Methods and compositions for preventing ischemia reperfusion injury in organs

09868953 ยท 2018-01-16

Assignee

Inventors

Cpc classification

International classification

Abstract

The invention, in some embodiments, relates to compounds and methods for the prevention of ischemia reperfusion injury (IRI) in organs, and in particular to IRI in organs aged 35 years and older. Specific uses include prevention of IRI in native organs in vivo, in reimplantations and in transplantations of donor organs aged 35 years and older. Additional embodiments include the prophylaxis of delayed graft function (DGF) and reduction in the frequency, amount and duration of dialysis in recipients of deceased donor kidney transplantations. The methods entail contacting the organ in vivo or ex vivo with a temporary p53 inhibitor. Novel temporary dsNA p53 inhibitors are further provided.

Claims

1. A method of prophylaxis of ischemic reperfusion injury (IRI) in a kidney at risk of IRI transplanted into a subject, the method comprising contacting the kidney with a temporary inhibitor of a p53 gene in an amount effective to provide prophylaxis of IRI in the kidney, wherein the kidney is from a donor aged 35 years or older, and wherein the inhibitor is a synthetic small interfering ribonucleic acid (siRNA) having the structure: TABLE-US-00032 (SEQIDNO:37) 5 UGAAGGGUGAAAUAUUCUC3 (antisensestrand) (SEQIDNO:36) 3 ACUUCCCACUUUAUAAGAG5 (sensestrand) wherein each of A, C, U and G is a ribonucleotide and each consecutive ribonucleotide is joined to the next ribonucleotide by a covalent bond; and wherein alternating ribonucleotides in both the antisense strand and the sense strand are 2-O-methyl sugar modified ribonucleotides and a 2-O-methyl sugar modified ribonucleotide is present at both the 5 terminus and the 3 terminus of the antisense strand and an unmodified ribonucleotide is present at both the 5 terminus and the 3 terminus of the sense strand; or a pharmaceutically acceptable salt thereof.

2. The method of claim 1, wherein contacting the kidney with the temporary inhibitor comprises administering the temporary inhibitor to the subject possessing the kidney at risk of IRI after transplantation.

3. The method of claim 1, wherein contacting the kidney with the temporary inhibitor comprises contacting the kidney with the temporary inhibitor ex vivo prior to transplantation of the kidney into the subject.

4. The method claim 1, wherein the kidney at risk of IRI is from a donor aged 45 years old or older.

5. The method of claim 1, wherein prophylaxis of IRI results in prophylaxis of IRI-associated kidney dysfunction or IRI-associated delayed graft function (DGF) of the kidney.

6. The method of claim 5, wherein the prophylaxis of DGF results in the reduction of the amount, intensity, and duration of dialytic support during at least the first 7 days post-transplantation in a dialysis-dependent end stage renal disease (ESRD) patient undergoing deceased donor renal transplantation.

7. The method of claim 5, wherein prophylaxis of DGF results in at least one of a longer time interval between transplantation and the first dialysis treatment post-transplantation, a shorter mean duration of initial post-transplantation course of dialysis, and a higher measured glomerular filtration rate (mGFR) at the end of the first post-transplantation month.

8. The method of claim 5, wherein the prophylaxis of IRI results in the reduction of the amount, intensity, and/or duration of dialytic support during the first 180 days post-transplantation in a dialysis-dependent end stage renal disease (ESRD) patient undergoing deceased donor renal transplantation.

9. The method of claim 1, wherein the kidney is preserved entirely by cold storage following removal from the donor and prior to implantation into the subject.

10. The method claim 1, wherein the kidney is preserved by machine-perfusion for at least a portion of time following removal from the donor and prior to implantation into the subject.

11. The method of claim 1, further comprising the steps of (a) selecting a recipient having a kidney from an Expanded Criteria Donor, and (b) administering to the subject the temporary inhibitor in an amount effective to provide prophylaxis of DGF in the subject.

12. The method of claim 1, wherein the kidney is from a donor who is or was between the ages of 50 and 59 (inclusive) who does not have at least two of the following: a history of high blood pressure, terminal serum creatinine level greater than 1.5 mg/dl, and cardiovascular cause of brain death.

13. The method of claim 1, wherein the 5 termini and the 3 termini are unphosphorylated.

14. The method of claim 1, wherein the pharmaceutically acceptable salt is a sodium salt.

15. The method claim 1, wherein the temporary inhibitor of a p53 gene is administered at a dose of about 1 to about 50 mg/kg.

16. The method of claim 15, wherein the temporary inhibitor of a p53 gene is administered at a dose of about 10 mg/kg.

17. The method of claim 1, wherein the temporary inhibitor is administered by intravenous (IV) injection.

18. The method of claim 17, wherein the intravenous (IV) injection is administered in a single treatment, wherein the single treatment comprises a single dose or multiple doses.

19. The method of claim 18, wherein the single treatment is a single intravenous push (IVP).

20. The method of claim 17, wherein the intravenous (IV) injection is administered directly into a proximal port of a central venous line or through a peripheral line.

21. The method of claim 1, wherein the temporary inhibitor is conjugated or formulated in liposomes or nanoparticles.

22. The method of claim 1, wherein the subject is further administered a medication selected from the group consisting of an antiviral agent, an antifungal agent, an antimicrobial agent, an immunosuppressant agent, and any combination thereof.

23. The method of claim 22, wherein the medication is an immunosuppressant agent that is a calcineurin inhibitor.

24. The method of claim 22, wherein the immunosuppressant agent is selected from the group consisting of tacrolimus (TAC), mycophenolate mofetil (MMF), mycophenolic acid (MPA), a corticosteroid, a cyclosporine, an azathioprine, a sirolimus, and any combination thereof.

25. The method of claim 24, wherein the immunosuppressant agent is tacrolimus (TAC).

26. The method of claim 1, wherein the subject is further administered an antibody induction therapy agent.

27. The method of claim 26, wherein the antibody induction therapy agent comprises a polyclonal anti-thymocyte globulin (ATG) or an anti-CD25 (anti-IL-2R) monoclonal antibody.

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) Some embodiments of the invention are described herein with reference to the accompanying figures. The description, together with the figures, makes apparent to a person having ordinary skill in the art how some embodiments of the invention may be practiced.

(2) In the Figures:

(3) FIG. 1 is a graph showing protein levels of ischemia induced activation of p53 in kidneys from young and old rat donors.

(4) FIGS. 2a and 2b are line graphs showing secondary endpoint time to first post-transplant dialysis in mITT(EE) population (FIG. 2a) and in ECD/CS stratum (FIG. 2b).

(5) FIG. 3 shows a Forest plot demonstrating the impact of QPI-1002 treatment on DGF relative risk reduction in graft recipients per donor kidney type.

DESCRIPTION OF SOME EMBODIMENTS OF THE INVENTION

(6) Provided herein are compounds and compositions that temporarily inhibit the p53 gene, and the use of such compounds for prophylaxis of IRI in organs, a reduction in the amount and duration of dialysis in deceased donor kidney transplant recipients and for prevention of Delayed Graft Function (DGF) in recipients of Expanded Criteria Donor (ECD) kidneys.

(7) Temporary Inhibitors of p53

(8) Temporary inhibitors of p53 are intended to reduce the expression or function of a p53 gene for a length of time sufficient to evoke a therapeutic or prophylactic effect, for example in an organ or in a subject, without increasing the risk for cancerous growth. A method of temporary p53 inhibition is disclosed in, inter alia, U.S. Pat. Nos. 6,593,353; 6,982,277; 7,008,956 and 7,012,087, incorporated herein by reference in their entirety.

(9) As used herein the term inhibitor refers to a compound, which is capable of reducing (partially or fully) the expression of a gene or the activity of a product of such gene (mRNA, protein) to an extent sufficient to achieve a desired biological or physiological effect. For example, the expression may be reduced to 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% or less than that observed in the absence of an inhibitor. Preferably, the inhibitor is a temporary inhibitor that reversibly reduces p53 expression or activity.

(10) A temporary inhibitor of p53 refers to a molecule that exerts its effect for up to 24 hours, up to 36 hours, up to 48 hours, up to 72 hours, up to 96 hours, up to 120 hours or no longer than 30 days.

(11) An inhibitor of a p53 gene may be a small organic molecule, a protein, an antibody or fragment thereof, a peptide, a polypeptide, a peptidomimetic or a nucleic acid molecule; or a pharmaceutically acceptable salt or prodrug thereof.

(12) A small organic molecule of may be, for example, pifithrin.

(13) An inhibitor of the p53 gene can be an aptamer, which are nucleic acid or peptide molecules that bind to a specific protein target molecule (see, for example, patent documents: Sundaram, et al., Eu. J. Pharm. Sci. 2013, 48:259-271; WO 1992/014843 U.S. Pat. Nos. 5,861,254; 5,756,291; 6,376,190.

(14) Aptamers may be used to inhibit target genes or to target other inhibitors to specific target cells or organs (see for example US 2006/0105975).

(15) Aptamers are meant to include thiophosphate oligonucleotide aptamers, thioaptamers or TAs, which are a class of ligand that structurally differs from RNA and DNA capable of binding proteins with high (nM) affinity. TAs may also be used to inhibit target genes or as targeting moieties, per se.

(16) In certain preferred embodiments the compounds that down-regulate or inhibit expression of the p53 gene are nucleic acid molecules (for example, antisense molecules, short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded NA (dsNA), micro-RNA (miRNA) or short hairpin RNA (shRNA)) that bind a nucleotide sequence (such as an mRNA sequence) or portion thereof, encoding p53, for example, the mRNA coding sequence (SEQ ID NO:1-7) for human p53, encoding one or more proteins or protein subunits. In various embodiments the nucleic acid molecule is selected from the group consisting of unmodified or chemically modified dsNA compound such as a dsRNA, a siRNA or shRNA that down-regulates the expression of a p53 gene.

(17) In some embodiments the nucleic acid molecule is a synthetic, unmodified double stranded RNA (dsRNA) compound that down-regulates p53 expression.

(18) In some preferred embodiments the nucleic acid molecule is a synthetic, chemically modified double-stranded RNA (dsRNA) compound that down-regulates p53 expression. In certain preferred embodiments, p53 refers to human p53 gene. In certain preferred embodiments, target gene refers to human p53 gene.

(19) The chemically modified nucleic acid molecules and compositions provided herein exhibit beneficial properties, including at least one of increased serum stability, improved cellular uptake, reduced off-target activity, reduced immunogenicity, improved endosomal release, improved specific delivery to target tissue or cell and increased knock down/down-regulation activity when compared to corresponding unmodified nucleic acid molecules.

(20) Nucleic Acid Compounds

(21) In the context of this disclosure, the terms nucleic acid compound or nucleic acid molecule refer to an oligomer (oligonucleotide) or polymer (polynucleotide) of deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) or a combination thereof. This term includes compounds composed of naturally occurring nucleobases, sugars and covalent internucleoside linkages.

(22) A dsRNA is a small double stranded nucleic acid molecule which includes RNA and RNA analogs. A dsNA is a small double stranded nucleic acid molecule which includes RNA, modified nucleotides and/or unconventional nucleotides. The terms dsRNA and dsNA may be used interchangeably.

(23) The term dsRNA relates to two strands of anti-parallel polyribonucleic acids held together by base pairing. The two strands can be of identical length or of different lengths provided there is enough sequence homology between the two strands that a double stranded structure is formed with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% complementarity over the entire length. According to one embodiment, there are no nucleotide overhangs for the dsRNA molecule. According to another embodiment, the dsRNA molecule comprises overhangs, which may be selected from nucleotide overhangs, non-nucleotide overhangs or a combination thereof. According to other embodiments, the strands are aligned such that there are between 1-10 bases, preferably between 1-6 bases at least at the end of the strands, which do not align such that an overhang of 1-10 residues occurs at one or both ends of the duplex when strands are annealed.

(24) In some embodiments, the dsRNA in the present application is between 15 and 100 bp, between 15 and 50 bp, between 15 and 40 bp, between 15 and 30, or between 15 and 25 bp. In a further embodiment, the 5 and/or 3 ends of the sense and/or antisense strands of the dsRNA comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotide overhangs. In some embodiments, the dsRNA comprises between 1-6 nucleotide overhangs on the 5 and/or 3 ends of the sense and/or antisense strands. In another embodiments, the ends of the dsRNA are blunt.

(25) The term siRNA relates to small inhibitory dsRNA (generally between 15-25 bp) that may interact with the RNA interference (RNAi) machinery and induce the RNAi pathway. Typically, siRNA are chemically synthesized as 15-25 mers, preferably comprising a central 15-19 bp duplex region with or without symmetric 2-base or more 3 overhangs on the termini.

(26) The strands of a double stranded interfering RNA (e.g. siNA and siRNA) may be connected to form a hairpin or stem-loop structure (e.g. a shRNA). Thus, as mentioned the RNA silencing agent of some embodiments of the invention may also be a short hairpin RNA (shRNA).

