High affinity T cell receptor and use thereof

09862755 ยท 2018-01-09

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention is directed to a high affinity T cell receptor (TCR) against a tumor-associated antigen, an isolated nucleic acid molecule encoding same, a T cell expressing said TCR, and a pharmaceutical composition for use in the treatment of diseases involving malignant cells expressing said tumor-associated antigen.

Claims

1. A functional TCR ? and/or ?-chain fusion protein, comprising: a) at least one epitope-tag, and b) the amino acid sequence of an ? and/or ?-chain of a TCR, wherein the TCR binds to a tyrosinase peptide comprising the amino acid sequence of YMDGTMSQV (SEQ ID NO: 9), wherein the amino acid sequence of the ? and/or ?-chain of the TCR is encoded by: i) a nucleic acid molecule coding for the V(D)J regions of a TCR that recognizes tyrosinase and comprises the nucleic acid sequence of SEQ ID NO: 1 coding for the ?-chain and/or the nucleic acid sequence of SEQ ID NO: 2 coding for the ?-chain of said TCR; ii) a derivative of the nucleic acid molecule of i), coding for the ?- or ?-chain, wherein the chain has been altered by one or more additions, deletions, or conservative substitutions of from 1-15 amino acids, the additions, deletions, or conservative substitutions being outside the CDR3 region of each chain; or iii) a nucleic acid molecule coding for the V(D)J regions of a TCR that recognizes tyrosinase and comprising a CDR3 region encoded by the nucleic acid sequence of SEQ ID NO: 3 or 4 or having the amino acid sequence of SEQ ID NO: 5 or 6, wherein said epitope-tag is selected from i) an epitope-tag added to the N- and/or C-terminus of said ? and/or ? chain, or added into the ? and/or ? chain sequence, but outside the CDR3 region, ii) an epitope-tag inserted into a constant region of said ? and/or ? chain, and iii) an epitope-tag replacing a number of amino acids in a constant region of said ? and/or ?-chain.

2. The functional TCR ? and/or ?-chain fusion protein of claim 1, wherein the amino acid sequence of the ? and/or ?-chain of the TCR is encoded by a nucleic acid molecule coding for the V(D)J regions of a TCR that recognizes tyrosinase and comprising the nucleic acid sequence of SEQ ID NO: 1 coding for the ?-chain and/or the nucleic acid sequence of SEQ ID NO: 2 coding for the ?-chain of said TCR.

3. The functional TCR ? and/or ?-chain fusion protein of claim 1, wherein the epitope-tag is selected from the group consisting of CD20-tag, Her2/neu-tag, myc-tag, FLAG-tag, T7-tag, HA-tag, His-tag, S-tag, GST-tag, and GFP-tag.

4. The functional TCR ? and/or ?-chain fusion protein of claim 1, wherein the amino acid sequence of the ? and/or ?-chain of the TCR is encoded by a nucleic acid molecule coding for the V(D)J regions of a TCR that recognizes tyrosinase and comprising a CDR3 region encoded by the nucleic acid sequence of SEQ ID NO: 3 or 4 or having the amino acid sequence of SEQ ID NO: 5 or 6.

Description

DESCRIPTION OF THE FIGURES

(1) FIG. 1: Screening of clones obtained from limiting dilution cultures after DC priming.

(2) T cells were primed with dendritic cells expressing HLA-A2 and tyrosinase RNA. After two rounds of priming in vitro, cells were cloned by limiting dilution. 14 to 28 days later T cell clones showing adequate growth in individual culture wells were identified by light microscopy. Aliquots of growing clones were obtained and tested in a standard .sup.51Cr release assay to measure their killing activity against two melanoma target cell lines. Mel-A375 cells express HLA-A2 but not tyrosinase. Mel-93.04A12 cells express HLA-A2 and tyrosinase, so they can form the ligands recognized by HLA-A2-restricted, tyrosinase peptide (YMDGTMSQV; SEQ ID NO: 9)-specific T cells. If Mel-A375 cells are recognized by T cell clones, this means the clones are alloreactive and recognize HLA-A2 independent of tyrosinase peptide (i.e., clone T41 and T42). If the T cell clones only recognize Mel-93.04A12, then they should have specificity for HLA-A2-tyrosinase peptide ligands (i.e. T58, T43). Percentage specific lysis mediated by various T cell clones, (listed on x-axis) is given for the two target melanoma cell lines. The arrow designates clone T58 which shows strong killing of Mel-93.04A12 but not of Mel-A375. This clone was selected for further characterization based on its strong growth capacity.

(3) FIG. 2: Comparison of clones T58 and IVS-B

(4) FIG. 2a: Cytotoxic activity directed against melanoma cell lines.

(5) The killing capacity of clone T58 was compared with that of clone IVS-B, derived from a melanoma patient, using as target cells the T2 cell line pulsed with synthetic tyrosinase-peptide for the amino acid sequence YMDGTMSQV (SEQ ID NO: 9) in different molar concentrations, listed on the x-axis. The % relative lysis is given on the y-axis. The concentration of peptide that corresponds to 50% relative lysis is indicated by the crossing lines and shows that clone T58 can recognize substantially lower concentrations of peptide in comparison to clone IVS-B.

(6) FIG. 2b: Measurement of multimer binding and off-rates.

(7) The two clones were incubated with multimers to determine the percentage of positive cells at time 0 h. Both clones bound multimer on 100% of the cells. Multimer was washed out and the clones were incubated in medium containing HLA-A2-specific antibody. When multimers are released from the cell surface, they are captured by the antibody and can not rebind to the cells. The percent multimer-positive cells were reanalyzed at 1 h and 2 h.

(8) FIG. 2c: Interferon-gamma secretion after stimulation with melanoma cell lines.

(9) Clone T58 and IVS-B were co-cultured with the two melanoma cell lines used for the initial screening (described in FIG. 1) and their secretion of IFN-? into the culture medium was assessed by standard ELISA after 24 hours. n.d.=not detectable. Data are presented as pg/ml on the y-axis.

(10) FIG. 2d: Cytotoxic activity against melanoma cell lines.

(11) The clones were compared for killing activity using a standard .sup.51Cr-release assay as described in FIG. 1. Data are given as percent specific lysis on the y-axis.

(12) FIG. 3: Recognition of primary melanoma tumor cells by clone T58 and IVS-B.

(13) (a) HLA-A2 surface expression on primary tumor cells (passage 12) of an HLA-A2.sup.? melanoma patient transfected with 50 ?g HLA-A2 ivt-RNA and on established melanoma cell lines Mel-93.04A12 (HLA-A2.sup.+tyrosinase.sup.+) and Mel-A375 (HLA-A2.sup.+tyrosinase.sup.?) was measured by flow cytometry after staining with HLA-A2-specific monoclonal antibody. Each histogram shows the stained sample (filled curves) and the corresponding control sample (empty curves): control curves represent untransfected primary tumor cells stained with HLA-A2-specific monoclonal antibody (left histogram) or melanoma cell lines stained with isotype control antibody. HLA-A2 protein expression on RNA-transfected primary tumor cells was detected 10 h after electroporation. (b) The capacity of the patient-derived T cell clone (IVS-B), and T cell clone T58 to secrete IFN-? or (c) release perforin in co-culture with the melanoma cells shown above was measured in ELISPOT assays.

