Biocontrol of phytoparasitic nematodes by paecilomyces

Abstract

Provided herein are methods of preventing/controlling phytoparasitic nematodes in migratory and sedentary endoparasites belonging to families Anguinidae, Aphelenchidae, Aphelenchoididae, Criconematidae, Dolichodoridae, Hemicycliophoridae, Heteroderidae, Hoplolaimidae, Iotonchidae, Neotylenchidae, Pratylenchidae, Sphaerulariidae, Tilenchidae, and Tylenchulidae: Suborder Tylenchina; Longidoridae: Suborder Dorylaimina; Trichodoridae: Suborder Diphtherophorina using Paecilomyces carneus. The compositions and processes disclosed herein are useful in the prevention and/or control and/or eradication of phytoparasitic nematodes that infect and/or infest the vast majority of cultures for animal and human consumption, while optimum conditions are created in the soil for improving crop yield, with the option of getting organic products.

Claims

1. A method of controlling and/or eradicating a pest, phytoparasitic nematode, or fungus on plants or in soil comprising contacting a pest, a nematode, or a fungus with a composition comprising Paecilomyces carneus, wherein, said phytoparasitic nematode is selected from Anguinidae, Aphelenchidae, Aphelenchoididae, Criconematidae, Dolichodoridae, Hemicycliphoridae, Hoplolaimidae, Iotonchidae, Neotylenchidae, Pratylenchidae, Sphaerulariidae, Tylenchidae, Tylenchulidae: Suborder Tylenchina; Longidoridae: Suborder Dorylaimina; and Trichodoridae: Suborder Diphtherophorina; said pest is selected from Thysanoptera, Hemiptera, and Coleoptera; and said fungus is selected from Botrytis fabae, B. cinerea, Uromyces spp., Puccinia spp., Tranzschelia spp., Rhizoctonia spp., and Fusarium spp.

2. The method according to claim 1, wherein said phytoparasitic nematode is selected from Aphelenchus spp., Aphelencoides spp., Pratylenchus spp., Radopholus spp., Helicotylenchus spp., Criconema spp., Tylenchulus spp., Nacobbus spp., Rotylenchus spp., Rotylenchulus spp., Tylenchus spp., Ditylenchus spp., Criconemoides spp., Hoplolaimus spp., Xiphinema spp., Longidorus spp., Trichodorus spp., Discocriconemella spp., Hemicycliophora spp., Paratylenchus spp., and Tylenchorhinchus spp.

3. The method according to claim 1, wherein said method comprises contacting a pest or fungus with the composition, and wherein said composition further comprises Lecanicillium lecanii and/or Beauveria bassiana.

4. The method according to claim 1, wherein the plant is a coffee tree and the method comprises contacting the nematode or fungus on the coffee tree with a composition comprising Paecilomyces carneus in combination with Lecanicillium lecanii, Calcarisporium arbuscula, and Calcarisporium ovalisporum.

5. The method according to claim 4, wherein the phytoparasitic nematode is a gall-inducer nematode.

6. The method according to claim 1, wherein the plant is a potato with black scurf disease caused by a fungus, and wherein the method comprises contacting the fungus with a composition comprising Paecilomyces carneus in combination with Lecanicillium lecanii, Calcarisporium arbuscula, and Calcarisporium ovalisporum.

7. The method according to claim 6, wherein the fungus is Rhizoctonia solani.

8. The method according to claim 1, wherein the composition further comprises one or more biological control agents selected from Bacillus thuringiensis, Bacillus firmus, Sphingobacterium spiritivorum, Corynobacterium paurometabolum, Arthrobotrys spp., Pasteuria penetrans, Streptomyces dicklowii, Stevia rebaudiana, Streptomyces rubrogriseus, Pochonia chlamydosporia, Monacrosporium ullum, Bacillus amyloliquefaciens, Verticillium chlamydosporium, Bacillus subtillis, Bacillus licheniformis, Verticillium chlamydosporium, Paecilomyces lilacinus, Paecilomyces fumosoroseus, Paecilomyces lilacinus, Rhizoctonia solani, Fusarium oxysporum, Pythium sp., Phytophthora nicotiana, Verticillium dahliae, Paecilomyces cicadae, Corynebacterium paurometabolum, Lecanicillium lecanii, Beauveria bassiana, Calcarisporium arbuscula, Calcarisporium ovalisporum, plant extracts used for pest control, and combinations thereof.