(27) The term shRNA, as used herein, refers to a RNA molecule having a stem-loop structure, comprising a first and second region of complementarity sequence, the degree of complementarity and orientation of the regions being sufficient such that base pairing occurs between the regions, the first and second regions being sufficient such that base pairing occurs between the regions, the first and second regions being bound by a loop region, the loop resulting from lack of base pairing between nucleotides (or nucleotide analogs) within the loop region.

(28) As used herein the term modified nucleotide refers to a nucleotide comprising at least one modification which may be a sugar modification, a nucleobase modification or an internucleotide linkage modification (between said nucleotide and a consecutive nucleotide) or a combination thereof. Such modified nucleotides are often preferred over the naturally occurring forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for a nucleic acid target and enhanced nuclease stability.

(29) Internucleotide Linkage Modifications:

(30) The naturally occurring internucleoside linkage that makes up the backbone of RNA and DNA is a 3 to 5 phosphodiester linkage. The nucleic acid compounds according to some embodiments of the invention may comprise at least one modified (non-naturally occuring) internucleotide linkage. Modified internucleoside linkages may include internucleoside linkages that retain a phosphorus atom and internucleoside linkages that do not have a phosphorus atom.

(31) Non-limiting examples of modified internucleoside linkages containing a phosphorus atom therein include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3-alkylene phosphonates, 5-allylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, phosphonoacetate (PACE) and thiophosphonoacetate, selenophosphates and boranophosphates having normal 3-5 linkages, 2-5 linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3 to 3, 5 to 5 or 2 to 2 linkage.

(32) Non-limiting examples of modified internucleotide linkages that do not include a phosphorus atom therein include a short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane linkages; sulfide, sulfoxide and sulfone linkages; formacetyl and thioformacetyl linkages; methylene formacetyl and thioformacetyl linkages; riboacetyl linkages; alkene containing linkages; sulfamate linkages; methyleneimino and methylenehydrazino linkages; sulfonate and sulfonamide linkages; amide linkages; and other linkages having mixed N, O, S and CH.sub.2 component parts.

(33) Non-limiting examples of heteroatom internucleoside linkages include CH.sub.2NHOCH.sub.2, CH.sub.2N(CH.sub.3)OCH.sub.2 (known as a methylene (methylimino) or MMI linkage), CH.sub.2ON(CH.sub.3)CH.sub.2, CH.sub.2N(CH.sub.3)N(CH.sub.3)CH.sub.2 and ON(CH.sub.3)CH.sub.2CH.sub.2 (wherein the naturally occuring phosphodiester internucleotide linkage is represented as OP(O)(OH)OCH.sub.2).

(34) Sugar Modifications:

(35) Sugar moieties in nucleic acid compounds disclosed herein may include 2-hydroxylpentofuranosyl sugar moiety without any modification. Alternatively, nucleic acid compounds of the invention may contain one or more substituted or otherwise modified sugar moieties. A preferred position for a sugar substituent group is the 2-position not usually used in the native 3 to 5-internucleoside linkage. Other preferred positions are the 3 and the 5-termini. 3-sugar positions are open to modification when the linkage between two adjacent sugar units is a 2-5-linkage. Preferred sugar substituent groups include: OH; F; O-alkyl, S-alkyl, or N-alkyl; O-alkenyl, S-alkenyl, or N-alkenyl; O-alkynyl, S-alkynyl or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C1 to C10 alkyl or C2 to C10 alkenyl and alkynyl, C1 to C10 lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl (e.g. -propargyl, -propyl, -ethynyl, -ethenyl and propenyl). Non-limiting examples of sugar modification include methoxy (OCH.sub.3), methylthio (SCH.sub.3), OCN, OCF.sub.3, aminopropoxy (OCH.sub.2CH.sub.2CH.sub.2NH.sub.2), allyl (CH.sub.2CHCH.sub.2), O-allyl (OCH.sub.2CHCH.sub.2), O[(CH.sub.2).sub.nO].sub.mCH.sub.3, O(CH.sub.2).sub.nOCH.sub.3, O(CH.sub.2).sub.nNH.sub.2, O(CH.sub.2).sub.nCH.sub.3, O(CH.sub.2).sub.nONH.sub.2, and O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.sub.3].sub.2, where n and m are from 1 to about 10, 2-methoxyethoxy (2-OCH.sub.2CH.sub.2OCH.sub.3), 2-dimethylaminooxyethoxy (2-O(CH.sub.2).sub.2ON(CH.sub.3).sub.2), N-methylacetamide (2-OCH.sub.2C(O)N(H)CH.sub.3), F, Cl, Br, I, CN, SOCH.sub.3, SO.sub.2CH.sub.3, ONO.sub.2, NO.sub.2, N.sub.3, NH.sub.2, imidazole, carboxylate, thioate, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino and substituted silyl.

(36) The 2-sugar substituent groups described supra may be incorporated in the arabino (up) position or ribo (down) position. An example of 2-arabino modification is 2-F (2-F-arabino modified nucleotide is typically referred to as fluoroarabimo nucleic acid (FANA)). According to some embodiments, sugar moieties may be modified such as, 2-deoxy-pentofuranosyl sugar moiety.

(37) In some preferred embodiments, the modified nucleotide comprises at least one 2-O-methyl sugar modified ribonucleotide.

(38) Similar modifications to the ones described supra may also be made at positions other than the 2 position of the sugar moiety, particularly at the 3 position of the sugar of a 3 terminal nucleoside or in a 2-5 linked nucleotides and the 5 position of a 5 terminal nucleotide.

(39) Nucleobase Modifications:

(40) The nucleic acid compounds disclosed herein may comprise unmodified or natural nucleobases including the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Alternatively, nucleic acid compounds of the invention may contain one or more substituted or otherwise modified nucleobase. Non-limiting examples of nucleobase modifications include 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl adenine, 6-methyl guanine, 2-propyl adenine, 2-propyl guanine and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 5-halouracil, 5-halocytosine, 5-propynyl uracil, 5-propynyl cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, 6-azo cytosine, 6-azo thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo adenine, 8-halo guanines, 8-amino adenine, 8-amino guanine, 8-thiol adenine, 8-thiol guanine, 8-thioalkyl adenine, 8-thioalkyl guanine, 8-hydroxyl adenine, 8-hydroxyl guanine and other 8-substituted adenines and guanines, 5-halo (e.g. 5-bromo) uracil, 5-halo (e.g. 5-bromo) cytosine, 5-trifluoromethyl uracil, 5-trifluoromethyl guanine and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine. Modified nucleobases moieties may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 8-azaguanine, 8-azaadenine, 7-deaza-guanine, 7-deaza-adenine, 3-deazaguanine and 3-deazaadenine. Additional examples include nucleobases having non-purinyl and non-pyrimidinyl bases such as 2-aminopyridine, 2-pyridone and triazine.

(41) Nucleotide Analogues:

(42) The nucleic acid compounds, according to some embodiments of the invention, may comprise one or more nucleotide analogues. The term Nucleotide analogues alternatively referred to as nucleotide mimetics as used herein refers to nucleotides wherein the furanose ring or the furanose ring and the internucleotide linkage are replaced with alternative groups. The nucleobase moiety (modified or unmodified) is maintained.

(43) Non-limiting examples of nucleotide analogues include a peptide nucleic acid (PNA), in which the sugar-backbone of a nucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone; a morpholino nucleic acid, in which the furanose ring is replaced with a morpholine ring; a cyclohexenyl nucleic acid (CeNA), in which the furanose ring is replaced with a cyclohenyl ring; a nucleic acid comprising bicyclic sugar moiety (BNAs), such as Locked Nucleic Acids (LNAs) in which the 2-hydroxyl group of the ribosyl sugar ring is linked to the 4 carbon atom of the sugar ring thereby forming a 2-C,4-C-oxymethylene linkage to form the bicyclic sugar moiety, a 2-O,4-ethylene-bridged nucleic acid (ENA) and the like; a threose nucleic acid in which the hydroxylpentofuranosyl sugar moiety is replaced with threose sugar moiety; an arabino nucleic acid (ANA) in which the ribose sugar moiety is replaced with arabinose sugar moiety; an unlocked nucleic acid (UNA), in which the ribose ring is replaced with an acyclic analogue, lacking the C2-C3 bond; a mirror nucleotide in which the typical D-ribose ring is replaced with a L-ribose ring, thus forming a nucleotide which is a mirror image of natural nucleotide and a nucleotide comprising a 2-5 linkage, in which the typical 3 to 5 internucleotide linkage is replaced with a 2 to 5 linkage (preferably a 2-5 phosphate based internucleotide linkage). It is to be emphasized that the nucleotide analogues described, may be further modified as described above for modified nucleotide.

(44) The nucleic acid compound according to some embodiments of the invention may further comprise at least one unconventional moiety. The term unconventional moiety as used herein refers to as an abasic nucleotide or an abasic nucleotide analog. Such abasic nucleotide encompasses sugar moieties lacking a base or having other chemical groups in place of base at the 1 position. The abasic nucleotide may comprise an abasic ribose moiety (unmodified or modified as described supra) or an abasic deoxyribose moiety (unmodified or modified). Additionally, the abasic nucleotide may be a reverse abasic nucleotide, e.g., where a reverse abasic phosphoramidite is coupled via a 5 amidite (instead of 3 amidite) resulting in a 5-5 phosphate linkage. The term abasic nucleotide analog encompasses any nucleotide analog as defined above, wherein the sugar moiety is lacking a base or having other chemical groups in place of base at the 1 position.

(45) Terminal Modifications:

(46) Modifications can be made at terminal phosphate groups. Non-limiting examples of different stabilization chemistries can be used, for example to stabilize the 3-end of nucleic acid sequences, include [3-3]-inverted deoxyribose; deoxyribonucleotide; [5-3]-3-deoxyribonucleotide; [5-3]-ribonucleotide; [5-3]-3-O-methyl ribonucleotide; 3-glyceryl; [3-5]-3-deoxyribonucleotide; [3-3]-deoxyribonucleotide; [5-2]-deoxyribonucleotide; and [5-3]-dideoxyribonucleotide. In addition to modified and unmodified backbone structures indicated, these structures can be combined with different internucleotide linkage modifications, sugar modifications and/or nucleobase modifications as described above.

(47) The nucleic acid compounds according to some embodiments disclosed herein may comprise blunt ends (i.e., ends do not include any overhanging nucleotides). Alternatively, the nucleic compounds of the invention may comprise at least one overhang, said overhangs may be selected from the group consisting of nucleotide overhangs (e.g. 3-terminal nucleotide overhangs) and non-nucleotide overhangs.

(48) In particular embodiments, chemically modified dsNA compounds that target p53, compositions and kits comprising same and methods of use thereof in the treatment of a condition or pathology involving apoptosis (programmed cell death), are provided herein. In particular embodiments the invention, relates to use of such compounds for prophylaxis of Delayed Graft Function (DGF) in a recipient of a kidney from a deceased Expanded Criteria Donor (ECD), including as a kidney that has been preserved entirely by cold storage following removal from the donor and prior to implantation in the recipient.

(49) In some embodiments the nucleic acid compounds that target and down-regulate the p53 gene are having oligonucleotide sequences (SEQ ID NOS: 8-37). In some embodiments pharmaceutically acceptable salts of such compounds are used. In some embodiments of nucleic acid compounds having a double-stranded structure, the oligonucleotide sequence of one of the strands is selected from one of SEQ ID NOS: 8-20, 34 and 36 and the oligonucleotide sequence of the other strand is selected from one of SEQ ID NOS: 21-33, 35 and 37. For example, SEQ ID NO:21; SEQ ID NO:22; SEQ ID NO:23; SEQ ID NO:24; SEQ ID NO:25; SEQ ID NO:26; SEQ ID NO:27; SEQ ID NO:28; SEQ ID NO:29; SEQ ID NO:30; SEQ ID NO:31; SEQ ID NO:32; SEQ ID NO:33; SEQ ID NO:35; or SEQ ID NO:37.

(50) In some embodiments, the inhibitors of p53 are nucleic acid molecules, or pharmaceutically acceptable salts of such molecules, having a double-stranded structure in which (a) the nucleic acid molecule is a duplex which includes a sense strand and a complementary antisense strand; (b) each strand of the nucleic acid molecule is 19 nucleotides in length; (c) a 19 nucleotide sequence of the antisense strand is complementary to a consecutive sequence of a mRNA encoding mammalian p53 (e.g., SEQ ID NOS: 1-7) or portion thereof; and (d) the sense strand and antisense strand are selected from the oligonucleotide sequences set forth in Table 1 below (SEQ ID NOS: 8-37).

