Novel Fatty Acid Modified Urocortin-2 Analogs for the Treatment of Diabetes and Chronic Kidney Disease
20180016318 ยท 2018-01-18
Inventors
Cpc classification
A61K9/0019
HUMAN NECESSITIES
C07K14/57509
CHEMISTRY; METALLURGY
A61K38/2228
HUMAN NECESSITIES
C07K14/4705
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention provides a compound or a pharmaceutically acceptable salt of the Formula:
X.sub.1IVX.sub.2SLDVPIGLLQILX.sub.3EQEKQEKEKQQAK*TNAX.sub.4ILAQV-NH.sub.2 wherein the X.sub.1 denotes that the I residue is modified by either acetylation or methylation at the N-terminus; wherein X.sub.2 is L or T; wherein X.sub.3 is L or I; wherein X.sub.4 is Q or E; and wherein a modified K residue (K*) at position 29 is modified through conjugation to the epsilon-amino group of the K-side chain with a group of the formula X.sub.5X.sub.6, wherein X.sub.5 is selected from the group consisting of one to four amino acids; one to four ([2-(2-Amino-ethoxy)-ethoxy]-acetyl) moieties; and combinations of one to four amino acids and one to four ([2-(2-Amino-ethoxy)-ethoxy]-acetyl) moieties; and X.sub.6 is a C.sub.14-C.sub.24 fatty acid. In some embodiments, the group of the formula X.sub.5X.sub.6 is ([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-(E).sub.2-CO(CH.sub.2).sub.xCO.sub.2H where x is 16 or 18.
Claims
1. A compound of the Formula:
X.sub.1IVX.sub.2SLDVPIGLLQILX.sub.3EQEKQEKEKQQAK*TNAX.sub.4ILAQV-NH.sub.2 wherein X.sub.1 denotes that the I residue is modified by either acetylation or methylation at the N-terminus; wherein X.sub.2 is L or T; wherein X.sub.3 is L or I; wherein X.sub.4 is Q or E; and wherein a modified K residue (K*) at position 29 is modified through conjugation to the epsilon-amino group of the K-side chain with a group of the formula X.sub.5X.sub.6, wherein X.sub.5 is selected from the group consisting of: one to four more amino acids; one to four ([2-(2-Amino-ethoxy)-ethoxy]-acetyl) moieties; and combinations of one to four amino acids and one to four ([2-(2-Amino-ethoxy)-ethoxy]-acetyl) moieties; X.sub.6 is a C.sub.14-C.sub.24 fatty acid (SEQ ID NO:16); or a pharmaceutically acceptable salt thereof.
2. The compound or salt of claim 1, wherein X.sub.5 is selected from the group consisting of: one to four E or E amino acids; one to four ([2-(2-Amino-ethoxy)-ethoxy]-acetyl) moieties; and combinations of one to four E or E amino acids and one to four ([2-(2-Amino-ethoxy)-ethoxy]-acetyl) moieties.
3. The compound or salt of claim 2, wherein X.sub.5 is a combination of one to four E or E amino acids and one to four ([2-(2-Amino-ethoxy)-ethoxy]-acetyl) moieties.
4. The compound or salt of claim 3, wherein X.sub.5 is a combination of two to four E amino acids and one to four ([2-(2-Amino-ethoxy)-ethoxy]-acetyl) moieties.
5. The compound or salt of claim 3, wherein X.sub.5 is a combination of two E amino acids and two ([2-(2-Amino-ethoxy)-ethoxy]-acetyl) moieties.
6. The compound or salt of claim 1, wherein X.sub.6 is a straight chain fatty acid of the formula CO(CH.sub.2).sub.xCO.sub.2H, wherein x is 16, 18, or 20.
7. The compound or salt of claim 1, wherein group of the formula X.sub.5X.sub.6 is ([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-(E).sub.2-CO(CH.sub.2).sub.xCO.sub.2H where x is 16 or 18.
8. The compound or salt according to claim 1 wherein the C-terminal amino acid is amidated as a C-terminal primary amide.
9. The compound or salt according to claim 1 wherein: X.sub.1 denotes that the I residue is modified by acetylation at the N-terminus; X.sub.2 is L; X.sub.3 is L; X.sub.4 is Q; and the group of the formula X.sub.5X.sub.6 is ([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-(E).sub.2-CO(CH.sub.2).sub.xCO.sub.2H where x is 16 or 18.
10. The compound or salt according to claim 9 wherein x is 18.
11. The compound or salt according to claim 9 wherein x is 16.
12. The compound or salt according to claim 1 wherein: X.sub.1 denotes that the I residue is modified by methylation at the N-terminus; X.sub.2 is L; X.sub.3 is L; X.sub.4 is Q; and the group of the formula X.sub.5X.sub.6 is ([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-(E).sub.2-CO(CH.sub.2).sub.18CO.sub.2H.
13. The compound or salt according to claim 1 wherein: X.sub.1 denotes that the I residue is modified by methylation at the N-terminus; X.sub.2 is L; X.sub.3 is L; X.sub.4 is Q; and the group of the formula X.sub.5X.sub.6 is ([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-(E).sub.2-CO(CH.sub.2).sub.16CO.sub.2H.
14. The compound or salt according to claim 1 wherein: X.sub.1 denotes that the I residue is modified by methylation at the N-terminus; X.sub.2 is T; X.sub.3 is L; X.sub.4 is E; and the group of the formula X.sub.5X.sub.6 is ([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-(E).sub.2-CO(CH.sub.2).sub.18CO.sub.2H.
15. The compound or salt according to claim 1 wherein: X.sub.1 denotes that the I residue is modified by methylation at the N-terminus; X.sub.2 is L; X.sub.3 is L; X.sub.4 is E; and the group of the formula X.sub.5X.sub.6 is ([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-(E).sub.2-CO(CH.sub.2).sub.18CO.sub.2H.
16. The compound or salt according to claim 1 wherein: X.sub.1 denotes that the I residue is modified by methylation at the N-terminus; X.sub.2 is T; X.sub.3 is I; X.sub.4 is E; and the group of the formula X.sub.5X.sub.6 is ([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-(E).sub.2-CO(CH.sub.2).sub.18CO.sub.2H.
17. A compound comprising: the amino acid sequence TABLE-US-00030 (SEQIDNO:67) IVX.sub.2SLDVPIGLLQILX.sub.3EQEKQEKEKQQATX.sub.7NAX.sub.4ILAX.sub.8V-NH.sub.2 wherein X.sub.2 is L or T; wherein X.sub.3 is L or I; wherein X.sub.4 is Q, R, or E; wherein X.sub.7 is T or E; and wherein X.sub.8 is Q, H or R, wherein a modified K residue (K*) is substituted for the amino acid residue at position 10 or at any amino acid residue between position 14 and position 30 inclusive, wherein K* is modified by having the epsilon amino group of the K-side chain bound to a group of the formula X.sub.5X.sub.6, wherein X.sub.5 is selected from the group consisting of: between one to four amino acid residues; between one to four ([2-(2-Amino-ethoxy)-ethoxy]-acetyl moieties; and combinations of one to four amino acid residues and one to four ([2-(2-Amino-ethoxy)-ethoxy]-acetyl moieties; X.sub.6 is a C.sub.14-C.sub.24 fatty acid; or a pharmaceutically acceptable salt thereof.
18. A compound or salt according to claim 17, wherein X.sub.5 is either an H or Q residue.
19. A compound or salt according to claim 17, wherein X.sub.5 comprises 1 or 2 amino acid residues and 1 or 2 ([2-(2-Amino-ethoxy)-ethoxy]-acetyl moieties.
20. A compound or salt according to claim 19, wherein X.sub.5 comprises two amino acid residues and two ([2-(2-Amino-ethoxy)-ethoxy]-acetyl moieties, wherein the two amino acid residues are either E or E residues.
21. A compound or salt according to claim 17, wherein X.sub.1 is modified at the N-terminus by either acetylation or methylation.
22. A compound or salt according to claim 17, wherein X.sub.2 is an L residue.
23. A compound or salt according to claim 17, wherein X.sub.3 is an L residue.
24. A compound or salt according to claim 17, wherein X.sub.4 is a Q residue.
25. A compound or salt according to claim 17, wherein X.sub.7 is an T residue.
26. A compound or salt according to claim 17, wherein X.sub.5 comprises between one to four amino acid residues such that there are no ([2-(2-Amino-ethoxy)-ethoxy]-acetyl moieties in the synthetic molecule.
27. A compound or salt according to claim 17 wherein the I residue at position 1 is modified at the N-terminus by one of acetylation or methylation
28. A pharmaceutical composition comprising a compound or salt according to claim 1 and one or more pharmaceutically acceptable carriers, diluents, and excipients.
29. A method for treating type II diabetes in a patient comprising administering to a patient in need of such treatment an effective amount of a compound or salt according to claim 1.
30. A method for treating chronic kidney disease in a patient comprising administering to a patient in need of such treatment an effective amount of a compound or salt according to claim 1.
31. The method according to claim 30 wherein the chronic kidney disease is caused by diabetic nephropathy.
32. The method according to claim 30 wherein the chronic kidney disease is caused by hypertensive nephropathy.
33. The methods according to claim 30, wherein the administration of the compound or salt to the patient in need of such treatment is subcutaneous.
34. A compound or salt according to claim 1 for use in therapy.
35. A compound or salt according to claim 1 for use in the treatment of type II diabetes.
36. A compound or salt according to claim 1 for use in the treatment of chronic kidney disease.
37. A compound of the Formula:
X.sub.1IVX.sub.2SLDVPIGLLQILX.sub.3EQEKQEKEKQQAKTNAX.sub.4ILAQV-NH.sub.2 wherein X.sub.1 denotes that the I residue is modified by either acetylation or methylation at the N-terminus; wherein X.sub.2 is L or T; wherein X.sub.3 is L or I; wherein X.sub.4 is Q or E (SEQ ID NO:18).
38. A method for treating type II diabetes in a cat comprising administering to a cat in need of such treatment an effective amount of a compound or salt according to any one of SEQ. ID NOS. 1, 2, 3, 5, 6, and 7.
39. A method for treating chronic kidney disease in a cat comprising administering to a cat in need of such treatment an effective amount of a compound or salt according to any one of SEQ. ID NOS. 1, 2, 3, 5, 6, and 7.
Description
EXAMPLE 1
X.SUB.1.IVX.SUB.2.SLDVPIGLLQILX.SUB.3.EQEKQEKEKQQAK*TNAX.SUB.4.ILAQV-NH2
[0079] wherein the X.sub.1 at position 1 is I that is modified, at the N terminus, by acetylation; X.sub.2 is L; X.sub.3 is L; X.sub.4 is Q; and the K* at position 29 is chemically modified through conjugation to the epsilon-amino group of the K side-chain with ([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-(E).sub.2-CO(CH.sub.2).sub.16CO.sub.2H; and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO: 1). The structure of this sequence is shown below.
##STR00001##
[0080] The structure of this sequence contains the standard single letter amino acid code with exception of residues I at position 1, and K at position 29 where the structures of these amino acid residues have been expanded.
[0081] The peptide according to SEQ ID NO: 1 of the present invention is generated by solid-phase peptide synthesis using a Fmoc/t-Bu strategy carried out on a Symphony automated peptide synthesizer (PTI Protein Technologies Inc.) starting from RAPP AM-Rink Amide resin (H40023 Polystyrene AM RAM, Rapp polymere GmbH) and with couplings using 6 equivalents of amino acid activated with diisopropylcarbodiimide (DIC) and Oxyma pure (1:1:1 molar ratio) in dimethylformamide (DMF) for 3 h at 25 C.
[0082] Extended coupling for Thr30 (10 h) is necessary to improve the quality of the crude peptide. A Fmoc-Lys(Alloc)-OH building block is used for K at position 29 coupling (orthogonal protecting group) to allow for site specific attachment of the fatty acid moiety later on in the synthetic process. The N-terminal residue (I at position 1) is acetylated using 10 equivalents of acetic acid with diisopropylcarbodiimide (DIC) and Oxyma pure (1:1:1 molar ratio) in dimethylformamide (DMF) for 1 h at 25 C.
[0083] After finishing the elongation of the peptide-resin described above, the Alloc protecting group present in the K at position 29 is removed using catalytic amounts of Pd(PPh.sub.3).sub.4 in the presence of PhSiH.sub.3 as a scavenger. Additional coupling/deprotection cycles using a Fmoc/t-Bu strategy to extend the K at position 29 side-chain involved Fmoc-NH-PEG.sub.2-CH.sub.2COOH (ChemPep Catalog#280102), Fmoc-Glu(OH)-OtBu (ChemPep Catalog#100703) and HOOC(CH.sub.2).sub.16COOtBu. In all couplings, 3 equivalents of the building block are used with PyBOP (3 equiv) and DIEA (6 equiv) in DMF for 4 h at 25 C.
[0084] Concomitant cleavage from the resin and side chain protecting group removal are carried out in a solution containing trifluoroacetic acid (TFA):triisopropylsilane:1,2-ethanedithiol:methanol:thioanisole 80:5:5:5:5 (v/v) for 2 h at 25 C. followed by precipitation with cold ether. Crude peptide is purified to >99% purity (15-20% purified yield) by reversed-phase HPLC chromatography with water/acetonitrile (containing 0.1% v/v TFA) gradient on a Phenyl hexyl column (phenomenex, 5 micron, 100 A), where suitable fractions are pooled and lyophilized.
[0085] In a synthesis performed essentially as described above, the purity of Example 1 was examined by analytical reversed-phase HPLC, and identity was confirmed using LC/MS (observed: M+3H.sup.+/3=1718.8; Calculated M+3H.sup.+/3=1720.0; observed: M+4H.sup.+/4=1289.2; Calculated M+4H.sup.+/4=1290.3; observed: M.sup.+5H.sup.+/5=1031.5; Calculated M.sup.+5H.sup.+/5=1032.4).
EXAMPLE 2
X.SUB.1.IVX.SUB.2.SLDVPIGLLQILX.SUB.3.EQEKQEKEKQQAK*TNAX.SUB.4.ILAQV-NH2
[0086] wherein the X.sub.1 is I in which the N terminus is modified via acetylation; X.sub.2 is L; X.sub.3 is L; X.sub.4 is Q; and the K* at position 29 is chemically modified through conjugation to the epsilon-amino group of the K side-chain with ([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-(E).sub.2-CO(CH.sub.2).sub.18CO.sub.2H; and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO: 2). The structure of this sequence is shown below.
##STR00002##
[0087] The structure of this sequence contains the standard single letter amino acid code with exception of residues I at position 1 and K at position 29 where the structures of these amino acid residues have been expanded.
[0088] The peptide according to SEQ ID NO: 2 of the present invention is synthesized similarly as described above in Example 1. HOOC(CH.sub.2).sub.18COOtBu is incorporated using 3 equivalents of the building block with PyBOP (3 equiv) and DIEA (6 equiv) in DMF for 4 h at 25 C.
[0089] In a synthesis performed essentially as described above, the purity of Example 2 was examined by analytical reversed-phase HPLC, and identity was confirmed using LC/MS (observed: M+3H.sup.+/3=1728.2; Calculated M+3H.sup.+/3=1729.4; observed: M+4H.sup.+/4=1296.3; Calculated M+4H.sup.+/4=1297.3; observed: M+5H.sup.+/5=1037.4; Calculated M+5H.sup.+/5=1038.0).
EXAMPLE 3
X.SUB.1.IVX.SUB.2.SLDVPIGLLQILX.SUB.3.EQEKQEKEKQQAK*TNAX.SUB.4.ILAQV-NH2
[0090] wherein the X.sub.1 is I in which the N terminus is modified via methylation; X.sub.2 is L; X.sub.3 is L; X.sub.4 is Q; and the K* at position 29 is chemically modified through conjugation to the epsilon-amino group of the K side-chain with ([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-(E).sub.2-CO(CH.sub.2).sub.16CO.sub.2H; and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO: 3). The structure of this sequence is shown below.
##STR00003##
[0091] The structure of this sequence contains the standard single letter amino acid code with exception of residues N-methyl isoleucine at position 1 and K at position 29, where the structures of these amino acid residues have been expanded.
[0092] The compound according to SEQ ID NO: 3 of the present invention is synthesized similarly as described above for Example 1. The N-terminal residue (N-methyl isoleucine at position 1) is incorporated as Boc-NMeIle-OH using 6 equivalents of the building block with PyBOP (6 equiv) and DIEA (12 equiv) in DMF-DCM (1:1, v/v) for 15 h at 25 C.
[0093] In a synthesis performed essentially as described above, the purity of Example 3 was examined by analytical reversed-phase HPLC, and identity was confirmed using LC/MS (observed: M+3H.sup.+/3=1709.6; Calculated M+3H.sup.+/3=1710.7; observed: M+4H.sup.+/4=1282.2; Calculated M+4H.sup.+/4=1283.3; observed: M+5H.sup.+/5=1025.8; Calculated M+5H.sup.+/5=1026.8).
EXAMPLE 4
X.SUB.1.IVX.SUB.2.SLDVPIGLLQILX.SUB.3.EQEKQEKEKQQAK*TNAX.SUB.4.ILAQV-NH2
[0094] wherein X.sub.1 is I in which the N terminus is modified via methylation; X.sub.2 is L; X.sub.3 is L; X.sub.4 is Q; and the K* at position 29 is chemically modified through conjugation to the epsilon-amino group of the K side-chain with ([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-(E).sub.2-CO(CH.sub.2).sub.18CO.sub.2H; and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO: 4). The structure of this sequence is shown below.
##STR00004##
[0095] The structure of this sequence contains the standard single letter amino acid code with exception of residues N-methyl Isoleucine at position 1 and K at position 29, where the structures of these amino acid residues have been expanded.
[0096] The compound according to SEQ ID NO: 4 of the present invention is synthesized similarly as described above for Example 1. The N-terminal residue (N-methyl Isoleucine at position 1) is incorporated as Boc-NMeIle-OH using 6 equivalents of the building block with PyBOP (6 equiv) and DIEA (12 equiv) in DMF-DCM (1:1, v/v) for 15 h at 25 C. HOOC(CH.sub.2).sub.18COOtBu is incorporated using 3 equivalents of the building block with PyBOP (3 equiv) and DIEA (6 equiv) in DMF for 4 h at 25 C.
[0097] In a synthesis performed essentially as described above, the purity of Example 4 was examined by analytical reversed-phase HPLC, and identity was confirmed using LC/MS (observed: M+3H.sup.+/3=1719.4; Calculated M+3H.sup.+/3=1720.1; observed: M+4H.sup.+/4=1289.8; Calculated M+4H.sup.+/4=1290.3; observed: M+5H.sup.+/5=1031.8; Calculated M+5H.sup.+/5=1032.4).
EXAMPLE 5
X.SUB.1.IVX.SUB.2.SLDVPIGLLQILX.SUB.3.EQEKQEKEKQQAK*TNAX.SUB.4.ILAQV-NH2
[0098] wherein X.sub.1 is I in which the N terminus is modified via methylation; X.sub.2 is T; X.sub.3 is L; X.sub.4 is E; and the K* at position 29 is chemically modified through conjugation to the epsilon-amino group of the K side-chain with ([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-(E).sub.2-CO(CH.sub.2).sub.18CO.sub.2H; and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO: 5). The structure of this sequence is shown below.
##STR00005##
[0099] The structure of this sequence contains the standard single letter amino acid code with exception of residues N-methyl Isoleucine at position 1, and K at position 29 where the structures of these amino acid residues have been expanded.
[0100] The compound according to SEQ ID NO: 5 of the present invention is synthesized similarly as described above for Example 4.
[0101] In a synthesis performed essentially as described above, the purity of Example 5 was examined by analytical reversed-phase HPLC, and identity was confirmed using LC/MS (observed: M+3H.sup.+/3=1715.7; Calculated M+3H.sup.+/3=1716.4; observed: M+4H.sup.+/4=1287.0; Calculated M+4H.sup.+/4=1287.5; observed: M+5H.sup.+/5=1029.7; Calculated M+5H.sup.+/5=1030.2).