(14) FIG. 4: Transfer of antigen specificity by TCR retroviral gene transfer. (a) The human TCR-deficient T cell line Jurkat76.sup.9 was transduced with the TCR of the T cell clone T58. TCR-expression was detected using tyrosinase-peptide-specific HLA-multimers. TCR expression was only detected in Jurkat76 cells transduced with TCR-T58 (right histogram) and not in untransduced Jurkat76 cells (left histogram). (b) PBL of a healthy donor were retrovirally transduced with TCR-T58. After 10 days, untransduced and TCR-transduced PBL were analysed for tyrosinase TCR-expression using specific HLA-multimers. Multimer staining is shown on the x-axis and CD8 staining on the y-axis. The percentage of multimer.sup.+CD8.sup.+ T cells is displayed in the upper right quadrant. (c) Functionality of TCR-transduced PBL was measured using a standard IFN-? release assay. T2 cells loaded with graded amounts of tyrosinase.sub.369-377 peptide (YMDGTMSQV; SEQ ID NO: 9; 10.sup.?12 M-10.sup.?5 M) were used as target cells at a fixed effector to target cell ratio of 1:1. Untransduced PBL served as a control and showed no tyrosinase-peptide specific IFN-? release (data not shown). Data are shown as pg/ml cytokine after subtration of secretion by untransduced PBL controls. (d) The capacity to secrete IFN-? in co-culture with melanoma cell lines SK-Mel-28 (HLA-A2.sup.?tyrosinase.sup.+), Mel-A375 (HLA-A2.sup.+tyrosinase.sup.?), Mel-624.38 (HLA-A2.sup.+tyrosinase.sup.+) and Mel-93.04A12 (HLA-A2.sup.+tyrosinase.sup.+) was assessed using a standard IFN-? release assay using an E:T=1:1; (n.d.=not detectable).

(15) FIG. 5: Transfer of specificity of T58 and IVS-B for HLA-A2 and tyrosinase-peptide YMDGTMSQV (SEQ ID NO: 9) by TCR retroviral gene transfer. (a) PBL of a healthy donor were retrovirally transduced with the patient-derived TCR-IVS-B or the TCR-T58. After 11 days, untransduced and TCR-transduced PBL were analysed for tyrosinase TCR-expression using specific HLA-multimers. Multimer staining is shown on the x-axis and CD8 staining on the y-axis. The percentage of multimer.sup.+CD8.sup.+ T cells is displayed in the upper right quadrant. (b) Functionality of TCR-transduced PBL was measured using a standard IFN-? release assay. T2 cells loaded with graded amounts of tyrosinase.sub.369-377 peptide (10.sup.?11 M-10.sup.?5 M) or with 10.sup.?5 M irrelevant influenza matrix proteins.sub.58-66 were used as target cells at a fixed effector to target cell ratio of 1:1. Untransduced PBL served as a control and showed no tyrosinase-peptide specific IFN-? release (data not shown). Data are shown as pg/ml cytokine after substration of secretion by untransduced PBL controls (mean=318 pg/ml; range=219-368 pg/ml) and adjustment for comparable numbers of multimer.sup.+ cells.

(16) FIG. 6: Tyrosinase peptide-specific CTL recognition of tumor cell lines and primary melanoma tumor cells. Columns represent the amount of IFN-? (pg/ml) secreted by self-restricted D115 CTL and allo-restricted T58 CTL in co-culture with a panel of tumor cell lines from left to right: MaCa1 (HLA-A2-tyrosinase?); SK-Mel-28 (HLA-A2-tyrosinase+); Mel-A375, RCC-26, PancTu 1, MaCa1/A2, and UTS CC 1588 (all HLA-A2+tyrosinase?); Mel-624.38, Mel-93.04A12, SK-Mel-23, SK-Mel-29 and WM-266-4 (all HLA-A2+tyrosinase+). T cells designates CTL without stimulating cells. The HLA-A2+tyrosinase? tumor cell lines Mel-A375, RCC-26 and MaCa1/A2 were exogenously loaded with either 10-5 M irrelevant flu peptide or 10-5 M tyrosinase peptide YMD and IFN-? secretion was measured by ELISA and given as pg/ml.

(17) FIG. 7: Transfer of antigen specificity by retroviral transfer of TCR-D115 and TCR-T58. PBL of a healthy donor were transduced with TCR-D115 or TCR-T58. Specificity of recognition was assessed by IFN-? release following co-culture with the tumor cell lines from left to right: MaCa1 (HLA-A2-tyrosinase?); SK-Mel-28 (HLA-A2-tyrosinase+); Mel-A375, RCC-26, PancTu 1, MaCa1/A2, and UTS CC 1588 (all HLA-A2+tyrosinase?); Mel-624.38, Mel-93.04A12, SK-Mel-23, SK-Mel-29 and WM-266-4 (all HLA-A2+tyrosinase+). T designates CTL without stimulating cells. The HLA-A2+tyrosinase-tumor cell lines Mel-A375, RCC-26 and MaCa1/A2 were exogenously loaded with either 10-5 M irrelevant flu peptide or 10-5 M tyrosinase peptide YMD and IFN-? secretion was measured by ELISA and given as pg/ml.

(18) FIG. 8: Transfer of antigen specificity by retroviral transfer of TCR-D115 and TCR-T58. (A) PBL of a healthy donor were transduced with TCR-D115 or TCR-T58. Unsorted TCR-transduced PBL were analyzed on day 10 for transgenic TCR-expression using irrelevant B7-pp65 and A2-pp65 multimers and specific A2-tyr multimers. Untransduced PBL showed no multimer binding (0.1%, data not shown). Percentages of multimer+CD8+ T cells are displayed in the upper right quadrant. (B) and (C) show the IFN-? release of unsorted TCR-transduced PBL following stimulation with T2 cells loaded with graded amounts of tyrosinase peptide (10-12 M-10-5 M) at a ratio of 2:1. In (B) the relative IFN-? release is displayed in percent and in (C) the specific IFN-? release is presented as pg/ml. (D) Functionality of unsorted TCR-transduced PBL was measured by IFN-? release using autologous HLA-A2+PBMC loaded with tyrosinase peptide (10-11 M-10-6 M) as stimulating cells at ratio of 2:1. Untransduced PBL (?) showed no peptide-specific IFN-? release. (E) The HLA-A2+tyrosinase? tumor cell lines Mel-A375, RCC-26 and MaCa1/A2 were exogenously loaded with either 10-5 M irrelevant flu peptide (f) or 10-5 M tyrosinase peptide YMD (t) and IFN-? secretion was measured by ELISA and given as pg/ml. (F) Specificity of recognition was assessed by IFN-? release following co-culture with the tumor cell lines from left to right: MaCa1 (HLA-A2-tyrosinase?); SK-Mel-28 (HLA-A2-tyrosinase+); Mel-A375, RCC-26, PancTu 1, MaCa1/A2, and UTS CC 1588 (all HLA-A2+tyrosinase?); Mel-624.38, Mel-93.04A12, SK-Mel-23, SK-Mel-29 and WM-266-4 (all HLA-A2+tyrosinase+). T designates CTL without stimulating cells.