(51) TABLE-US-00002 TABLE1 Selectedsensestrandandantisensestrandoligonucleotidesequences fornucleicacidcompoundstargetingp53 SEQIDNO Sensestrand(5 > 3) SEQIDNO Antisensestrand(5 > 3) 8 5 CAGACCUAUGGAAACUACU3 21 5 AGUAGUUUCCAUAGGUCUG3 9 5 GGAUGUUUGGGAGAUGUAA3 22 5 UUACAUCUCCCAAACAUCC3 10 5 GACUCAGACUGACAUUCUA3 23 5 UAGAAUGUCAGUCUGAGUC3 11 5 GGGUUGGUAGUUUCUACAA3 24 5 UUGUAGAAACUACCAACCC3 12 5 GGGAUGUUUGGGAGAUGUA3 25 5 UACAUCUCCCAAACAUCCC3 13 5 GGAUCCACCAAGACUUGUA3 26 5 UACAAGUCUUGGUGGAUCC3 14 5 GAGGGAUGUUUGGGAGAUA3 27 5 UAUCUCCCAAACAUCCCUC3 15 5 GGGCCUGACUCAGACUGAA3 28 5 UUCAGUCUGAGUCAGGCCC3 16 5 GACUCAGACUGACAUUCUU3 29 5 AAGAAUGUCAGUCUGAGUC3 17 5 GCAUUUGCACCUACCUCAA3 30 5 UUGAGGUAGGUGCAAAUGC3 18 5 GGAUGUUUGGGAGAUGUAU3 31 5 AUACAUCUCCCAAACAUCC3 19 5 GGGCCUGACUCAGACUGAU3 32 5 AUCAGUCUGAGUCAGGCCC3 20 5 CAGACCUAUGGAAACUACA3 33 5 UGUAGUUUCCAUAGGUCUG3 34 5 CCGAGUGGAAGGAAAUUUG3 35 5 CAAAUUUCCUUCCACUCGG3 36 5 GAGAAUAUUUCACCCUUCA3 37 5 UGAAGGGUGAAAUAUUCUC3

(52) All positions given in Table 1 are 5>3 on the sense strand and on the antisense strand.

(53) In other embodiments, the inhibitors of p53 are nucleic acid compounds (e.g., dsNA molecules), or pharmaceutically acceptable salts of such compounds, in which (a) the nucleic acid molecule is a duplex which includes a sense strand and a complementary antisense strand; (b) each strand of the nucleic acid molecule is 19 nucleotides in length; (c) a 19 nucleotide sequence of the antisense strand is complementary to a consecutive sequence of a mRNA encoding mammalian p53 (e.g., SEQ ID NOS: 1-7) or portion thereof; and (d) the sense strand and antisense strand comprise sequence pairs set forth in Table 2 below.

(54) TABLE-US-00003 TABLE2 Selectedpairsofsenseandantisensestrandsforgenerating double-strandednucleicacidcompoundstargetingp53 PairName SEQIDNO Sensestrand(5 > 3) SEQIDNO Antisensestrand(5 > 3) p53_1 36 5 GAGAAUAUUUCACCCUUCA3 37 5 UGAAGGGUGAAAUAUUCUC3 p53_13 8 5 CAGACCUAUGGAAACUACU3 21 5 AGUAGUUUCCAUAGGUCUG3 p53_34 9 5 GGAUGUUUGGGAGAUGUAA3 22 5 UUACAUCUCCCAAACAUCC3 9 5 GGAUGUUUGGGAGAUGUAA3 31 5 AUACAUCUCCCAAACAUCC3 p53_35 10 5 GACUCAGACUGACAUUCUA3 23 5 UAGAAUGUCAGUCUGAGUC3 p53_36 11 5 GGGUUGGUAGUUUCUACAA3 24 5 UUGUAGAAACUACCAACCC3 p53_37 12 5 GGGAUGUUUGGGAGAUGUA3 25 5 UACAUCUCCCAAACAUCCC3 p53_38 13 5 GGAUCCACCAAGACUUGUA3 26 5 UACAAGUCUUGGUGGAUCC3 p53_39 14 5 GAGGGAUGUUUGGGAGAUA3 27 5 UAUCUCCCAAACAUCCCUC3 p53_40 15 5 GGGCCUGACUCAGACUGAA3 28 5 UUCAGUCUGAGUCAGGCCC3 p53_41 16 5 GACUCAGACUGACAUUCUU3 29 5 AAGAAUGUCAGUCUGAGUC3 p53_42 17 5 GCAUUUGCACCUACCUCAA3 30 5 UUGAGGUAGGUGCAAAUGC3 p53_43 18 5 GGAUGUUUGGGAGAUGUAU3 31 5 AUACAUCUCCCAAACAUCC3 18 5 GGAUGUUUGGGAGAUGUAU3 22 5 UUACAUCUCCCAAACAUCC3 p53_44 19 5 GGGCCUGACUCAGACUGAU3 32 5 AUCAGUCUGAGUCAGGCCC3 19 5 GGGCCUGACUCAGACUGAU3 28 5 UUCAGUCUGAGUCAGGCCC3 p53_45 20 5 CAGACCUAUGGAAACUACA3 33 5 UGUAGUUUCCAUAGGUCUG3 20 5 CAGACCUAUGGAAACUACA3 21 5 AGUAGUUUCCAUAGGUCUG3

(55) All positions given in Table 2 are 5>3 on the sense strand and on the antisense strand.

(56) In preferred embodiments the sense strand and the antisense strand of the double-stranded nucleic acid molecule are selected from the group consisting of a sense strand SEQ ID NO: 36 and an antisense strand SEQ ID NO: 37; a sense strand SEQ ID NO: 16 and an antisense strand SEQ ID NO: 29; a sense strand SEQ ID NO: 19 and an antisense strand SEQ ID NO: 32; and a sense strand SEQ ID NO: 19 and an antisense strand SEQ ID NO: 28.

(57) QP-1002

(58) QPI-1002 (also known as I5NP, CAS Number 1231737-88-4) having molecular weight 12,319.75 Daltons (protonated form), QPI-1002 Sodium Salt: 13,111.10 Daltons (sodium salt) is nuclease-resistant, chemically modified, synthetic, double-stranded (19-base pair) RNA oligonucleotide designed to temporarily inhibit the expression of the pro-apoptotic gene, p53, via activation of the RNA interference (RNAi) pathway. The sodium salt of QPI-1002 has the molecular formula: C.sub.380H.sub.448O.sub.262N.sub.140P.sub.36Na.sub.36. The RNA duplex is partially protected from nuclease degradation using a modification on the 2 position of the ribose sugar.

(59) The structure of QPI-1002 is as follows:

(60) TABLE-US-00004 (SEQIDNO:37) 5 UGAAGGGUGAAAUAUUCUC3 (antisensestrand) (SEQIDNO:36) 3 ACUUCCCACUUUAUAAGAG5 (sensestrand)
wherein each of A, C, U and G is a ribonucleotide and each consecutive ribonucleotide is joined to the next ribonucleotide by a covalent bond; and wherein alternating ribonucleotides in both the antisense strand and the sense strand are 2-O-methyl sugar modified ribonucleotides and a 2-O-methyl sugar modified ribonucleotide is present at both the 5 terminus and the 3 terminus of the antisense strand and an unmodified ribonucleotide is present at both the 5 terminus and the 3 terminus of the sense strand. Such that in the antisense strand each of the first, third, fifth, seventh, ninth, eleventh, thirteenth, fifteenth, seventeenth and nineteenth ribonucleotide is a 2-O-Methyl sugar modified ribonucleotide; and in the sense strand each of the second, fourth, sixth, eighth, tenth, twelfth, fourteenth, sixteenth and eighteenth ribonucleotide is a 2-O-Methyl sugar modified ribonucleotide.

(61) p53 protein is activated as a consequence of the acute renal tubular (ischemia-reperfusion) injury that can occur in donor kidneys transplanted following hypothermic preservation, particularly prolonged hypothermic preservation, such as for periods of 26 hours or more, and after removal of patients from cardiopulmonary bypass following major cardiac surgery, leading to the induction of apoptosis/programmed cell death. The temporary inhibition of p53 expression by QPI-1002 affords proximal tubular epithelial cells time to repair cellular damage and, therefore, avoid induction of apoptosis. Temporarily blocking induction of apoptosis has been shown by the present inventors reduce the severity, frequency or duration of reperfusion injury following prolonged ischemia.

(62) The administered dose of the temporary inhibitor of p53 must be effective to achieve prophylaxis, including but not limited to improved survival rate or more rapid recovery, or improvement or attenuation or prevention of symptoms and other indicators as are selected as appropriate measures by those skilled in the art. The compounds disclosed herein can be administered by any of the conventional routes of administration. It should be noted that the compound can be administered as the compound or as pharmaceutically acceptable salt and can be administered alone or as an active ingredient in combination with pharmaceutically acceptable carriers, solvents, diluents, excipients, adjuvants and vehicles. The compounds can be administered orally, subcutaneously or parenterally including intravenous, intraarterial, intramuscular, intraperitoneally, and intranasal administration as well as intrathecal and infusion techniques. Implants of the compounds are also useful. Liquid forms may be prepared for injection, the term including subcutaneous, transdermal, intravenous, intramuscular, intrathecal, and other parental routes of administration. The liquid compositions include aqueous solutions, with and without organic cosolvents, aqueous or oil suspensions, emulsions with edible oils, as well as similar pharmaceutical vehicles. In addition, under certain circumstances the compositions for use in the novel treatments of the present invention may be formed as aerosols, for intranasal and like administration. The patient being treated is a warm-blooded animal and, in particular, mammals including man. The pharmaceutically acceptable carriers, solvents, diluents, excipients, adjuvants and vehicles as well as implant carriers generally refer to inert, non-toxic solid or liquid fillers, diluents or encapsulating material not reacting with the active ingredients of the invention and they include liposomes, lipidated glycosaminoglycans and microspheres. Many such implants, delivery systems, and modules are well known to those skilled in the art.

(63) The invention has been described in an illustrative manner, and it is to be understood that the terminology which has been used is intended to be in the nature of words of description rather than of limitation.

(64) Citation of any document herein is not intended as an admission that such document is pertinent prior art, or considered material to the patentability of any claim of the present application. Any statement as to content or a date of any document is based on the information available to applicant at the time of filing and does not constitute an admission as to the correctness of such a statement.

EXAMPLES

(65) Without further elaboration, it is believed that one skilled in the art can, using the preceding description, utilize the present invention to its fullest extent. The following preferred specific embodiments are, therefore, to be construed as merely illustrative, and not limitative of the claimed invention in any way.

Example 1: Ischemia-Reperfusion Induced p53 Activation in Kidneys from Rat Donors

(66) Kidneys were harvested from young (3-month old) and old (14-month old) SD rats (n=4-6) and subjected to cold ischemia (CI) for 5 hours. One kidney from each animal was processed for protein extraction whereas the second kidney was transplanted into 3-month old syngeneic rats. The transplanted kidneys were harvested 24 hours after the surgery and the resultant onset of ischemia-reperfusion injury (IR) and also processed for protein extraction. Protein extracts were analyzed in ELISA for p53 expression levels.

(67) Results: In FIG. 1, the Y-axis shows arbitrary units corresponding to p53 protein levels measured in ELISA. FIG. 1 shows that the p53 protein level is significantly increased in transplanted kidneys from older rats, compared to transplanted kidneys from young rats (3 months old). Note that following p53 activation occurring via a variety of post-translational modifications, its steady-state levels are increased due to marked protein stabilization.

Example 2: Use of an Inhibitor of a p53 Gene for Prophylaxis of Ischemic Reperfusion Injury (IRI) and Delayed Graft Function (DGF) in a Kidney Transplantation Recipient

(68) A placebo-controlled, randomized, prospective, double-blind, multicenter, phase II, dose-escalation study of the clinical activity of QPI-1002 (10 mg/kg single bolus IV dose given at 30 minutes after the reperfusion) for prophylaxis of delayed graft function in ESRD dialysis-dependent patients undergoing deceased donor kidney transplantation as well as the safety and PK of QPI-1002 in these patients.

(69) The primary objectives of the study were 1) to assess the efficacy of QPI-1002 in the prevention of DGF and 2) to further assess the safety of a single-dose IV bolus infusion of QPI-1002 in high-risk patients following deceased donor renal transplantation.

(70) The primary endpoint was the incidence of DGF, whereas DGF was defined in the protocol as the necessity for dialysis during the first 7 days following the transplantation. The secondary endpoints included parameters measuring dialysis severity in dialyzed patients, kidney function in non-dialyzed patients immediately post-transplant (within 5 days) as well as kidney function at an intermediate-term observation point, i.e. at 30 days after transplantation.