EXAMPLE 6
X.SUB.1.IVX.SUB.2.SLDVPIGLLQILX.SUB.3.EQEKQEKEKQQAK*TNAX.SUB.4.ILAQV-NH2
[0102] wherein X.sub.1 is I in which the N terminus is modified via methylation; X.sub.2 is L; X.sub.3 is L; X.sub.4 is E; and the K* at position 29 is chemically modified through conjugation to the epsilon-amino group of the K side-chain with ([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-(E).sub.2-CO(CH.sub.2).sub.18CO.sub.2H; and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO: 6). The structure of this sequence is shown below.
##STR00006##
[0103] The structure of this sequence 6 contains the standard single letter amino acid code with exception of residues N-Methyl Isoleucine at position 1 and K at position 29 where the structures of these amino acid residues have been expanded.
[0104] The compound according to SEQ ID NO: 6 of the present invention is synthesized similarly as described above for Example 4.
[0105] In a synthesis performed essentially as described above, the purity of Example 6 was examined by analytical reversed-phase HPLC, and identity was confirmed using LC/MS (observed: M+3H.sup.+/3=1719.7; Calculated M+3H.sup.+/3=1720.4; observed: M+4H.sup.+/4=1289.8; Calculated M+4H.sup.+/4=1290.5; observed: M+5H.sup.+/5=1032.2; Calculated M+5H.sup.+/5=1032.6).
EXAMPLE 7
X.SUB.1.IVX.SUB.2.SLDVPIGLLQILX.SUB.3.EQEKQEKEKQQAK*TNAX.SUB.4.ILAQV-NH2
[0106] wherein X.sub.1 is I in which the N terminus is modified via methylation; X.sub.2 is T; X.sub.3 is I; X.sub.4 is E; and the K* at position 29 is chemically modified through conjugation to the epsilon-amino group of the K side-chain with ([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-(E).sub.2-CO(CH.sub.2).sub.18CO.sub.2H; and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO: 7). The structure of this sequence is shown below.
##STR00007##
[0107] The structure of this sequence contains the standard single letter amino acid code with exception of residues N-methyl Isoleucine at position 1 and K at position 29, where the structures of these amino acid residues have been expanded.
[0108] The compound according to SEQ ID NO: 7 of the present invention is synthesized similarly as described above for Example 4.
[0109] In a synthesis performed essentially as described above, the purity of Example 7 was examined by analytical reversed-phase HPLC, and identity was confirmed using LC/MS (observed: M+3H.sup.+/3=1715.6; Calculated M+3H.sup.+/3=1716.4; observed: M+4H.sup.+/4=1286.8; Calculated M+4H.sup.+/4=1287.5; observed: M+5H.sup.+/5=1029.8; Calculated M+5H.sup.+/5=1030.2).
EXAMPLE 8
[0110] The following compounds of the present invention are synthesized similarly as described above for Example 4. The structures shown below contains the standard single letter amino acid code with exception of residues N-methylated I at position 1 and K at position 29 where the structures of these amino acid residues have been expanded.
X.sub.1IVLSLDVPIGLLQILLEQEKQEKEKQQAK*TNAQILAQV-NH2 [0111] wherein X.sub.1 has the N-terminus of the I residue modified by methylation; [0112] wherein the K* at position 29 has been chemically modified with the following fatty acid side chain: [0113] -E-([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-(E).sub.2-CO(CH.sub.2).sub.18COOH; and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:9).
X.SUB.1.VLSLDVPIGLLQILLEQEKQEKEKQQAK*TNAQILAQV-NH2
[0114] wherein X.sub.1 has the N-terminus of the I residue modified by methylation; [0115] wherein the K* at position 29 has been chemically modified with the following fatty acid side chain: [0116] -E-([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-(E).sub.2-CO(CH.sub.2).sub.16COOH; [0117] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:10).
X.SUB.1.IVLSLDVPIGLLQILLEQEKQEKEKQQAK*TNAQILAQV-NH2
[0118] wherein X.sub.1 has the N-terminus of the I residue modified by methylation; [0119] wherein the K* at position 29 has been chemically modified with the following fatty acid side chain: [0120] -E-E-E-E-CO(CH.sub.2).sub.18COOH; [0121] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:11).
X.SUB.1.IVLSLDVPIGLLQILLEQEKQEKEKQQAK*TNAQILAQV-NH2
[0122] wherein X.sub.1 has the N-terminus of the I residue modified by methylation; [0123] wherein the K* at position 29 has been chemically modified with the following fatty acid side chain: [0124] -E-E-([2-(2-Amino-ethoxy)-ethoxy]-acetyl)-E-E-CO(CH.sub.2).sub.18COOH; [0125] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:12).
X.SUB.1.IVLSLDVPIGLLQILLEQEKQEKEKQQAK*TNAQILAQV-NH2
[0126] wherein X.sub.1 has the N-terminus of the I residue modified by methylation; [0127] wherein the K* at position 29 has been chemically modified with the following fatty acid side chain: [0128] -E-E-([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-E-E-CO(CH.sub.2).sub.18COOH; [0129] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:13).
X.SUB.1.VLSLDVPIGLLQILLEQEKQEKEKQQAK*TNAQILAQV-NH2
[0130] wherein X.sub.1 has the N-terminus of the I residue modified by methylation; [0131] wherein the K* at position 29 has been chemically modified with the following fatty acid side chain: [0132] -E-([2-(2-Amino-ethoxy)-ethoxy]-acetyl)-E-E-CO(CH.sub.2).sub.18COOH; [0133] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:14).
EXAMPLE 9
[0134] The following compounds of the present invention are synthesized similarly as described above for Example 4. The structures shown below contains the standard single letter amino acid codes. All of the following compounds or synthetic molecules fall within the scope of Formula III. The purity of these compounds was tested by analytical reversed-phase HPLC, and identity was confirmed using LC/MS, in the manner outlined herein.
IVLSLDVPIGLLQK*LLEQEKQEKEKQQATTNARILARV-NH2
[0135] wherein the K* at position 14 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a -E-CO(CH.sub.2).sub.14CH.sub.3 group; [0136] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:21).
[0137] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 is an unmodified I residue, X.sub.2 is L, X.sub.3 is L, X.sub.4 is R, X.sub.7 is T, X.sub.8 is R, X.sub.5 is one E residue and X.sub.6 is a C.sub.16 mono fatty acid and the K* residue has replaced the original amino acid at position 14).
IVLSLDVPIGLLQIK*LEQEKQEKEKQQATTNARILARV-NH2
[0138] wherein the K* at position 15 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a -E-CO(CH.sub.2).sub.14CH.sub.3 group; [0139] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:22).
[0140] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 is an unmodified I residue, X.sub.2 is L, X.sub.3 is L, X.sub.4 is R, X.sub.7 is T, X.sub.8 is R, X.sub.5 is one E residue and X.sub.6 is a C.sub.16 mono fatty acid and the K* residue has replaced the original amino acid at position 15).
IVLSLDVPIGLLQILLK*QEKQEKEKQQATTNARILARV-NH2
[0141] wherein the K* at position 17 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a -E-CO(CH.sub.2).sub.14CH.sub.3 group; [0142] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:23).
[0143] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 is an unmodified I residue, X.sub.2 is L, X.sub.3 is L, X.sub.4 is R, X.sub.7 is T, X.sub.8 is R, X.sub.5 is one E residue and X.sub.6 is a C.sub.16 mono fatty acid and the K* residue has replaced the original amino acid at position 17).
IVLSLDVPIGLLQILLEQK*KQEKEKQQATTNARILARV-NH2
[0144] wherein the K* at position 19 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a -E-CO(CH.sub.2).sub.14CH.sub.3 group; [0145] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:24).
[0146] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 is an unmodified I residue, X.sub.2 is L, X.sub.3 is L, X.sub.4 is R, X.sub.7 is T, X.sub.8 is R, X.sub.5 is one E residue and X.sub.6 is a C.sub.16 mono fatty acid and the K* residue has replaced the original amino acid at position 19).
IVLSLDVPIGLLQILLEQEK*QEKEKQQATTNARILARV-NH2
[0147] wherein the K* at position 20 has been chemically such that the epsilon-amino group of the K-side chain is bonded with a -E-CO(CH.sub.2).sub.14CH.sub.3 group; [0148] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:25).
[0149] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 is an unmodified I residue, X.sub.2 is L, X.sub.3 is L, X.sub.4 is R, X.sub.7 is T, X.sub.8 is R, X.sub.5 is one E residue and X.sub.6 is a C.sub.16 mono fatty acid and the K* residue has replaced the original amino acid at position 20).
IVLSLDVPIGLLQILLEQEKK*EKEKQQATTNARILARV-NH2
[0150] wherein the K* at position 21 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a -E-CO(CH.sub.2).sub.14CH.sub.3 group; [0151] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:26).
[0152] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 is an unmodified I residue, X.sub.2 is L, X.sub.3 is L, X.sub.4 is R, X.sub.7 is T, X.sub.8 is R, X.sub.5 is one E residue and X.sub.6 is a C.sub.16 mono fatty acid and the K* residue has replaced the original amino acid at position 21).
IVLSLDVPIGLLQILLEQEKQK*KEKQQATTNARILARV-NH2
[0153] wherein the K* at position 22 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a -E-CO(CH.sub.2).sub.14CH.sub.3 group; [0154] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:27).
[0155] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 is an unmodified I residue, X.sub.2 is L, X.sub.3 is L, X.sub.4 is R, X.sub.7 is T, X.sub.8 is R, X.sub.5 is one E residue and X.sub.6 is a C.sub.16 mono fatty acid and the K* residue has replaced the original amino acid at position 22).
IVLSLDVPIGLLQILLEQEKQEK*EKQQATTNARILARV-NH2
[0156] wherein the K* at position 23 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a -E-CO(CH.sub.2).sub.14CH.sub.3 group; [0157] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:28).
[0158] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 is an unmodified I residue, X.sub.2 is L, X.sub.3 is L, X.sub.4 is R, X.sub.7 is T, X.sub.8 is R, X.sub.5 is one E residue and X.sub.6 is a C.sub.16 mono fatty acid and the K* residue has replaced the original amino acid at position 23).
IVLSLDVPIGLLQILLEQEKQEKK*KQQATTNARILARV-NH2
[0159] wherein the K* at position 24 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a -E-CO(CH.sub.2).sub.14CH.sub.3 group; [0160] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:29).
[0161] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 is an unmodified I residue, X.sub.2 is L, X.sub.3 is L, X.sub.4 is R, X.sub.7 is T, X.sub.8 is R, X.sub.5 is one E residue and X.sub.6 is a C16 mono fatty acid and the K* residue has replaced the original amino acid at position 24).
IVLSLDVPIGLLQILLEQEKQEKEK*QQATTNARILARV-NH2
[0162] wherein the K* at position 25 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a -E-CO(CH.sub.2).sub.14CH.sub.3 group; [0163] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:30).
[0164] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 is an unmodified I residue, X.sub.2 is L, X.sub.3 is L, X.sub.4 is R, X.sub.7 is T, X.sub.8 is R, X.sub.5 is one E residue and X.sub.6 is a C.sub.16 mono fatty acid and the K* residue has replaced the original amino acid at position 25).
IVLSLDVPIGLLQILLEQEKQEKEK*QQATTNARILARV-NH2
[0165] wherein the K* at position 25 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a -E-E-CO(CH.sub.2).sub.14CH.sub.3 group; [0166] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:31).
[0167] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 is an unmodified I residue, X.sub.2 is L, X.sub.3 is L, X.sub.4 is R, X.sub.7 is T, X.sub.8 is R, X.sub.5 is two E residues and X.sub.6 is a C16 mono fatty acid and the K* residue has replaced the original amino acid at position 25).
IVLSLDVPIGLLQILLEQEKQEKEK*QQATTNARILARV-NH2
[0168] wherein the K* at position 25 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a -([2-(2-Amino-ethoxy)-ethoxy]-acetyl)-E-CO(CH.sub.2).sub.14CH.sub.3 group; [0169] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:32).
[0170] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 is an unmodified I residue, X.sub.2 is L, X.sub.3 is L, X.sub.4 is R, X.sub.7 is T, X.sub.8 is R, X.sub.5 is a combination of one E residue and one ([2-(2-Amino-ethoxy)-ethoxy]-acetyl) group and X.sub.6 is a C16 mono fatty acid and the K* residue has replaced the original amino acid at position 25).
IVLSLDVPIGLLQILLEQEKQEKEKK*QATTNARILARV-NH2
[0171] wherein the K* at position 26 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a -E-CO(CH.sub.2).sub.14CH.sub.3 group; [0172] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:33).
[0173] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 is an unmodified I residue, X.sub.2 is L, X.sub.3 is L, X.sub.4 is R, X.sub.7 is T, X.sub.8 is R, X.sub.5 is one E residue and X.sub.6 is a C16 mono fatty acid and the K* residue has replaced the original amino acid at position 26).
IVLSLDVPIGLLQILLEQEKQEKEKK*QATTNARILARV-NH2
[0174] wherein the K* at position 26 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a -E-E-CO(CH.sub.2).sub.14CH.sub.3 group; [0175] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:34).
[0176] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 is an unmodified I residue, X.sub.2 is L, X.sub.3 is L, X.sub.4 is R, X.sub.7 is T, X.sub.8 is R, X.sub.5 is two E residues and X.sub.6 is a C.sub.16 mono fatty acid and the K* residue has replaced the original amino acid at position 26).
IVLSLDVPIGLLQILLEQEKQEKEKQK*ATTNARILARV-NH2
[0177] wherein the K* at position 27 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a -E-CO(CH.sub.2).sub.14CH.sub.3 group; [0178] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:35).
[0179] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 is an unmodified I residue, X.sub.2 is L, X.sub.3 is L, X.sub.4 is R, X.sub.7 is T, X.sub.8 is R, X.sub.5 is one E residue and X.sub.6 is a C.sub.16 mono fatty acid and the K* residue has replaced the original amino acid at position 27).
IVLSLDVPIGLLQILLEQEKQEKEKQQK*TTNARILARV-NH2
[0180] wherein the K* at position 28 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a -E-CO(CH.sub.2).sub.14CH.sub.3 group; [0181] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:36).
[0182] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 is an unmodified I residue, X.sub.2 is L, X.sub.3 is L, X.sub.4 is R, X.sub.7 is T, X.sub.8 is R, X.sub.5 is one E residue and X.sub.6 is a C.sub.16 mono fatty acid and the K* residue has replaced the original amino acid at position 28).
IVLSLDVPIGLLQILLEQEKQEKEKQQAK*TNARILARV-NH2
[0183] wherein the K* at position 29 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a -E-CO(CH.sub.2).sub.14CH.sub.3 group; [0184] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:37).
[0185] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 is an unmodified I residue, X.sub.2 is L, X.sub.3 is L, X.sub.4 is R, X.sub.7 is T, X.sub.8 is R, X.sub.5 is one E residue and X.sub.6 is a C.sub.16 mono fatty acid and the K* residue has replaced the original amino acid at position 29).
[0186] IVLSLDVPIGLLQILLEQEKQEKEKQQAK*TNARILARV-NH2 [0187] wherein the K* at position 29 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a -E-E-CO(CH.sub.2).sub.14CH.sub.3 group; [0188] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:38).
[0189] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 is an unmodified I residue, X.sub.2 is L, X.sub.3 is L, X.sub.4 is R, X.sub.7 is T, X.sub.8 is R, X.sub.5 is two E residues and X.sub.6 is a C.sub.16 mono fatty acid and the K* residue has replaced the original amino acid at position 29).
IVLSLDVPIGLLQILLEQEKQEKEKQQATK*NARILARV-NH2
[0190] wherein the K* at position 30 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a -E-CO(CH.sub.2).sub.14CH.sub.3 group; [0191] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:39).
[0192] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 is an unmodified I residue, X.sub.2 is L, X.sub.3 is L, X.sub.4 is R, X.sub.8 is R, X.sub.5 is one E residue and X.sub.6 is a C.sub.16 mono fatty acid and the K* residue has replaced the original amino acid (e.g., X.sub.7) at position 30).
IVLSLDVPIGLLQK*LLEQEKQEKEKQQATTNAQILAHV-NH2
[0193] wherein the K* at position 14 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a ([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-E-E-CO(CH.sub.2).sub.16COOH group; [0194] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:40).
[0195] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 is an unmodified I residue, X.sub.2 is L, X.sub.3 is L, X.sub.4 is Q, X.sub.7 is T, X.sub.8 is H, X.sub.5 is a combination of two ([2-(2-Amino-ethoxy)-ethoxy]-acetyl) groups and two E residues and X.sub.6 is a C.sub.18 diacid fatty acid and the K* residue has replaced the original amino acid at position 14).
IVLSLDVPIGLLQIK*LEQEKQEKEKQQATTNAQILAHV-NH2
[0196] wherein the K* at position 15 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a ([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-E-E-CO(CH.sub.2).sub.16COOH group; [0197] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:41).
[0198] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 is an unmodified I residue, X.sub.2 is L, X.sub.3 is L, X.sub.4 is Q, X.sub.7 is T, X.sub.8 is H, X.sub.5 is a combination of two ([2-(2-Amino-ethoxy)-ethoxy]-acetyl) groups and two E residues and X.sub.6 is a C.sub.18 diacid fatty acid and the K* residue has replaced the original amino acid at position 15).
IVLSLDVPIGLLQILK*EQEKQEKEKQQATTNAQILAHV-NH2
[0199] wherein the K* at position 16 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a ([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-E-E-CO(CH.sub.2).sub.16COOH group; [0200] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:42).
[0201] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 is an unmodified I residue, X.sub.2 is L, X.sub.4 is Q, X.sub.7 is T, X.sub.8 is H, X.sub.5 is a combination of two ([2-(2-Amino-ethoxy)-ethoxy]-acetyl) groups and two E residues and X.sub.6 is a C.sub.18 diacid fatty acid and the K* residue has replaced the original amino acid (e.g., X.sub.3) at position 16).
IVLSLDVPIGLLQILLK*QEKQEKEKQQATTNAQILAHV-NH2
[0202] wherein the K* at position 17 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a ([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-E-E-CO(CH.sub.2).sub.16COOH group; [0203] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:43).
[0204] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 is an unmodified I residue, X.sub.2 is L, X.sub.3 is L, X.sub.4 is Q, X.sub.7 is T, X.sub.8 is H, X.sub.5 is a combination of two ([2-(2-Amino-ethoxy)-ethoxy]-acetyl) groups and two E residues and X.sub.6 is a C.sub.18 diacid fatty acid and the K* residue has replaced the original amino acid at position 17).
IVLSLDVPIGLLQILLEK*EKQEKEKQQATTNAQILAHV-NH2
[0205] wherein the K* at position 18 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a ([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-E-E-CO(CH.sub.2).sub.16COOH group; [0206] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:44).
[0207] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 is an unmodified I residue, X.sub.2 is L, X.sub.3 is L, X.sub.4 is Q, X.sub.7 is T, X.sub.8 is H, X.sub.5 is a combination of two ([2-(2-Amino-ethoxy)-ethoxy]-acetyl) groups and two E residues and X.sub.6 is a C.sub.18 diacid fatty acid and the K* residue has replaced the original amino acid at position 18).
IVLSLDVPIGLLQILLEQEKK*EKEKQQATTNAQILAHV-NH2
[0208] wherein the K* at position 21 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a ([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-E-E-CO(CH.sub.2).sub.16COOH group; [0209] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:45).
[0210] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 is an unmodified I residue, X.sub.2 is L, X.sub.3 is L, X.sub.4 is Q, X.sub.7 is T, X.sub.8 is H, X.sub.5 is a combination of two ([2-(2-Amino-ethoxy)-ethoxy]-acetyl) groups and two E residues and X.sub.6 is a C.sub.18 diacid fatty acid and the K* residue has replaced the original amino acid at position 21).
IVLSLDVPIGLLQILLEQEKQEKEK*QQATTNAQILAHV-NH2
[0211] wherein the K* at position 25 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a ([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-E-E-CO(CH.sub.2).sub.16COOH group; [0212] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:46).
[0213] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 is an unmodified I residue, X.sub.2 is L, X.sub.3 is L, X.sub.4 is Q, X.sub.7 is T, X.sub.8 is H, X.sub.5 is a combination of two ([2-(2-Amino-ethoxy)-ethoxy]-acetyl) groups and two E residues and X.sub.6 is a C.sub.18 diacid fatty acid and the K* residue has replaced the original amino acid at position 25).