(19) FIG. 9: TCR transfer retains differences in cytokine profile. (A-D) On the left hand side the cytokine release of TCR-transduced PBL in co-culture with the melanoma lines Mel-A375 (HLA-A2+tyrosinase?) and Mel-624.38 (HLA-A2+tyrosinase+) is depicted, on the right hand side the corresponding cytokine release after stimulation with T2 cells loaded with graded amounts of tyrosinase peptide (10-12 M-10-5 M) is shown. Untransduced PBL (?) showed no peptide-specific cytokine release. The following cytokines were measured: IFN-? (A), IL-2 (B), TNF-? (C) and MIP-1? (D). The levels of cytokine secretion for all four cytokines were higher when PBL transduced with the allo-restricted TCR-T58 were used. Since untransduced PBL secreted very high levels of MIP-13 in response to T2 cells the peptide titration for this cytokine could not be evaluated.

EXAMPLE 1

(20) The inventors prepared stimulating dendritic cells (DC) from an HLA-A2-negative healthy donor that co-expressed allogeneic HLA-A*0201-molecules and tyrosinase protein using mature DC that were electroporated with in vitro transcribed (ivt)-RNA for tyrosinase and HLA-A2, as described.sup.1,2. These DC were used to prime purified, autologous CD8.sup.+ T cells using two rounds of stimulation with freshly prepared DC. After these two rounds of priming, CD8.sup.+ T cells with T cell receptors (TCR) recognizing HLA-A2-tyrosinase.sub.369-377-peptide complexes were stained using a tyrosinase.sub.369-377/HLA-A*0201-multimer.sup.3. CD8.sup.+multimer.sup.+ cells were isolated by fluorescence activated cell sorting. Sorted cells were cloned in limiting dilution cultures and isolated clones showing HLA-A2/tyrosinase-peptide specificity were expanded using antigen-independent stimulation.sup.4. The T cell clone T58 was identified in an initial screen as having good functional activity (FIG. 1).

(21) Because T58 was isolated from an HLA-A*0201-negative donor it represents an allo-restricted T cell clone that did not undergo negative selection in vivo. The activity of the T58 clone was compared with the IVS-B clone that was isolated from a patient with metastatic melanoma.sup.5. This clone recognizes exactly the same HLA-A2/tyrosinase peptide ligand as clone T58 but it is self-restricted since it was activated in vivo in the patient who was HLA-A*0201-positive. This patient-derived T cell clone represents an example of T cells that are available in the peripheral repertoire that have undergone negative selection against self-peptides/self-MHC-molecules in the thymus in vivo.

(22) Side-by-side comparisons of clone T58 and clone IVS-B were made to demonstrate the superior properties of the allo-restricted T58 clone versus the self-restricted IVS-B clone. Functional T cell avidity for tyrosinase.sub.369-377 peptide recognition was measured in a .sup.51Cr-release assay using HLA-A2.sup.+ T2 cells pulsed with graded amounts of exogenous peptide as target cells. The peptide concentration needed for 50% relative lysis defined the value of half-maximum lysis.sup.6. The allo-restricted T cell clone T58 required substantially less peptide to be activated by peptide-pulsed T2 cells than clone IVS-B (6.0?10.sup.?10 M vs. 3.0?10.sup.?8 M) (FIG. 2a).

(23) As an estimate of structural TCR-MHC/peptide binding affinity, loss of multimer binding was measured over time (i.e. HLA-multimer off-rate). A slower off-rate indicates that TCR-ligand interactions are more stable and of higher structural affinity.sup.7. After initial incubation with multimer and washing, T cells were incubated for 1 h and 2 h without multimers in the presence of HLA-A2-specific antibody to prevent cellular re-association of released multimers. The melanoma patient-derived T cell clone IVS-B showed an intermediate multimer binding: all cells were multimer.sup.+ at 0 h and about 40% retained multimers at 1 and 2 h (FIG. 2b). In contrast, clone T58 had a slower off-rate, showing 74% positive binding at 1 h versus 41% for clone IVS-B and even at 2 h still had somewhat more multimer.sup.+ cells (55% vs. 40%).

(24) Both T cell clones were analyzed in an IFN-? release assay for function and specificity (FIG. 2c). The clones were co-cultured with two melanoma cell lines that express HLA-A2 molecules but differ with respect to expression of tyrosinase protein: Mel-93.04A12 co-expresses both proteins (HLA-A2.sup.+tyrosinase.sup.+) but Mel-A375 fails to express tyrosinase protein (HLA-A2.sup.+tyrosinase.sup.?) and therefore can not generate the MHC-peptide ligand seen by the T cell clones. Allo-restricted T cell clone T58 was induced to secrete a high level of IFN-? by the tyrosinase-expressing melanoma cell line, whereas only marginal cytokine secretion was seen with IVS-B cells (1,234 pg/ml vs. 106 pg/ml), demonstrating the vastly superior function of clone T58 in recognizing tumor cells expressing their HLA-A2-tyrosinase ligand. As expected, the clones showed no detectable IFN-? secretion after stimulation with Mel-A375 cells, demonstrating the specificity for HLA-A2 and tyrosinase expression for tumor cell recognition.

(25) The killing capacity of allo-restricted clone T58 was also compared with clone IVS-B using a .sup.51Cr-release assay (FIG. 2d). Again, clone T58 showed superior function (76% vs. 24% specific lysis).

(26) Both clones were also tested for their capacity to recognize primary melanoma cells. Since primary HLA-A2.sup.+ melanoma cells were not available, we introduced ivt-RNA for HLA-A2 into the tumor cells as for DC (FIG. 3a). Function was measured using ELISPOT assays detecting IFN-? secretion and perforin release to bypass high spontaneous release of radioactive label by primary tumor cells. Recognition of primary tumor cells was shown to be HLA-A2-restricted since primary tumor cells lacking HLA-A2 RNA were not recognized. Again, a strong difference was observed with poor recognition by the patient self-restricted IVS-B cells versus good recognition by allo-restricted T58 cells as assessed with IFN-? secretion (FIG. 3b) and by perforin secretion (FIG. 3c).

(27) To demonstrate that the superior functional avidity of allo-restricted T58 cells resided directly in the TCR, separate recombinant retroviruses were created for TCR alpha and beta chains of clone T58 as described.sup.8. Human TCR-deficient Jurkat76 cells.sup.9 were co-infected with the ?-chain and ?-chain retroviruses and transgenic TCR-expression was measured by multimer staining. TCR-T58 was expressed at a good level, demonstrating adequate quality of the separate retroviral supernatants (FIG. 4a). Next, activated peripheral blood lymphocytes (PBL) of a healthy HLA-A2.sup.? donor were transduced and analyzed with multimers for tyrosinase-specific TCR-expression (FIG. 4b). Despite this low frequency, PBL transduced with TCR-T58 released high amounts of IFN-? following stimulation with T2 cells pulsed with graded amounts of tyrosinase-peptide (FIG. 4c). TCR-T58 transduced PBL could also respond specifically to stimulation by melanoma cell lines that expressed HLA-A2 and tyrosinase (FIG. 4d). They did not respond to tumor cells that did not express HLA-A2 or tyrosinase, again demonstrating the specificity of HLA-A2-tyrosinase ligands for T58 recognition.