(71) Materials and Methods

(72) Test product: QPI-1002 was provided by Quark Pharmaceuticals Inc., Fremont Calif., formulated as a preservative free, sterile solution formulated in phosphate buffered saline. The product was filled into clear Type I glass vials sealed with Teflon-coated butyl rubber stoppers with aluminum flip-off overseals. Each vial was provided for single use. Vials were stored at 2-8 C., protected from light. The solution was warmed to room temperature prior to use.

(73) QPI-1002 was administered via bolus intravenous injection at a dose of 10 mg/kg at about 30 minutes following completion of surgery and removal of the patient from the cardiopulmonary bypass machine, or following reperfusion of the transplanted kidney.

(74) Cold storage: Following removal from the donor, kidneys preserved by cold storage were flushed with cold preservative solution and placed in a sterile bag immersed in the solution. The sterile bag was placed inside an additional bag containing crushed ice.

(75) Machine-perfusion: Following removal from the donor, kidneys preserved by machine-perfusion were connected to a perfusion device configured to continuously pump perfusion fluid through the organ. non-limiting examples of commonly used devices for machine perfusion of donor kidneys include the Waters RM3 (IGL/Waters Medical Systems, Rochester Minn.) and the LifePort kidney transporter (Organ Recovery Systems, des Plaines, Ill., USA). Non-limiting examples of suitable preservation solutions include UW (University of Wisconsin) solution and HTK (histidine-tryptophan-ketoglutarate) solution. During machine perfusion, the perfusion pressure was monitored and verapamil administered as required to vasodilate the kidney.

(76) Patients: After obtaining written, informed consent, 332 patients scheduled for DDRT were randomized 1:1 to receive either a single IV dose of QPI-1002, 10.0 mg/kg or isotonic saline placebo (0.9% NaCl) in double-blind fashion, intraoperatively following allograft reperfusion (establishment of blood flow of the transplanted kidney). 331 patients received study drug (QPI-1002 or Placebo). Due to a pharmacy dispensing error, one patient did not receive a study drug.

(77) The following table provides details of patient analysis sets:

(78) TABLE-US-00005 TABLE A Analysis Sets ITT (Intent-to-treat): All patients randomized, transplanted and dosed, analyzed as randomized ITTEE: Efficacy evaluable (EE) patients: All patients randomized, transplanted and dosed, analyzed as randomized, (excludes four patients who experienced graft loss in first 24 hrs post-transplant and one patient who did not receive study drug) - this population was used in the analysis of the primary efficacy endpoint MITT (Modified Same as ITT but analyzed as treated - this population was used in intent-to-treat): safety analysis mITT(EE): Same as ITTEE but analyzed as treated - this population was used in efficacy analysis (secondary endpoints)

(79) Key eligibility criteria were designed to enroll patients scheduled to receive kidney transplant from a deceased donor in 4 subgroups formed based on the protocol-specified donor type and preservation modality (entirely cold-stored (CS) or at least partially machine-perfused (MP)): ECD/CS: ECD kidney that has been preserved by cold storage for the entire period of cold ischemia time (CIT), regardless of duration ECD/MP: ECD kidney that has been preserved by machine perfusion for any interval of time during the period of cold ischemia, where total CIT has been at least 26 hours SCD/SCD kidney that has been preserved by cold storage where total CIT has been at least 26 hours SCD kidney that has been preserved by machine perfusion for any interval of time during the period of cold ischemia, where total CIT has been at least 26 hours.

(80) Thus, estimated CIT duration did not limit study eligibility in the ECD/CS patients study group (Entirely cold stored ECD kidneys). Estimated CIT duration did limit eligibility (26 hours) in the other patient study groups:

(81) The following table provides stratification results for efficacy analysis:

(82) TABLE-US-00006 TABLE B Stratification Results for Efficacy Analysis Strata ITT mITT(EE) ITTEE % of mITT(EE) 332 patients 327 patients 327 patients Overall 100% 167 Placebo 163 Placebo 165 Placebo 165 QPI-1002 164 QPI-1002 162 QPI-1002 ECD/CS 54.4% 91 Placebo 88 Placebo 89 Placebo 90 QPI-1002 90 QPI-1002 88 QPI-1002 ECD/MP 11.6% 18 Placebo 19 Placebo 18 Placebo 20 QPI-1002 19 QPI-1002 20 QPI-1002 SCD/CS 11.6% 21 Placebo 21 Placebo 21 Placebo 19 QPI-1002 17 QPI-1002 19 QPI-1002 SCD/MP 22.4% 37 Placebo 35 Placebo 37 Placebo 36 QPI-1002 38 QPI-1002 35 QPI-1002

(83) It should be noted that organ donor type was not accurately identified until transplant, hence at time of randomization, final organ type was not identified. As can be seen from Table B, ECD/CS was largest stratum (N=178 (mITT(EE)), with more than 50% of patients included in this stratum. ITT & ITTEE strata are presented in Table B as organ donor type (ECD/SCD) used in randomization. mITT(EE) stratum is presented in Table B as per actual organ donor type (ECD/SCD).

(84) The age of the donors was as detailed in following Table C:

(85) TABLE-US-00007 TABLE C Donor Age Donor Age (yrs); mean (range) QPI-1002 Placebo Overall Population 53.9 (12-84) 53.6 (9-86) SCD/CS CIT >26 hrs 38.1 (12-56) 38.4 (9-59) SCD/MP CIT >26 hrs 37.1 (12-59) 38.0 (16-59) ECD/CS 62.9 (50-84) 62.4 (51-86) ECD/MP CIT >26 hrs 58.5 (50-74) 58.8 (51-69)

(86) DGF was defined as the need for dialysis within 24 hours following kidney transfer (excluding for hyperkalemia and/or hypervolemia).

(87) Among 327 efficacy-evaluable patients (162 QPI-1002; 165 Placebo), the mean ages were 58.9 and 59.1 yrs, respectively; 64.8% and 68.5%, were male, 23.5% and 22.4% were black (p=ns). There were no significant treatment differences based on recipient weight, body mass index (BMI), peak pre-transfer % panel reactive antibody (PRA), prior transfusion status or HLA mismatching. The pre-transfer DGF risk, determined per Irish nomogram (2010), was 35-36% in both groups (p=ns). Among donors, were ECD and SCD in each group; mean CIT and terminal serum creatinine, % with hypertension and cause of death were not significantly different between groups.

(88) Detailed description of recipient and donor demographics is provided in the following Table D:

(89) TABLE-US-00008 TABLE D Stratification Results for Efficacy Analysis Recipients Donors QPI-1002 Placebo QPI-1002 Placebo Age (yrs); mean (range) 58.9 (24-85) 59.1 (23-83) 53.9 (12-84) 53.6 (9-86) Sex (% male) 64.8 68.5 58.0 52.1 Race (% black) 23.5 22.4 11.7 9.7 Weight*, kg; mean (range) 79.4 79.2 80.8 (20.79).sup. 82.7 (21.11) BMI**, kg/m.sup.2; mean (SD) 27.6 (4.93) 27.6 (4.36) Prior blood transfusion, n (%) .sup.64 (39.8) .sup.63 (38.2) Peak % PRA***, mean (range) 16.9 (0-100) 14.2 (0-99) Donor/recipient HLA 4.4 (0-6) 4.4 (0-6) mismatches, mean (range) *Weight: Recipient weight at Screening evaluation; **BMI: Body mass index ***PRA: Panel reactive antibodies

(90) Table E provides non-demographic donor DGF risk variables:

(91) TABLE-US-00009 TABLE E Non-Demographic Donor DGF Risk Variables Donor QPI-1002 Placebo Donor type: (N = 162) (N = 165) ECD, n (%) 108 (66.7) 108 (65.5) SCD, n (%) 54 (33.3) 57 (34.5) Cold ischemia time, hrs, mean (range) 22.6 (3-65).sup. 23 (5-59) Terminal Scr*, mg/dL; mean (SD) (N = 159) (N = 165) 1.2 (0.84) 1.3 (0.95) History of hypertension, n (%) (N = 162) (N = 165) 85 (52.5) 90 (54.5) Cause of death (N = 112) (N = 114) Anoxia 30 (26.8) 29 (25.4) CVA/stroke 80 (71.4) 84 (73.7) Cardiac 2 (1.8) 1 (0.9) DGF risk probability, mean (SD) (N = 162) (N = 165) 0.35 (0.16) 0.36 (0.18) In Table E: *Scr: serum creatinine concentration; *PRA: Panel reactive antibodies.
Results

(92) Efficacy Endpoints: The primary endpoint of the study was the incidence of Delayed Graft

(93) Function (DGF) in the Intention-to-Treat (ITT) population of all randomized and transplanted patients, where DGF was defined as the need for dialysis initiated within the first 7 days post-transplant excluding the following:

(94) (i) Dialysis performed during the first 24 hours for one or more of the following reasons:

(95) Treatment of hyperkalemia or hypervolemia Hyperacute rejection or other antibody-mediated acute rejection (biopsy confirmed) Technical vascular complications involving the allograft: renal arterial and/or venous thrombosis due to vascular injury or technical surgical complications.
(ii) Dialysis performed during the first 7 days post-transplant for one or more of the following reasons: Obstructive uropathy (Radiographically confirmed) Fulminant recurrence of primary disease (underlying etiology of ESRD, biopsy confirmed), including focal segmental glomerulosclerosis A specific diagnosis of thrombotic microangiopathy (Thrombotic Thrombocytopenic Purpura or Hemolytic-Uremic Syndrome, biopsy confirmed).

(96) In addition to the primary endpoint, the following key exploratory efficacy endpoints were also evaluated:

(97) 1. The incidence of DGF in the modified Intention-to-Treat ((mITT)(EE)) population of all randomized and transplanted patients who received study drug, where DGF was defined as the need for acute dialysis within the first 7 days post-transplant excluding the following: Dialysis performed during the first 24 hours for one or more of the following reasons: Treatment of hyperkalemia or hypervolemia Hyperacute rejection or other antibody-mediated acute rejection (biopsy confirmed) Technical vascular complications involving the allograft: renal arterial and/or venous thrombosis due to vascular injury or technical surgical complications Dialysis performed during the first 7 days post-transplant for one or more of the following reasons: Obstructive uropathy (Radiographically-confirmed) Fulminant recurrence of primary disease (underlying etiology of ESRD), including focal segmental glomerulosclerosis A specific diagnosis of thrombotic microangiopathy (Thrombotic Thrombocytopenic Purpura or Hemolytic-Uremic Syndrome, biopsy confirmed)
2. Treatment differences in the rate of improvement in renal function over time
3. Treatment differences in the need for renal replacement therapy.

(98) As defined, DGF occurred in 50 (30.9%) and 60 (36.4%) of QPI-1002 and placebo patients, respectively (p=0.349), a 15.1% relative reduction in DGF risk. In the largest patient group (ECD/CS, n=178), DGF rates were 27.9% and 39.3% for QPI-1002 vs. placebo, respectively, a clinically meaningful 30.7% relative reduction (p=0.111). The probability of remaining dialysis free time-to-first post-transplant dialysis was significantly longer improved for QPI-1002 (log-rank p=0.045) and the mean duration of dialysis was numerically shorter in this stratum (3.5 vs. 9.0 days for QPI-1002 vs. placebo, respectively, p=0.097). The overall safety profile of the drug was consistent with that expected among DDRT recipients during the early post-transplant period, and similar in both treatment groups.

(99) Table F provides primary efficacy endpoint results in ITTEE population (Analyzed as randomized):

(100) TABLE-US-00010 TABLE F Primary Efficacy Endpoint (ITTEE population) QPI-1002 Placebo Relative Risk Strata N DGF n (%) N DGF n (%) Reduction (%) Overall 162 50 (30.86) 165 60 (36.36) 15.12 SCD/CS 19 7 (36.84) 21 7 (33.33) 10.53 CIT > 26 h SCD/MP 35 11 (31.43) 37 10 (27.03) 16.29 CIT > 26 h ECD/CS 88 24 (27.27) 89 35 (39.33) 30.65 ECD/MP 20 8 (40.00) 18 8 (44.44) 10 CIT > 26 h

(101) Results for secondary endpoint dialysis received any time during first 7 days post-transplant (UNOS definition) in ITTEE population and in ECD/CS stratum are provided in the following Table G:

(102) TABLE-US-00011 TABLE G Secondary Endpoint DGF (UNOS Definition) (ITTEE population) ITTEE population ECD/CS stratum overall (N = 327) only (N = 178) DGF DGF N % N % QPI-1002 62 37.80 QPI-1002 32 35.56 (n = 164) (n = 90) Placebo (n = 163) 76 46.63 Placebo (n = 88) 43 48.86 Relative 18.9 Relative 27.2 Reduction (%) Reduction (%) Risk difference 8.82 Risk difference 13.31 (95% CI) (19.49, 1.84) (95% CI) (27.69, 1.08) Fisher's Exact 0.1176 Fisher's Exact 0.0947 p-value p-value

(103) FIGS. 2a and 2b provide results for secondary endpoint probability of remaining dialysis free time to first post-transplant dialysis in mITT(EE) population (FIG. 2a) and in ECD/CS stratum (FIG. 2b), showing a greater reduction improvement in ECD/CS population treated with QP1-1002 as compared to the overall population.