IVLSLDVPIGLLQILLEQEKQEKEKK*QATTNAQILAHV-NH2
[0214] wherein the K* at position 26 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a ([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-E-E-CO(CH.sub.2).sub.16COOH group; [0215] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:47).
[0216] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 is an unmodified I residue, X.sub.2 is L, X.sub.3 is L, X.sub.4 is Q, X.sub.7 is T, X.sub.8 is H, X.sub.5 is a combination of two ([2-(2-Amino-ethoxy)-ethoxy]-acetyl) groups and two E residues and X.sub.6 is a C.sub.18 diacid fatty acid and the K* residue has replaced the original amino acid at position 26).
IVLSLDVPIGLLQILLEQEKQEKEKQQAK*TNAQILAHV-NH2
[0217] wherein the K* at position 29 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a ([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-E-E-CO(CH.sub.2).sub.16COOH group; [0218] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:48).
[0219] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 is an unmodified I residue, X.sub.2 is L, X.sub.3 is L, X.sub.4 is Q, X.sub.7 is T, X.sub.8 is H, X.sub.5 is a combination of two ([2-(2-Amino-ethoxy)-ethoxy]-acetyl) groups and two E residues and X.sub.6 is a C.sub.18 diacid fatty acid and the K* residue has replaced the original amino acid at position 29).
IVLSLDVPIK*LLQILLEQEKQEKEKQQATTNAQILAQV-amide
[0220] wherein the K* at position 10 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a ([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-E-E-CO(CH.sub.2).sub.16COOH group; [0221] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:49).
[0222] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 is an unmodified I residue, X.sub.2 is L, X.sub.3 is L, X.sub.4 is Q, X.sub.7 is T, X.sub.8 is Q, X.sub.5 is a combination of two ([2-(2-Amino-ethoxy)-ethoxy]-acetyl) groups and two E residues and X.sub.6 is a C.sub.18 diacid fatty acid and the K* residue has replaced the original amino acid at position 10).
IVLSLDVPIGLLQILLK*QEKQEKEKQQATTNAQILAQV-NH2
[0223] wherein the K* at position 17 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a ([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-E-E-CO(CH.sub.2).sub.16COOH group; [0224] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:50).
[0225] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 is an unmodified I residue, X.sub.2 is L, X.sub.3 is L, X.sub.4 is Q, X.sub.7 is T, X.sub.8 is Q, X.sub.5 is a combination of two ([2-(2-Amino-ethoxy)-ethoxy]-acetyl) groups and two E residues and X.sub.6 is a C.sub.18 diacid fatty acid and the K* residue has replaced the original amino acid at position 17).
IVLSLDVPIGLLQILLEQEKQEKEKK*QATTNAQILAQV-NH2
[0226] wherein the K* at position 26 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a ([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-E-E-CO(CH.sub.2).sub.16COOH group; [0227] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:51).
[0228] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 is an unmodified I residue, X.sub.2 is L, X.sub.3 is L, X.sub.4 is Q, X.sub.7 is T, X.sub.8 is Q, X.sub.5 is a combination of two ([2-(2-Amino-ethoxy)-ethoxy]-acetyl) groups and two E residues and X.sub.6 is a C.sub.18 diacid fatty acid and the K* residue has replaced the original amino acid at position 26).
IVLSLDVPIGLLQILLEQEKQEKEKQQAK*TNAQILAQV-NH2
[0229] wherein the K* at position 29 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a ([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-E-E-CO(CH.sub.2).sub.16COOH group; [0230] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:52).
[0231] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 is an unmodified I residue, X.sub.2 is L, X.sub.3 is L, X.sub.4 is Q, X.sub.7 is T, X.sub.8 is Q, X.sub.5 is a combination of two ([2-(2-Amino-ethoxy)-ethoxy]-acetyl) groups and two E residues and X.sub.6 is a C.sub.18 diacid fatty acid and the K* residue has replaced the original amino acid at position 29).
IVLSLDVPIGLLQILLK*QEKQEKEKQQATENAQILAQV-NH2
[0232] wherein the K* at position 17 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a ([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-E-E-CO(CH.sub.2).sub.16COOH group; [0233] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:53).
[0234] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 is an unmodified I residue, X.sub.2 is L, X.sub.3 is L, X.sub.4 is Q, X.sub.7 is E, X.sub.8 is Q, X.sub.5 is a combination of two ([2-(2-Amino-ethoxy)-ethoxy]-acetyl) groups and two E residues and X.sub.6 is a C.sub.18 diacid fatty acid and the K* residue has replaced the original amino acid at position 17).
IVLSLDVPIGLLQILLEQEKQEKEKK*QATENAQILAQV-NH2
[0235] wherein the K* at position 26 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a ([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-E-E-CO(CH.sub.2).sub.16COOH group; [0236] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:54).
[0237] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 is an unmodified I residue, X.sub.2 is L, X.sub.3 is L, X.sub.4 is Q, X.sub.7 is E, X.sub.8 is Q, X.sub.5 is a combination of two ([2-(2-Amino-ethoxy)-ethoxy]-acetyl) groups and two E residues and X.sub.6 is a C.sub.18 diacid fatty acid and the K* residue has replaced the original amino acid at position 26).
IVLSLDVPIGLLQILLEQEKQEKEKQQAK*ENAQILAQV-NH2
[0238] wherein the K* at position 29 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a ([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-E-E-CO(CH.sub.2).sub.16COOH group; [0239] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:55).
[0240] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 is an unmodified I residue, X.sub.2 is L, X.sub.3 is L, X.sub.4 is Q, X.sub.7 is E, X.sub.8 is Q, X.sub.5 is a combination of two ([2-(2-Amino-ethoxy)-ethoxy]-acetyl) groups and two E residues and X.sub.6 is a C.sub.18 diacid fatty acid and the K* residue has replaced the original amino acid at position 29).
IVLSLDVPIGLLQILLEQEKQEKEKQQAK*ENAQILAQV-NH2
[0241] wherein the K* at position 29 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a ([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-E-CO(CH.sub.2).sub.16COOH group; [0242] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:56).
[0243] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 is an unmodified I residue, X.sub.2 is L, X.sub.3 is L, X.sub.4 is Q, X.sub.7 is E, X.sub.8 is Q, X.sub.5 is a combination of two ([2-(2-Amino-ethoxy)-ethoxy]-acetyl) groups and a single E residue and X.sub.6 is a C.sub.18 diacid fatty acid and the K* residue has replaced the original amino acid at position 29).
X.SUB.1.IVLSLDVPIGLLQILLEQEKQEKEKQQAK*ENAEILAQV-NH2
[0244] wherein X.sub.1 has the N-terminus of the I residue modified by methylation; [0245] wherein the K* at position 29 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a ([2-(2-Amino-ethoxy)-ethoxy]-acetyl)-E-E-CO(CH.sub.2).sub.18COOH group; [0246] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:57).
[0247] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 represents that the I residue has been methylated at the N-terminus, X.sub.2 is L, X.sub.3 is L, X.sub.4 is E, X.sub.7 is E, X.sub.8 is Q, X.sub.5 is a combination of a single ([2-(2-Amino-ethoxy)-ethoxy]-acetyl) group and two E residues and X.sub.6 is a C.sub.20 diacid fatty acid and the K* residue has replaced the original amino acid at position 29).
X.SUB.1.IVLSLDVPIGLLQILLEQEKQEKEKQQAK*ENAEILAQV-NH2
[0248] wherein X.sub.1 has the N-terminus of the I residue modified by methylation; [0249] wherein the K* at position 29 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a E-E-CO(CH.sub.2).sub.18COOH group; [0250] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:58).
[0251] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 represents that the I residue has been methylated at the N-terminus, X.sub.2 is L, X.sub.3 is L, X.sub.4 is E, X.sub.7 is E, X.sub.8 is Q, X.sub.5 is two E residues and X.sub.6 is a C.sub.20 diacid fatty acid and the K* residue has replaced the original amino acid at position 29).
X.SUB.1.IVLSLDVPIGLLQILLEQEKQEKEKQQAK*ENAEILAQV-NH2
[0252] wherein X.sub.1 has the N-terminus of the I residue modified by methylation; [0253] wherein the K* at position 29 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a E-([2-(2-Amino-ethoxy)-ethoxy]-acetyl)-E-E-CO(CH.sub.2).sub.18COOH group; [0254] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:59).
[0255] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 represents that the I residue has been methylated at the N-terminus, X.sub.2 is L, X.sub.3 is L, X.sub.4 is E, X.sub.7 is E, X.sub.8 is Q, X.sub.5 is a combination of a E residue, a ([2-(2-Amino-ethoxy)-ethoxy]-acetyl) group and then two more E residues and X.sub.6 is a C.sub.20 diacid fatty acid and the K* residue has replaced the original amino acid at position 29).
X.SUB.1.VLSLDVPIGLLQILLEQEKQEKEKQQAK*TNAQILAQV-NH2
[0256] wherein X.sub.1 has the N-terminus of the I residue modified by methylation; [0257] wherein the K* at position 29 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a E-([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-E-E-CO(CH.sub.2).sub.18COOH group; [0258] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:60).
[0259] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 represents that the I residue has been methylated at the N-terminus, X.sub.2 is L, X.sub.3 is L, X.sub.4 is Q, X.sub.7 is T, X.sub.8 is Q, X.sub.5 is a combination of a E residue, two ([2-(2-Amino-ethoxy)-ethoxy]-acetyl) groups and then two more E residues and X.sub.6 is a C.sub.20 diacid fatty acid and the K* residue has replaced the original amino acid at position 29).
X.SUB.1.VLSLDVPIGLLQILLEQEKQEKEKQQAK*TNAQILAQV-NH2
[0260] wherein X.sub.1 has the N-terminus of the I residue modified by methylation; [0261] wherein the K* at position 29 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a E-([2-(2-Amino-ethoxy)-ethoxy]-acetyl)-E-E-CO(CH.sub.2).sub.18COOH group; [0262] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:61).
[0263] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 represents that the I residue has been methylated at the N-terminus, X.sub.2 is L, X.sub.3 is L, X.sub.4 is Q, X.sub.7 is T, X.sub.8 is Q, X.sub.5 is a combination of a E residue, a ([2-(2-Amino-ethoxy)-ethoxy]-acetyl) group and then two more E residues and X.sub.6 is a C.sub.20 diacid fatty acid and the K* residue has replaced the original amino acid at position 29).
X.SUB.1.IVLSLDVPIGLLQILLEQEKQEKEKQQAK*TNAQILAQV-NH2
[0264] wherein X.sub.1 has the N-terminus of the I residue modified by methylation; [0265] wherein the K* at position 29 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a E-E-([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-E-E-CO(CH.sub.2).sub.18COOH group; [0266] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:62).
[0267] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 represents that the I residue has been methylated at the N-terminus, X.sub.2 is L, X.sub.3 is L, X.sub.4 is Q, X.sub.7 is T, X.sub.8 is Q, X.sub.5 is a combination of two E residues, two ([2-(2-Amino-ethoxy)-ethoxy]-acetyl) groups and then two more E residues and X.sub.6 is a C.sub.20 diacid fatty acid and the K* residue has replaced the original amino acid at position 29).
X.SUB.1.VLSLDVPIGLLQILLEQEKQEKEKQQAK*TNAQILAQV-NH2
[0268] wherein X.sub.1 has the N-terminus of the I residue modified by methylation; [0269] wherein the K* at position 29 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a E-E-([2-(2-Amino-ethoxy)-ethoxy]-acetyl)-E-E-CO(CH.sub.2).sub.18COOH group; [0270] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:63).
[0271] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 represents that the I residue has been methylated at the N-terminus, X.sub.2 is L, X.sub.3 is L, X.sub.4 is Q, X.sub.7 is T, X.sub.8 is Q, X.sub.5 is a combination of two E residues, a single ([2-(2-Amino-ethoxy)-ethoxy]-acetyl) group and then two more E residues and X.sub.6 is a C.sub.20 diacid fatty acid and the K* residue has replaced the original amino acid at position 29).
X.SUB.1.IVLSLDVPIGLLQILLEQEKQEKEKQQAK*TNAQILAQV-NH2
[0272] wherein X.sub.1 has the N-terminus of the I residue modified by methylation; [0273] wherein the K* at position 29 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a E-E-E-E-CO(CH.sub.2).sub.18COOH group; [0274] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:64).
[0275] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 represents that the I residue has been methylated at the N-terminus, X.sub.2 is L, X.sub.3 is L, X.sub.4 is Q, X.sub.7 is T, X.sub.8 is Q, X.sub.5 is a combination of four E residues and X.sub.6 is a C.sub.20 diacid fatty acid and the K* residue has replaced the original amino acid at position 29).
X.SUB.1.IVTSLDVPIGLLQILLEQEKQEKEKQQAK*TNAEILAQV-NH2
[0276] wherein X.sub.1 has the N-terminus of the I residue modified by methylation; [0277] wherein the K* at position 29 has been chemically modified such that the epsilon-amino group of the K-side chain is bonded with a E-([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-E-E-CO(CH.sub.2).sub.18COOH group; [0278] and the C-terminal amino acid is amidated as a C-terminal primary amide (SEQ ID NO:66).
[0279] This sequence falls within the scope of Formula III (in that, in this particular embodiment, X.sub.1 represents that the I residue has been methylated at the N-terminus, X.sub.2 is T, X.sub.3 is L, X.sub.4 is E, X.sub.7 is T, X.sub.8 is Q, X.sub.5 is a combination of a E residue, two ([2-(2-Amino-ethoxy)-ethoxy]-acetyl) groups and then two more E residues and X.sub.6 is a C.sub.20 diacid fatty acid and the K* residue has replaced the original amino acid at position 29).
[0280] It should be noted that, in addition to the methods of preparing the compounds described above, a convergent synthesis may also be used. For example, in this convergent synthesis, an acylated lysine sidechain is constructed and/or obtained. This acylated lysine side chain fragment may have the acid fragments protected orthogonally as t-butyl esters or other protecting groups commonly known in peptide synthesis. It is believed that such a method of synthesis may produce the acylated sidechain in high purity, 98% which may reduce the downstream chromatography requirements, potentially leading to improved purity and increased process efficiency. For example, in an all linear build, the acylated lysine component (i.e. the fatty acid side chain having the amino-ethoxy moieties, etc.) is typically installed at the end of the synthesis, and this can create high levels of process impurities such as, but not limited to impurities have greater or fewer numbers of amino-ethoxy moieties which can be problematic to remove. Using the convergent (outlined herein) strategy may de-risk an all linear synthetic build strategy, wherein a single mistake can result in a total loss. In addition, using a convergent synthesis approach may improve supply chain flexibility with comparable resourcing requirements to a standard all linear build. Additionally a convergent synthesis strategy may also be a means of lowering COPS (cost of product sold) and further improving robustness. Another benefit may be that the N-terminus N-methyl isoleucine residue is frequently a difficult coupling for a large peptide. Incorporation of N-methyl isoleucine onto a smaller fragment may be potentially a good means of de-risking this coupling issue.
[0281] Using the compound of Example 4 as an example, the acylated lysine side chain is close to the C-terminus, a strategic retrosynthetic break for a convergent synthesis process may be between the alanine (A) at position 28 and the lysine (K) at position 29. Thus, this fragment will include the lysine at position 29 (and its accompanying side chain) along with the final 9 residues (leading up to the C-terminus). In some embodiments, this fragment may be the primary parent fragment produced on Rink Amide or Sieber Amide resin. Another retrosynthetic disconnection may be between the Glycine (G) at position 10 and the Leucine (L) at position 11. Making a fragment of these sequences may ensure that such a sequence has no (or a lower) propensity for racemization. The third fragment of 18 amino acids (e.g., from the residue at position 11 to the Alanine at position 28 could also be produced. This 18 residue fragment, along with the initial 10 amino acid fragment (e.g., the N-terminus to the G at position 10) could both be produced, for example, by a 2-CTC resin. The 2-CTC resin may often be preferred for synthesis of most fragments as the resin can be orthogonally cleaved while leaving peptide protecting groups in tact.
[0282] Thus, in summary, the following synthesis method for the compound of Example 4 is provided below: [0283] 1) Construct the fatty acid side chain that is connected to a Lysine (e.g., the K that will ultimately be K at position 29); [0284] 2) Construct a 10 amino acid fragment starting with the Lysine with the fatty acid side chain (e.g., the K that will ultimately be K at position 29) and add the other amino acids to ending in the C-terminus after the final V residue; [0285] 3) Construct the 18 amino acid residue fragment, starting with the L at position 11 and ending with the A at position 28; [0286] 4) Construct the 10 amino acid fragment starting with the modified I at position 1 and ending with the G at position 10; [0287] 5) The 18 residue fragment of step 3 could be coupled to the 10 reside fragment of step 4, and then this 28 construct could be coupled to the fragment of step 2 (having the side chain); alternatively the 18 residue fragment of step 3 could be coupled to the added to 10 amino acid fragment of step 2, and then this residue construct could be coupled to the fragment of step 4.
[0288] Again, one of the benefits of using this fragment based construction technique is that each fragment could be produced sequentially or simultaneously. Further, the smaller fragments of the peptides may be easier to purify and sometimes can be isolated in crystalline form which imparts high purity. Likewise, if an error is made in one of the fragment, only that fragment has to be discarded and re-created (rather than having to re-create the entire compound). Other strategic fragment breaks are possible to further improve purity and efficiency such as but not limited to fragment condensation to produce the 18 amino acid residue.
[0289] In some embodiments, lyophilization may be incorporated as the strategy as a means of potentially de-risking potential physical property issues of the compound. Specifically, the compound may be constructed by in which it is purified via chromatography. Once purified, the solution may be concentrated and then isolated as a solid (e.g., dry powder) via lyophilization. In alternate embodiments, a solid may be obtained and isolated using a precipitation/filtration/drying/humidification procedure.
[0290] Lyophilization is the most commonly practiced (80%) industrial means for production of solid peptide drug products for storage or reconstitution. In some embodiments, the primary drawback to precipitation is the extensive material and design space development necessary to assure a robust process. Precipitated compounds may also contain high density particles which tend to agglomerate and frequently these precipitated products may slowly dissolve with standard dissolution assays and/or drug product formulations. On the other hand, high surface area product produced by lyophilization may assure maximized dissolution rates in dissolution assays and/or drug product formulations. However, precipitation products may also be used, as this method tends to be less expensive for high volume products.
[0291] In other embodiment, the present invention is also directed to a compound comprising the following amino acid sequence:
X.sub.1IVX.sub.2SLDVPIGLLQILX.sub.3EQEKQEKEKQQAKTNAX.sub.4ILAQV-NH.sub.2
[0292] wherein X.sub.1 denotes that the I residue is modified by either acetylation or methylation at the N-terminus;
[0293] wherein X.sub.2 is L or T;
[0294] wherein X.sub.3 is L or I;
[0295] wherein X.sub.4 is Q or E (SEQ ID NO:18).
[0296] This sequence has use as an intermediate. Specifically, this sequence may be used as an intermediate to construct the compounds described herein. In this particular method, synthesis on this intermediate would begin on a solid phase (in the manner outlined above) starting from the V at position 38 and finishing at the I (with either the acyl or N-methyl group at the N-terminus). Once this sequence is constructed, the K at position 29 would be deprotected such that the orthogonal protecting group is removed. Then, the particular group of the formula X.sub.5X.sub.6 could then be added to the epsilon-amino group of the K-side chain at position 29. Any of the particular side chains for the group of the formula X.sub.5X.sub.6 outlined herein may be used. Such addition of the group of the formula X.sub.5X.sub.6 may be added while the peptide is still attached to the solid phase. After adding the group of the formula X.sub.5X.sub.6, the peptide may be released from the resin and purified.
Assays
[0297] Provided below are the conditions and data for some of the above-recited Examples in several assays: in vitro function and selectivity, pharmacokinetics, type II diabetes, muscle atrophy, chronic kidney disease (diabetic nephropathy, hypertensive nephropathy), and blood pressure.