9. The method according to claim 1, wherein the Paecilomyces carneus is Paecilomyces carneus having a genetic sequence of SEQ ID NO: 1.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1. Meloidogyne spp. parasitized by Paecilomyces carneus strain IE-431.

(2) FIG. 2. Development of Paecilomyces carneus strain 418 over Pratylenchus spp. at 72 hrs.

(3) FIG. 3. Development of Paecilomyces carneus strain 418 over Pratylenchus spp. at 120 hrs.

(4) FIG. 4. Pathoenicity plot for Paecilomyces carneus strain 418 over Hoplolaimus spp.

(5) FIG. 5. Pathoenicity plot for Paecilomyces carneus strain 418 over Criconemoides spp.

DETAILED DESCRIPTION OF THE INVENTION

(6) The present invention relates to the use and application of one or more cells of Paecilomyces carneus for the control and/or prevention and/or eradication of phytoparasitic nematodes from the groups of migratory endoparasites and/or sedentary endoparasites of the families Anguinidae, Aphelenchidae, Aphelenchoididae, Criconematidae, Dolichodoridae, Hemicycliophoridae, Heteroderidae, Hoplolaimidae, Iotonchidae, Neotylenchidae, Pratylenchidae, Sphaerulariidae, Tilenchidae, and Tylenchulidae: Suborder Tylenchina; Longidoridae: Suborder Dorylaimina; Trichodoridae: Suborder Diphtherophorina, that infect and/or infest cropland.

(7) The Paecilomyces carneus strains IE-412, IE-416, IE-418, IE-419, IE-431, IE-451, and IE-452 are deposited, preserved and stored in the ceparium of fungi of the Instituto de Ecologia A.C. (INECOL), production and/or isolation and/or preservation of such strains is performed by breeding them on a solid culture medium consisting of at least one source of nitrogen and/or at least one carbon source and/or one or more mineral salts and/or at least a suitable carrier and/or at least one antibiotic agent and/or at least one growth promoting agent. The incubation temperature of the fungus in the culture medium is about 13-37 C.

(8) Propagation and reproduction of the fungus consist in the inoculation of cells in compositions of solid or liquid mediums comprising one or more amino-acids, and/or one or more long-chain carbohydrates, and/or one or more mineral salts, and/or one or more vehicles, and/or one or more antibiotic agents, and/or one or more buffers in sufficient quantities. The culture is fixed or static and with uninterrupted oxygenation in a percentage between 40% and 90% of oxygen content to allow the optimum development of the fungus Paecilomyces carneus.

(9) The mechanism of action of Paecilomyces carneus is characterized by the production of specific enzymes that allow it to degrade the cuticle and penetrate to the interior of the nematode in any of its stages (juvenile and adult eggs, among others), where it grows and reproduces until causing the death of the different taxonomic groups of phytoparasitic nematodes.

(10) The 1E-418 strain of Paecilomyces carneus is characterized by having the DNA nucleotide sequence coded as follows:

(11) TABLE-US-00002 GGGATCATTACCGAGTTTACAACTCCCAAACCCCCTGTGAACTTATACCA TTTACTGTTGCTTCGGCGGGTCACGGCCCCGGGGAAGGACAGCGGTCGCC GTCAGGCCTCAGCTGCCCGCCCCCGGAAACAGGCGCCCGCCGGGGAACTC AAACTCTTCTGTATTTCTTTATCTAATATATACTGTCTGAGTAAAAACTA AAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGA AGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAAT CATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATG CCTGTTCGAGCGTCATTTCAACCCTCAAGTCCCCTGTGGACTCGGTGTTG GGGACCGGCGAGACAGCCGCGGATCTTCTTCCGCAGCGAGTCGCCGCCCC CCAAATGACTTGGCGGCCTCGTCGCGGCCCTCCTCTGCGTAGTATAGCAC ACCTCGCAACAGGAGCCCGGCGAATGGCCACTGCCGTAAAACCCCCCAAC TTTTTCAGAGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGC ATATCA(SEQIDNO:1).