(28) Bi-cistronic retroviral vectors were also prepared encoding the ?-chain and ?-chains of the TCR of IVS-B cells and used to transduce activated PBL. In parallel, the same activated PBL were transduced with bi-cistronic retroviral vectors encoding the two chains of TCR-T58. PBL expressing the corresponding receptors were identified by co-staining for CD8 and multimer and showed low numbers of positive cells. (FIG. 5a) Despite their low frequency, PBL transduced with TCR-T58 released high amounts of IFN-? following stimulation with T2 cells pulsed with graded amounts of tyrosinase-peptide. PBL expressing TCR-IVS-B secreted far less IFN-?. Tyrosinase peptide-specific cytokine secretion was not detected with untransduced PBL control cells. Data are shown as pg/ml cytokine after substraction of secretion by untransduced PBL controls (mean=318; range=219-369 pg/ml) (FIG. 5b).

(29) Table 1 shows the genetic information regarding the use of VJ and VDJ gene segments by the alpha and beta chains of TCR-T58, respectively. The CDR3 regions, according to IMGT, are presented as nucleotide sequences and amino acid sequences. Also shown are the codon optimized sequences for the full VJ and VDJ regions.

(30) Materials and Methods

(31) Cell Lines

(32) The human melanoma cell lines, Mel-A375 (HLA-A2.sup.+, tyrosinase.sup.?; CRL-1619, American Type Culture Collection (ATCC), Bethesda, Md.), Mel-93.04A12 (HLA-A2.sup.+, tyrosinase.sup.+, gift of P. Schrier, Department of Immunohematology, Leiden University Hospital, The Netherlands), Mel-624.38.sup.10 (HLA-A2.sup.+, tyrosinase.sup.+, gift of M. C. Panelli, National Institutes of Health, Bethesda, Md.), SK-Mel-28 (HLA-A2.sup.?, tyrosinase.sup.+; MTB-72, ATCC) as well as the lymphoid cell line T2 (CRL-1992, ATCC), and the human TCR-deficient Jurkat76.sup.9 T cell line were cultured in RPMI 1640 medium supplemented with 12% fetal bovine serum (FBS), 2 mM L-glutamine and 1 mM sodium-pyruvate and non-essential amino acids.

(33) The HLA-A*0201-restricted tyrosinase.sub.369-377 peptide-specific melanoma patient-derived IVS-B T cell clone was cultured as described.sup.5.

(34) Production of Tyrosinase and HLA-A2 ivt-RNA

(35) The plasmid pCDM8-HLA-A2 with HLA-A*0201 cDNA and the pZeoSV2+/huTyr with tyrosinase cDNA were linearized and used as in vitro transcription templates to produce RNA with the aid of the mMESSAGE mMACHINE T7 kit (Ambion, Austin, Tex.) according to the manufacturer's instructions.

(36) De Novo Priming of T Cells with RNA-Pulsed DC

(37) Blood samples from healthy donors were collected after informed consent and with approval of the Institutional Review Board of the University Hospital of the Ludwig-Maximilians-University, Munich, Germany. Peripheral blood lymphocytes (PBL) were isolated by Ficoll density gradient centrifugation. PBL were resuspended in 15 ml very low endotoxin (VLE) RPMI 1640 medium (Biochrom, Berlin, Germany) supplemented with 1.5% human serum (DC medium) at 7.5?10.sup.7 cells per 75 cm.sup.2 culture flask and incubated at 37? C. and 5% CO.sub.2 for 1 h. Non-adherent cells were carefully removed by washing. Mature DC were prepared from adherent monocytes and transfected with ivt-RNA via electroporation as previously described.sup.2. DC of HLA-A2.sup.? donors were co-transfected with 24 ?g tyrosinase ivt-RNA and 48 ?g HLA-A2 ivt-RNA. On the same day, autologous CD8.sup.+ T lymphocytes were enriched from PBL via negative selection using a commercial kit according to the manufacturer's instructions (CD8.sup.+ T cell Isolation Kit II (human), Miltenyi, Bergisch Gladbach, Germany). Co-cultures were initiated 10 h after DC electroporation in 24-well plates (TPP, Trasadingen, Switzerland) by adding 1?10.sup.5 RNA-pulsed DC to 1?10.sup.6 CD8.sup.+ T cells in RPMI 1640, supplemented with 10% heat-inactivated human serum, 4 mM L-glutamine, 12.5 mM HEPES, 50 ?M ?-mercaptoethanol and 100 U/ml penicillin/streptomycin (T cell medium). IL-7 (5 ng/ml) (Promokine, Heidelberg, Germany) was added on day 0 and 50 U/ml IL-2 (Chiron Behring, Marburg, Germany) was added after 2 days and then on every 3.sup.rd subsequent day. Addition of IL-2 was delayed to decrease proliferation of non-specific CD8.sup.+ T cells.sup.4. The 2.sup.nd stimulation of primed T cells was made after seven days using freshly prepared RNA-pulsed DC.

(38) HLA-Multimer Staining and Sorting

(39) Seven days after the 2.sup.nd stimulation of CD8-enriched T cells with RNA-pulsed DC, HLA-A2-restricted tyrosinase-specific T cells were detected by staining with a PE-labeled HLA-A*0201/htyr.sub.369-377 peptide/human ?.sub.2m multimer.sup.11, anti-CD8-APC antibody (clone RPA-T8, BD Pharmingen, Franklin Lakes, N.J.) and propidium iodide (PI: 2 ?g/ml). For sorting, up to 5?10.sup.6 cells were incubated with 12 ?g multimer in 100 ?l PBS+0.5% human serum. CD8-APC antibody was then added at 1/50 for an additional 25 min. After staining cells were washed twice and diluted in PBS+0.5% human serum with PI for sorting. 20-50?10.sup.6 total cells per priming culture were stained for sorting. PI-negative cells were gated and CD8.sup.+multimer.sup.+ T cells were sorted on a FACSAria cell sorter (BD Biosciences) with a 70 ?m nozzle, at a rate of 15,000 events/s.

(40) For HLA-multimer off-rate assays, cells were washed after multimer binding and resuspended in FACS buffer containing saturating amounts of BB7.2 monoclonal antibody (ATCC) to capture detached multimers and prevent rebinding to T cells. After 1 or 2 h, samples were fixed in FACS buffer with 1% paraformaldehyde and analysed by flow cytometry.sup.7.