In Vitro Function and Selectivity
[0298] CRHR agonistic activity is measured in a cell-based cAMP assay. Serial dilutions of the test peptides are made in assay buffer containing Hank's Balanced Salt Solution (HBSS, without phenol red) supplemented with 20 mM HEPES and 0.05% lactalbumin enzymatic hydrolysate (LAH) (assay buffer). The highest concentration that is used starts from 1 M in the human CRHR2b, whereas 100 M starting concentration is used in the human CRHR1 assay. A one to three dilution of the test peptides is used in both assays.
[0299] Receptor over-expressing Chinese Hamster Ovary (CHO) cell line is used for the human CRHR2b assay. CHO cells are grown in DMEM supplemented with 10% fetal bovine serum at 37 C. under suspension conditions and transiently transfected with cDNA constructs of human CRHR2b (Genbank accession number: AF011406.1). Forty-eight hours after the transfection, the cells are centrifuged to remove the culture media and resuspended in fetal bovine serum containing 5% DMSO. They are cryofrozen and stored in vials in liquid nitrogen (20106 cells/ml/vial). On the day of the assay, cells are thawed and resuspended in cold 30 ml culture media supplemented with 20 mM HEPES. The cells are then centrifuged to remove the media and washed once with HBSS supplemented with 20 mM HEPES. Finally, following the last centrifugation, the cells are resuspended in assay buffer. Thirty-thousand cells are used in the human CRHR2b assay for each treatment.
[0300] The human Retinoblastoma cell line Y79 (ATCC #HTB-18), which expresses endogenous human CRHR1, is used in the human CRHR1 assay. The cells are grown in RPMI 1640 (Hyclone, #SH30255) containing 20% fetal bovine serum and 10 mM HEPES, in suspension culture. Cells are centrifuged to remove the culture media and washed once in HBSS supplemented with 20 mM HEPES. The cells are resuspended in the assay buffer and 20,000 cells are used per treatment in the human CRHR1 assay.
[0301] The cells are dispensed into Costar 96-well black polystyrene half area EIA/RIA plates (Corning Incorporated, Corning, N.Y.) followed by the addition of the diluted peptides, each at a volume of 20 L. The agonist induced cAMP levels are detected using a HTRF cAMP Dynamic 2 kit (CisBio, Bedford, Mass.). After incubation at 37 C. for 30 min, the assay is stopped by cell lysis via the addition of 20 L of d2-labeled cAMP and followed by 20 L of cryptate-labeled anti-cAMP antibody, as described by the manufacturer. Cellular cAMP (as a result of agonist stimulation) competes with the d2-labeled cAMP for binding to the antibody. HTRF detection is performed on an Envision plate reader (Perkin Elmer Life and Analytical Sciences, Waltham, Mass.) by measuring ratiometric emission at 620 and 665 nm after excitation at 320 nm.
[0302] The data are converted to picomoles of cAMP using a standard curve obtained from the same assay performed with varying concentrations of unlabeled cAMP. Percent of the maximum activation of the cells is calculated using converted picomole cAMP data by comparing to the amount of cAMP produced by 1 M human UCN2 for the human CRHR2b or 1 M human UCN1 for the human CRHR1 assay. The data are analyzed using a Curve Fitting Tool to calculate ED50. Numeric values shown below in Table 1 represent the mean of multiple runs (number of runs shown in parentheses) following the mean valueSEM.
TABLE-US-00001 TABLE 1 In vitro activity for hCRHR2b and hCRHR1. hCRHR2b hCRHR1 Example Average EC50 (nM) Average EC50 (nM) hUCN1 0.81 0.96 (n = 14) 7.30 3.65 (n = 23) hUCN2 0.19 0.12 (n = 32) >100000 (n = 6) Example 1 2.44 1.36 (n = 3) ~10000 (n = 5) Example 2 1.20 0.52 (n = 4) >10000 (n = 4) Example 3 2.00 1.11 (n = 5) >100000 (n = 4) Example 4 1.85 0.51 (n = 8) >100000 (n = 4) Example 5 1.01 0.23 (n = 8) 33891 16067 (n = 4) Example 6 2.50 1.06 (n = 8) >100000 (n = 4) Example 7 0.94 0.05 (n = 4) ~100000 (n = 4)
[0303] These data demonstrate that the compounds of Examples 1 to 7 have CRHR2 agonist activity in a cAMP assay. These data further demonstrate that the compounds of Examples 1 to 7 are selective for CRHR2, over CRHR1.
Pharmacokinetics
[0304] Plasma concentrations of compounds were determined by LC/MS methods. Each method measured the intact compound; peptide plus linked time extension. For each assay, the compound and an analog, used as an internal standard (IS), were extracted from 100% mouse, rat or monkey plasma (25 l) using acetonitrile. Two distinct layers were formed upon centrifugation with the compound and the IS located in the supernatant layer. An aliquot of the supernatant (80 l) was transferred to a Thermo Protein Precipitation Plate with water (150 l) and formic acid (25 l) followed by mixing. A final 31% acetonitrile in 10% formic acid sample (10 l) was loaded onto a Supelco Analytical Discovery BIO Wide Pore C5-3 column (5 cm1 mm, 3 m). The column effluent was directed into a Thermo Q-Exactive mass spectrometer for detection and quantitation.
[0305] Male Cynomolgus monkeys were administered a single subcutaneous dose or intravenous dose (96.4 nmol/kg) of a compound described herein in 20 mM Tris-HCl Buffer (pH 7) at a volume of 1 mL/kg. Blood was collected from each animal at 2, 6, 24, 48, 72, 96, 168, 240, 336, 408, and 504 hours postdose for pharmacokinetic characterization.
[0306] Male Cynomolgus monkeys were also administered a single subcutaneous dose (50 nmol/kg) of a compound described herein in 20 mM Tris-HCl Buffer (pH 8) at a volume of 0.26 mL/kg. Blood was collected from each animal at 3, 6, 12, 24, 48, 72, 96, 120, 168, 192, 240, 336, 408, and 504 hours postdose for pharmacokinetic characterization.
[0307] Male Sprague Dawley rats were administered a single subcutaneous dose (50 or 150 nmol/kg) of a compound described herein in 20 mM Tris-HCl Tris Buffer (pH 8) at a volume of 0.26 or 0.77 mL/kg. Blood was collected from each animal at 6, 12, 24, 48, 72, 96, 120, 144, 168, 192, 240, 288, and 336 hours postdose for pharmacokinetic characterization.
[0308] Male CD-1 mice were administered a single subcutaneous dose (350, 386 or 388 nmol/kg) of a compound described herein in 20 mM Tris-HCl Tris Buffer (pH 7 or 8) at a volume of 0.05 or 0.06 mL/animal. Blood was collected at 6, 12, 24, 48, 72, 96, 120 and 168 hours postdose for pharmacokinetic characterization (101).
TABLE-US-00002 TABLE 2 Individual and Mean Pharmacokinetic Parameters Following a Single 50 or 96.4 nmol/kg Subcutaneous Dose to Male Cynomolgus Monkeys Compound T.sub.1/2 Tmax Cmax AUC.sub.0-inf CL/F (Dose) (hr) (hr) (nmole/L) (hr*nmole/L) (mL/hr/kg) Example 2 97 24 1238 237954 0.41 (96.4 84 48 1699 245711 0.39 nmol/kg) Mean 91 36 1469 241833 0.40 Example 3 101 48 441 69880 0.72 (50 70 24 432 58414 0.86 nmol/kg) Mean 85 36 437 64147 0.79 Example 4 79 48 333 51829 0.97 (50 106 24 291 46654 1.07 nmol/kg) Mean 93 36 312 49241 1.02 Abbreviations for this table: AUC.sub.0-inf = area under the curve from time 0 hours to infinity, CL/F = clearance/bioavailability, Tmax = time to maximal concentration, Cmax = maximum observed plasma concentration, T1/2 = half-life.
TABLE-US-00003 TABLE 3 Individual and Mean Pharmacokinetic Parameters Following a Single 96.4 nmol/kg Intravenous Dose to Male Cynomolgus Monkeys Compound T.sub.1/2 C.sub.0 AUC.sub.0-inf CL (Dose) (hr) (nmole/L) (hr*nmole/L) (mL/hr/kg) Example 2 124 3267 0.28 (96.4 98 3059 0.36 nmol/kg) Mean 111 3163 305766 0.32 Abbreviations for this table: AUC.sub.0-inf = area under the curve from time 0 hours to infinity, CL = clearance, C.sub.0 = Estimated plasma concentration at time zero, T.sub.1/2 = half-life.
TABLE-US-00004 TABLE 4 Individual and Mean Pharmacokinetic Parameters Following a Single 50 or 150 nmol/kg Subcutaneous Dose to Male Sprague Dawley Rats Compound T.sub.1/2 Tmax Cmax AUC.sub.0-inf CL/F (Dose) (hr) (hr) (nmole/L) (hr*nmole/L) (mL/hr/kg) Example 2 37 24 4.1 (150 32 24 4.9 nmol/kg) 34 24 5.0 Mean 34 24 429 32268 4.7 SD 3 0 53 3532 0.5 Example 3 16 12 188 6.2 (50 nmol/kg) 14 24 160 7.5 17 24 141 7.3 Mean 16 20 163 7175 7.0 SD 1 7 24 784 1.0 Example 3 16 24 531 6.0 (150 16 24 496 6.2 nmol/kg) 16 24 470 6.4 Mean 16 24 499 24363 6.0 SD 0 0 31 801 0.0 Example 4 19 24 126 6.4 (50 nmol/kg) 21 24 150 6.6 20 24 127 7.0 Mean 20 24 134 7513 7.0 SD 1 0 14 326 0.0 Example 4 21 24 356 6.8 (150 20 24 527 5.3 nmol/kg) 21 24 482 6.0 Mean 21 24 455 25057 6.0 SD 0 0 89 3136 1.0 Abbreviations for this table: AUC.sub.0-inf = area under the curve from time 0 hours to infinity, CL/F = clearance/bioavailability, Tmax = time to maximum concentration, Cmax = maximum observed plasma concentration, T1/2 = half-life.
TABLE-US-00005 TABLE 5 Mean Pharmacokinetic Parameters Following a Single Subcutaneous Dose to Male CD-1 Mice Compound T.sub.1/2 Tmax Cmax AUC.sub.0-inf CL/F (Dose) Study (hr) (hr) (nmole/L) (hr*nmole/L) (mL/hr/kg) Example 1 8296049 16 12 1149 32209 12.1 (388 nmol/kg) Example 2 8296049 20 12 1152 46488 8.3 (386 nmol/kg) Example 3 8323964 14 12 1338 35527 9.9 (350 nmol/kg) Example 4 8315101 18 24 1164 51552 6.8 (350 nmol/kg) Abbreviations for this table: AUC.sub.0-inf = area under the curve from time 0 hours to infinity, CL/F = clearance/bioavailability, Tmax = time to maximal concentration, Cmax = maximum observed concentration, T1/2 = half-life.
[0309] These data demonstrate that the above compounds have a pharmacokinetic profile suitable for once weekly administration or other types of administration such as bi-monthly or monthly.
Type II Diabetes
In Vivo Diet Induced Obesity (DIO) ModelChronic Dose Administration
[0310] The DIO model represents a pre-diabetic state that is sensitive to insulin. These animals, although not diabetic, display insulin resistance, dyslipidemia, and hepatic steatosis, all characteristics of metabolic syndrome, after being placed on a high fat (60% Kcal from fat) diet for 12 weeks (Surwit R S et al., Diet-induced type II diabetes in C57BL/6J mice. Diabetes 37(9): 1163-7 (1988)). The purpose of this study is to assess the effects of the molecules of Examples 4, 5, 6, and 7 on fasting glucose, fasting insulin, weight loss, and body composition.
[0311] Male C57BL6 mice 22 weeks old (on high fat diet since 6 weeks of age, Jackson Laboratories 3800050; Bar Harbor, Me.) are housed 1 per cage and maintained on D12492 chow (60% lard high fat diet: Research diets New Brunswick N.J.) for 2 weeks in the vivarium and on a normal light cycle prior to experiment start. Animals are randomized by body weight to treatment groups using block randomization. On day 1 of experiment animals and food are weighed and recorded. Animals are separated in to two equal groups and started on separate days (data combined) to simplify the logistics of the study. Animals are given a single subcutaneous injection (s.c.) of the indicated treatment in 20 mM citrate pH 7 on days 1 (start), 4, 7, 10, and 13 of experiment at a volume of 10 ml/kg. Vehicle control animals are injected with a similar volume of this solution. The solutions are kept in sterile capped vials stored at 4 C. for the duration of the study. Each treatment arm has an n of 5 mice per group.
[0312] From study day 1 to study day 15 the animals and their food are weighed daily prior to dose administration. These data are used to calculate body weight gain and food consumption. The animals or the wire rack containing the food are placed in a weigh pan and the balance is allowed to stabilize. The weight is recorded.
[0313] On Study Day 15, the animals are fasted overnight (approximately 16-18 hours) by placing them in a clean cage with a clean wire rack without food but allowed access to water, and on day 16 are subjected to a intraperitoneal glucose tolerance test (ipGTT). This is performed as follows; the tail of the animal is resected and baseline blood and serum samples (Time 0) are collected and the animals are injected intraperitoneally (ip) with a bolus of 2 g/kg glucose in sterile saline at a volume of 5 ml/kg. Thereafter, blood glucose and serum samples for insulin are collected at 20, 60, and 120 minutes after injection. Blood glucose is measured using an Accu-Chek Aviva glucose meter (Roche; Indianapolis, Ind.). The serum samples are centrifuged in a micro hematocrit centrifuge at 9000 relative centrifugal force (rcf) for 5 minutes. The serum is collected and analyzed for insulin using a Rat/Mouse Insulin Kit (Mesoscale Discovery). Statistical significance (*=p>0.05 vs. 0 dose; one way ANOVA Dunnett's post hoc) is calculated using GraphPad Prizm software (La Jolla, Ca). Glucose and insulin AUC are calculated using GraphPad Prism software (GraphPad Software Inc., La Jolla, Calif.). The area is computed between 0 and the curve, starting from the first X value in the data set and ending at the largest X value (from 0, Trapezoid rule).
[0314] On study day 1 and study day 15 (prior to fasting for the IPGTT measurement), body composition is analyzed using Quantitative Nuclear Magnetic Resonance EchoMRI analyzer (EMR-166-s, EchoMRI; Houston Tex.). After calibrating the analyzer with a known amount of canola oil, the animals are placed in the analyzer which measures fat and non-fat (lean) mass in grams. Change in mass is calculated by subtraction of the day 15 value from the day 1 value.
[0315] Tables 6, 7, 8 and 9 below show data corresponding to each of the above measurements. The data are represented as the arithmetic mean with SEM.
[0316] The data in Tables 6 to 9 demonstrate that subcutaneous administration of Examples 4-7 once every three days for 15 consecutive days results in the following significant differences: (1) decreases in: total body weight and improved body composition (represented as a decrease in fat mass with no significant change in lean mass) when compared to the Vehicle DIO mice. Further, Examples 4-7 when injected every third day s.c. for 15 consecutive days showed the following significant differences: (1) reduction of fasting serum glucose and serum insulin and (2) improvements in: glucose tolerance (represented by the reductions in glucose and insulin AUC during IPGTT). When an ED.sub.50 for fasting serum insulin lowering is calculated, Example 4, 5, and 6 produced ED.sub.50's of 6.47, 6.23 and 16.97 nmol/kg, respectively.
TABLE-US-00006 TABLE 6 In vivo chronic dose administration in male DIO mice. Example 4 0 nmol/kg 2.4 nmol/kg 7.2 nmol/kg 24 nmol/kg 72 nmol/kg 144 nmol/kg ED50 Dose (n = 5) (n = 5) (n = 5) (n = 5) (n = 5) (n = 5) (nmol/kg) Body weight change 3.7 0.66 2.3 1.6 0.52 1.2 4.1 1.6* 15 1.2* 15 0.98* 29.03 (% change SEM) Fasting blood 119 5.6 93 6.4* 80 3.8* 86 4.6* 80 3.8* 78 3.2* Ambiguous glucose(mg/dL SEM) Fasting serum insulin 1.4 0.24 1.3 0.08 0.56 0.21 0.52 0.14 0.25 0.15* 0.6 0.4 4.30 (ng/mL SEM) Blood glucose AUC during 46831 2531 32016 3812* 31918 2396* 31649 2174* 29750 3055* 27984 1481* Ambiguous ipGTT (mg/dL min.sup.1) Serum insulin AUC during 285 39 313 22 218 42 205 31 132 14* 118 7.4* 21.13 ipGTT (ng/mL min.sup.1) Fat mass change (g SEM) 1.3 0.22 0 0.7 1 0.45 2.7 0.63* 7.8 0.56* 7.1 0.54* 27.19 Lean mass change (g SEM) 0.3 0.32 1.2 0.21 0.52 0.16 0.84 0.33 0.14 0.19 0.02 0.36 Ambiguous *represents significance (p < 0.05) compared to Vehicle DIO and is calculated by One-Way ANOVA with a Dunnett's Comparison using GraphPad Prizm software (La Jolla, Ca)
TABLE-US-00007 TABLE 7 In vivo chronic dose administrationin male DIO mice. Example 5 0 nmol/kg 2.4 nmol/kg 7.2 nmol/kg 24 nmol/kg 72 nmol/kg 144 nmol/kg ED50 Dose (n = 5) (n = 5) (n = 5) (n = 5) (n = 5) (n = 5) (nmol/kg) Body weight change 3.7 0.66 0.88 2.4 2.1 0.62 11 1.4* 13 1.7* 13 1.5* 10.22 (% change SEM) Fasting blood 119 5.6 86 3.5* 83 2.5* 80 3.9* 80 3.5* 77 3.7* Ambiguous glucose(mg/dL SEM) Fasting serum insulin 1.4 0.24 1.1 0.2 0.65 0.1* 0.52 0.21* 0.25 0.09* 0.41 0.12* 6.23 (ng/mL SEM) Blood glucose AUC 46831 2531 34313 1608* 30089 2822* 32291 2283* 32768 4860* 26859 1697* Ambiguous during ipGTT (mg/dL min.sup.1) Serum insulin AUC 285 39 240 26 167 24 108 21 163 26* 285 39 9.70 during ipGTT (ng/mL min.sup.1) Fat mass change 1.3 0.22 0.78 0.87 2.6 0.33* 5.8 0.48* 6.6 0.74* 6.1 0.89* 6.60 (g SEM) Lean mass change 0.3 0.32 1.3 0.42 1.3 0.48 0.04 0.29 0.16 0.17 0.49 1.1 Ambiguous (g SEM) *represents significance (p < 0.05) compared to Vehicle DIO and is calculated by One-Way ANOVA with a Dunnett's Comparison using GraphPad Prizm software (La Jolla, Ca)
TABLE-US-00008 TABLE 8 In vivo chronic dose administration in male DIO mice. Example 6 0 nmol/kg 2.4 nmol/kg 7.2 nmol/kg 24 nmol/kg 72 nmol/kg 144 nmol/kg ED50 Dose (n = 5) (n = 5) (n = 5) (n = 5) (n = 5) (n = 5) (nmol/kg) Body weight change 5.3 1.1 2.3 1.4 1 1.9 3.5 0.77* 9.9 2.3* 16 0.88* 33.56# (% change SEM) Fasting blood 127 4.5 99 3.1* 91 4.3* 95 2.9* 86 4.2* 86 4.5* Not glucose(mg/dL SEM) converged Fasting serum insulin 1.4 0.29 1.1 0.22 1.1 0.34 0.6 0.14 0.53 0.21 0.34 0.16 16.97 (ng/mL SEM) Blood glucose AUC 42526 2213 32775 2674 24439 2165* 29473 3180* 29719 3115* 24650 1532* Ambiguous during ipGTT (mg/dL min.sup.1) Serum insulin AUC 315 39 306 44 230 28 173 22* 115 11* 89 17* 15.49 during ipGTT (ng/mL min.sup.1) Fat mass change 1.8 0.43 0.34 0.48 0.79 0.4.9 2.8 0.62* 5.6 0.96* 8 0.43* 22.33 (g SEM) Lean mass change 0.16 0.2 0.75 0.25 1.1 0.49 0.87 0.16 0.91 0.17 0.53 0.24 Ambiguous (g SEM) *represents significance (p < 0.05) compared to Vehicle DIO and is calculated by One-Way ANOVA with a Dunnett's Comparison using GraphPad Prizm software (La Jolla, Ca). #bottom of curve fixed to highest dose.