(12) The IE-418 strain of Paecilomyces carneus has the following structural features:

(13) Mycelium with radial growth, upright conidiophores, in PDA grows 12 mm in 10 days, white hairy dusty mycelium, in EMA grows from 9 to 11 mm in ten days. In both media it stains dark green 29F8 the back of the culture medium plate according to the 1961's Farver i Farver color chart from Wanscher and Kornerup. White mycelium, filamentous dusty texture. In oatmeal agar (OA) it grows from 18 to 20 mm in ten days. Mycelium with dusty texture due to the sporulation, which turns from white to slightly pinkish 7A2 in OA in a time greater than 55 days after inoculation. It stains slightly the culture medium in the back of the case with grayish yellow 3C3 or 3C4 irregularly after 35 days, and in the oldest parts with olive green 3E7. Bottle-shaped conidiogenic cells, tapering towards the tip in a very thin neck, monophialidic, or in well-defined verticillia of 2-5 cells, although groups of three cells predominate, with a minimum length of: 7.2-8.8 m; the more frequent length is: 9.6-10.4 m and the greater length is between: 11-14.4 m. The width is 1.6-2.4 m. Subglobose conidia, ellipsoidal to spheric, equinulated, arranged in chains. The spores are 2.4-4.0 m long and 1.6-2.4 m. width. In 5 mm discs, the sporulation is 2510.sup.6 spores.

(14) The IE-418 strain from Paecilomyces carneus product of the present invention, is characterized by having the ability to infect and/or infest phytoparasitic nematodes from groups of: migratory endoparasites, and/or sedentary endoparasites, and/or semiendoparasites, and/or migratory ectoparasites, and/or sedentary ectoparasites from the classification according to the molecular analysis proposed by De Ley P. and Blaxter. M. in 2004, from the following families: Anguinidae, and/or Aphelenchidae, and/or Aphelenchoididae, and/or Criconematidae, and/or Dolichodoridae, and/or Hemicycliophoridae, and/or Heteroderidae, and/or Hoplolaimidae, and/or Iotonchidae, and/or Neotylenchidae, and/or Pratylenchidae, and/or Sphaerulariidae, and/or Tilenchidae, and/or Tylenchulidae: Suborder Tylenchina; and/or Longidoridae: Suborder Dorylaimina; and/or Trichodoridae: Suborder Diphtherophorina.

(15) During the investigation of the use and application of the IE-431 strain of Paecilomyces carneus in the control, and/or prevention, and/or eradication of phytoparasitic nematodes, migratory and sedentary endoparasites, semiendoparasites, and migratory and sedentary ectoparasites it was established that said strain, even when infects such nematodes, requires at least 15 days for the infection without controlling and/or eradicating the nematodes, except in the case of Meloidogyne spp. Surprisingly and unexpectedly it was found that the IE-418 strain of Paecilomyces carneus infests and/or infects the phytoparasitic nematodes in less than 72 hours, controlling and eradicating the above-mentioned families of nematodes.

(16) A first stage of evaluation of the effectiveness and efficiency of the IE-418 strain of Paecilomyces carneus, was carried out placing cells (conidiospores, and/or blastospores, and/or hyphal fragments) in a suspension of Paecilomyces carneus IE-418 in contact with migratory and sedentary endoparasitic nematodes, semiendoparasites and migratory and sedentary ectoparasites, among which are: Meloidogyne spp., Pratylenchus spp., Radopholus spp., Helicotylenchus spp., Criconemoides spp.; Hoplolaimus spp.; Xiphinema spp. and, separately the same nematodes were placed in contact with Paecilomyces carneus strain IE-431.

(17) The results of this first stage for the IE-431 strain of Paecilomyces carneus were the following:

(18) 1. The viability of the juvenile and adult egg masses of nematodes of genus Meloidogyne spp. is reduced.

(19) 2. At 24 hours after being brought into contact, the fungus germinated and penetrated to the host.

(20) 3. At 72 hours the mycelium was found in development both inside and outside of the egg masses and females of Meloidogyne spp.

(21) 4. At 120 hours the fungus completely invaded the whole egg mass and the interior of the females of Meloidogyne spp. (FIG. 1).