(41) Culture of Peptide-Specific T Clones

(42) Multimer-sorted T cells were cloned by limiting dilution. Clones were plated in 96-well round-bottom plates (TPP) in 200 ?l/well T cell medium. 50 IU/ml IL-2 was supplemented every 3 days with 5 ng/ml IL-7 and 10 ng/ml IL-15 (PeproTech Inc., Rocky Hill, N.J.) every 7 days. T cell clones were stimulated non-specifically with anti-CD3 antibody (0.1 ?g/ml; OKT-3) and provided with 1?10.sup.5 feeder cells per 96-well, consisting of irradiated (50 Gy) PBL derived from a pool of five unrelated donors and 1?10.sup.4 irradiated (150 Gy) EBV-transformed allogeneic B-LCL every two weeks. Proliferating T cells were transferred into 24-well plates (TPP) and cultured in 1.5 ml T cell medium plus cytokines. 1?10.sup.6 allogeneic irradiated PBL and 1?10.sup.5 irradiated EBV-transformed allogeneic B-LCL were added per well as feeder cells in 24-well plates. Clonality was determined by TCR-beta-chain receptor analysis, as described.sup.12.

(43) Peptide Loading of T2 Cells

(44) For exogenous peptide pulsing, 1?10.sup.6 T2 cells were incubated at 37? C. and 5% CO.sub.2 for 2 h with 10 ?g/ml human ?.sub.2-microglobulin (Calbiochem, San Diego, Calif.) and titrating amounts, ranging from 10.sup.?5 M to 10.sup.?12 M, of the tyrosinase peptide YMD (tyrosinase.sub.369-377 YMDGTMSQV, SEQ ID NO: 9, Metabion, Martinsried, Germany). T2 cells pulsed with 10.sup.?5 M influenza peptide GIL (influenza matrix protein.sub.58-66 GILGFVTL, SEQ ID NO: 10, Metabion) served as negative control. After washing, peptide-loaded T2 cells were used as target cells in cytotoxicity or IFN-?-release assays.

(45) IFN-? Release Assay

(46) For investigation of specificity, T cell clones (2?10.sup.3 cells in 100 ?l) were incubated with the respective melanoma cell lines or peptide-pulsed T2 cells (1?10.sup.4 cells in 100 ?l). Culture supernatants were harvested after 24 h co-culture and assessed by a standard ELISA using the OptEIA? Human IFN-? Set (BD Biosciences Pharmingen).

(47) Cytotoxicity Assay

(48) Cytotoxic activity of T cell clones was analysed in a standard 4 h 51-chromium release assay. Melanoma cells or peptide-loaded T2 cells were used as target cells. Briefly, 1?10.sup.6 target cells were labeled with 100 ?Ci Na.sub.2.sup.51CrO.sub.4 (ICN Biochemicals, Irvine, Calif.) for 1-1.5 h. .sup.51Cr-labeled target cells were cultured with T cells in 100 ?l/well RPMI 1640 with 12% FCS in V-bottom 96-well tissue culture plates (Greiner, Solingen, Germany). For determination of functional avidity 1?10.sup.4 T cells were added to 1?10.sup.3 peptide-pulsed T2 cells loaded with titrated amounts of peptide, giving a constant E:T of 10:1.

(49) After 4 h co-culture at 37? C., 50 ?l of supernatant were collected and radioactivity was measured in a gamma counter. The percentage of specific lysis was calculated as: 100?(experimental release?spontaneous release)/(maximum release?spontaneous release). Spontaneous release was assessed by incubating target cells in the absence of effector cells and was generally less than 15%. For the calculation of percent relative lysis, the maximum percent specific lysis was set to the reference value of 100% and corresponding values were calculated corresponding to this reference. To determine half-maximum lysis, percent relative lysis was plotted against peptide concentration. The peptide concentration at which the curve crossed 50% relative lysis was taken as the value of half-maximum lysis.sup.6.

(50) ELISPOT

(51) Antibody pre-coated PVDF plates (Mabtech AB, Nacka, Sweden) were incubated at 37? C. in CTL Test? medium (Cellular Technology Ltd., Cleveland, Ohio) for 2 h to block unspecific binding. For the IFN-? ELISPOT, plates were pre-coated with the IFN-?-specific capture antibody clone 1-D1K; for perforin ELISPOT plates were pre-coated with the perforin-specific capture antibody (clone Pf-80/164; Mabtech AB). Primed T cells were washed with CTL Wash? Supplement culture medium (Cellular Technology Ltd) and 1?10.sup.3 responder T cells were stimulated with 5?10.sup.3 melanoma cells in 150 ?l CTL Test? medium and 24 h later assessed in IFN-? ELISPOT or 48 h later in perforin ELISPOT. After washing with PBS/0.01% Tween and PBS alone, plates were incubated either with a direct streptavidin-alkaline phosphatase (ALP)-conjugated detection antibody (clone 7-B6-1; Mabtech AB) for IFN-? ELISPOT or with biotinylated detection antibody (clone Pf-344; Mabtech AB) for perforin ELISPOT for 2 h at room temperature following a 1 h incubation with streptavidin-alkaline phosphatase (ALP). The plates were washed again and a ready-to-use BCIP/NBT-plus substrate solution (Mabtech AB) was added. Spots were counted using the AID reader system ELR03 with the software version 4.0 (AID Autoimmun Diagnostika GmbH, Strassberg, Germany).

(52) Construction of Retroviral Vectors, Production of Virus Supernatants and Transduction of Jurkat76 T Cells and PBL

(53) For TCR identification of tumor-specific T cell clones, part of the TCR?- and TCR?-chain sequences including the complementary determining region (CDR3) was amplified by PCR using a panel of TCRV? and TCRV? primers combined with the respective constant region primer as described.sup.13. The TCR? and TCR? chain genes of T cell clones T58 and IVS-B were amplified by PCR with gene specific primers and cloned into the retroviral vector MP71PRE.sup.8 via NotI and EcoRI restriction sites. Both chains of human TCR-T58 (V?7, V?23) and TCR-IVS-B (V?3, V?14) were constructed as single-TCR gene vectors or double-TCR gene vectors (pMP71-T58? and pMP71-T58?, pMP71-IVS-B? and pMP71-IVS-B?; pMP71-T58?-P2A-T58? and pMP71-IVS-B?-P2A-IVS-B?). Retroviral vector plasmids were co-transfected into 293T cells with expression plasmids encoding Moloney MLV gag/pol and MLV-10A1 env gene to produce amphotropic MLV-pseudotyped retroviruses as described.sup.14. The human TCR-deficient T cell line Jurkat76 and PBL were transduced as reported.sup.14. Jurkat76 cells (5 days after transduction) and PBL (10 days after transduction) were stained using PE-labeled HLA-A*0201/htyr.sub.369-377 peptide/human ?.sub.2m multimer and anti-CD8-FITC antibody. On day 13 an IFN-? release assay was performed using T2 cells loaded with graded amounts of tyrosinase.sub.369-377 peptide (10.sup.?12 M-10.sup.?5 M) or T2 cells pulsed with 10.sup.?5 M influenza matrix proteins.sub.58-66 peptide and the tumor cell lines SK-Mel-28, Mel-A375, Mel-624.38 and Mel-93.04A12 as stimulating cells at an E:T ratio=1:1. Control values for peptide-stimulated untransduced PBL were subtracted from values of transduced cells at each peptide concentration and then adjusted to comparable numbers of total TCR-transgenic cells.