TABLE-US-00009 TABLE 9 In vivo chronic dose administration in male DIO mice. Example 7 0 nmol/kg 24 nmol/kg Dose (n = 5) (n = 5) Body weight change 3.8 0.41 11 1.6* (% change SEM) Blood glucose AUC during ipGTT 46453 883 26495 1399* (mg/dL min.sup.1) Serum insulin AUC during ipGTT 423 67 144 17* (ng/mL min.sup.1) Fasting blood glucose 142 6.8 87 3.5* (mg/dL SEM) Fasting serum insulin 2.3 0.29 0.26 0.14* (ng/mL SEM) *represents significance (p < 0.05) compared to Vehicle DIO and is calculated by One-Way ANOVA with a Dunnett's Comparison using GraphPad Prizm software (La Jolla, Ca)
[0317] C57BL6 mice 22 weeks old (on high fat diet since 6 weeks of age, Jackson Laboratories 380050; Bar Harbor, Me.) are housed and treated as described above. Animals are randomized by body weight to treatment groups using block randomization. On day 1 of experiment animals and food are weighed and recorded. Animals are separated into three equal groups and started on separate days (data combined) to simplify the logistics of the study. Animals are given a single s.c. injection of the indicated treatment in 20 mM citrate pH 7 on days 1 (start), 4, 7, 10, and 13 of experiment at a volume of 10 ml/kg. Vehicle control animals are injected with a similar volume of this solution. The solutions are kept in sterile capped vials stored at 4 C. for the duration of the study.
[0318] On the 14.sup.th day of study (the morning of the in vivo glucose uptake experiment), DIO mice are placed in clean cages and food is removed for 4 hours. Animals are then anesthetized with 2% isoflurane, and 10 Ci of [.sup.3H]-2-deoxyglucose together with the indicated insulin dose or saline (together in 100 ul of sterile saline) is injected retro-orbitally with a 0.3 ml syringe. The tip of the tail is resected and at 2, 5, 10, 15, 20 and 30 minutes after isotope injection, a drop of blood is taken for measurement of blood glucose in triplicate via Accu-Chek Aviva glucose meter (Roche; Indianapolis, Ind.). These values represent Cp. At the same time points indicated above, an additional 10 l of blood is taken and placed into a Heparin tube, mixed, and placed on ice. Five 5 l of the heparizined blood is then transferred to a clean microcentrifuge tube, and 125 l of 1 M Ba(OH).sub.2 and 125 l of 1 M ZnSO.sub.4 are added sequentially. The tube is then mixed and placed on ice. The tubes are centrifuged at 8000 rcf for 5 minutes. Two hundred al of the supernatant is combined with 5 ml of scintilation fluid and counted in order to determine plasma disintegrations per minute (DPM). These values represent C*p.
[0319] After the final blood sample is collected at 30 minutes, the animals are then euthanized by cervical dislocation and tissues samples (red quadriceps (RQ), white quadriceps (WQ), soleus, extensor digitorum longus (EDL)) are removed and frozen between clamps cooled in liquid nitrogen. Tissues are stored at 80 C. until processed. Tissues are then processed for counting by placing 50-100 mg of dry tissue weight in a 2 ml Lysing Matrix D tube kept on dry ice. One 1 ml of 0.5% Perchloric acid is added to the tube and the tissue is homogenized on setting 6.0 for 30 seconds using Fastprep-24 (MP Bio, Santa Ana, Calif.). The sample is neutralized by the addition of 20 l of 5N KOH mixed and centrifuged at 2000 rcf for 15 minutes at 4 C. Three hundred l of the neutralized supernatant is placed into two separate clean 1.5 ml microcentrifuge tubes. Three hundred l of distilled water is added to the first tube, while 150 l of Barium Hydroxide (Ba(OH).sub.2 and 150 l of Zinc Sulfate (ZnSO.sub.4) are sequentially added to the second tube. The samples are then mixed and incubated for 1 hour on ice. Both sets of tubes are then centrifuged at 3000 rcf for 15 minutes at 4 C. Two hundred ul from each tube is added to a 7 ml scintilation vial and 5 ml of scintilation fluid (Scinti-Safe) is then added. The vials are then counted for DPM in a Beckman Scintillation counter (Beckman-Coulter, Brea Calif.). The difference in the DPM between these samples represents C*m.
[0320] Uptake of 2-deoxyglucose by the respective tissues is calculated by the following formula:
Rg=(C*m)/Cp*/Cpdt
Rg=glucose metabolic rate (mol/100 g/min)
C*m=accumulated 2DG6P (dpm/100 g wet weight) at t=30 min
C*p=plasma 2DG activity (dpm/ml)
Cp is plasma glucose (mM)
[0321] Tables 10 and 11 below show the data corresponding to each of the above measurements. The data are represented as the arithmetic mean with SEM.
[0322] The data in Table 10 demonstrate that subcutaneous administration once every three days of Example 7 for 14 consecutive days results in a significant increase in muscle glucose uptake when stimulated by a submaximal insulin concentration (0.5 U/kg) in RQ, WQ and EDL, while uptake in the soleus muscle is not altered when compared to the corresponding value for the Vehicle DIO mice. In addition, the data in Table 11 indicate that the combined weights of both EDL muscles are significantly increased by subcutaneous administration once every three days of Example 7 for 14 consecutive days.
TABLE-US-00010 TABLE 10 In vivo muscle glucose uptake in male DIO mice treated with the molecule of Example 7. Tissue 2-Deoxyglucose Uptake mol/100 g/min Group Tissue Saline N 0.5 U/kg N 5 U/kg N Vehicle RQ 3.02 0.22 6 6.378 0.7 5 12.38 2.04 6 Example 7 RQ 4.97 0.74 4 13.33 1.36* 12 16.65 1.27 6 Vehicle WQ 2.53 0.24 6 5.66 0.74 6 8.93 0.79 6 Example 7 WQ 5.33 1.06 4 8.20 0.96* 12 10.85 0.33 6 Vehicle EDL 2.88 0.21 6 8.93 1.23 6 12.98 1.12 6 Example 7 EDL 9.05 1.6* 4 14.59 1.09* 12 15.44 1.62 5 Vehicle Soleus 2.27 0.63 6 5.97 1.05 6 13.13 1.66 5 Example 7 Soleus 2.51 0.32 6 7.22 1.40 12 16.51 1.78 6 *represents significance (p < 0.05) compared to Vehicle DIO and is calculated by Two-Way ANOVA with a Dunnett's Comparison using JMP Software (V 5.0; SAS Institute, Cary, NC).
TABLE-US-00011 TABLE 11 Combined EDL and Soleus muscle weights from in vivo muscle glucose uptake experiment in male DIO mice treated with the molecule of Example 7. Tissue Weight (mg) N Vehicle Soleus 20.88 0.87 17 Example 7 Soleus 22.42 0.50 18 Vehicle EDL 24.42 1.06 18 Example 7 EDL 27.18 0.89* 18 *represents significance (p < 0.05) compared to Vehicle DIO and is calculated by One-Way ANOVA with a Dunnett's Comparison using GraphPad Prizm software (La Jolla, Ca).
In Vivo Leptin Receptor Deficient (C57Bl/6db/db) MiceChronic Dose Administration
[0323] In vivo pharmacology studies investigating diabetes efficacy parameters are performed for the molecules of Examples 1, 2, 3, and 4, in the db/db mouse, a commonly used preclinical model of T2D. This mouse strain has a genetic mutation in the leptin receptor resulting in a lack of leptin signaling, an important adipokine for maintenance of food intake (Coleman DL. Obese and diabetes: two mutant genes causing diabetes-obesity syndromes in mice. Diabetologia; 14(3):141-8, (1978)). These mice become obese around 3 to 4 weeks on a normal rodent chow diet. They demonstrate elevations in plasma insulin and blood glucose, and display lowering of blood glucose in response to a number of insulin sensitizing agents. Therefore, the purpose of this study is to assess the ability to improve insulin sensitivity and subsequently lower plasma glucose.
[0324] Male db/db (BKS.Cg-+ Lepr.sup.db/+Lepr.sup.db/OaHlisd) (Harlan Indianapolis) mice 5-6 weeks old are housed 3-4 per cage and maintained on water bottles and 5008 chow (LabDiet; St Louis) for 2 weeks in the vivarium and on a normal light cycle prior to experiment start. Assessment of body weight, food consumption and other serum parameters are determined as explained above in the in vivo DIO Modelchronic dose administration, with the exception of food consumption which is averaged over each cage of animals (3-4 animals per cage; 2 cages per treatment). Percent body weight change is the percent change at end of study from the day 1 body weight.
[0325] On study day 1 mice are lightly restrained and the tail is resected using a clean scalpel. One drop of blood is placed on a glucose test strip and analyzed using an accuCheck blood glucose meter (Roche, Indianapolis). The animals are then randomized based on blood glucose into treatment groups by block randomization. Animals are given a single subcutaneous injection of the indicated treatment (4 day studies) or dosed once every three days of experiment (starting on day 1; 14 and 16 day studies) at a volume of 10 ml/kg in either 20 mM Tris HCl pH 8 or 20 mM citrate pH7. Vehicle control animals are injected with a similar volume of this solution. The solutions are kept in sterile capped vials stored at 4 C. for the duration of the study. Each day of the study (16 day) or each dosing day (14 day study) just prior to dosing animals are bled for determination of blood glucose as described below. Animals are sacrificed by CO.sub.2 asphyxiation after glucose measurement on either day 4, 14 or 16 (based on study length).
[0326] Glucose AUC (from 0, Trapazoid rule) and statistical significance (*=p>0.05 vs. 0 dose: one way ANOVA Dunnett's post hoc) are calculated using GraphPad Prizm software (La Jolla, Ca).
[0327] Tables 12, 13, and 14 below show data corresponding to each of the above measurements. The data are represented as the arithmetic mean with SEM.
[0328] The data in Table 12 demonstrate that Examples 1-3 significantly lower blood glucose AUC measured over 4 days following a single injection. The data in Table 12 and 13 demonstrate that Examples 1-3 induced a significant decrease in body weight after being administered by s.c. administration for 4 (one injection) or 13 (injected on days 1, 4, 7, 10 and 13 of study days). Table 14 below demonstrates that Example 4 significantly reduces both body weight and glucose AUC (dosed on day 1, 4, 7, 10, and 13 of study) in a 16 day study in db/db mice. The significant glucose and body weight lowering effects of Example 4 produced a calculated ED.sub.50 of 13.04 nmol/kg and 30.16 nmol/kg respectively.
TABLE-US-00012 TABLE 12 In vivo chronic dose administration in male db/db mice. 4 day, 1 injection Example 1 Example 2 Example 3 0 mg/kg 0.6 mg/kg 0 mg/kg 0.6 mg/kg 0 mg/kg 0.6 mg/kg Dose (n = 7) (n = 7) (n = 6) (n = 6) (n = 6) (n = 6) Body weight change 0.7 1.2 5 0.22* 4.5 0.42 1.9 0.31* 0.23 0.44 4.7 0.59* (% change SEM) Blood glucose AUC 1331 44 910 41* 1235 59 760 24 1185 120 866 48* (mg/dL day.sup.1 SEM) *represents significance (p < 0.05) compared to Vehicle and is calculated by One-Way ANOVA with a Dunnett's post hoc using GraphPad Prism Software (GraphPad Software, Inc., La Jolla, CA).
TABLE-US-00013 TABLE 13 In vivo chronic dose administration in male db/db mice. 14 day, 5 injections Example 1 Example 2 0 mg/kg 0.3 mg/kg 0.6 mg/kg 0 mg/kg 0.3 mg/kg 0.6 mg/kg Dose (n = 5) (n = 5) (n = 5) (n = 5) (n = 5) (n = 5) Body weight change 14 1.1 11 1.2 2.7 2.2* 14 1.1 6.8 1.3* 9.7 1 (% change SEM) Blood glucose AUC 5413 386 4705 147 4409 321 5413 386 4762 174 4385 144 (mg/dL day.sup.1 SEM) *represents significance (p < 0.05) compared to Vehicle and is calculated by One-Way ANOVA with a Dunnett's post hoc using GraphPad Prism Software (GraphPad Software, Inc., La Jolla, CA).
TABLE-US-00014 TABLE 14 In vivo chronic dose administration in male db/db mice. 16 day, 5 injections Example 4 0 nmol/kg 2.4 nmol/kg 7.2 nmol/kg 24 nmol/kg 72 nmol/kg 144 nmol/kg ED50 Dose (n = 5) (n = 5) (n = 5) (n = 5) (n = 5) (n = 5) nmol/kg Body weight change 9.3 1.1 9.7 2.3 8.1 1.2 6.0 1.7 6.9 1.0 3.4 4.6* Ambiguous (% change SEM) Blood glucose AUC 7592 303 7270 191 6455 484 5945 621* 5746 424* 5143 199* 14.52 (mg/dL day.sup.1 SEM) *represents significance (p < 0.05) compared to Vehicle and is calculated by One-Way ANOVA with a Dunnett's post hoc using GraphPad Prism Software (GraphPad Software, Inc., La Jolla, CA).
[0329] These data demonstrates that the compounds outlined herein are capable of treating type II diabetes.
Chronic Kidney DiseaseHypertensive Nephropathy
[0330] A mouse remnant kidney model (remnant) involving surgical reduction of of the entire renal mass is used as a preclinical model of hypertensive renal disease (Kidney Int. 64(1):350-5, (2003)). This model results in hypertension and modest albuminuria over time and also shows elevations in serum creatinine consistent with decreases in glomerular filtration rate (GFR) and thus represents the later stages of human chronic kidney disease (approximating stage 3).
[0331] Surgical reduction of renal mass (N=40 mice) or sham surgery is performed by Taconic, Inc. in male 129S6 mice at 8-9 weeks of age (obtained by Taconic, Inc.). Randomization into 5 equivalent groups of 8 remnant kidney mice is done at 15 weeks post-surgery by urine albumin to creatinine ratio (ACR) and body weight. Either 0.9% physiological saline with 20 mM citrate (saline control) or different dose levels of the compound of Example 2 (7.2, 24, 72 and 144 nmol/kg) are dosed subcutaneously three times weekly beginning at 16 weeks of age for 2 weeks.
[0332] Study duration is 9 weeks. After 2 weeks of dosing, a necropsy is done on all groups except the 144 nmol/kg group of Example 2 which continues to be monitored for ACR for another 7 weeks to determine the durability of the effects of the compound of Example 2 on urine ACR.
[0333] For all groups except the 144 nmol/kg group of Example 2, the endpoints of the study are body weight, kidney weight, heart weight, serum creatinine and urine ACR. For the 144 nmol/kg group of Example 2, the endpoints are body weight and urine ACR. There are no deaths during the study.
[0334] Body weight is determined at baseline and at termination with a Metler Toledo Balance. The heart and kidney are removed at necropsy and weighed on a Metler Toledo Balance. Blood (500 ul) is collected from the retro-orbital sinus at termination under isoflurane anesthesia. The clotted blood is centrifuged to obtain serum. Serum is analyzed for BUN and creatinine on a Roche Hitachi Modular Analytics P analyzer with reagents from Roche.
[0335] Table 15 below shows data corresponding to the above measurements. Data shown represent the arithmetic meanthe SEM for the parameters listed. All data represent an N value of 8 animals per group.
TABLE-US-00015 TABLE 15 In vivo measurement of body weight, heart weight, kidney weight, serum BUN and creatinine in a chronic kidney disease model of hypertensive nephropathy. 144 7.2 nmol/kg 24 nmol/kg 72 nmol/kg nmol/kg Parameter Sham Saline Example 2 Example 2 Example 2 Example 2 Initial Body nd 26.7 0.8 26.0 0.6 26.5 0.9.sup. 25.7 0.8.sup. 26.3 0.8.sup. Weight (g) Final Body 27.2 0.7 27.9 0.7 25.5 1.2 24.0 0.5 a 24.8 0.4 .sup.a 24.5 0.7 .sup.a Weight (g) Heart .sup.142 7 .sup.a 195 22 172 11 142 4 .sup.a 151 4 .sup.a nd Weight (mg) Kidney .sup.158 4 .sup.a 206 6 204 12 188 8.sup. 195 6.sub. nd Weight (mg) Serum BUN .sup.33 3 .sup.a 57 4 49 3 44 1 .sup.a 46 3 .sup.a nd (mg/dL) Serum .sup.0.128 0.004 .sup.a 0.261 0.018 0.240 0.010 0.213 0.008 .sup.a 0.228 0.014.sup. nd Creatinine (mg/dL) .sup.a denotes significant differences relative to the saline control group. nddenotes not determined.
[0336] The data in Table 15 demonstrate that the disease control shows significant increases in heart weight, kidney weight, serum BUN and serum creatinine relative to the sham control due to chronic kidney disease associated with surgically reduced renal mass. The data in Table 15 demonstrate that the compound of Example 2 significantly reduces body weight at all dose levels except the 7.2 nmol/kg relative to the saline control. The compound of Example 2 also significantly reduces heart weight at the 24 and 72 nmol/kg dose levels with no effect on kidney weight compared to the saline control group. The compound of Example 2 also significantly reduces serum BUN at the 24 and 72 nmol/kg dose levels and serum creatinine at the 24 nmol/kg dose level compared to the saline control group.
[0337] A spot urine collection to measure urine ACR is performed at baseline (1), 1 and 2 weeks for the saline and all the dose levels of the compound of Example 2. Spot urine collections are also collected for the 144 nmol/kg dose level of Example 2 at 4, 6 and 9 weeks. Spot urine collections are done by placing mice on top of a 96 well polypropylene microplate to collect their urine over a 2 hr time period. The collected urine is placed on ice, centrifuged and subjected to albumin and creatinine analysis.
[0338] Urine albumin and creatinine are determined on a Roche Hitachi Modular Analytics P analyzer. Urine creatinine is determined with the Creatinine Plus reagent by Roche. For urine albumin, the Roche Microalbumin assay is modified to adapt the calibration curve for measuring urine albumin in mice. The assay limit of detection for albumin in urine is 4.9 mcg per ml. Sham mice do not have detectable albumin in the urine.
[0339] Table 16 shows data corresponding to measurements of urine ACR. The data shown are the arithmetic meanthe SEM at each time point. There are 8 mice per group.
TABLE-US-00016 TABLE 16 In vivo measurement of Albumin to Creatinine Ratio (ACR) in a chronic kidney disease model of hypertensive nephropathy. ACR (mcg/mg) 1 week 1 week 2 week 4 weeks 6 weeks 9 weeks Saline 2205 411 1824 480 1866 720.sup. nd nd nd Example 2 2273 576 1215 321 630 200 .sup.a nd nd nd 7.2 nmol/kg Example 2 2228 410 .sup.636 173 .sup.a 246 50 .sup.a nd nd nd 24 nmol/kg Example 2 2141 416 1053 230 304 68 .sup.a nd nd nd 72 nmol/kg Example 2 2271 500 889 218 336 85 .sup.a 266 52 328 136 834 412 144 nmol/kg .sup.a denotes significant differences relative to the saline control group. nddenotes not determined.
[0340] The data in Table 16 demonstrate that the compound of Example 2 significantly reduces urine ACR at the 24 nmol/kg dose level as early as 1 week of dosing and at all dose levels relative to the saline control after 2 weeks of dosing in the remnant kidney model. The data in Table 16 further demonstrate there is durability in the urine ACR lowering effect with the compound of Example 2 at 144 nmol/kg and that the reduction in ACR may not simply be hemodynamic in origin as the effect persists out to 7 weeks after the dosing of the compound of Example 2 is stopped.
[0341] Overall, these data demonstrate that the compound of Example 2 improves renal function under hypertensive conditions associated with chronic kidney disease with reductions in serum BUN, serum creatinine and urine ACR relative to the untreated controls.
[0342] All data are analyzed with JMP v.8.0 software (SAS Institute). Statistical analysis of albuminuria (ACR) was done by the following: 1) data were analyzed on log scale to stabilize variance over different treatment groups 2) data analysis was carried out in JMP v.8.0 using a ANOVA and a Dunnett's t test at each time point. All other data were evaluated by ANOVA with log transformed data if the data were skewed and a Students unpaired t test. Statistical outliers were removed prior to analysis. A P value of <0.05 was considered statistically significant.