(104) Results for secondary endpoint duration of the initial post-transplant course of dialysis in all patients and in ECD/CS stratum are provided in the following Table H:

(105) TABLE-US-00012 TABLE H Secondary Endpoint Duration of the Initial Post-Transplant Course of Dialysis QPI-1002 Placebo Duration Duration Relative (days) (days) Reduction N Mean (SD) N Mean (SD) (%) P-value* All 51 14.1 (27.75) 59 16.9 (30.91) 17 0.620 patients** ECD/CS*** 26 13.40 (34.43) 34 21.06 (39.61) 36 0.436 stratum *P-value: (Unpaired t-test) **All patients who received a course of dialysis that began during the first post-transplant week ***All ECD/CS patients who received a course of dialysis that began during the first post-transplant week

(106) Table H shows that clinically significant reduction of more than 30% was achieved in ECD/CS stratum, such that on average one week of dialysis was saved in patients receiving QPI-1002.

(107) Additional secondary efficacy endpoint was incidence of achieving an eGFR>10 mL/min/1.73 m2 for at least 3 of 7 days during the first post-transplant week (non dialysis-based DGF definition). Results are provided in Table I.

(108) TABLE-US-00013 TABLE I Post-transplant Recovery of Renal Function. Incidence of Decrease in Serum Creatinine 10%/day for 3 of First 7 Days. QPI-1002 Placebo Relative Fisher's Exact (n = 107)* (n = 92)* Drug Effect (%) P-value All patients 63 (58.9) 52 (56.5) 4.2 0.775 n (%) (n = 58)* (n = 50)* ECD/CS 34 (58.6) 23 (46.0) 27.4 0.247 n (%) *Analysis restricted to the serum creatinine concentrations of patients who were not receiving a course of dialysis (and had not received any dialysis for at least 48 hours).

(109) Additional non-dialysis DGF secondary efficacy endpoint was slope of estimated GFR (eGFR) versus time post-transplant. Results are provided in Table J.

(110) TABLE-US-00014 TABLE J Non Dialysis DGF Secondary Efficacy Endpoint. Slope of Estimated GFR (eGFR) Versus Time Post-transplant. QPI-1002 Placebo eGFR slope*, eGFR slope*, Relative mL/min/1.73 m.sup.2/day; mL/min/1.73 m.sup.2/day; Effect N mean (SD) N mean (SD) (%) P-value All patients 4-variable MDRD 164 2.7 (3.63) 163 2.4 (3.45) 12.5 0.587 equation Cockroft-Gault 155 2.6 (3.79) 153 2.4 (4.18) 8.3 0.701 equation Nankivell equation 100 2.5 (4.01) 100 2.6 (4.68) 4.0 0.825 B ECD/CS patients 4-variable MDRD 90 2.6 (3.40) 88 1.8 (2.88) 44.4 0.065 equation Cockroft-Gault 84 2.6 (3.70) 86 1.7 (3.23) 52.9 0.081 equation Nankivell equation 60 2.7 (4.14) 64 2.4 (4.42) 12.5 0.633 B *eGFR: Calculated after censoring serum creatinine results obtained during or within 48 hrs of completion of any course of dialysis.

(111) Additional non-dialysis DGF secondary efficacy endpoint was measured GFR at the day 30 study visit, determined with non-radiolabeled iothalamate, using a commercially available protocol (Mayo Clinic, Rochester Minn.), at North American sites only. Patients who were dialysis dependent within 48 hours of the Day 30 visit and those with any history of allergy to shellfish or iodinated radiocontrast were also excluded from participation in this assay. Results are provided in Table K.

(112) TABLE-US-00015 TABLE K Non Dialysis DGF Secondary Efficacy Endpoint. Post-transplant Recovery of Renal Function Measured GFR at the Day 30 Study Visit ECD/CS stratum ITTEE population only (N = 178) overall (N = 327) DGF DGF mGFR mGFR mean mean N (SD) N (SD) QPI-1002 62 33.8 (31.96) QPI-1002 (n = 90) 30 34.8 (n = 164) Placebo (n = 163) 76 29.3 (28.13) Placebo (n = 88) 36 21.1 Absolute GFR 4.54 Absolute GFR 13.72 difference (95% (5.58, 14.67) difference (95% (1.02, 26.41) CI) CI) Fisher's Exact 0.376 Fisher's Exact p- 0.035 p-value value

(113) An additional non-dialysis DGF secondary efficacy endpoint was urine output between 2 and 3 days post-transplant, as determined from the protocol-specified, Day 2-Day 3 quantitated urine output; the total volume reported was normalized to that of a 24-hour collection for each patient. Analysis excluded results from all patients who received, or were still receiving dialysis at any time post-transplant through the end of the (Day 2-Day 3) urine collection period. Results are provided in Table L.

(114) TABLE-US-00016 TABLE L Non Dialysis DGF Secondary Efficacy Endpoint. Urine Output Between 2 and 3 Days Post-transplant QPI-1002 Placebo Day 2-Day 3 Day 2-Day 3 urine output (# urine output (# Relative patients >500 patients >500 Effect N ml/day); mean (SD) N ml/day) mean (SD) (%) P-value All patients 80 71 (88.8) 79 62 (78.5) 13.1 0.090 All ECD/CS 40 37 (92.5) 41 28 (68.3) 35.4 0.011 patients

(115) Additional non-dialysis DGF secondary efficacy endpoint was based on treatment differences in the percentages of subjects with DGF, SGF and IGF, as defined per the criteria of Humar et al (Clinical Transplantation, 2002) and Johnston et al (NDT, 2006). Results are provided in Table M and the data suggest a shift from DGF to slow graft function (SGF) in QPI-1002 treated group.

(116) TABLE-US-00017 TABLE M Non Dialysis DGF Secondary Efficacy Endpoint. Incidence of Delayed, Slow and Immediate Graft Function (EGF, SGF and IGF). QPI-1002 Placebo Overall P-value, Adjusted Odds Event Subset (N = 164) (N = 163) (N = 327) unadjusted [2] Ratio [3] Humar et al. All patients (n = 133) (n = 134) (n = 267) IGF 36 (27.1) 36 (26.9) 72 (27.0) 0.112 0.8 (0.5, 1.2) SGF 35 (26.3) 22 (16.4) 57 (21.3) DGF 62 (46.6) 76 (56.7) 138 (51.7) Johnston et al All patients (n = 132) (n = 136) (n = 268) IGF 31 (23.5) 33 (24.3) 64 (23.9) 0.167 0.8 (0.5, 1.3) SGF 39 (29.5) 27 (19.9) 66 (24.6) DGF 62 (47.0) 76 (55.9) 138 (51.5)
Age Defined Limitations

(117) Primary Efficacy End-Point:

(118) The primary protocol definition-based and UNOS definition-based DGF results (relative risks and 95% confidence intervals) in the overall mITT(EE) population, the pre-specified ECD/CS stratum and in patients receiving kidneys from donors older than 45 or older than 35 years of age are shown in FIG. 3. FIG. 3 shows a Forest plot demonstrating the impact of QPI-1002 treatment on DGF relative risk reduction in graft recipients per donor kidney type. Relative risk (RR) is calculated as the ratio between DGF incidence in QPI-1002-treated patients and placebo-treated patients in a given patient subgroup. Box plots: Estimated RR values are marked with + inside the boxes. Box sizes are proportional to respective sample sizes. Line ends represent respective calculated RR 95% confidence limits (CL). Other definitions: Nnumber of patients in a given subgroup. RRRrelative risk reduction (%) calculated as RRR (%)=100*(RR-1). LCL95% lower confidence limit of RRR. UCL95% upper confidence limit of RRR.

(119) The strongest drug effect was observed in patients receiving kidneys from donors older than 45 years of age (n=252; 77% of all evaluable patients in this study regardless of subgroup attribution) where QPI-1002 reduced the incidence of DGF by about 30% relative to placebo. The results were the same when either the primary definition of DGF in this protocol or the widely accepted UNOS definition was used. This 30% difference was both statistically significant (protocol-defined DGFp=0.048; UNOS DGF definitionp=0.016) and clinically meaningful. Furthermore, when the donor age threshold was lowered to 35 years (n=281; 86% of all evaluable patients in this study regardless of subgroup attribution), QPI-1002 still retained its ability to reduce the DGF rate by relative 27%, a clinically and statistically significant difference (UNOS definition of DGF, p=0.023).

(120) These results are compatible with the new OPTN UNOS classification, which are designed to replace the previous ECD, SCD, DCD classification.

(121) Secondary Efficacy Endpoint:

(122) The impact of QPI-1002 on the severity of DGF was evaluated by looking at duration (in days) of the initial course of dialysis and intensity (in number of sessions) of dialysis in the first 30 days post-transplant. For both parameters, QPI-1002 produced numerically superior results in the overall mITT(EE) population (n=110), and in the subgroups of patients receiving ECD/CS kidneys (n=60) or in patients receiving kidneys from older donors at either 45 (n=88) or 35 (n=101) year of age thresholds. Specifically, in dialyzed QPI-1002-treated patients receiving ECD/CS kidneys both the duration and the intensity of dialysis were shorter by 46% relative to the placebo group. In the dialyzed patients receiving older kidneys (whether from donors older than 45 or 35 years of age) as well as in the overall patient population these reductions ranged from 26% to 33%%.

(123) The impact of QPI-1002 on kidney function in the immediate post-transplant period (5 days) in non-dialyzed patients was evaluated by measuring urine output as well as creatinine-based parameters related to glomerular function, i.e. eGFR and serum creatinine concentration. The number of patients in whom urine output was greater than 500 ml from day 2 to day 3 post-transplant was 35% higher among QPI-1002-treated ECD/CS patients when compared to the placebo group (n=81; p=0.011). Among patients receiving kidneys from older donors, the corresponding percentage increases associated with QPI-1002 treatment were 18% and 20% for donor age thresholds of 35 (n=132) and 45 (n=118) years of age, respectively.

(124) Tables 3a, 3b and 3c show endpoint data for overall recipient population, population of recipients who received a kidney from a donor 45 years old and older; and population of recipients who received a kidney from a donor 35 years old and older. Duration of DGF (ie., the total number of contiguous days counted from the DGF Start date to the DGF Stop date).

(125) TABLE-US-00018 TABLE 3a Overall Population Placebo QPI-1002 Absolute Relative Endpoint (N = 163) (N = 164) Difference Difference p-value DGF (Primary Endpoint) N = 163 N = 164 Percent 36.2% 31.1% 5.1 14.09% 0.351 DGF (UNOS) N = 163 N = 164 Percent 46.6% 37.8% 8.8 18.88% 0.118 Duration of DGF N = 59 N = 51 Mean Days (SD) 19.2 (36.9) 14.1 (27.8) 5.13 26.72% 0.417 Intensity of Dialysis N = 59 N = 51 Mean Dialysis Sessions (SD) 8.7 (15.7) 6.2 (11.8) 2.48 28.51% 0.356 24 hr Urine Output >500 ml N = 79 N = 80 between Day 2 and Day 3 78.5% 88.8% 10.3 13.12% 0.090 Percent eGFR Slope Cockroft-Gault N = 153 N = 155 Mean Coefficient (SD) 2.4 (4.2) 2.6 (3.8) 0.17 7.08% 0.701 eGFR Slope (MDRD) N = 163 N = 164 Mean Coefficient (SD) 2.4 (3.5) 2.7 (3.6) 0.21 8.75% 0.587 eGFR Slope Nankivell N = 100 N = 100 Mean Coefficient (SD) 2.6 (4.7) 2.5 (4.0) 0.14 5.38% 0.825 eGFR Day 30 Cockroft-Gault N = 127 N = 116 Mean (SD) 42.3 (20.1) 45.7 (20.2) 3.46 8.18% 0.183 eGFR Day 30 MDRD N = 151 N = 146 Mean (SD) 41.4 (20.7) 42.2 (21.2) 0.83 2.00% 0.734 eGFR Day 30 Nankivell N = 127 N = 116 Mean (SD) 53.3 (23.2) 56.9 (22.2) 3.54 6.64% 0.226 mGFR Day 30 N = 76 N = 62 Mean (SD) 42.6 (21.3) 42.5 (26.5) 0.13 0.31% 0.974