(54) T58-TCR Analysis

(55) For the T-cell receptor analysis of the tyrosinase-specific clone T58, part of the TCR alpha-chain and beta-chain containing the CDR3 region was amplified by RT-PCR using a panel of TCR V? and TCR V? primers combined with a respective TCR constant region primer. Products were sequenced and assigned according to IMGT (Table 1; IMGT, THE INTERNATIONAL IMMUNOGENETICS INFORMATION SYSTEM?, http://imgt.cines.fr).

(56) Modifications of the TCR-Sequence

(57) Codon optimization of the VJ/VDJ-regions of both T58-TCR chains was done to facilitate TCR mRNA translation (Table 1). Antibody-tags, for example myc-tags.sup.15 (Patent Application number: 06014606.5-1212) or other modifications, for example a CD20 epitope, can be introduced in any position, i.e. the N-terminus of the TCR?-chain, that is recognized by the depleting antibody and does not interfere with TCR-functionality.

(58) TABLE-US-00001 TABLE1 TCR-CDR3sequencesandcodonoptimized VJ/VDJregionsofcloneT58 Alpha-chain VJregion* TRAV1-2AJ28 CDR3region* Nucleotide TGTGCTGTGACATACTCTGGGGCTGGG sequence AGTTACCAACTC(SEQIDNO:3) Aminoacid CAVTYSGAGSYQL sequence (SEQIDNO:5) Codon ATGTGGGGCGTGTTTCTGCTGTACGTGTCCATGAAGA optimized TGGGCGGCACCACCGGCCAGAACATCGACCAGCCCA VJ CCGAGATGACAGCCACCGAGGGCGCCATCGTGCAGA TCAACTGCACCTACCAGACCAGCGGCTTCAACGGCCT GTTCTGGTATCAGCAGCACGCCGGCGAGGCCCCTACC TTCCTGAGCTACAACGTGCTGGACGGCCTGGAAGAG AAGGGCCGGTTCAGCAGCTTCCTGAGCCGGTCCAAG GGCTACAGCTACCTGCTGCTGAAAGAACTGCAGATG AAGGACAGCGCCAGCTACCTGTGCGCCGTGACCTAC AGCGGAGCCGGCAGCTACCAGCTGACCTTCGGCAAG GGCACCAAGCTGTCCGTG(SEQIDNO:7) Beta-chain VDJregion* TRBV13BD1BJ1-4 CDR3region* Nucleotide TGTGCCAGCAGTCAGAAACAGGGCT sequence GGGAAAAACTG(SEQIDNO:4) Aminoacid CASSQKQGWEKL sequence (SEQIDNO:6) Codon ATGCTGTCCCCCGATCTGCCCGACAGCGCCTGGAA optimized CACCAGACTGCTGTGCCACGTGATGCTGTGTCTGC VDJ TGGGAGCCGGATCTGTGGCCGCTGGCGTGATCCA GAGCCCCAGACACCTGATCAAAGAGAAGCGGGAG ACAGCCACCCTGAAGTGCTACCCCATCCCCCGGC ACGACACCGTGTACTGGTATCAGCAGGGACCAGG ACAGGACCCCCAGTTCCTGATCAGCTTCTACGAGA AGATGCAGAGCGACAAGGGCAGCATCCCCCGACAG ATTCAGCGCCCAGCAGTTCAGCGACTACCACAGC GAGCTGAACATGAGCAGCCTGGAACTGGGCGACT CTGCCCTGTACTTCTGCGCCAGCAGCCAGAAGCA GGGCTGGGAGAAGCTGTTCTTCGGCAGCGGCACC CAGCTGTCCGTGCTG(SEQIDNO:8)

(59) TCR alpha-chain (VJ region), TCR beta-chain (VDJ region) and CDR3 lengths are designated according to IMGT (IMGT, THE INTERNATIONAL IMMUNOGENETICS INFORMATION SYSTEM?, http://imgt.cines.fr)

EXAMPLE 2

(60) In EXAMPLE 1, data are provided that compared two T cell clones that specifically recognize a peptide derived from tyrosinase (i.e., YMDGTMSQV hereafter referred to as YMD) presented by HLA-A*0201 molecules. The T cell clone T58 was an allo-restricted, peptide-specific T cell clone derived from an HLA-A2-negative donor. The T cell clone IVS-B was derived from an HLA-A*0201-positive patient who suffered from metastatic melanoma. This melanoma expressed tyrosinase.

(61) In this EXAMPLE, comparisons have been extended to include an example of a T cell clone, D115, which is also derived from an HLA-A*0201-positive individual and recognizes the same YMD peptide. However, in contrast to clone IVS-B, clone D115 was generated in vitro using responding T cells derived from the blood of a healthy individual. Therefore, there have been no potential negative impacts on this T cell clone from a tumor environment (i.e., melanoma) in vivo.

(62) FIG. 6 shows a comparison of the pattern of the target cell recognition of the new clone D115 and clone T58 which is the subject of this patent. As can be clearly seen, both D115 and T58 show the same pattern of recognition, detected by secretion of interferon-gamma (y-axis), after co-cultivation with various tumor cell lines (x-axis and figure legend). Neither clone recognizes tumor cells that are HLA-A2-negative but express tyrosinase, nor do they recognize tumor cells that are HLA-A2-positive and tyrosinase negative. On the other hand, both T cell clones recognize several tumor cell lines that are both HLA-A2-positive and tyrosinase-positive. The role of the YMD peptide in this recognition is shown by the finding that HLA-A2-positive tumor cells that do not express tyrosinase from which the YMD peptide could be processed internally and transported to the cell surface by HLA-A2 molecules for presentation, can be loaded with synthetic YMD peptide, leading to their recognition by D115 and T58. Thereby, both clones show the same specificity for the YMD peptide presented by HLA-A2 molecules. However, the efficiency of recognition displayed by clone T58 is far superior to clone D115, as seen by the levels of interferon-gamma secretion. This, for example, leads to negligible recognition of the melanoma cell line SK-Mel-29 by D115 but clear recognition by T58.

(63) The TCR of clone D115 and T58 were expressed as recombinant proteins in activated recipient lymphocytes (FIG. 7). When these TCR-transduced lymphocytes were retested with the same panel of target cells, they showed the same specificity pattern as the original T cell clones, demonstrating that the TCR recognition was responsible for the results seen in FIG. 6. Again, in FIG. 7 it is demonstrated that the TCR of clone T58 shows superior recognition of the melanoma tumor cell lines that express HLA-A2 and tyrosinase and the YMD peptide-pulsed HLA-A2-positive tumor cells.

(64) FIG. 8A shows that the TCR-transduced lymphocytes show comparable levels of expression of the respective recombinant TCRs, with each transduced population having around 11% of T cells that bind a MHC multimer comprised of HLA-A2 molecules presenting the YMD peptide. Such binding is not observed with control multimers that present other peptides derived from the pp65 protein of human cytomegalovirus.