[0343] This data demonstrate that the compounds outlined herein are capable of treating chronic kidney disease caused by hypertensive nephropathy.
Chronic Kidney DiseaseHypertensive Nephropathy
[0344] A mouse remnant kidney model (remnant) involving surgical reduction of of the entire renal mass is used as a preclinical model of hypertensive renal disease (Kidney Int. 64(1):350-5, (2003)). This model results in hypertension and modest albuminuria over time and also shows elevations in serum creatinine consistent with decreases in glomerular filtration rate (GFR) and thus represents the later stages of human chronic kidney disease (approximating stage 3).
[0345] Surgical reduction of renal mass (N=32 mice) (obtained by Taconic, Inc.) is performed by Taconic, Inc. in male 129S6 mice at 9-10 weeks of age. Randomization into 4 equivalent groups of 8 remnant kidney mice is done at 17 weeks post-surgery by urine albumin to creatinine ratio (ACR) and body weight. Either 0.9% physiological saline for injection (saline control) or different dose levels of Example 4 (2.6, 7.2 and 24 nmol/kg, Lot # BCA-BE03935-019) are dosed subcutaneously three times weekly beginning at 18 weeks post-surgery.
[0346] Study duration is 8 weeks. An intermittent dosing strategy is used as Example 4 is administered only during the first two weeks and then again during the fourth week of the study, thus there are periods of time during the study in which there is no exposure of the animals to Example 4. This is done to determine if effects of the compound of Example 4 on albuminuria are simply hemodynamic driven or if there are longer lasting effects on kidney function.
[0347] For all groups, the endpoints for the study are body weight, kidney weight, heart weight, albuminuria, serum creatinine and renal pathology scores for pelvic dilation, tubular changes, tubular protein, tubular regeneration, glomerular changes, interstitial inflammation, interstitial fibrosis, Masson's score and a PAS score. There is one death in the 2.6 nmol/kg dose group of Example 4 during the study.
[0348] Body weight is determined at baseline and at termination with a Metler Toledo Balance.
[0349] The heart and kidney are removed at necropsy and weighed on a Metler Toledo Balance. Blood (500 ul) is collected from the retro-orbital sinus at termination under isoflurane anesthesia. The clotted blood is centrifuged to obtain serum. Serum is analyzed for creatinine on a Roche Hitachi Modular Analytics P analyzer with reagents from Roche.
[0350] Table 17 below shows data corresponding to the above measurements. Data shown represent the arithmetic meanthe SEM for the parameters listed. All data represent an N value of 7-8 animals per group.
TABLE-US-00017 TABLE 17 In vivo measurement of body weight, heart weight, kidney weight and serum creatinine in a chronic kidney disease model of hypertensive nephropathy. 2.6 nmol/kg 7.2 nmol/kg 24 nmol/kg Parameter Saline Example 4 Example 4 Example 4 Initial Body 29.7 0.8 32.3 0.9 30.1 1.0 30.6 0.6 Weight (g) Final Body 30.9 0.8 31.8 1.1 29.8 1.0 31.6 0.6 Weight (g) Heart Weight 239 17 203 8 203 10 205 8 (mg) Kidney 289 9 280 13 277 14 310 8 Weight (mg) Serum 0.224 0.010 0.220 0.013 0.201 0.008 .sup. 0.188 0.013 .sup.a Creatinine (mg/dL) .sup.a denotes significant differences relative to the saline control group
[0351] The data in Table 17 demonstrate that that the compound of Example 4 shows no significant effects on body weight, heart weight or kidney weight, although there is a trend for lower heart weight with the compound of Example 4. The compound of Example 4 at the 24 nmol/kg dose level significantly reduces serum creatinine relative to the saline group.
Measurement of Albuminuria
[0352] A spot urine collection to measure urine albumin to creatinine ratio (ACR) is performed at baseline, 1, 2, 4, 6 and 8 weeks of dosing for the saline and all of the Example 4 dose groups. Spot urine collections are done by placing mice on top of a 96 well polypropylene microplate to collect their urine over a 2 hr time period. The collected urine is placed on ice, centrifuged and subjected to albumin and creatinine analysis.
[0353] Urine albumin and creatinine are determined on a Roche Hitachi Modular Analytics P analyzer. Urine creatinine is determined with the Creatinine Plus reagent by Roche. For urine albumin, the Roche Microalbumin assay is modified to adapt the calibration curve for measuring urine albumin in mice.
[0354] Table 18 shows data corresponding to measurements of albuminuria. The data shown are the arithmetic meanthe SEM at each time point. There are 9-10 mice per group.
TABLE-US-00018 TABLE 18 In vivo measurement of Albumin to Creatinine Ratio (ACR) in a chronic kidney disease model of hypertensive nephropathy for 8 weeks. ACR (mcg/mg) 1 week 1 week 2 week 4 weeks 6 weeks 8 weeks Saline 1586 242 909 232 1296 437.sup. 1992 585.sup. 2415 732.sup. 2902 1236.sup. Example 4 @ 2.6 nmol/kg 1617 429 618 147 254 98 .sup.a 245 121 .sup.a 358 143 .sup.a 687 108.sup. Example 4 @ 7.2 nmol/kg 1599 298 540 188 206 41 .sup.a 176 110 .sup.a 169 17 .sup.a 479 87 .sup.a Example 4 @ 24 nmol/kg 1792 728 415 77 123 35 .sup.a 73 22 .sup.a 175 73 .sup.a 278 161 .sup.a .sup.a denotes significant differences relative to the saline control group.
[0355] The data in Table 18 demonstrate that the compound of Example 4 significantly reduces albuminuria at all dose levels relative to the saline control in the remnant kidney model. The data in Table 18 further demonstrate there is a dose dependent effect on albuminuria relative to the saline control group as early as 1 week of dosing with the compound of Example 4 that results in a return of albuminuria to near normal values after only 2 weeks of dosing at the highest dose level of the compound of Example 4. The data further demonstrate that the effect of the compound of Example 4 on albuminuria may not simply be hemodynamic in origin as the effect persists at the 6 and 8 week time points when the compound of Example 4 is no longer present based on the pharmacokinetic properties of the compound of Example 4.
[0356] Overall, these data demonstrate that the compound of Example 4 improves renal function under hypertensive conditions with reductions in serum creatinine and albuminuria that are associated with chronic kidney disease.
Renal Pathology
[0357] Remnant kidneys are removed at study termination, fixed in formalin and processed for paraffin sectioning according to standard methodology. Sections of kidney are evaluated for renal lesions by a board certified pathologist. Tubular protein, tubular regeneration, glomerular sclerosis, peri-glomerular fibrosis/inflammation, interstitial inflammation and interstitial fibrosis are semi-quantitatively scored using the following scale: none (0), minimal (1), slight (2), moderate (3), marked (4) and severe (5). Pathology scores are obtained with H&E, Masson's Trichrome and PAS stained sections.
[0358] Table 19 shows data corresponding to measurements of renal pathology. The data shown are the arithmetic meanthe SEM for each parameter. There are 7-8 mice per group.
TABLE-US-00019 TABLE 19 In vivo measurement of renal pathology in a hypertensive chronic kidney disease model. Example 4 Example 4 Example 4 Parameter Saline 2.6 nmol/kg 7.2 nmol/kg 24 nmol/kg Tubular protein 1.3 0.3 0.4 0.2 .sup.a 0.1 0.1 .sup.a 0.0 0.0 .sup.a Tubular regeneration 1.4 0.3 0.9 0.2 .sup. 0.6 0.2 .sup.a 0.3 0.2 .sup.a Glomerular sclerosis 1.3 0.4 0.4 0.2 .sup. 0.5 0.3 .sup. 0.3 0.2 .sup.a Peri-glomerular 1.1 0.4 0.3 0.2 .sup. 0.4 0.2 .sup. 0.3 0.2 .sup. fibrosis/inflammation Interstitial Fibrosis 1.6 0.3 1.0 0.0 .sup.a 0.9 0.1 .sup.a 0.8 0.2 .sup.a Interstitial 1.3 0.4 0.7 0.2 .sup. 0.6 0.2 .sup. 0.4 0.2 .sup.a Inflammation .sup.a denotes significant differences relative to the saline control group.
[0359] The data in Table 19 demonstrate that the compound of Example 4 significantly reduces renal pathology at all dose levels relative to the saline control for tubular protein and interstitial fibrosis in the remnant kidney model. The data in Table 19 further demonstrate that the compound of Example 4 shows significant reductions in tubular regeneration, glomerular sclerosis, and interstitial inflammation at the highest dose level relative to the saline control group. These data demonstrate that the improvement in renal function with the compound of Example 4 in this model is accompanied by significant improvements in renal structure with reductions in renal pathology due to hypertensive renal disease.
Statistical Methods
[0360] Pathology data are statistically evaluated with R software by fitting an ordered logit model to the categorical scores, and then comparing the differences between different treatment groups. Statistical analysis of albuminuria (ACR) is done with R software by the following: 1) data are analyzed on log scale to stabilize variance over different treatment groups, 2) data analysis is carried out using a mixed model with treatment group, time and their interactions as model terms, plus baseline ACR is included as covariate, 3) observations from each animal at different times are treated as repeated measurements using a CS covariance structure and 4) the test p values are not adjusted for multiple testing. All other data are evaluated by ANOVA with log transformed data and a Students unpaired t test with JMP v.8.0 software (SAS Institute). Statistical outliers were removed prior to analysis. A P value of <0.05 was considered statistically significant.
[0361] This data demonstrate that the compounds outlined herein are capable of treating chronic kidney disease caused by hypertensive nephropathy.
The Effects of Long Acting Urocortin 2 on Blood Pressure Regulation in SHR Model
[0362] Male spontaneously hypertensive rats (SHR/NCrl, Charles River Laboratories, Inc.) were implanted with Data Science International transmitters (TA11PA-C40) for blood pressure and heart rate data collection. All SHR were allowed to recover from the surgical implantation procedure for at least 2 weeks prior to the initiation of the experiments. During the monitoring phase (Day1 to Day21), cardiovascular parameters (mean arterial, systolic and diastolic pressure and heart rate) were continuously monitored via the radiotransmitter in conscious, freely moving and undisturbed SHR in their individual home cages. The telemetry data from the DSI telemetry implants were then converted to a calibrated analog signal which inputs to a commercially produced data acquisition and analysis system (PONEMAH). All rats were individually housed in a temperature and humidity controlled room and are maintained on a 12 hour light/dark cycle.
[0363] SHR were randomized to groups according to mean arterial blood pressure (MAP) collected 7 days prior to dosing started. Rats were administered with vehicle (20 mM Tris-HCl buffer, pH8.0) or one of the 4 dose levels (2.4, 7.2, 24, 72 nmol/kg) of the compound of Example 4 twice weekly for 2 weeks with subcutaneous injection (injections on day 1, 4, 8 and 11). Blood pressure data were collected for one additional week to evaluate the blood pressure responses after withdrawal of Example 4 treatment.
[0364] The compound of Example 4 dose-dependently reduced blood pressure (Table 21, 22). Maximal MAP reduction was achieved at 24 hours post dosing. Blood pressure lowering effects of the compound of Example 4 were diminished with repeated dosing as demonstrated in the table comparing MAP after 1.sup.st on day 1 and 4.sup.th injection on day 11. After withdrawal of the compound of Example 4, blood pressure levels in all treatment groups were recovered and were not different from vehicle group.
[0365] Table 20 below shows the AUC results with P values for time periods (1-68 hrs) and (241-332 hrs).
TABLE-US-00020 TABLE 21 MAP after 1.sup.st or 4.sup.th injections of vehicle or the compound of Example 4. N = 7-8/group. Hours indicate time post respective injection on day 1 or day 11. 1-24 hrs 26-48 hrs 50-68 hrs Treatment MEAN s.e. MEAN s.e. MEAN s.e. MAP post injection on day 1 Control 149.9 3.4 149.3 2.4 147.3 3.3 72 nmol/kg 128.6 2.3 130.4 3.5 143.1 4.0 24 nmol/kg 137.6 3.3 131.8 2.5 137.2 2.3 7.2 nmol/kg 140.1 4.2 140.6 3.4 144.3 4.0 2.4 nmol/kg 149.0 2.5 147.6 3.1 148.6 2.8 MAP (mean sem) post injection on day 11 Control 150.0 3.7 151.4 2.8 149.6 2.5 72 nmol/kg 139.3 2.6 142.3 1.9 145.0 2.7 24 nmol/kg 142.9 2.3 145.1 2.0 145.1 1.4 7.2 nmol/kg 146.2 3.8 148.1 3.8 148.8 4.6 2.4 nmol/kg 151.4 2.6 153.0 2.6 151.7 3.1
TABLE-US-00021 TABLE 22 1-way ANCOVA for AUC over 68 hours following the 1st injection (Day 1) or the 4th injection (Day 11), with baseline AUC (over 22 hours) as the covariate and comparison of each treatment to vehicle by Dunnett's test. Difference from Control LS Mean adjusted Day Treatment Estimate s.e. Estimate s.e. p-value 1 (1-68 Control 10045.9 102.28 hrs) 72 8829.7 109.22 1216.2 150.1 <.0001 nmol/kg 24 9180.3 109.89 865.6 149.27 <.0001 nmol/kg 7.2 9313.8 103.17 732.1 146.26 <.0001 nmol/kg 2.4 9935.2 101.91 110.6 144.29 0.8613 nmol/kg 11 (1-68 Control 10141.8 95.82 hrs) 72 9432.6 102.32 709.3 140.62 <.0001 nmol/kg 24 9778.3 102.95 363.5 139.84 0.0472 nmol/kg 7.2 9732.8 96.66 409 137.03 0.019 nmol/kg 2.4 10180.7 95.47 38.9 135.18 0.9954 nmol/kg
[0366] The data in Tables 20-22 and statistical results in Table 20 demonstrate that the compound of Example 4 dose-dependently reduces blood pressure after the first injection. Maximal MAP reduction is achieved at 24 hours post dose. After withdrawal of the compound of Example 4, MAP in all treatment groups recovers and is not different from the vehicle group at 336 hrs.
[0367] MAP data are statistically evaluated with SAS software by 1-way ANCOVA for AUC over 68 hours following the first dose (Day 1), and over 92 hours following the last dose (Day 11).
Chronic Kidney DiseaseDiabetic Nephropathy
[0368] The uninephrectomized db/db adeno-associated viral (AAV) renin model represents a progressive model of diabetic kidney disease with hypertension driven by an AAV renin transgene (Am J Physiol Regul Integr Comp Physiol. 309(5):R467-74, (2015)). This model exhibits overt albuminuria that progressively increases over time and also shows decreases in glomerular filtration rate (GFR) and thus represents the later stages of human diabetic nephropathy (approximating stage 3-4).
[0369] The uninephrectomy (UniNx) surgery on female db/db mice on a C57BLKS/J background (obtained from Harlan Laboratories) is performed by Harlan Laboratories at 4 weeks of age with removal of the right kidney to accelerate the diabetic kidney disease. Animals are received at 5 weeks of age and housed in micro-isolator cages at 3 mice per cage and are on a 12 hour light/dark cycle. All db/db mice are fed ad libitum with Purina special diet 5008 and allowed free access to autoclaved water.
[0370] Mice are acclimated for 7 weeks prior to administration of AAV Renin (510.sup.9 GC) intravenously by the retro-orbital sinus to induce persistent hypertension. Randomization by urine albumin to creatinine ratio (ACR), blood glucose and body weight is done at 15 weeks of age (a point at which renal disease and pathology are established in this model based on observations) into 2 groups of 12 saline control mice and 33 mice to receive Lisinopril treatment.
[0371] Dosing with Lisinopril (30 mg/L) begins at 16 weeks of age. After 2 weeks of Lisinopril treatment, the 33 mice are randomized by urine ACR, blood glucose and body weight into 4 groups (one group of 9 mice and 3 groups of 8 mice).
[0372] In the 4 groups of UniNx db/db AAV renin mice receiving Lisinopril treatment, either 0.9% physiological saline for injection (saline control N=9) or different dose levels of Example 4 (7.2, 24 or 72 nmol/kg, N=8 per dose level) are dosed at 0.2 mL s.c. per injection beginning at 18 weeks of age and continued 3 times weekly for 12 weeks. Albumin and creatinine are measured in urine with a Roche Hitachi Modular Analytics P analyzer with Roche reagents for detection of albumin and creatinine.
[0373] There were 6 deaths in the saline disease control group, 2 deaths in the Lisinopril plus saline group, 1 death in the Lisinopril plus 7.2 nmol/kg Example 4 group, 3 deaths in the Lisinopril plus 24 nmol/kg Example 4 group and 3 deaths in the Lisinopril plus 72 nmol/kg Example 4 group over the course of the study.
[0374] For all the groups, the parameters measured are body weight, kidney weight, heart weight, urine albumin to creatinine ratio, serum creatinine and renal pathology scores for mesangial matrix expansion, glomerular fibrosis, tubular regeneration, interstitial inflammation and interstitial fibrosis.
[0375] At 15 and 27 weeks of age, blood (30 to 50 uL) from all the UniNx db/db AAV Renin mice is obtained from the tail vein and dropped onto a Precision PCx blood glucose sensor electrode strip (Abbott Laboratories) for blood glucose determination with a MediSense Precision PCx glucometer (Abbott Laboratories). Blood glucose data is used to block the UniNx db/db mice into equivalent groups. Body weight is determined at baseline and at termination with a Metler Toledo Balance. The heart and kidney are removed at necropsy and weighed on a Metler Toledo Balance. Blood (500 ul) is collected from the retro-orbital sinus at termination under isoflurane anesthesia. The clotted blood is centrifuged to obtain serum. Serum is analyzed for creatinine on a Roche Hitachi Modular Analytics P analyzer with reagents from Roche.
[0376] Table 23 below shows data corresponding to measurements of body weight, blood glucose, kidney weight, heart weight and serum creatinine. Data shown represent the arithmetic meanthe SEM for the parameters listed. All data represent an N value of 5-8 animals per group except for the saline control group (N=6-12).
TABLE-US-00022 TABLE 23 In vivo measurement of body weight, blood glucose, kidney weight, heart weight and serum creatinine in a chronic kidney disease diabetic nephropathy model after 12 weeks. Lisinopril Lisinopril Lisinopril plus 7.2 plus 24 plus 72 Lisinopril nmol/kg nmol/kg nmol/kg Parameter Saline plus Saline Example 4 Example 4 Example 4 Initial Body 62.3 0.9 61.6 2.3 66.7 1.2 62.5 1.2 62.0 1.8 Weight (g) Final Body 56.0 4.6 61.8 4.9 68.8 2.5 .sup.a 59.1 2.3 59.4 4.3 Weight (g) Initial Blood 339 29 444 48 333 38 461 19 455 26 Glucose (mg/dL) Final Blood 202 22 .sup.b 466 71 222 15 .sup.b 362 55 260 81 .sup.b Glucose (mg/dL) Kidney 394 22 392 17 371 18 345 4 319 13 .sup.ab Weight (mgs) Heart Weight 326 32 227 26 .sup.a 278 12 231 17 .sup.a 255 13 .sup.a (mgs) Serum 0.188 0.020 0.130 0.070 .sup.a 0.141 0.009 0.118 0.010 .sup.a 0.348 0.144 .sup.b Creatinine (mg/dL) .sup.a denotes significant differences relative to the saline control group. .sup.b denotes significant differences relative to the Lisinopril alone group.