(126) TABLE-US-00019 TABLE 3b >45 years of age Placebo QPI-1002 Absolute Relative Endpoint (N = 163) (N = 164) Difference Difference p-value DGF (Primary Endpoint) N = 127 N = 125 Percent 40.94 28.8 12.14 29.66% 0.048 DGF (UNOS) N = 127 N = 125 Percent 50.39 35.2 15.19 30.15% 0.016 Duration of DGF N = 52 N = 36 Mean Days (SD) 20.7 (39.0) 14.3 (32.4) 6.39 30.87% 0.421 Intensity of Dialysis N = 52 N = 36 Mean Dialysis Sessions (SD) 9.3 (16.6) 6.2 (13.8) 3.10 33.3% 0.359 24 hr Urine Output >500 ml N = 60 N = 58 between Day 2 and Day 3 73.33 87.93 14.6 19.91% 0.063 Percent eGFR Slope Cockroft-Gault N = 121 N = 117 Mean Coefficient (SD) 2.0 (4.1) 2.4 (3.6) 0.40 20.0% 0.421 eGFR Slope (MDRD) N = 127 N = 125 Mean Coefficient (SD) 2.0 (3.3) 2.6 (3.6) 0.65 32.5% 0.136 eGFR Slope Nankivell N = 83 N = 81 Mean Coefficient (SD) 2.4 (4.6) 2.6 (4.0) 0.19 7.92% 0.783 eGFR Day 30 Cockroft-Gault N = 101 N = 89 Mean (SD) 39.1 (20.4) 42.9 (18.7) 3.81 9.74% 0.183 eGFR Day 30 MDRD N = 117 N = 111 Mean (SD) 37.2 (19.6) 40.3 (19.9) 3.12 8.39% 0.235 eGFR Day 30 Nankivell N = 101 N = 89 Mean (SD) 50.2 (24.1) 54.9 (21.8) 4.72 8.4% 0.161 mGFR Day 30 N = 56 N = 47 1.87 4.77% 0.663 Mean (SD) 39.2 (20.2) 41.1 (23.2)

(127) TABLE-US-00020 TABLE 3c >35 years of age Placebo QPI-1002 Absolute Relative Endpoint (N = 163) (N = 164) Difference Difference p-value DGF (Primary Endpoint) N = 139 N = 142 Percent 41.01 30.99 10.02 24.44% 0.084 DGF (UNOS) N = 139 N = 142 Percent 51.08 37.32 13.76 26.93% 0.023 Duration of DGF N = 57 N = 44 Mean Days (SD) 19.6 (37.4) 14.0 (29.6) 5.59 28.52% 0.419 Intensity of Dialysis N = 57 N = 44 Mean Dialysis Sessions (SD) 8.9 (15.9) 6.2 (12.7) 2.64 29.66% 0.370 24 hr Urine Output >500 ml N = 64 N = 68 between Day 2 and Day 3 73.44 86.76 13.32 18.14% 0.079 Percent eGFR Slope Cockroft-Gault N = 131 N = 134 Mean Coefficient (SD) 2.0 (4.2) 2.5 (3.8) 0.54 27.0% 0.271 eGFR Slope (MDRD) N = 139 N = 142 Mean Coefficient (SD) 2.0 (3.3) 2.7 (3.7) 0.66 33.0% 0.115 eGFR Slope Nankivell N = 90 N = 87 Mean Coefficient (SD) 2.3 (4.8) 2.5 (4.0) 0.20 8.70% 0.767 eGFR Day 30 Cockroft-Gault N = 109 N = 102 Mean (SD) 40.1 (20.3) 44.0 (19.2) 3.92 9.78% 0.152 eGFR Day 30 MDRD N = 129 N = 126 Mean (SD) 38.5 (19.7) 40.4 (20.0) 1.93 5.01% 0.439 eGFR Day 30 Nankivell N = 109 N = 102 Mean (SD) 51.0 (23.7) 55.4 (21.5) 4.45 8.73% 0.156 mGFR Day 30 N = 63 N = 54 Mean (SD) 41.0 (20.9) 42.3 (27.6) 1.33 3.24% 0.768

(128) Note that all day 30 GFR values in Tables 3a-3c are observed values and not change from baseline. Conclusions: The clinical benefit of the QPI-1002 in patients undergoing deceased donor renal transplantation with marginal kidneys increases with donor age.

(129) The best primary endpoint results were obtained for patients receiving kidneys from donors older than 45 years of age, regardless of their primary subgroup classification (that constituted 77% of all the evaluable patients in the study). A threshold of 35 years of age (86% of all the evaluable patients in the study regardless of subgroup classification) yielded similar benefits, which are:

(130) Clinically meaningful and, in some subgroups, statistically significant reduction in the incidence of dialysis in the first week post-transplantthe primary endpoint of this study.

(131) Clinically meaningful reductions in the duration and intensity of dialysis in patients who experienced DGF.

(132) Clinically meaningful increases in urine output and eGFR slope over time in the immediate post-transplant period in non-dialyzed patients; and,

(133) Clinically meaningful increase in day 30 eGFR.

(134) Non Dialysis/Renal Function Recovery Efficacy Conclusions:

(135) 1. eGFR Slope over time. Overall population showed modest increase in the rate of eGFR improvement over time in QPI-1002 treated patients compared to Placebo treated patients. Whereas ECD/CS stratum showed a clinically significant increase (44% MDRD) in the rate of eGFR improvement over time in QPI-1002 treated patients compared with Placebo-treated patients (p=0.065 for the eGRF calculated by the MDRD equation).
2. mGRF at Day 30. Overall population showed 4.5 mL/min/1.73 m2 increase in mGFR for QPI-1002 treated patients vs. placebo. Whereas ECD/CS stratum showed a clinically and statistically increase of 13.72 mL/min/1.73 m2in mGFR for QPI-1002 treated patients vs. placebo (p=0.035)
3. Urine output post transplantation. Overall population showed 13% increase in urine output in QPI-1002 patients vs. placebo (p=0.09). Whereas ECD/CS stratum showed 35% increase in urine output in QPI-1002 patients vs. placebo. (p=0.011).
4. A shift from DGF to SGF in QPI-1002 treated group.

Conclusion

(136) The rate of DGF was numerically lower among QPI-1002 treated patients as compared to patients receiving placebo in the largest (ECD/CS) group and was accompanied by reduced need for post-transfer dialysis and a comparable safety profile among both treatment groups. Patients undergoing DDRT with entirely cold-stored ECD kidneys may benefit from intraoperative, post-reperfusion treatment with QPI-1002 in terms of reduced need for dialysis and higher GFRs at 1 month post-transfer.

(137) Single-dose treatment with QPI-1002 following vascular reperfusion was associated with a safety profile similar to that of Placebo, and comparable to that expected among recipients of deceased donor renal transplants.

(138) Overall, recipients of single-dose treatment with QPI-1002 demonstrated a 15% lower rate of DGF when compared to Placebo. This result was not statistically significant.

(139) Among recipients of entirely cold-stored ECD kidneys, the largest stratum of study patients, a 30% treatment difference in the rate of DGF in favor of QPI-1002 approached statistical significance (p=0.11).

(140) Secondary endpoint analyses demonstrated clinically significant beneficial treatment differences versus Placebo in the following endpoints: Rate of DGF by the classical UNOS definition Time to first dialysis Severity of DGF: Duration and intensity eGFR Slope Urine output 2-3 days post transplantation Shift from DGF to SGF

(141) For many of these secondary endpoints the results for recipients of entirely cold-stored ECD kidneys, the largest stratum of study, more closely approached (and in some cases achieved) statistical significance.

(142) A potential pharmacoeconomic benefit was observed in the ECD/CS stratum in association with single-dose treatment with QPI-1002, in terms of: A significantly higher probability of remaining dialysis free, as demonstrated by Kaplan-Meier analysis (log-rank p<0.05); and Fewer total dialysis treatments received during the first 30 days post-transplant (lower dialysis intensity), a difference that approached statistical significance (p<0.10).

Example 2: Use of an Inhibitor of a p53 Gene for Prophylaxis of Delayed Graft Function (DGF) in a Recipient of a Kidney from Donors of Various Ages

(143) A study similar to Example 1 was performed to test the effectiveness of QPI-1002 using kidneys from donors of various ages that did not necessarily meet the criteria for ECD donors.

(144) In the efficacy analysis, the best primary endpoint results were obtained for patients receiving kidneys from donors older than 45 years of age (regardless of their primary subgroup classification) that constituted 77% of all the evaluable patients in the study). Importantly, a threshold of 35 years of age (86% of all the evaluable patients in the study regardless of subgroup classification) yielded similar benefits (listed below):

(145) Clinically meaningful and, in some subgroups, statistically significant reduction in the incidence of dialysis in the first week post-transplantthe primary endpoint of this study.

(146) Clinically meaningful reductions in the duration and intensity of dialysis in patients who experienced DGF.

(147) Clinically meaningful increases in urine output and eGFR slope over time in the immediate post-transplant period in non-dialyzed patients; and,

(148) Clinically meaningful increase in day 30 eGFRcustom character

Example 3: Dialysis Analysis in Phase II Study

(149) Objective: Dialysis has a pharmacoeconomic impact as well as health consequences. Therefore, a comparison of the number of dialyses from day 0 to day 180 between treatment groups is of interest.

(150) Statistical Methods: to compare between treatment groups (I5NP, Placebo) Zero-inflated Poisson regression model (ZIP), which is a statistical model based on a Poisson probability distribution that allows for frequent zero-valued observations. The dialysis count per patient variable is of such nature. Sensitivity analysis: Non-parametric test: Wilcoxon and Median Descriptive statistics: using counts, mean, standard deviation (SD), median, minimum and maximum

(151) The analysis was not limited to the first course only or conditioned on DGF event.

(152) Analysis scheme: The analysis was performed on the mitt(EE) population. Over all patients Donor age >35 years patient group Donor age >45 years patient group

(153) Study duration analysis 0-180 day and 0-7 days 7(+)-30 days 30+

(154) Technical (data) details: Dialysis data is drawn out from Dial file. In general, in Dial data set any record before day 30 is considered as a session and from day 30 and onward the record is regarded as a course which includes the start date and the end date. The number of dialyses in a course is calculated as follow: Number of Dialysis in a course=3*(Last date of the CourseStart date of a course)/7.

(155) Results: Overall patients: Overall, 936 dialysis have been performed in the study. Their distribution according to time interval and overall are summarized in Table 4a:

(156) TABLE-US-00021 TABLE 4a Overall dialysis distribution and time intervals - total population Overall Count Count Count Count Treat- dialysis dialysis dialysis dialysis ment 0 < days <= 180 0 < days <= 7 7 < days <= 30 day >30 I5NP 375 (40%) 138 (44%) 113 (41%) 124 (36%) Placebo 561 (60%) 178 (56%) 162 (59%) 221 (64%) Total 936 316 275 345 Dialysis

(157) Table 4b summarizes the mean, STD, min, max and median of the number of dialysis per patients for each treatment group. The most right hand side columns include the p-value obtained from the different tests for the treatment comparison.

(158) TABLE-US-00022 TABLE 4b comparison of mean number of dialysis per patients between treatment groups (Total population) Overall: Count dialysis 0 < days <= 180 Treatment N mean std min median max MedianP wilcoxonP I5NP 164 2.29 7.31 0 0 78 0.0857 0.112 Placebo 163 3.44 10.47 0 0 86

(159) The mean number of dialysis per patients in I5NP group is 2.29, which is of the Placebo group (3.44). The p-value is 0.086 according to the median test.

(160) The p-value obtained by the ZIP model is 0.014, which means that there is a significant reduction of the number of dialysis per patient in the I5NP group with respect to the Placebo group. Donor Age >45 kidneys patients sub-population: Overall, 796 dialysis have been performed in the sub population of donor age kidneys >45 years. Their distribution according to time interval and overall are summarized in Table 4c:

(161) TABLE-US-00023 TABLE 4c Overall dialysis distribution and time intervals - Donor Age >45 population Donor Age >45 Count Count Count Count Treat- dialysis dialysis dialysis dialysis ment 0 < days <= 180 0 < days <= 7 7 < days <= 30 day >30 I5NP 269 (34%) 93 (38%) 65 (30%) 111 (33%) Placebo 527 (66%) 151 (62%) 155 (70%) 221 (67%) Total 796 244 220 332 Dialysis

(162) Table 4d contains the descriptive statistics for the mean number of dialysis per patients according to treatment groups.

(163) TABLE-US-00024 TABLE 4d comparison of mean number of dialysis per patients between treatment groups Donor Age > 45 population Donor Age > 45: Count dialysis 0 < days <= 180 Treatment n mean std min median max MedianP wilcoxonP I5NP 125 2.15 7.95 0 0 78 0.0076 0.0071 Placebo 127 4.15 11.74 0 1 86

(164) The mean number of dialysis per patients in I5NP group is 2.15, which is of the Placebo group (4.14). The difference is statistically significant p-value is 0.0076 according to the median test.

