti (Ampicillin resistance)) E2: The lentivirus The transfer plasmid comprising CD19-BBz recited 4 9.2 N/A N/A packaging system of in PE2 the present invention The plasmid comprising a nucleotide sequence of 2.4 N/A N/A gag gene and a nucleotide sequence of pol gene (driven by CMV promoter) (purchased from Aldevron, pALD-Lenti (Ampicillin resistance)) The plasmid of yTA-CMV-tat of PE1 (driven by 1.2 N/A N/A CMV promoter) The plasmid comprising a nucleotide sequence of rev 1.2 N/A N/A gene (driven by OG-RSV promoter) (purchased from Aldevron, pALD-Lenti (Ampicillin resistance)) The envelope plasmid comprising a nucleotide 0.4 N/A N/A sequence encoding VSV-G (driven by PGK/CMV Fusion promoter) (purchased from Aldevron, pALD- Lenti (Ampicillin resistance))
[0047] The lentivirus prepared in Experimental Example 1 was tested to determine lentivirus titer. Specifically, the lentivirus titer was determined by the result of Jurkat cells transducing with 3-fold serial diluted (3-fold to 6561-fold) virus samples. First, 50 μL of lentivirus sample was added to 100 μL of X-Vivo 15 medium, and a 3-fold serial dilution was carried out until the 6561-fold diluted sample was obtained. Second, 100 μL of 4×10.sup.5 cells/ml Jurkat cells suspended in a culture medium (RPMI 1640 medium (11875, Gibco) containing 10% FBS) were mixed with 50 μL of each serial diluted lentivirus sample in a 96-well plate (U-Shaped-Bottom) on Day 0. On Day 2, another 100 μL of fresh culture medium was added to each well, and the 96-well cell culture plate was incubated in the culture incubator for another 24 hours. Afterwards, an antibody of biotin-conjugated goat anti-mouse IgG F(ab).sub.2 fragment (Jackson ImmunoResearch) and Streptavidin-PE (Invitrogen) was used to detect CD19-BBz, and the flow cytometer was used to analyze the percentage of cells expressing the target protein (CD19-BBz) to determine the virus transduction efficacy. The functional virus titer was calculated as follows:
Virus titer (TU/ml)=(percentage of the cells expressing CD19-BBz/100)×4×10.sup.4×20×dilution-fold.
[0048] When the lentivirus prepared by the lentivirus packaging system of the present invention (E2, Table 1) was examined, and the percentage of CD19-BBz positive population of the 729-fold diluted sample was used, in which the percentage of the cells expressing CD19-BBz was 16.09%, the virus titer obtained was 9.38×10.sup.7 transducing units (TU)/ml. Furthermore, the virus titer of the lentivirus prepared by using E2 was better than that prepared by using E1. Besides, as shown in
Preparation Example 3 (PE3): Preparing the Pkr Knockout 293T Cells
[0049] Two partial complementary primers were annealed to prepare a PKR guide RNA (gRNA) which was 24 bp, and then ligated into a BsmBI linearized Cas9-T2A-eGFP-DP plasmid to obtain the Cas9-PKR-T2A-eGFP-DP all-in-one plasmid. The sequence of PKR gRNA is GCAACCUACCUCCUAUCAUG (SEQ ID NO: 3), and CRISPR/Cas9 gene editing technique was applied to prepare the pkr knockout 293T cells, wherein said pkr means Protein kinase R (PKR), also named Eukaryotic translation initiation factor 2-alpha kinase 2 (eIF2AK2). Specifically, the Cas9-PKR-T2A-eGFP-DP all-in-one plasmid containing said gRNA sequence was transfected into 293T cells through calcium-phosphate method. The individual candidate clone was obtained through seeding the transfected 293T cells to a 96-well plate with a cell density of 0.5 cell/well, and examined by western blot, which comprised steps as follows. The total proteins of each individual candidate clones were prepared by using RIPA lysis buffer, and then analyzed for PKR protein expression by using the rabbit anti-PKR polyclonal antibody (GTX132826, GeneTex). The GAPDH protein served as internal control, and wild type 293T cells served as a control group. The 293T cell strains #1, #4, #12, #17, #20, #23 and #26 were selected from the 96-well plate, and the western blot result (See
Experimental Example 2: Preparing Lentivirus by the Pkr Knockout 293T Cells
[0050] The lentivirus production method of Experimental Example 2 is similar to that of Experimental Example 1 except for the host cell. The lentivirus were produced by transfecting the pkr knockout 293T #12 cell, obtained from PE3, with plasmids of the third-generation packaging system (CE2, Table 1) or the packaging system of the present invention (E1, Table 1) by using PolyJet™ in 10-cm culture dishes (small scale). The virus titer was determined by the virus titration steps described in PE2. The results were shown in
Experimental Example 3: Infection Ability Test by Transducing Primary T Cell
[0051] Primary T cells were purified and activated from Ficoll (GE)-prepared peripheral blood mononuclear cells (PBMC) of healthy donors by using CD3/CD28 expander beads (Thermo Fisher Scientific). On the next day (Transduction-Day 1), these purified T cells were respectively transduced with the lentivirus prepared in a small scale by using the second-generation lentivirus packaging system, the third-generation lentivirus packaging system and the lentivirus packaging system of the present invention recited in Experimental Example 1. The steps were summarized as follows: 1 mL of primary T cells with the cell number of 1×10.sup.6 were co-cultured with the lentivirus prepared in Experimental Example 1, with virus dosage of Multiplicity of Infection (MOI) 1, 3 and 5. After transduction for two days (Transduction-Day 3), CD3/CD28 expander beads were removed. Finally, the percentage of the primary T cells expressing the gene of interest (CD19-BBz) was examined by using flow cytometry on Transduction-Day 6. Specifically, 1×10.sup.5 primary T cells were collected and suspended in 100 μL staining solution, which is a PBS solution containing 1% Fetal Calf Serum (FCS). The staining solution containing the primary T cells was added with a primary antibody (Biotin-conjugated goat anti mouse IgG F(ab).sub.2) and stood still at room temperature for 20 minutes. The primary T cells were washed with 1 mL staining solution for two times, and then re-suspended with 100 μL staining solution containing Streptavidin-PE. After incubating at room temperature for another 20 minutes, the stained primary T cells were washed with 1 mL staining solution for two times, re-suspended in a suitable amount of staining solution, and analyzed by the flow cytometry.
[0052] The analysis results of the flow cytometry were shown in
[0053] Accordingly, the lentivirus packaging system of the present invention can significantly increase the yield and activity of lentivirus, and effectively increase the gene delivery efficiency during genetic modifications of cells, so that the cost of gene modified cells can be reduced. In addition, the pkr knockout 293T cells can further be used to enhance the yield of the lentivirus produced therefrom.
[0054] The aforementioned detailed description simply recites preferred embodiments and is by no means to restrict the present invention in any aspect. Although the present invention has been disclosed as the aforementioned preferred embodiments, the inventor does not mean to restrict the present invention accordingly. Without departing from the range of the technical solutions of the present invention, any person having ordinary skill in the art can take advantages of the aforementioned technical content and conduct some adjustments or modifications to obtain embodiments with equivalent variations and efficacies. Without deviating from the content of the technical solutions of the present invention, the simple adjustments, equivalent variations and modifications carried out for the aforementioned embodiments and based on the substantial technique of the present invention still fall within the range of the technical solutions of the present invention.