[0377] The data in Table 23 demonstrate that that the saline control group loses weight during the course of the study due to the effects of the renin transgene, while addition of Lisinopril prevents this effect on body weight. The compound of Example 4 at the 7.2 nmol/kg dose level added to Lisinopril significantly increases body weight relative to the saline control group. The loss of body weight in the saline control group also leads to a reduction in blood glucose at the end of the study while Lisinopril significantly prevents this effect on blood glucose. The addition of Example 4 at the 7.2 and 72 nmol/kg dose levels to Lisinopril results in a significant reduction in blood glucose relative to the Lisinopril alone group. Lisinopril alone has no effect on kidney weight relative to the saline control group, while addition of the compound of Example 4 at the dose level of 72 nmol/kg to Lisinopril results in a significant reduction of kidney weight relative to the saline control group and the Lisinopril alone group. The Lisinopril treatment alone as well as addition of the compound of Example 4 (24 and 72 nmol/kg) to Lisinopril results in a significant reduction of heart weight relative to the saline control group. The addition of the compound of Example 4 at the 24 nmol/kg dose level to Lisinopril as well as Lisinopril alone results in a significant reduction of serum creatinine relative to the saline control group. The addition of the compound of Example 4 at the 72 nmol/kg dose level to Lisinopril results in a significant increase in serum creatinine relative to the Lisinopril alone group.
[0378] Urine is collected by a spot collection method to collect urine over a 2-4 hr time period. An individual mouse is placed on top of a 96 well polypropylene microplate and then covered by a Plexiglas chamber with holes for breathing but no access to food or water. At the end of the time period, the urine is removed from the plate with a micropipette and placed on ice, centrifuged and subjected to albumin and creatinine analysis. Urine albumin, creatinine and glucose are determined on a Roche Hitachi Modular Analytics P analyzer. Urine creatinine is determined with the Creatinine Plus reagent by Roche. For urine albumin, the Roche Microalbumin assay is modified to adapt the calibration curve for measuring urine albumin in mice. Albuminuria was defined as albumin to creatinine ratio (ACR).
[0379] Table 24 below shows data corresponding to measurements of albuminuria. The data shown are the arithmetic meanthe SEM at each time point given as weeks of treatment with the compound of Example 4. There were 6-8 mice per group over the time points except for the saline group (N=5-12).
TABLE-US-00023 TABLE 24 In vivo measurement of Albumin to Creatinine Ratio (ACR) in a chronic kidney disease diabetic nephropathy model for 12 weeks. Weeks of Lisinopril Lisinopril Lisinopril treatment plus 7.2 plus 24 plus 72 with Lisinopril nmol/kg nmol/kg nmol/kg Example 4) Saline plus Saline Example 4 Example 4 Example 4 0 25385 3804 .sup. 15203 2835 .sup. 15724 2826 14329 2306 15086 2722 1 43984 6671 .sup. 16491 3362 .sup. 16336 2761 .sup.a 13219 2137 .sup.a 14706 2352 .sup.a 2 51871 9107 .sup. 16160 4162 .sup.a 7095 1170 .sup.ab 3612 218 .sup.ab 5918 741 .sup.ab 3 47313 8939 .sup. 13069 3295 .sup.a 9745 1416 .sup.a 9735 2066 .sup.a 9098 1359 .sup.a 6 41647 5750 .sup. 11584 3132 .sup.a 4164 1271 .sup.ab 3880 713 .sup.ab 4783 769 .sup.ab 8 49725 5663 .sup. 12484 4626 .sup.a 19633 8562 .sup.a 11852 7132 .sup.a 6156 1165 .sup.a 10 63009 8448 .sup. 20429 4998 .sup.a 13192 5454 .sup.a 5029 1473 .sup.ab 7935 1029 .sup.ab 12 38176 6750 .sup.c 19075 6268 .sup.a 26527 8454 .sup.a 7372 3934 .sup.abc 6257 1649 .sup.abc .sup.a denotes significant differences relative to the saline control group. .sup.b denotes significant differences relative to the Lisinopril plus saline group. .sup.c denotes significant differences from Week 0 to Week 12 within the group.
[0380] The data in Table 24 demonstrate there is significant albuminuria in all the UniNx db/db AAV Renin groups at the time that the compound of Example 4 is initiated (week 0). The data in Table 24 show that Lisinopril treatment for 2 weeks prior to the dosing of the compound of Example 4 shows a trend for lower albuminuria relative to the saline control group at week 0. An overall statistical comparison of all ACR values shows that all of the Lisinopril groups are significantly improved for ACR relative to the saline group. The compound of Example 4 added to Lisinopril overall shows a further significant ACR lowering effect relative to Lisinopril alone at the 24 and 72 nmol/kg dose levels. The compound of Example 4 at the 24 and 72 nmol/kg dose levels also shows a significant reduction in ACR at week 12 relative to the respective baseline values at week 0, while the saline group shows a significant increase over this time and Lisinopril alone has no significant effect.
[0381] Measurement of Renal Pathology
[0382] Kidneys are removed at study termination, fixed in formalin and processed for paraffin sectioning according to standard methodology. Sections of kidney are evaluated for renal lesions by a board certified pathologist. The major renal pathologies in this diabetic model are increases in glomerular and interstitial fibrosis as well as increases in interstitial inflammation. Renal pathologies are semi-quantitatively scored using the following scale: none (0), minimal (1), slight (2), moderate (3), marked (4) and severe (5). Pathology scores are obtained using H&E, Masson's Trichrome and PAS stained sections.
[0383] Table 25 below shows data corresponding to measurements of renal pathology. Data shown represent the arithmetic meanthe SEM for the parameters listed. All data represent an N value of 4-7 animals per group.
TABLE-US-00024 TABLE 25 In vivo measurement of renal pathology in a chronic kidney disease diabetic nephropathy model after 12 weeks. Lisinopril plus Lisinopril plus Lisinopril plus Lisinopril 7.2 nmol/kg 24 nmol/kg 72 nmol/kg Parameter Saline plus Saline Example 4 Example 4 Example 4 Mesangial 3.8 0.3 2.1 0.1 .sup.a 1.2 0.2 .sup.ab 1.4 0.2 .sup.ab 1.6 0.2 .sup.a Matrix Expansion Glomerular 2.8 0.3 1.4 0.2 .sup.a 1.3 0.2 .sup.a 1.0 0.0 .sup.a 1.0 0.3 .sup.a Fibrosis Tubular 3.3 0.5 2.0 0.2 .sup.a 1.0 0.0 .sup.ab 1.0 0.3 .sup.ab 1.0 0.3 .sup.ab Regeneration Interstitial 2.3 0.3 1.1 0.3 .sup.a 0.3 0.2 .sup.ab 0.2 0.2 .sup.ab 0.2 0.2 .sup.ab Inflammation Interstitial 2.5 0.3 2.0 0.3 .sup. 1.0 0.0 .sup.ab 1.2 0.2 .sup.a 1.2 0.2 .sup.a Fibrosis .sup.a denotes significant differences relative to the saline control group. .sup.b denotes significant differences relative to the Lisinopril plus saline group.
[0384] The data in Table 25 demonstrate that Lisinopril plus saline treatment significantly reduces all of the renal pathology parameters relative to the saline control group with the exception of interstitial fibrosis. The data in Table 25 also demonstrate that Lisinopril plus the compound of Example 4 significantly reduces renal pathology for all the parameters relative to the saline control group. The data in Table 25 further demonstrate that the Lisinopril plus the compound of Example 4 significantly reduces renal pathology for mesangial matrix expansion, tubular regeneration, interstitial inflammation and interstitial fibrosis at a minimum of at least one dose level of Example 4 relative to the Lisinopril plus saline group.
[0385] Overall, these data demonstrate that the improvement in renal function obtained with Lisinopril plus the compound of Example 4 treatment in this diabetic nephropathy model is accompanied by significant improvements in renal structure with reductions in major renal pathologies due to diabetic hypertensive kidney disease. These data demonstrate that the compound of Example 4 is capable of treating chronic kidney disease caused by diabetes and hypertension.
[0386] Pathology data are statistically evaluated with R software by fitting an ordered logit model to the categorical scores, and then comparing the differences between different treatment groups. Statistical analysis of albuminuria (ACR) is done with R software by the following: 1) data are analyzed on log scale to stabilize variance over different treatment groups, 2) data analysis is carried out using a mixed model with treatment group, time and their interactions as model terms, plus baseline ACR is included as covariate, 3) observations from each animal at different times are treated as repeated measurements using a CS covariance structure and 4) the test p values are not adjusted for multiple testing. All other data are evaluated by ANOVA with log transformed data and a Students unpaired t test with JMP v.8.0 software (SAS Institute). Statistical outliers were removed prior to analysis. A P value of <0.05 was considered statistically significant.
[0387] This data demonstrate that the compounds outlined herein are capable of treating chronic kidney disease caused by hypertensive nephropathy.
[0388] As noted above, Table 1 provides in vitro activity for hCRHR2b for the compounds of Examples 1-7 (as well as this data for hUCN1 and hUCN2). Table 26 below provides the hCRHR2b in a cAMP assay for the compounds of Example 9. This data further shows that such compounds have CRHR2 agonist activity in a cAMP assay.
TABLE-US-00025 TABLE 26 Compound hCRHR2b No. Average EC50 (nM) 21 5.25 (n = 2) 22 1.20 (n = 2) 23 17.9 (n = 2) 24 25.3 (n = 2) 25 63.5 (n = 2) 26 15.62 (n = 2) 27 31.54 (n = 2) 28 83.2 (n = 2) 29 64.7 (n = 2) 30 12.4 (n = 2) 31 3.20 (n = 2) 32 9.18 (n = 2) 33 8.68 (n = 2) 34 4.54 (n = 2) 35 404 (n = 2) 36 330.9 (n = 2) 37 24.09 (n = 2) 38 2.33 (n = 2) 39 26.99 (n = 2) 40 55.86 (n = 4) 41 207.0 (n = 4) 42 500.2 (n = 2) 43 12.56 (n = 4) 44 13.37 (n = 2) 45 27.69 (n = 4) 46 11.67 (n = 4) 47 4.56 (n = 5) 48 3.61 (n = 5) 49 2.86 (n = 2) 50 3.56 (n = 2) 51 2.42 (n = 2) 52 1.16 (n = 2) 53 4.01 (n = 2) 54 4.26 (n = 2) 55 1.51 (n = 2) 56 1.17 (n = 3) 57 3.65 (n = 2) 58 3.79 (n = 2) 59 2.62 (n = 2) 60 2.55 (n = 4) 61 2.50 (n = 2) 62 4.50 (n = 2) 63 1.30 (n = 2) 64 1.63 (n = 2) 65 1.24 (n = 2) 66 1.45 (n = 2)
NUMBERED EMBODIMENTS
[0389] 1. A compound of the Formula:
X.sub.1IVX.sub.2SLDVPIGLLQILX.sub.3EQEKQEKEKQQAK*TNAX.sub.4ILAQV-NH.sub.2
[0390] wherein X.sub.1 denotes that the I residue is modified by either acetylation or methylation at the N-terminus, wherein X.sub.2 is L or T, wherein X.sub.3 is L or I, wherein X.sub.4 is Q or E, and wherein K* at position 29 is modified through conjugation to the epsilon-amino group of the K-side chain with a group of the formula X.sub.5X.sub.6, wherein
[0391] X.sub.5 is selected from the group consisting of: [0392] one to four amino acids, one to four ([2-(2-Amino-ethoxy)-ethoxy]-acetyl) moieties, and combinations of one to four amino acids and one to four ([2-(2-Amino-ethoxy)-ethoxy]-acetyl) moieties,
[0393] X.sub.6 is a C.sub.14-C.sub.24 fatty acid (SEQ ID NO:16),
[0394] or a pharmaceutically acceptable salt thereof.
[0395] 2. The compound or salt of numbered embodiment 1, wherein X.sub.5 is selected from the group consisting of: one to four E or E amino acids, one to four ([2-(2-Amino-ethoxy)-ethoxy]-acetyl) moieties, and combinations of one to four E or E amino acids and one to four ([2-(2-Amino-ethoxy)-ethoxy]-acetyl) moieties.
[0396] 3. The compound or salt of numbered embodiment 2, wherein X.sub.5 is a combination of one to four E or E amino acids and one to four ([2-(2-Amino-ethoxy)-ethoxy]-acetyl) moieties.
[0397] 4. The compound or salt of numbered embodiment 3, wherein X.sub.5 is a combination of two to four E amino acids and one to four ([2-(2-Amino-ethoxy)-ethoxy]-acetyl) moieties.
[0398] 5. The compound or salt of numbered embodiments 1 to 4, wherein X.sub.5 is a combination of two E amino acids and two ([2-(2-Amino-ethoxy)-ethoxy]-acetyl) moieties.
[0399] 6. The compound or salt of any one of numbered embodiments 1 to 5, wherein X.sub.6 is a straight chain fatty acid of the formula CO(CH.sub.2).sub.xCO.sub.2H, wherein x is 16, 18, or 20.
[0400] 7. The compound or salt of any one of numbered embodiments 1 to 6, wherein group of the formula X.sub.5X.sub.6 is ([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-(E).sub.2-CO(CH.sub.2).sub.xCO.sub.2H where x is 16 or 18.
[0401] 8. The compound or salt according to any one of numbered embodiments 1 to 7 wherein the terminal amino acid is amidated as a C-terminal primary amide.
[0402] 9. The compound or salt according to any one of numbered embodiments 1 to 8 wherein X.sub.1 denotes that the I residue is modified by acetylation at the N-terminus, X.sub.2 is L, X.sub.3 is L, X.sub.4 is Q, and the group of the formula X.sub.5X.sub.6 is ([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-(E).sub.2-CO(CH.sub.2).sub.xCO.sub.2H where x is 16 or 18 (SEQ ID NO:17).
[0403] 10. The compound or salt according to any one of numbered embodiment 9 wherein x is 18 (SEQ ID NO:2).
[0404] 11. The compound or salt according to any one of numbered embodiment 9 wherein x is 16 (SEQ ID NO:1).
[0405] 12. The compound or salt according to any one of numbered embodiments 1 to 8 wherein X.sub.1 denotes that the I residue is modified by methylation at the N-terminus, X.sub.2 is L, X.sub.3 is L, X.sub.4 is Q, and the group of the formula X.sub.5X.sub.6 is ([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-(E).sub.2-CO(CH.sub.2).sub.18CO.sub.2H (SEQ ID NO:4).
[0406] 13. The compound or salt according to any one of numbered embodiments 1 to 8 wherein X.sub.1 denotes that the I residue is modified by methylation at the N-terminus, X.sub.2 is L, X.sub.3 is L, X.sub.4 is Q, and the group of the formula X.sub.5X.sub.6 is ([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-(E).sub.2-CO(CH.sub.2).sub.16CO.sub.2H (SEQ ID NO:3).
[0407] 14. The compound or salt according to any one of numbered embodiments 1 to 8 wherein X.sub.1 denotes that the I residue is modified by methylation at the N-terminus, X.sub.2 is T, X.sub.3 is L, X.sub.4 is E, and the group of the formula X.sub.5X.sub.6 is ([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-(E).sub.2-CO(CH.sub.2).sub.18CO.sub.2H (SEQ ID NO:5).
[0408] 15. The compound or salt according to any one of numbered embodiments 1 to 8 wherein X.sub.1 denotes that the I residue is modified by methylation at the N-terminus, X.sub.2 is L, X.sub.3 is L, X.sub.4 is E, and the group of the formula X.sub.5X.sub.6 is ([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-(E).sub.2-CO(CH.sub.2).sub.18CO.sub.2H (SEQ ID NO:6).
[0409] 16. The compound or salt according to any one of numbered embodiments 1 to 8 wherein X.sub.1 denotes that the I residue is modified by methylation at the N-terminus, X.sub.2 is T, X.sub.3 is I, X.sub.4 is E, and the group of the formula X.sub.5X.sub.6 is ([2-(2-Amino-ethoxy)-ethoxy]-acetyl).sub.2-(E).sub.2-CO(CH.sub.2).sub.18CO.sub.2H (SEQ ID NO:7).
[0410] 17. A pharmaceutical composition comprising a compound according to any one of numbered embodiments 1 to 16 and one or more pharmaceutically acceptable carriers, diluents, and excipients.
[0411] 18. A method for treating type II diabetes in a patient comprising administering to a patient in need of such treatment an effective amount of a compound or salt according to any one of numbered embodiments 1 to 16.
[0412] 19. The method of numbered embodiment 18, wherein the administering to a patient in need of such treatment an effective amount of a compound or salt is combined with diet and exercise.
[0413] 20. A method for treating chronic kidney disease in a patient comprising administering to a patient in need of such treatment an effective amount of a compound or salt according to any one of numbered embodiments 1 to 16.
[0414] 21. The method according to numbered embodiment 20 wherein the chronic kidney disease is caused by diabetic nephropathy.
[0415] 22. The method according to numbered embodiment 20 wherein the chronic kidney disease is caused by hypertensive nephropathy.
[0416] 23. The methods according to any one of numbered embodiments 19 to 22, wherein the administration of the compound or salt to the patient in need of such treatment is subcutaneous.
[0417] 24. A compound or salt according to any one of numbered embodiments 1 to 16 for use in therapy.
[0418] 25. A compound or salt according to any one of numbered embodiments 1 to 16 for use in the treatment of type II diabetes.
[0419] 26. A compound or salt according to any one of numbered embodiments 1 to 16 for use in the treatment of chronic kidney disease.
[0420] 27. A compound or salt for use according to any one of numbered embodiments 24 to 26 wherein the administration of the compound or salt is subcutaneous.
[0421] 28. A compound of the Formula:
X.sub.1IVX.sub.2SLDVPIGLLQILX.sub.3EQEKQEKEKQQAKTNAX.sub.4ILAQV-NH.sub.2
[0422] wherein X.sub.1 denotes that the I residue is modified by either acetylation or methylation at the N-terminus, wherein X.sub.2 is L or T, wherein X.sub.3 is L or I, wherein X.sub.4 is Q or E (SEQ ID NO:18).
[0423] 29. A compound of the formula:
TABLE-US-00026 (SEQIDNO:68) IleValXaaSerLeuAspValProIleXaaLeuLeu 1510 GlnXaaXaaXaaXaaXaaXaaLysXaaXaaLysXaa 1520 LysXaaXaaXaaXaaXaaAsnAlaXaaIleLeuAla 253035 XaaVal
Wherein:
[0424] Ile at position 1 may optionally be derivatized at the N-terminal amine with a methyl or an acetyl group;
Xaa at position 3 is Leu or Thr;
Xaa at position 10 is Gly or Lys;
Xaa at position 14 is Ile or Lys;
Xaa at position 15 is Leu or Lys;
Xaa at position 16 is Leu, Ile, or Lys;
Xaa at position 17 is Glu or Lys;
Xaa at position 18 is Gln or Lys;
Xaa at position 19 is Glu or Lys;
Xaa at position 21 is Gln or Lys;
Xaa at position 22 is Glu or Lys;
Xaa at position 24 is Glu or Lys;
Xaa at position 26 is Gln or Lys;
Xaa at position 27 is Gln or Lys;
Xaa at position 28 is Ala or Lys;
Xaa at position 29 is Thr or Lys;
Xaa at position 30 is Thr, Glu or Lys;
Xaa at position 33 is Gln, Arg, or Glu;
Xaa at position 37 is Gln, His, or Arg; and
Val at position 38 is optionally amidated at the C-terminal carboxyl;
provided that the epsilon-amine of Lys at exactly one of positions 10 and 14-30 is modified with X5-X6, where X5 is 1 to 4 amino acids and/or 1 to 4 ([2-(2-Amino-ethoxy)-ethoxy]-acetyl) moieties and X6 is C14-C24 fatty acid; and
provided that if any of positions 10, 14-19, 21, 22, 24, and 26-30 is Lys then that position is the only one of positions 10, 14-19, 21, 22, 24, and 26-30 that is Lys; and
provided that when one of positions 10, 14-19, 21, 22, 24, and 26-30 is Lys, that Lys is modified with X5-X6.