(165) The p-value obtained by the ZIP model is <0.01, which means that there is a significant reduction of the number of dialysis per patient in the I5NP group with respect to the Placebo group. Donor Age >35 kidneys patients: Overall, 871 dialysis were performed in the sub population of donor age kidneys >35 years. Their distribution according to time interval and overall are summarized in Table 4e:

(166) TABLE-US-00025 TABLE 4e Overall dialysis distribution and time intervals - Donor Age >35 population Donor Age >35 Count Count Count Count Treat- dialysis dialysis dialysis dialysis ment 0 < days <= 180 0 < days <= 7 7 < days <= 30 day >30 I5NP 322 (37%) 118 (41%) 88 (35%) 116 (34%) Placebo 549 (63%) 168 (59%) 160 (65%) 221 (66%) Total 871 286 248 337 Dialysis

(167) Table 4f contains the descriptive statistics for the mean number of dialysis per patients according to treatment groups.

(168) TABLE-US-00026 TABLE 4F comparison of mean number of dialysis per patients between treatment groups Donor Age > 35 population Donor Age > 35: Count dialysis 0 < days <= 180 Treatment n mean std min median max MedianP wilcoxonP I5NP 142 2.27 7.63 0 0 78 0.0149 0.0186 Placebo 139 3.95 11.26 0 1 86

(169) The mean number of dialysis per patients in I5NP group is 2.27, which is of the Placebo group result (3.95). The difference is statistically significant p-value is 0.0149 according to the median test.

(170) The p-value obtained by the ZIP model is <0.01, which means that there is a significant reduction of the number of dialysis per patient in the I5NP group with respect to the Placebo group.

SUMMARY

(171) In total, the QPI-1002 patient group consumed of dialysis than of the Placebo patients group In the overall mITTEE population there is a significant reduction of the number of dialysis per patient in the I5NP group with respect to the Placebo group according to the ZIP regression model, and it is supported by the sensitivity non-parametric tests. In the sub-population according to donor age the p-values are smaller and the difference between treatment groups the mean numbers of dialysis per patient increase.

Example 4: Generation of Novel Sequences for Active dsNA Compounds

(172) Using proprietary algorithms and the known sequence of the mRNA of the p53 gene (SEQ ID NOS:1-7), the sequences of many potential dsNA compounds, were generated. The oligonucleotide sequences were prioritized based on their score in a proprietary algorithm as the best predicted sequences for targeting the human p53 gene expression.

(173) Exemplary sense and antisense sequences useful for generating a dsNA temporary inhibitor of p53 gene are shown in Table 2, supra, and include SEQ ID NOS:36 and 37; 8 and 21; 9 and 22; 9 and 31; 10 and 23; 11 and 24; 12 and 25; 13 and 26; 14 and 27; 15 and 28; 16 and 29; 17 and 30; 18 and 31; 18 and 22; 19 and 32; 19 and 28; 20 and 33; and 20 and 21.

Example 5: Identification of Preferred Sequences for Active Nucleic Acid Compounds and Generation of Double-Stranded Nucleic Acid Compounds

(174) The best scoring oligonucleotide sequences were further prioritized based on their activity in vitro. For this purpose, dsRNA compounds were synthesized having the following modification patterns:

(175) dsRNA compounds having unmodified ribonucleotides in the antisense strand and in the sense strand, and a -dTdT$ 3-end overhang in both the antisense strand and the sense strand, with dT designating thymidine and dT$ designating thymidine with no terminal phosphate.

(176) dsRNA compound having alternating 2-O-methyl (Me) sugar modified ribonucleotides are present in the first, third, fifth, seventh, ninth, eleventh, thirteenth, fifteenth, seventeenth and nineteenth positions of the antisense strand, whereby the very same modification, i.e. a 2-O-Methyl sugar modified ribonucleotides are present in the second, fourth, sixth, eighth, tenth, twelfth, fourteenth, sixteenth and eighteenth positions of the sense strand.

(177) The following assay was used for the in vitro activity studies.

(178) Activity Assay

(179) About 1.5-210.sup.5 tested human or rat cells endogenously expressing p53 genes (Human HCT116 cells or Rat REF52 cells) were grown in 6 wells plate in 1.5 ml growth medium for about 24 hours to 30-50% confluence. Cells were then transfected with tested dsNA compound in a required final concentration 0.001-100 nM per well using Liopofectamine 2000 reagent. In order to determine the transfection efficiency, of the study, 5 wells were treated independently with Lipofectamine 2000 reagent and defined as Negative Control samples and 5 wells were transfected independently with active dsRNA at final concentration of 5 nM defined as Control active samples (positive control). Cy3-labeled siRNA transfected cells were used as positive control for transfection efficiency. Cells were then incubated in a 371 C., 5% CO.sub.2 incubator for 48-72 hours. dsRNA transfected cells were harvested and RNA was isolated using EZ-RNA kit [Biological Industries (#20-410-100)]. Reverse transcription was performed as follows: cDNA was synthesized and human and/or rat p53 mRNA levels were determined, accordingly by Real Time qPCR and normalized to those of the Cyclophilin A (CYNA, PPIA) mRNA for each sample. dsRNA activity was determined based on the ratio of the mRNA quantity in siRNA-treated samples versus non-transfected control samples.

(180) As a result of the activity study preferred sequences for novel dsRNA compounds for down regulation of the p53 gene were identified (results not shown). These sequences are set forth in Table 1, supra (SEQ ID NOS: 8-37

Example 6: Generation and Testing of Modified Double-Stranded Nucleic Acid Compounds

(181) The preferred sequences (SEQ ID NOS: 8-37) were used for generating modified double-stranded nucleic acid compounds. Some modified double-stranded nucleic acid compounds that were generated using the preferred antisense strand and sense strand sequences are set forth in Tables N and O, below. Table P below shows some preferred modified double-stranded nucleic acid compounds that were generated using the preferred antisense strand and sense strand sequences (SEQ ID NOS: 8-37).

(182) TABLE-US-00027 TABLEN DuplexName Sensestrand(5 > 3) Antisensestrand(5 > 3) p53_34 GGAUGUUUGGGAGAUGUAA UUACAUCUCCCAAACAUCC p53_35 GACUCAGACUGACAUUCUA UAGAAUGUCAGUCUGAGUC p53_36 GGGUUGGUAGUUUCUACAA UUGUAGAAACUACCAACCC p53_37 GGGAUGUUUGGGAGAUGUA UACAUCUCCCAAACAUCCC p53_38 GGAUCCACCAAGACUUGUA UACAAGUCUUGGUGGAUCC p53_39 GAGGGAUGUUUGGGAGAUA UAUCUCCCAAACAAUCCCUC p53_40 GGGCCUGACUCAGAACUGAA UUCAGUCUGAGUCAGGCCC p53_41 GACUCAGACUGACAUUCUU AAGAAUGUCAGUCUGAGUC p53_42 GCAUUUGCACCUACCUCAA UUGAGGUAGGUGCAAAUGC p53_43 GGAUGUUUGGGAGAUGUAU AUACAUCUCCCAAACAUCC p53_44 GGGCCUGACUCAGACUGAU AUCAGUCUGAGUCAGGCCC p53_45 CAGACCUAUGGAAACUACA UGUAGUUUCCAUAGGUCUG

(183) In all tables above and below the duplex names are identified by prefixes p53 and TP53 that are used interchangeably.

(184) For all dsRNA compounds in Table N:

(185) A, U, G, Cdesignates an unmodified ribonucleotide;

(186) A, U, G, Cdesignates a 2-O-methyl sugar modified ribonucleotide;

(187) In various embodiments, in the nucleic acid compounds in Table N, the ribonucleotide at the 3 terminus and at the 5 terminus in each of the antisense strand and the sense strand may be phosphorylated or non-phosphorylated. In some embodiments, of the nucleic acid compounds in Table N, in each of the antisense strand and the sense strand the ribonucleotide at the 3 terminus is phosphorylated and the ribonucleotide at the 5 terminus is non-phosphorylated. In some embodiments, in each of the nucleic acid compound in Table N, the antisense strand and the sense strand are non-phosphorylated at both the 3 terminus and the 5 terminus.

(188) Certain exemplary duplexes for generation of double-stranded nucleic acid compounds for down-regulation of a p53 gene are set forth herein below in Table O. Additional duplexes are provided in the Examples section below.

(189) TABLE-US-00028 TABLEO P53duplexes. DuplexName Sense(N)y5> 3 Antisense(N)x5> 3 p53_13 custom character -CAGACCUAUGGAAACUACU-C3-pi AGUAGUcustom character UCCAUAGGUCUG-C3-C3 custom character -CAGACCUAUGGAAAcustom character -C3-pi AGUAGUcustom character UCCAUAGGUCUG-C3-C3 custom character -CAGACCUAUGGAAACUACU-pi AGUAGUUUCCAUAGGUCUG-pi custom character -CAGACCUAUGGAAAcustom character -C3-pi UGUAGUcustom character UCCAUAGGUCUG-C3-C3 custom character -CAGACCUAUGGAAACUACA-C3-pi UGUAGUUUCCAUAGGUCUG-pi custom character -CAGACCUAUGGAAACUACA-pi UGUAGUUUCCAUAGGUCUG custom character -CAGACCUAUGGAAACUACA UGUAGUUUCCAUAGGUCUG p53_34 custom character -GGAUGUUUGGGAGAUGUAA-C3-pi UUACAUcustom character UCCCAAACAUCC-C3-C3 custom character -GGAUGUUUGGGAGAcustom character -C3-pi UUACAUcustom character UCCCAAACAUCC-C3-C3 custom character -GGAUGUUUGGGAGAcustom character -C3-pi AUACAUcustom character UCCCAAACAUCC-C3-C3 custom character -GGAUGUUUGGGAGAUGUAU-C3-pi UUACAUcustom character UCCCAAACAUCC-C3-C3 custom character -GGAUGUUUGGGAGAcustom character -C3-pi AUACAUcustom character UCCCAAACAUCC-C3-C3 GGAUGUUUGGGAGAUGUAUzdTzdT$ AUACAUCUCCCAAACAUCCzdTzdT$ p53_35 custom character -GACUCAGACUGACAcustom character -C3-pi UAGAAUcustom character UCAGUCUGAGUC-C3-C3 custom character -GACUCAGACUGACAUUCUA-C3-pi UAGAAUcustom character UCAGUCUGAGUC-C3-C3 custom character -GACUCAGACUGACAUUCUA-C3-pi UAGAAcustom character GUCAGUCUGAGUC-C3-C3 custom character -GACUCAGACUGACAUUCUA-C3-pi UAGAAUcustom character UCAGUCUGAGUC-C3-C3 GACUCAGACUGACAUUCUAzdTzdT$ UAGAAUGUCAGUCUGAGUCzdTzdT$ p53_40 custom character -GGGCCUGACUCAGACUGAA-C3-pi UUCAGUcustom character UGAGUCAGGCCC-C3-C3 custom character -GGGCCUGACUCAGAcustom character -C3-pi UUCAGcustom character UGAGUCAGGCCC-C3-C3 custom character -GGGCCUGACUCAGACUGAU-C3-pi UUCAGcustom character CUGAGUCAGGCCC-C3-C3 custom character -GGGCCUGACUCAGAcustom character -C3-pi AUCAGcustom character CUGAGUCAGGCCC-C3-C3 custom character -GGGCCUGACUCAGACUGAA-C3-pi UUCAGUcustom character UGAGUCAGGCCC-C3-C3 custom character -GGGCCUGACUCAGACUGAU-C3-pi AUCAGUcustom character UGAGUCAGGCCC-C3-C3 custom character -GGGCCUGACUCAGACUGAA-C3-pi UUCAGcustom character CUGAGUCAGGCCC-C3-C3 GGGCCUGACUCAGACUGAAzdTzdT$ UUCAGUCUGAGUCAGGCCCzdTzdT$ p53_41 custom character -GACUCAGACUGACAcustom character -C3-pi AAGAAUcustom character UCAGUCUGAGUC-C3-C3 custom character -GACUCAGACUGACAUUCUU-C3-pi AAGAAUcustom character UCAGUCUGAGUC-C3-C3 custom character -GACUCAGACUGACAUUCUU-C3-pi AAGAAUcustom character UCAGUCUGAGUC-C3-C3 custom character -GACUCAGACUGACAUUCUU-C3-pi AAGAAcustom character GUCAGUCUGAGUC-C3-C3 GACUCAGACUGACAUUCUUzdTzdT$ AAGAAUGUCAGUCUGAGUCzdTzdT$ p53_43 custom character -GGAUGUUUGGGAGAcustom character -C3-pi AUACAUcustom character UCCCAAACAUCC-C3-C3 custom character -GGAUGUUUGGGAGAUGUAU-C3-pi AUACAUcustom character UCCCAAACAUCC-C3-C3 p53_44 custom character -GGGCCUGACUCAGACUGAU-C3-pi AUCAGUcustom character UGAGUCAGGCCC-C3-C3 custom character -GGGCCUGACUCAGAcustom character -C3-pi AUCAGcustom character CUGAGUCAGGCCC-C3-C3 custom character -GGGCCUGACUCAGACUGAU-C3-pi AUCAGcustom character CUGAGUCAGGCCC-C3-C3 custom character -GGGCCUGACUCAGACUGAU-C3-pi AUCAGUcustom character UGAGUCAGGCCC-C3-C3 p53_45 custom character -CAGACCUAUGGAAAcustom character -C3-pi UGUAGUcustom character UCCAUAGGUCUG-C3-C3 custom character -CAGACCUAUGGAAACUACA-C3-pi UGUAGUUUCCAUAGGUCUG-pi custom character -CAGACCUAUGGAAACUACA-pi UGUAGUUUCCAUAGGUCUG

(190) For all double-stranded nucleic acid compounds in Table O:

(191) A, U, G, Cdesignates an unmodified ribonucleotide;

(192) A, U, G, Cdesignates a 2-O-methyl sugar modified ribonucleotide;

(193) custom characterdesignates a nucleotide joined to an adjacent nucleotide by a 2-5 internucleotide phosphate bond (5>3);

(194) capdesignates a capping moiety. In some preferred embodiments the capping moiety is the group consisting of an abasic ribose moiety, an abasic deoxyribose moiety, an inverted deoxyribose moiety, an inverted deoxyabasic moiety (idAb), amino-C6 moiety (AM-c6), C6-amino-pi, a non-nucleotide moiety, a mirror nucleotide, a 5,6,7,8-tetrahydro-2-naphthalene butyric phosphodiester (THNB) and a conjugate moiety.