(22) The results of this first stage for the IE-431 strain of Paecilomyces carneus with Pratylenchus spp., Hoplolaimus spp., and Criconemoides spp. were the following:

(23) 1. At 120 hours after being brought into contact, some fungal spores germinating on the cuticle of the nematode were seen.

(24) 2. At 15 days, the mycelium had an incipient development outside the nematode, so it is not possible to control or to eradicate the same.

(25) The results of this first stage for the IE-431 strain of Paecilomyces carneus were the following:

(26) 1. At 48 hours after being brought into contact, the fungus germinated and penetrated to the nematode.

(27) 2. From 72 (FIG. 2) to 120 hours (FIG. 3) the mycelium was found in development both inside and outside the nematode, which indicates the potential for control and/or eradication thereof.

(28) In a second stage, it was carried out the assessment of pathogenicity expressed as % mortality for IE-418 strain of Paecilomyces carneus in contact with ectoparasitic nematodes (FIG. 4):

(29) 1. 2% mortality was obtained in individuals of Hoplolaimus spp. at 24 hours of exposition to Paecilomyces carneus IE-418.

(30) 2. At 24 hrs of exposition to the fungus a 68% mortality was found for Hoplolaimus spp. At 120 hrs of exposition to the fungus a 78% mortality was found for individuals of

(31) 3. Hoplolaimus spp.

(32) 4. On the contrary, in the blank treatment it was found only 26% individuals of Hoplolaimus spp. dead at 120 h after the start of the experiment.

(33) In the assessment of pathogenicity expressed as mortality for IE-418 strain of Paecilomyces carneus in contact with Criconemoides spp. (FIG. 5.)

(34) 1. 46% mortality of individuals of Criconemoides spp. was obtained at 24 hrs of exposure to IE-418 strain of Paecilomyces carneus.

(35) 2. At 72 hrs of exposure to IE-418 strain of Paecilomyces carneus more than 80% individuals of Criconemoides spp. were found parasited with the fungus.

(36) 3. Finally at 120 hrs after having infected the nematodes Criconemoides spp. with IE-418 strain of Paecilomyces carneus 96% individuals were found dead, and with visible sporulation.

(37) 4. On the contrary, in blank treatment, it was not seen evidence of mycelium and only a 16.6% mortality was found.

(38) In a third stage, the application procedure of Paecilomyces carneus was combined with crop rotation and application of Beauveria bassiana and Lecanicillium lecanii for combating in parallel other existing crop pests such as: thrips (Order Thysanoptera), whitefly (Order Hemiptera), greenfly Aphis spp. (Order Hemiptera) (which may affect the plant since its early stages, which significantly affect production), and the chafer, Macrodactylus spp. (Order Coleoptera), which is an omnivorous insect and can destroy a crop in a few days; and diseases caused by Helotiales, such as Botrytis fabae (chocolate spot disease), and/or B. cinerea (grey rot), and/or diseases caused by Uredinales, such as Uromyces spp., and/or Puccinia spp., and/or Tranzschelia spp. (rusts), which producers of various crops can no longer control with chemicals sold in the market.

(39) For the prevention, and/or control, and/or eradication of nematodes and also said pests and diseases, Lecanicillium lecanii was used in early stages of plant growing, applied separately or in combination with Paecilomyces carneus in the soil.

(40) Surprisingly, the results obtained were the significant reduction of thrips, whitefly and greenfly pests, and an almost complete reduction of chocolate spots. With regard to the rust, the crop remains clean until the production of sheaths and filling thereof in the case of broad bean, i.e., when the seed is ripe and ready to be harvested.

(41) Additionally, Beauveria bassiana was applied for the control of Macrodactylus spp. In 2 or more days such pest starts to die and diminish significantly the culture damage. To obtain better results, the fungus Beauveria bassiana is applied during farm work to affect before the larval stage and thus reduce the population.

(42) The results obtained were an increment in the yield of wide bean plants in plots treated with biological control, in comparison with plots with chemical control (50% less sheaths) and the blank plot.