Compounds
[0425]
TABLE-US-00027 N- C- term- term- Com- Exam- inal SEQ Modified inal pound ple modifi- Peptide ID Lysine modifi- No. No. cation sequence NO: position cation SidechainonmodifiedLysine 1 1 Ac IVLSLDVPIGLLQIL 1 29 amide -([2-(2-Amino-ethoxy)-ethoxy]- LEQEKQEKEKQQAKT acetyl)2-(E)2-CO(CH2)16COOH NAQILAQV 2 2 Ac IVLSLDVPIGLLQIL 2 29 amide -([2-(2-Amino-ethoxy)-ethoxy]- LEQEKQEKEKQQAKT acetyl)2-(E)2-CO(CH2)18CO2H NAQILAQV 3 3 Me IVLSLDVPIGLLQIL 3 29 amide -([2-(2-Amino-ethoxy)-ethoxy]- LEQEKQEKEKQQAKT acetyl)2-(E)2-CO(CH2)16CO2H NAQILAQV 4 4 Me IVLSLDVPIGLLQIL 4 29 amide -([2-(2-Amino-ethoxy)-ethoxy]- LEQEKQEKEKQQAKT acetyl)2-(E)2-CO(CH2)18CO2H NAQILAQV 5 5 Me IVTSLDVPIGLLQIL 5 29 amide -([2-(2-Amino-ethoxy)-ethoxy]- LEQEKQEKEKQQAKT acetyl)2-(E)2-CO(CH2)18CO2H NAEILAQV 6 6 Me IVLSLDVPIGLLQIL 6 29 amide -([2-(2-Amino-ethoxy)-ethoxy]- LEQEKQEKEKQQAKT acetyl)2-(E)2-CO(CH2)18CO2H NAEILAQV 7 7 Me IVTSLDVPIGLLQIL 7 29 amide -([2-(2-Amino-ethoxy)-ethoxy]- IEQEKQEKEKQQAKT acetyl)2---(E)2-CO(CH2)18CO2H NAEILAQV Me IVXSLDVPIGLLQIL 8 29 amide -([2-(2-Amino-ethoxy)-ethoxy]- or XEQEKQEKEKQQAKT acetyl)2-(E)2-CO(CH2)xCO2H Ac NAXILAQV wherexis16or18 Xat3isLor T Xat16isLor I Xat33isQor E 9 8 Me IVLSLDVPIGLLQIL 9 29 amide -Glu-([2-(2-Amino-ethoxy)- LEQEKQEKEKQQAKT ethoxy]-acetyl)2-(E)2- NAQILAQV CO(CH2)18COOH 10 8 Me IVLSLDVPIGLLQIL 10 29 amide -E-([2-(2-Amino-ethoxy)- LEQEKQEKEKQQAKT ethoxy]-acetyl)2-(E)2- NAQILAQV CO(CH2)16COOH 11 8 Me IVLSLDVPIGLLQIL 11 29 amide -E-E-E-E-CO(CH2)18COOH LEQEKQEKEKQQAKT NAQILAQV 12 8 Me IVLSLDVPIGLLQIL 12 29 amide -E-E-([2-(2-Amino-ethoxy)- LEQEKQEKEKQQAKT ethoxy]-acetyl)-E-E- NAQILAQV CO(CH2)18COOH 13 8 Me IVLSLDVPIGLLQIL 13 29 amide -E-E-([2-(2-Amino-ethoxy)- LEQEKQEKEKQQAKT ethoxy]-acetyl)2-- NAQILAQV E-CO(CH2)18COOH 14 8 Me IVLSLDVPIGLLQIL 14 29 amide -E-([2-(2-Amino-ethoxy)- LEQEKQEKEKQQAKT ethoxy]-acetyl)-E-E- NAQILAQV CO(CH2)18COOH IVLSLDVPIGLLQIL 15 None LEQARARAAREQATT NARILARV Me IVXSLDVPIGLLQIL 16 29 amide Asdescribedherein. or XEQEKQEKEKQQAKT Ac NAXILAQV Xat3isLor T Xat16isLor I Xat33isQor E 17 Ac IVLSLDVPIGLLQIL 17 29 amide -([2-(2-Amino-ethoxy)-ethoxy]- LEQEKQEKEKQQAKT acetyl)2-(E)2-CO(CH2)xCO2H, NAQILAQV wherexis16or18 Me IVXSLDVPIGLLQIL 18 amide None or XEQEKQEKEKQQAKT Ac NAXILAQV Xat3isLor T Xat16isLor I Xat33isQor E EKQEKEKQ 19 None IVLSLDVPIGLLQIL 20 None LEQEKQEKEKQQATT NARILARV 21 9 IVLSLDVPIGLLQKL 21 14 amide -E-CO(CH2)14CH3 LEQEKQEKEKQQATT NARILARV 22 9 IVLSLDVPIGLLQIK 22 15 amide -E-CO(CH2)14CH3 LEQEKQEKEKQQATT NARILARV 23 9 IVLSLDVPIGLLQIL 23 17 amide -E-CO(CH2)14CH3 LKQEKQEKEKQQATT NARILARV 24 9 IVLSLDVPIGLLQIL 24 19 amide -E-CO(CH2)14CH3 LEQKKQEKEKQQATT NARILARV 25 9 IVLSLDVPIGLLQIL 25 20 amide -E-CO(CH2)14CH3 LEQEKQEKEKQQATT NARILARV 26 9 IVLSLDVPIGLLQIL 26 21 amide -E-CO(CH2)14CH3 LEQEKKEKEKQQATT NARILARV 27 9 IVLSLDVPIGLLQIL 27 22 amide -E-CO(CH2)14CH3 LEQEKQKKEKQQATT NARILARV 28 9 IVLSLDVPIGLLQIL 28 23 amide -E-CO(CH2)14CH3 LEQEKQEKEKQQATT NARILARV 29 9 IVLSLDVPIGLLQIL 29 24 amide -E-CO(CH2)14CH3 LEQEKQEKKKQQATT NARILARV 30 9 IVLSLDVPIGLLQIL 30 25 amide -E-CO(CH2)14CH3 LEQEKQEKEKQQATT NARILARV 31 9 IVLSLDVPIGLLQIL 31 25 amide -E-E-CO(CH2)14CH3 LEQEKQEKEKQQATT NARILARV 32 9 IVLSLDVPIGLLQIL 32 25 amide -([2-(2-Amino-ethoxy)-ethoxy]- LEQEKQEKEKQQATT acetyl)-E-CO(CH2)14CH3 NARILARV 33 9 IVLSLDVPIGLLQIL 33 26 amide -E-CO(CH2)14CH3 LEQEKQEKEKKQATT NARILARV 34 9 IVLSLDVPIGLLQIL 34 26 amide -E-E-CO(CH2)14CH3 LEQEKQEKEKKQATT NARILARV 35 9 IVLSLDVPIGLLQIL 35 27 amide -E-CO(CH2)14CH3 LEQEKQEKEKQKATT NARILARV 36 9 IVLSLDVPIGLLQIL 36 28 amide -E-CO(CH2)14CH3 LEQEKQEKEKQQKTT NARILARV 37 9 IVLSLDVPIGLLQIL 37 29 amide -E-CO(CH2)14CH3 LEQEKQEKEKQQAKT NARILARV 38 9 IVLSLDVPIGLLQIL 38 29 amide -E-E-CO(CH2)14CH3 LEQEKQEKEKQQAKT NARILARV 39 9 IVLSLDVPIGLLQIL 39 30 amide -E-CO(CH2)14CH3 LEQEKQEKEKQQATK NARILARV 40 9 IVLSLDVPIGLLQKL 40 14 amide -([2-(2-Amino-ethoxy)-ethoxy]- LEQEKQEKEKQQATT acetyl)2-E-E-CO(CH2)16COOH NAQILAHV 41 9 IVLSLDVPIGLLQIK 41 15 amide -([2-(2-Amino-ethoxy)-ethoxy]- LEQEKQEKEKQQATT acetyl)2-E-E-CO(CH2)16COOH NAQILAHV 42 9 IVLSLDVPIGLLQIL 42 16 amide -([2-(2-Amino-ethoxy)-ethoxy]- KEQEKQEKEKQQATT acetyl)2-E-E-CO(CH2)16COOH NAQILAHV 43 9 IVLSLDVPIGLLQIL 43 17 amide -([2-(2-Amino-ethoxy)-ethoxy]- LKQEKQEKEKQQATT acetyl)2-E-E-CO(CH2)16COOH NAQILAHV 44 9 IVLSLDVPIGLLQIL 44 18 amide -([2-(2-Amino-ethoxy)-ethoxy]- LEKEKQEKEKQQATT acetyl)2-E-E-CO(CH2)16COOH NAQILAHV 45 9 IVLSLDVPIGLLQIL 45 21 amide -([2-(2-Amino-ethoxy)-ethoxy]- LEQEKKEKEKQQATT acetyl)2-E-E-CO(CH2)16COOH NAQILAHV 46 9 IVLSLDVPIGLLQIL 46 25 amide -([2-(2-Amino-ethoxy)-ethoxy]- LEQEKQEKEKQQATT acetyl)2-E-E-CO(CH2)16COOH NAQILAHV 47 9 IVLSLDVPIGLLQIL 47 26 amide -([2-(2-Amino-ethoxy)-ethoxy]- LEQEKQEKEKKQATT acetyl)2-E-E-CO(CH2)16COOH NAQILAHV 48 9 IVLSLDVPIGLLQIL 48 29 amide -([2-(2-Amino-ethoxy)-ethoxy]- LEQEKQEKEKQQAKT acetyl)2-E-E-CO(CH2)16COOH NAQILAHV 49 9 IVLSLDVPIKLLQIL 49 10 amide -([2-(2-Amino-ethoxy)-ethoxy]- LEQEKQEKEKQQATT acetyl)2-E-E-CO(CH2)16COOH NAQILAQV 50 9 IVLSLDVPIGLLQIL 50 17 amide -([2-(2-Amino-ethoxy)-ethoxy]- LKQEKQEKEKQQATT acetyl)2-E-E-CO(CH2)16COOH NAQILAQV 51 9 IVLSLDVPIGLLQIL 51 26 amide -([2-(2-Amino-ethoxy)-ethoxy]- LEQEKQEKEKKQATT acetyl)2-E-E-CO(CH2)16COOH NAQILAQV 52 9 IVLSLDVPIGLLQIL 52 29 amide -([2-(2-Amino-ethoxy)-ethoxy]- LEQEKQEKEKQQAKT acetyl)2-E-E-CO(CH2)16COOH NAQILAQV 53 9 IVLSLDVPIGLLQIL 53 17 amide ([2-(2-Amino-ethoxy)-ethoxy]- LKQEKQEKEKQQATE acetyl)2-E-E-CO(CH2)16COOH NAQILAQV 54 9 IVLSLDVPIGLLQIL 54 26 amide -([2-(2-Amino-ethoxy)-ethoxy]- LEQEKQEKEKKQATE acetyl)2-E-E-CO(CH2)16COOH NAQILAQV 55 9 IVLSLDVPIGLLQIL 55 29 amide -([2-(2-Amino-ethoxy)-ethoxy]- LEQEKQEKEKQQAKE acetyl)2-E-E-CO(CH2)16COOH NAQILAQV 56 9 IVLSLDVPIGLLQIL 56 29 amide -([2-(2-Amino-ethoxy)-ethoxy]- LEQEKQEKEKQQAKE acetyl)2-E-E-CO(CH2)16COOH NAQILAQV 57 9 Me IVLSLDVPIGLLQIL 57 29 amide -([2-(2-Amino-ethoxy)-ethoxy]- LEQEKQEKEKQQAKE acetyl)-E-E-CO(CH2)18COOH NAEILAQV 58 9 Me IVLSLDVPIGLLQIL 58 29 amide -E-E-CO(CH2)18COOH LEQEKQEKEKQQAKE NAEILAQV 59 9 Me IVLSLDVPIGLLQIL 59 29 amide -E-([2-(2-Amino-ethoxy)-ethoxy]- LEQEKQEKEKQQAKE acetyl)-E-E-CO(CH2)18COOH NAEILAQV 60 9 Me IVLSLDVPIGLLQIL 60 29 amide -E-([2-(2-Amino-ethoxy)-ethoxy]- LEQEKQEKEKQQAKT acetyl)2-E-E-CO(CH2)18COOH NAQILAQV 61 9 Me IVLSLDVPIGLLQIL 61 29 amide -E-([2-(2-Amino-ethoxy)-ethoxy]- LEQEKQEKEKQQAKT acetyl)-E-E-CO(CH2)18COOH NAQILAQV 62 9 Me IVLSLDVPIGLLQIL 62 29 amide -E-E-([2-(2-Amino-ethoxy)-ethoxy]- LEQEKQEKEKQQAKT acetyl)2-E-E-CO(CH2)18COOH NAQILAQV 63 9 Me IVLSLDVPIGLLQIL 63 29 amide -E-E-([2-(2-Amino-ethoxy)-ethoxy]- LEQEKQEKEKQQAKT acetyl)-E-E-CO(CH2)18COOH NAQILAQV 64 9 Me IVLSLDVPIGLLQIL 64 29 amide -E-E-E-E-CO(CH2)18COOH LEQEKQEKEKQQAKT NAQILAQV 65 Me IVTSLDVPIGLLQIL 65 29 -E-([2-(2-Amino-ethoxy)-ethoxy]- LEQEKQEKEKQQAKT acetyl)2-E-E-CO(CH2)18COOH NAQILAQV 66 9 Me IVTSLDVPIGLLQIL 66 29 amide -E-([2-(2-Amino-ethoxy)-ethoxy]- LEQEKQEKEKQQAKT acetyl)2-E-E-CO(CH2)18COOH NAEILAQV , IVXSLDVPIGLLQIL 67 As As Asdescribedherein. Me, XEQEKQEKEKQQATX des- des- Ac NAXILAXV cribed cribed Xatposition3 herein herein isLorT Xatposition 16isLorI Xatposition 30isTorE Xatposition 33isQ,R,or E Xatposition 37isQ,H,or R
As noted above, certain embodiments may be designed in which the patient is an animal, such as a cat. Below is a list of the sequences of various Urocortin 2 sequences found in humans and some animal species.
TABLE-US-00028 HUMAN IVLSLDVPIGLLQILLEQARARAAREQATTNARILARVGHC :41 MOUSE VILSLDVPIGLLRILLEQARYKAARNQAATNAQILAHV--- :38 RAT VILSLDVPIGLLRILLEQARNKAARNQAATNAQILARV--- :38 ORAN- IVLSLDVPIGLLQILLEQARARAAREQATTNARILAHVG-- :39 GUTAN DOG IILSLDVPIGLLQILLEQARARASREQATTNARILAQVG-- :39 BO- ITLSLDVPLGLLQILLEQARARAVREQAAANARILAHVGH- :40 VINE HORSE ITLSLDVPVGLLQILLEQVRARAAREQAAANARILAHVG-- :39 PIG ITLSLDVPLGLLQILLEQARARAVREQAAANARILAHVG-- :39 ELE- ITLSLDVPLGLLQILLEQARIRAAREQAAANARILAHVG-- :39 PHANT FISH ISLDVPTSILSVLIDIAKNQDMRTKAAANAELMARIG---- :37
Additionally, information about urocortin 2 for cats is found in the GENBANK database and is reproduced below:
TABLE-US-00029 GENBANKACCESSIONNUMBERXR_002150782(VERSIONXR_002150782.1) 1 gctctgggtgggatgggcagggccttgggggctgagtagatccgggtatgggttattgga 61 ggtctccggatgtggagtctctggctgcttctctaccttgaggaccccattcctgccctt 121 ctttgtccacgatctgctgcaagctccctcagacctgaggctccccttttgtccctctgt 181 gttctctccatgccttggtatccttattttcatcatgctgtctgtctctggggtggctcc 241 agcctctttgtcttccagtctccctcttttgctctgcctccatgtcctccctctcgtctt 301 tttccctcttctccctcccctccccaactgtacccatctctacatctagatccagaccta 361 gctgtgctctctgtctctttcactctccttcttgctctctccgtctccctggcccctgct 421 ctgtctggctgtcttgtgctttcatctctgtctctcttatctccgtcccatgcctggcct 481 ctctaatctctacctctctgtctccttcccttggtctccctctctctgtctgtctacttt 541 ccccgtctgcatctgtccatgcgccacggctgcccagaacccctgccctgagcctctttt 601 ctcctcgcagcctgaccacgcgatgaccaggtgggctctgctggtgctgatgatcctgac 661 gtcgggcagggccctgcttgtccccatgacccctattccagccttccagctcctccctca 721 gaaccctccccaagccactccccgccctgtggcctcagagagcccctcagccagcaccgt 781 gggcccctccactgcttggggccaccctagccctggcccccgcccaggcccccgcatcac 841 tctctcactggatgtccccattggcctcctgcggatcttactggagcaagcccgagccag 901 agctgtgagggagcaggccgctgccaacgctcgcatcctggcccatgttggccgccgctg 961 agcctcagggcgggggtcaccctgaattaggagacctggaaggcagcagcagagcaggac 1021 gcactacatctgggcacagtgcgcctggccacagccccgtgcagtcactgccatgtggtg 1081 tcatatcacagctgagtgcctcacagagccacagtttgtttggacagcccgggcattgcc 1141 atatcgggtgactgccaaatggagtcttgccatacctggagccacacagacttacaatat 1201 gtctggacagcttggacactactgtggaatgtgactaccgtgtggagtcttgccatgtct 1261 gggtgccccacagtcaaagagcaagaatctggacactgccaatgtggccactcttgtgcc 1321 agttttaggaacctcaacataggagcccagtattgcatctcagacccatccacctaagac 1381 cagacctgcaggtcttccctgcccccaacaggtcaccacacaggggagtgcaggctgagg 1441 gtcacatgcatgttttgtgcttcatgaggcagcacccaccccagaagaatggggccgtca 1501 caggcatctccaggcatgggtgaccgtacgtggaaagtctgtggttgtgacagccttgcc 1561 ttgtgccctgcacacctggcctcggcccttggacacacgatgactcaggagagaggaggc 1621 tcgggctgctggggctccggtccagccccatacctcctttgttgaattgtcccaagcaaa 1681 ctaaaatgtgctcacctttccaagccttagtttcttcctctgtaaagcagaatgatgcca 1741 ccaagcttcttgcaaacattgagtgacggtgcacttgaaggttctagcacgcaggaagag 1801 ctcaataaatgtagtgactgga GENBANKACCESSIONNUMBERXM_006928725(VERSIONXM_006928725.2) 1 gtccctctgtccagccctggtcactgttctgtgactctcagtgtccaacttgtccccaaa 61 aaggagtagacagagtggaggctgaggacacgtcctcactgcccccccaggaggggatga 121 gtcagaggtggggggctgcttcatgccggagccgtgcccagctcctacctcaggggctga 181 gagagataaatgggcccggaagggggcagaggcccgaccacagcacagcaccgcctggtc 241 ccagccgcgggcagccctggcggccccaccttgctccagaagaggctgctgctgcctgac 301 cacgcgatgaccaggtgggctctgctggtgctgatgatcctgacgtcgggcagggccctg 361 cttgtccccatgacccctattccagccttccagctcctccctcagaaccctccccaagcc 421 actccccgccctgtggcctcagagagcccctcagccagcaccgtgggcccctccactgct 481 tggggccaccctagccctggcccccgcccaggcccccgcatcactctctcactggatgtc 541 cccattggcctcctgcggatcttactggagcaagcccgagccagagctgtgagggagcag 601 gccgctgccaacgctcgcatcctggcccatgttggccgccgctgagcctcagggcggggg 661 tcaccctgaattaggagacctggaaggcagcagcagagcaggacgcactacatctgggca 721 cagtgcgcctggccacagccccgtgcagtcactgccatgtggtgtcatatcacagctgag 781 tgcctcacagagccacagtttgtttggacagcccgggcattgccatatcgggtgactgcc 841 aaatggagtcttgccatacctggagccacacagacttacaatatgtctggacagcttgga 901 cactactgtggaatgtgactaccgtgtggagtcttgccatgtctgggtgccccacagtca 961 aagagcaagaatctggacactgccaatgtggccactcttgtgccagttttaggaacctca 1021 acataggagcccagtattgcatctcagacccatccacctaagaccagacctgcaggtctt 1081 ccctgcccccaacaggtcaccacacaggggagtgcaggctgagggtcacatgcatgtttt 1141 gtgcttcatgaggcagcacccaccccagaagaatggggccgtcacaggcatctccaggca 1201 tgggtgaccgtacgtggaaagtctgtggttgtgacagccttgccttgtggtaggtgtacg 1261 tgtgatcggtgggtgcatctctgctgtgg
Specific embodiments may be designed in which the molecules of SEQ. ID NOS. 1, 2, 3, 5, 6 and 7 are used to treat chronic kidney disease and/or diabetes in cats or other animals.