(195) pidesignates 3-phosphate.

(196) zdesignates capping moiety

(197) $designates no terminal phosphate

(198) dT$designates thymidine (no phosphate)

(199) C3designates 1,3-Propanediol, mono(dihydrogen phosphate) (C3) [CAS RN: 13507-42-1].

(200) C3-C3designates two consecutive C3 molecules.

(201) In various embodiments of the nucleic acid compounds described in Table O, supra, the C3-C3 non-nucleotide overhang covalently attached at the 3 terminus of the antisense strand is phosphorylated (C3-C3-pi).

(202) In some embodiments of the nucleic acid compounds described in Table O, supra, in each of the nucleic acid compounds, the ribonucleotide at the 5 terminus in the antisense strand is phosphorylated. In some embodiments of the nucleic acid compounds described in Table O, supra, in each of the nucleic acid compounds, the ribonucleotide at the 5 terminus in the antisense strand is non-phosphorylated.

(203) TABLE-US-00029 TABLEP dsRNA Compound Sense(N)y5> 3 Antisense(N)x5> 3 TP53_13_S2275 custom character -CAGACCUAUGGAAACUACU-custom character custom character -AGUAGUcustom character UCCAUAGGUCUG-custom character TP53_13_S2276 custom character -CAGACCUAUGGAAACUACU-custom character custom character -AGUAGUcustom character UCCAUAGGUCUG-custom character TP53_13_S2277 custom character -CAGACCUAUGGAAAcustom character custom character -AGUAGUcustom character UCCAUAGGUCUG-custom character TP53_13_S2278 custom character -CAGACCUAUGGAAAcustom character custom character -AGUAGUcustom character UCCAUAGGUCUG-custom character TP53_41-S709 GACUCAGACUGACAUUCUU-custom character AAGAAUGUCAGUCUGAGUC-custom character TP53_41_S2279 custom character -GACUCAGACUGACAUUCUU-custom character custom character -AAGAUcustom character UCAGUCUGAGUC-custom character TP53_41_S2298 custom character -GACUCAGACUGACAcustom character custom character -AAGAAUcustom character UCAGUCUGAGUC-custom character TP53_41_S2299 custom character -GACUCAGACUGACAcustom character custom character -AAGAAUcustom character UCAGUCUGAGUC-custom character TP53_41_S2300 custom character -GACUCAGACUGACAUUCUU-custom character custom character -AAGAAUcustom character UCAGUCUGAGUC-custom character TP53_44_S2301 custom character -GGGCCUGACUCAGAcustom character custom character -AUCAGUcustom character UGAGUCAGGCCC-custom character TP53_44_S2302 custom character -GGGCCUGACUCAGAcustom character custom character -AUCAGUcustom character UGAGUCAGGCCC-custom character TP53_44_S2303 custom character -GGGCCUGACUCAGACUGAU-custom character custom character -AUCAGUcustom character UGAGUCAGGCCC-custom character TP53_44_S2304 custom character -GGGCCUGACUCAGACUGAU-custom character custom character -AUCAGUcustom character UGAGUCAGGCCC-custom character

(204) In all tables above and below the duplex names are identified by prefixes p53 and TP53 that are used interchangeably. Thus, for example a compound identified by prefix p53_13 and TP53_13 designates a double-stranded nucleic acid compound having a sense strand sequence 5 CAGACCUAUGGAAACUACU 3 (SEQ ID NO:8) and an antisense strand sequence 5 AGUAGUUUCCAUAGGUCUG 3 (SEQ ID NO: 21).

(205) For all dsRNA compounds in Table P:

(206) A, U, G, Cdesignates an unmodified ribonucleotide;

(207) A, U, G, C designates a 2-O-methyl sugar modified ribonucleotide;

(208) custom characterdesignates a nucleotide joined to an adjacent nucleotide (5>3) by a 2-5 internucleotide phosphate bond;

(209) C3designates 1,3-Propanediol, mono(dihydrogen phosphate) also identified as 3-Hydroxypropane-1-phosphate capping moiety [CAS RN: 13507-42-1].

(210) C3C3designates a capping moiety consisting of two consecutive C3 molecules

(211) pidesignates 3-phosphate.

(212) 5-phosdesignates 5-phosphate

(213) These and other chemical modifications may be found in inter alia US patent and US application publications U.S. Pat. No. 8,362,229; 20120283309; 20130035368; 20130324591, to the assignee of the present application and incorporated by reference herein.

(214) Activity of modified double-stranded nucleic acid compounds was studies in human HCT116 cells and in rat REF52 cells.

(215) Table Q summarizes the in vitro activity results obtained for some of the double-stranded nucleic acid molecules in human HCT116 cell line. All of the dsNA compounds are described in Table P, supra.

(216) The p53_13_S500 compound has sense strand SEQ ID NO: 8 and antisense strand SEQ ID NO: 21 and the following modification pattern: alternating 2-O-methyl (Me) sugar modified ribonucleotides are present in the first, third, fifth, seventh, ninth, eleventh, thirteenth, fifteenth, seventeenth and nineteenth positions of the antisense strand, whereby the very same modification, i. e. a 2-O-Methyl sugar modified ribonucleotides are present in the second, fourth, sixth, eighth, tenth, twelfth, fourteenth, sixteenth and eighteenth positions of the sense strand.

(217) The in-vitro activity in Table Q is demonstrated as the % residual target mRNA relative to control.

(218) TABLE-US-00030 TABLE Q Sample Description Concentration of p53 residual (dsRNA compound dsRNA mRNA % of used) compound control None (control) 100 p53_13_S500 50 nM 25 p53_13_S500 25 nM 14 p53_13_S500 5 nM 33 p53_13_S500 1 nM 55 p53_1_S500 50 nM 22 p53_1_S500 25 nM 16 p53_1_S500 5 nM 52 p53_1_S500 1 nM 107 p53_13_S2275 50 nM 19 p53_13_S2275 25 nM 14 p53_13_S2275 5 nM 25 p53_13_S2275 1 nM 60 p53_13_S2276 50 nM 19 p53_13_S2276 25 nM 19 p53_13_S2276 5 nM 44 p53_13_S2276 1 nM 112 p53_13_S2277 50 nM 22 p53_13_S2277 25 nM 14 p53_13_S2277 5 nM 38 p53_13_S2277 1 nM 112 p53_13_S2278 50 nM 41 p53_13_S2278 25 nM 25 p53_13_S2278 5 nM 49 p53_13_S2278 1 nM 99 p53_41_S709 50 nM 5 p53_41_S709 25 nM 8 p53_41_S709 5 nM 14 p53_41_S709 1 nM 30 p53_41_S2279 50 nM 3 p53_41_S2279 25 nM 8 p53_41_S2279 5 nM 3 p53_41_S2279 1 nM 5 p53_41_S2298 50 nM 5 p53_41_S2298 25 nM 8 p53_41_S2298 5 nM 5 p53_41_S2299 1 nM p53_41_S2299 50 nM 3 p53_41_S2299 25 nM 3 p53_41_S2299 5 nM 5 p53_41_S2299 1 nM 5 p53_41_S2300 50 nM 3 p53_41_S2300 25 nM 3 p53_41_S2300 5 nM 2 p53_41_S2300 1 nM 3 p53_44_S2301 50 nM 5 p53_44_S2301 25 nM 5 p53_44_S2301 5 nM 3 p53_44_S2301 1 nM 14 p53_44_S2302 50 nM 3 p53_44_S2302 25 nM 3 p53_44_S2302 5 nM 5 p53_44_S2302 1 nM 8 p53_44_S2303 50 nM 3 p53_44_S2303 25 nM 5 p53_44_S2303 5 nM 3 p53_44_S2303 1 nM 3 p53_44_S2304 50 nM 5 p53_44_S2304 25 nM 5 p53_44_S2304 5 nM 11 p53_44_S2304 1 nM 19

(219) Table R summarizes the in vitro activity results obtained for some of the double-stranded nucleic acid molecules in rat REF52 cell line.

(220) The in-vitro activity in Table R is demonstrated as the % residual target mRNA relative to control.

(221) TABLE-US-00031 TABLE R Sample Description Concentration (dsRNA of dsRNA p53 residual mRNA % of compound used) compound control REF52 control None 100 p53_13_S500 50 nM 26 25 nM 30 5 nM 63 1 nM 68 p53_41_S709 50 nM 40 25 nM 87 5 nM 96 1 nM 211 p53_41_S2279 50 nM 38 25 nM 20 5 nM 21 1 nM 60 p53_41_S2298 50 nM 137 25 nM 81 5 nM 71 1 nM 113 p53_41_S2299 50 nM 116 25 nM 122 5 nM 107 1 nM 153 p53_41_S2300 50 nM 102 25 nM 81 5 nM 112 1 nM 149 p53_44_S2301 50 nM 12 25 nM 14 5 nM 25 1 nM 55 p53_44_S2302 50 nM 14 25 nM 9 5 nM 18 1 nM 59 p53_44_S2303 50 nM 20 25 nM 12 5 nM 12 1 nM 38 p53_44_S2304 50 nM 22 25 nM 33 5 nM 1 nM

Example 7: Evaluation of the Knock Down Activity of Double-Stranded RNA Molecules Using psiCHECK-2-System

(222) Three psiCHECK-2-based (Promega) constructs were prepared for the evaluation of the potential activity. The psiCHECK constructs contained single copies of matched complementary guide (AS-CM). 1.3-1.510.sup.6 human HeLa cells were inoculated in 10 cm dish. Cells were then incubated in 371 C., 5% CO.sub.2 incubator for 24 hours. Growth medium was replaced one day post inoculation by 8 ml fresh growth medium and each plate was transfected with one of the plasmids mentioned above, using Lipofectamine 2000 reagent according to manufacturer's protocol and incubated for 5 hours at 371 C. and 5% CO.sub.2. Following incubation, cells were re-plated in a 96-well plate at final concentration of 510.sup.3 cells per well in 80 l growth medium. After 16 hours, cells were transfected with transfection RNA compound using Lipofectamine 2000 reagent at final concentrations ranging from 0.01 nM to 100 nM in a 100 l final volume. Cells were then incubated for 48 hours at 371 C. following assessment of Renilla and FireFly luciferase activities as described below.

(223) 48 hours following transfection with double-stranded RNA compound, Renilla and FireFly luciferase activities were measured in each of the siRNA transfected samples, using Dual-Luciferase Assay kit (Promega, Cat#E1960) according to manufacturer procedure. Renilla luciferase activity value was divided by Firefly luciferase activity value for each sample (normalization). Renilla luciferase activity is finally expressed as the percentage of the normalized activity value in tested sample relative to the normalized value obtained in cells transfected with the corresponding psiCHECK-2 plasmid only but with no double-stranded RNA.

(224) The results of the activity study in psiCHECK-2-System (results not shown) were used to select the best highly active sequences for generating highly active double-stranded nucleic acid compound for down-regulating the p-53 gene.

(225) Although the above examples have illustrated particular ways of carrying out embodiments of the invention, in practice persons skilled in the art will appreciate alternative ways of carrying out embodiments of the invention, which are not shown explicitly herein. It should be understood that the present disclosure is to be considered as an exemplification of the principles of this invention and is not intended to limit the invention to the embodiments illustrated.

(226) Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, equivalents of the specific embodiments of the invention described herein. Such equivalents intended to be encompassed by the following claims.