(43) Therefore, the strain IE-418 of Paecilomyces carneus is characterized by reducing the nematode population since the first application with total efficacy reached in three to five days for nematodes of Families Anguinidae, and/or Aphelenchidae, and/or Aphelenchoididae, and/or Hemicycliophoridae, and/or Heteroderidae, and/or Hoplolaimidae, and/or Iotonchidae, and/or Neotylenchidae, and/or Pratylenchidae, and/or Sphaerulariidae, and/or Tilenchidae, and/or Tylenchulidae: Suborder Tylenchina; and/or Longidoridae: Suborder Dorylaimina; and/or Trichodoridae: Suborder Diphtherophorina. However, the strain IE-431 fails to carry out its nematicide action in most of the above-mentioned phytoparasitic nematodes, but it is extremely effective and specific in endoparasitic and/or semiendoparasitic nematodes of Family Heteroderidae.

(44) The present invention discloses a method for isolation, and/or preservation, and/or massive reproduction of Paecilomyces carneus, as well as the use, and/or application thereof for the control, and/or prevention, and/or eradication of nematodes infecting and/or infesting areas for cultivation of Swiss chard, agave, avocado, garlic, alfalfa, cotton, sugar-apple, rubber tree, myrtle, rice, oat, baricoco, bamboo, begonia, egg plant, broccoli, peanut, coffee, cocoa, star apple, zucchini, pumpkin, courgette, bitter berry, she-oak, camellia, sweet potato, cinnamon, sugar cane, starfruit, apricot, safflower, barley, onion, cedar, citron, plumb, citrus plants, coconut tree, cabbage, cauliflower, carnation, chrysanthemum, ice-cream bean, chicozapote, pea, chili, peach, epazote, spihach, loofah, raspberry, strawberry, ash, bean, gardenia, chick pea, gladiolus, pomegranate, guava, wide bean, fig, Mexican yam, lettuce, lime, lemon, maize, mamee, tangerine, apple tree, mango, daisy, shasta daisy, melon, quince, mint, blackberry, yam, orange, nectarine, walnut tree, prickly pear, okra, papaya, potato, barnyard grass, cucumber, pear, banana, pepper, pine, pineapple, dragon fruit, pummelo, watermelon, white willow, satsuma, sorghum, soy, tobacco, tomato, ground cherry, grapefruit, wheat, vine, Madagascar periwinkle, African violet, carrot, yellow mombin, yellow chapote, cherimoya, soursop, paradise plum, cashew tree, melon, loquat, cucumber, persimmon, rose apple, watermelon, yellow sapote, white sapote, black sapote, sugar apple, between other crops in which this type of parasite spreads.

(45) The compositions with cells of Paecilomyces carneus can be developed for application in the form of suspension, granules, powder, lyophilized, pellets, controlled release forms, ecological pump, gels, jellies, pastes, capsules, immobilized cells, emulsion, micro-emulsion, solution, and/or combinations thereof.

EXAMPLES

(46) Nematicide compositions of Paecilomyces carneus obtained are provided below in a descriptive and not restrictive way:

Example 1: Composition 1 of Paecilomyces carneus Strain 418

(47) TABLE-US-00003 COMPONENT AMOUNT Paecilomyces carneus cells 0.5 10.sup.7 cells/mL Carrot juice 80-100 mL Yeast 0.1-5.0 g/L Ampicillin 500 mg Water q.s. 1000 mL

Example 2: Composition 2 of Paecilomyces carneus Strain 418

(48) TABLE-US-00004 COMPONENT AMOUNT Paecilomyces carneus cells 0.5 10.sup.7 cells/mL Oat 20-50 g/L Yeast 0.1-5.0 g/L Chloramphenicol 1000 mg Water q.s. 1000 mL

Example 3: Composition 3 of Paecilomyces carneus Strain 418

(49) TABLE-US-00005 COMPONENT AMOUNT Paecilomyces carneus cells 0.5 10.sup.7 cells/mL Oat 5-25 g/L Yeast 0.1-5.0 g/L Chloramphenicol 1000 mg Water q.s. 1000 mL

Example 4: Composition 4 for Isolation and Preservation of Paecilomyces carneus Strain IE-418

(50) TABLE-US-00006 COMPONENT AMOUNT Paecilomyces carneus cells 0.5 10.sup.7 cells/mL Carrot 50-160 g/L Potato 20-50 g/L Chloramphenicol 1000 mg Water q.s. 1000 mL