(65) When the two populations of TCR-transduced PBL are stimulated with HLA-A2-positive antigen-presenting cells (i.e., T2 cells) that are pulsed with different concentrations of YMD peptide (shown on the x-axis), it can be seen that the cells expressing TCR-T58 release 50% of their maximal levels of interferon-gamma (y-axis) at 100-fold lower peptide concentrations. This peptide-sensitivity assay shows that the TCR-T58 has a much higher functional avidity when compared to TCR-D115 (FIG. 8B).

(66) This difference is further exemplified by the strong difference in the maximum levels of interferon-gamma produced by the TCR-T58- versus TCR-D115-transduced lymphocytes. In the case of TCR-T58 cells, the maximum reaches 5000 pg/ml whereas this results in only around 2000 pg/ml for TCR-D115 in 24 hours. Furthermore, the amount of peptide that must be presented by T2 cells to cause release of 2000 pg/ml interferon-gamma is 15,000-fold lower for triggering of this level of response from TCR-T58-transduced lymphocytes compared with TCR-D115-transduced lymphocytes (FIG. 8C).

(67) FIG. 8D shows another peptide-sensitivity assay, this time using peripheral blood mononuclear cells that have been pulsed with titrating amounts of YMD peptide (x-axis). Once again, the amounts of interferon-gamma released by lymphocytes expressing TCR-T58 are much greater compared with TCR-D115. The arrows show that the first detection of cytokine secretion occurs with 1000-fold less peptide for TCR-T58 compared with TCR-D115.

(68) FIGS. 8E and 8F demonstrate the specificity of the transduced lymphocyte populations for peptide-pulsed tumor cells (FIG. 8E) or tumor cell lines expressing HLA-A2 and tyrosinase (FIG. 8F). In all cases, recognition is superior by lymphocytes expressing TCR-T58 compared to TCR-D115.

(69) The superior secretion of cytokine is not limited to interferon-gamma. The levels of secretion of interleukin-2, TNF-alpha and MIP-1beta are also superior for TCR-T58. This is seen after stimulation of the TCR-transduced lymphocytes by tumor cells or by peptide-pulsed T2 cells (FIG. 9).

(70) Material and Methods

(71) Cell Lines

(72) The human melanoma cell lines, Mel-A375 (HLA-A2.sup.+, tyrosinase.sup.?; CRL-1619, American Type Culture Collection (ATCC)), Mel-93.04A12 (HLA-A2.sup.+, tyrosinase.sup.+; gift of P. Schrier, Department of Immunohematology, Leiden University Hospital, The Netherlands), Mel-624.38.sup.1 and SK-Mel-23 (HLA-A2.sup.+, tyrosinase.sup.+; gift of M. C. Panelli, National Institutes of Health, Bethesda, Md.), SK-Mel-28 (HLA-A2.sup.?, tyrosinase.sup.+; MTB-72, ATCC), SK-Mel-29 (HLA-A2.sup.+, tyrosinase.sup.+, gift of P. Rieber, Institute of Immunology, Technical University Dresden, Germany), WM-266-4 (HLA-A2.sup.+, tyrosinase.sup.+; CRL-1676, ATCC) and primary cultures of a human melanoma (passage 6-12) and MaCa1 (HLA-A2.sup.?, tyrosinase.sup.?, gift of R. Wank, M.D. Munich, Germany), stable HLA-A*0201 transfectant of MaCa1 (MaCa1/A2) (HLA-A2.sup.+, tyrosinase.sup.?, gift of E. Noessner, Institute of Molecular Immunology, Helmholtz Zentrum Miinchen, Germany), RCC-26.sup.2 (HLA-A2.sup.+, tyrosinase), PancTu1 (HLA-A2.sup.+, tyrosinase.sup.?, gift of P. Nelson, Department for Biological Chemistry University Hospital LMU Munich, Germany), UTS CC 1588 (HLA-A2.sup.+, tyrosinase.sup.?, gift of M. Schmitz, Institute of Immunology, Technical University Dresden, Germany) as well as the lymphoid cell line T2 (CRL-1992, ATCC) were cultured in RPMI 1640 medium supplemented with 12% fetal bovine serum (FBS), 2 mM L-glutamine and 1 mM sodium-pyruvate and non-essential amino acids.

(73) Peptide Loading of T2 Cells, PBMC and Tumor Cells

(74) For exogenous peptide pulsing, 1?10.sup.6 T2 cells were incubated at 37? C. and 5% CO.sub.2 for 2 h with 10 ?g/ml human ?.sub.2-microglobulin (Calbiochem) and titrating amounts, ranging from 10.sup.?5 M to 10.sup.?11 M, of the tyrosinase peptide YMD (tyrosinase.sub.369-377 YMDGTMSQV, SEQ ID NO: 9, Metabion). T2 cells pulsed with 10.sup.?5 M influenza peptide GIL (flu: influenza matrix protein.sub.58-66 GILGFVFTL, SEQ ID NO: 10, Metabion) served as the negative control. PBMC were loaded with tyrosinase peptide as for T2 cells with titrating amounts ranging from 10.sup.?6 to 10.sup.?11 M. Tumor cells were loaded with either 10.sup.?5 M flu peptide or 10.sup.?5 M tyrosinase peptide YMD as described for T2 cells. After washing, peptide-loaded T2 cells, PBMC or tumor cells were used as stimulating cells in IFN-? release assays.

(75) Cytokine Assays

(76) For investigation of specificity, CTL (2?10.sup.3 cells in 100 ?l) were incubated with various tumor cell lines (1?10.sup.4 cells in 100 ?l), with or without peptide pulsing, as described above. Culture supernatants were harvested after 24 h co-culture and assessed by a standard ELISA using the OptEIA? Human IFN-? Set (BD Biosciences). Data represent mean values with corresponding mean deviations calculated from duplicate determinations. For the calculation of % relative IFN-? release, the maximum IFN-? release was set to the reference value of 100% and corresponding values were calculated corresponding to this reference.

(77) To investigate multiple cytokines simultaneously (IFN-?, IL-2, TNF-? and MIP-1?) cytokine secretion in supernatants of co-culture of CTL with tumor cells and with or without tyrosinase peptide pulsed T2 cells (10.sup.?5 M) was measured using the multiplex protein array system technology (Bio-Rad Laboratories, Hercules, Calif.).

(78) Retroviral TCR Gene Transfer

(79) For TCR identification of tumor-specific CTL, regions of the TCR?- and TCR?-chains encoding CDR3 were amplified by PCR using a panel of TCRV? and TCRV? primers in combination with respective constant region primers as described..sup.3 The full TCR?- and TCR?-chain genes of CTL clones T58 and D115 were amplified by PCR using cDNA as template. Primer sequences will be provided on request. The constant regions of both TCR chains were exchanged by the murine counterparts to increase the stability of the TCR..sup.4 The TCR chains were linked by a 2A peptide linker (TCR?-P2A-TCR?).sup.5, codon-optimized (Geneart).sup.6 and cloned into the retroviral vector MP71PRE via NotI and EcoRI restriction sites..sup.5 Retroviral vector plasmids were co-transfected into 293T cells with expression plasmids encoding Moloney MLV gag/pol and MLV-10A1 env gene, respectively, to produce amphotropic MLV-pseudotyped retroviruses as described..sup.5 Ten days after the second transduction, PBL were stained using PE-labeled A2-tyr multimer and FITC-labeled CD8-specific antibody. Multimers presenting peptides derived from cytomegalovirus pp65 were used as controls: PE-labeled HLA-B7 pp65.sub.417-427 (B7-pp65) multimers served as the HLA control and HLA-A2 pp65.sub.495-503 multimers as a peptide-specificity control. On day 15 an IFN-? release assay was performed using T2 cells or autologous PBMC loaded with graded amounts of tyrosinase peptide (10.sup.?12 M-10.sup.?5 M) and the tumor cell lines MaCa1, SK-Mel-28, Mel-A375, RCC-26, PancTu 1, MaCa1/A2, UTS CC 1588, Mel-624.38, Mel-93.04A12, SK-Mel-23, SK-Mel-29 and WM-266-4 as stimulating cells at an E:T of 2:1.