Example 5: Composition 5 for Isolation and Preservation of Paecilomyces carneus Strain IE-418

(51) TABLE-US-00007 COMPONENT AMOUNT Paecilomyces carneus cells 0.5 10.sup.7 cells/mL Rye 15-50 g/L Chloramphenicol 1000 mg Water q.s. 1000 mL

(52) The application method of one or more compositions of Paecilomyces carneus generally consists in:

(53) One or more applications of the composition(s) of Paecilomyces carneus to the soil at least 10 days prior to sowing for disinfecting it. The number of applications depends on the species of the phytoparasitic nematodes and its population density.

(54) In the case of crops whose sowing is carried out from tubers, bulbs, rhizomes, corms, among others, the application consists in immerse them in the composition(s) for at least one hour before the sowing.

(55) For the transplantation of shrub and/or tree crops, the application is performed directly to the root of the plant and/or to the soil where they will be sown.

(56) In the case of crops planted by seeds, the composition(s) are applied in the furrow before laying the seed and/or directly in the seed shortly before sowing.

(57) Optionally and without limitations, the application of the composition(s) is performed after sowing and/or during the growing of the crop.

(58) During and/or after the harvest, and/or during the culture rotation period, and/or the soil rest the application of the composition(s) is done to the soil in order to prevent new infestations and/or control and/or eradicate the phytoparasitic nematodes population remaining. This practice prepares the soil for the next growing cycle.

(59) Complementarily, it can be added to said composition one or more biological agents for nematode control, selected from the following: Bacillus thuringiensis, Bacillus thuringiensis ATCC 55273, Bacillus firmus CNCMI-1582, Sphingobacterium strain spiritivorum, Corynobacterium paurometabolum, Arthrobotrys spp., Pasteuria penetrans 98-35, Streptomyces dicklowii, Stevia rebaudiana, Streptomyces rubrogriseus, Pochonia chlamydosporia, Monacrosporium ullum, Bacillus amyloliquefaciens, Verticillium chlamydosporium CC 334168, Bacillus subtillis No. DSM17231, and/or Bacillus licheniformis DSM 17236, Verticillium chlamydosporium, Paecilomyces lilacinus, Paecilomyces fumosoroseus, Paecilomyces lilacinus 251, Paecilomyces lilacinus 252, Paecilomyces lilacinus 253, and Paecilomyces lilacinus 254, Rhizoctonia solani AG-4, Fusarium oxysporum, Pythium sp., Phytophthora nicotiana, Verticillium dahliae, Paecilomyces cicadae, Sphingobacterium spiitivorum C-926, and/or Corynebacterium paurometabolum C-924 Paecilomyces carneus strain IE-431, and/or Beauveria bassiana, and/or Lecanicillium lecanii, and/or Calcarisporium spp., and/or combinations thereof.

(60) In a comprehensive manner, the present invention provides the following advantages:

(61) 1. Biological method for rational management of nematode pests in crops.

(62) 2. Quality improvement of soil for cultivation.

(63) 3. Remediation of soil damaged by chemical agents like pesticides.

(64) 4. Obtaining high-quality agricultural products and forestry resources.

(65) 5. Improvement in crop and/or forest resources yield.

(66) 6. Favors the provision of macro elements such as phosphorus in the soil to the plant and improves soil fertility. Its phosphate solubilization efficacy is comparable to that of Penicillium spp. and Aspergillus spp.

(67) 7. The eradication of phytoparasitic nematodes is seen from the first application in less time compared to other control methods.

(68) 8. Nematicide compositions obtained are safe for humans, plants, and animals.

(69) 9. It allows the combination with other control methods such as crop rotation, soil rest, among others.

(70) 10. Is a sustainable method of prevention, and/or control, and/or eradication of phytoparasitic nematodes, easy to manage and apply.

(71) 11. It is an economic and profitable method in the short, medium and long term.

(72) 12. The specificity is due to the production of specific enzymes that attack the phytoparasitic nematodes without affecting the free-living nematodes beneficial to the agricultural system.

(73) IE-418 strain was also deposited in the Chilean Collection of Microbial Resources (CChRGM) with the access number RGM2140 Date Dec. 13, 2013