REFERENCES

(80) 1. Liao, X., et al. Transfection of RNA encoding tumor antigens following maturation of dendritic cells leads to prolonged presentation of antigen and the generation of high-affinity tumor-reactive cytotoxic T lymphocytes. Mol Ther 9, 757-764 (2004). 2. Javorovic, M., et al. Inhibitory effect of RNA pool complexity on stimulatory capacity of RNA-pulsed dendritic cells. J Inununother 31, 52-62 (2008). 3. Altman, J. D., et al. Phenotypic analysis of antigen-specific T lymphocytes. Science 274, 94-96 (1996). 4. Ho, W. Y., Nguyen, H. N., Wolfl, M., Kuball, J. & Greenberg, P. D. In vitro methods for generating CD8+ T-cell clones for immunotherapy from the naive repertoire. J Immunol Methods 310, 40-52 (2006). 5. Wolfel, T., et al. Analysis of antigens recognized on human melanoma cells by A2-restricted cytolytic T lymphocytes (CTL). Int J Cancer 55, 237-244 (1993). 6. Margulies, D. H. TCR avidity: it's not how strong you make it, it's how you make it strong. Nat Immunol 2, 669-670 (2001). 7. Palermo, B., et al. Qualitative difference between the cytotoxic T lymphocyte responses to melanocyte antigens in melanoma and vitiligo. Eur J Immunol 35, 3153-3162 (2005). 8. Engels, B., et al. Retroviral vectors for high-level transgene expression in T lymphocytes. Hum Gene Ther 14, 1155-1168 (2003). 9. Heemskerk, M. H., et al. Redirection of antileukemic reactivity of peripheral T lymphocytes using gene transfer of minor histocompatibility antigen HA-2-specific T-cell receptor complexes expressing a conserved alpha joining region. Blood 102, 3530-3540 (2003). 10. Rivoltini, L., et al. Quantitative correlation between HLA class I allele expression and recognition of melanoma cells by antigen-specific cytotoxic T lymphocytes. Cancer Res 55, 3149-3157 (1995). 11. Wolfl, M., et al. Quantitation of MHC tetramer-positive cells from whole blood: evaluation of a single-platform, six-parameter flow cytometric method. Cytometry A 57, 120-130 (2004). 12. Zhou, D., et al. High throughput analysis of TCR-beta rearrangement and gene expression in single T cells. Lab Invest 86, 314-321 (2006). 13. Steinle, A., Reinhardt, C., Jantzer, P. & Schendel, D. J. In vivo expansion of HLA-B35 alloreactive T cells sharing homologous T cell receptors: evidence for maintenance of an oligoclonally dominated allospecificity by persistent stimulation with an autologous MHC/peptide complex. J Exp Med 181, 503-513 (1995). 14. Leisegang, M., et al. Enhanced functionality of T cell receptor-redirected T cells is defined by the transgene cassette. J Mol Med 86, 573-583 (2008). 15. Kieback, E., Charo, J., Sommermeyer, D., Blankenstein, T. & Uckert, W. A safeguard eliminates T cell receptor gene-modified autoreactive T cells after adoptive transfer. Proc Natl Acad Sci USA 105, 623-628 (2008). 16. Kolb, H. J., Schattenberg, A., Goldman, J. M., Hertenstein, B., Jacobsen, H., Arcese W., Ljungman, P., Ferrant, A., Verdonck, L. Niederwieser, B. et al. 1995. Graft-versus-leukemia effect of donor lymphocyte transfusions in marrow grafted patients. Blood 86:2041. 17. Kolb, H. J., Schmid, C., Barrett, A. J. and Schendel, D. J. (2004). Graft-versus-leukemia reactions in allogeneic chimeras. Blood 103:767-776. 18. Dudley, M. E. and Rosenberg, S. A. (2003). Adoptive-cell-transfer therapy for the treatment of patients with cancer. Nature Reviews Cancer 3: 666-675. 19. Dudley, M. E., Wunderlich, J. R., Robbins, P. F., Yang, J. C., Hwu, P., Schwartzentruber, D. J., Topalian, S. L., Sherry, R., Restifo, N. P., Hubicki, A. M., Robinson, M. R., Raffeld, M., Duray, P., Seipp, C. A., Rogers-Freezer, L., Morton, K. E., Mavroukakis, S. A., White, D. E., Rosenberg, S. A. (2002). Cancer regression and autoimmunity in patients after clonal repopulation with antitumor lymphocytes. Science 298:850-854. 20. Engels, B., N?ssner, E., Frankenberger, B., Blankenstein, Th., Schendel, D. J., and W. Uckert. 2005. Redirecting human T lymphocytes towards renal cell carcinoma-specificity by retroviral transfer of T cell receptor genes. Human Gene Ther., 16(7):79.9-810 21. Rivoltini L, Barracchini K C, Viggiano V, et al. Quantitative correlation between HLA class I allele expression and recognition of melanoma cells by antigen-specific cytotoxic T lymphocytes. Cancer Res. 1995; 55:3149-3157. 22. Schendel D J, Gansbacher B, Oberneder R, et al. Tumor-specific lysis of human renal cell carcinomas by tumor-infiltrating lymphocytes. I. HLA-A2-restricted recognition of autologous and allogeneic tumor lines. J Immunol. 1993; 151:4209-4220. 23. Steinle A, Reinhardt C, Jantzer P, Schendel D J. In vivo expansion of HLA-B35 alloreactive T cells sharing homologous T cell receptors: evidence for maintenance of an oligoclonally dominated allospecificity by persistent stimulation with an autologous MHC/peptide complex. J Exp Med. 1995; 181:503-513. 24. Cohen C J, Zhao Y, Zheng Z, Rosenberg S A, Morgan R A. Enhanced antitumor activity of murine-human hybrid T-cell receptor (TCR) in human lymphocytes is associated with improved pairing and TCR/CD3 stability. Cancer Res. 2006; 66:8878-8886. 25. Leisegang M, Engels B, Meyerhuber P, et al. Enhanced functionality of T cell receptor-redirected T cells is defined by the transgene cassette. J Mol Med. 2008; 86:573-583. 26. Scholten K B, Kramer D, Kueter E W, et al. Codon modification of T cell receptors allows enhanced functional expression in transgenic human T cells. Clin Immunol. 2006; 119:135-145.