Compositions and methods relating to hindering DOT1L recruitment by MLL-fusion proteins
09862746 ยท 2018-01-09
Assignee
Inventors
Cpc classification
A61K45/06
HUMAN NECESSITIES
A61K31/4402
HUMAN NECESSITIES
A61K31/437
HUMAN NECESSITIES
C07D409/04
CHEMISTRY; METALLURGY
C07D213/74
CHEMISTRY; METALLURGY
C07D261/20
CHEMISTRY; METALLURGY
C07D405/04
CHEMISTRY; METALLURGY
A61K31/5377
HUMAN NECESSITIES
A61K31/352
HUMAN NECESSITIES
A61K31/496
HUMAN NECESSITIES
A61K31/454
HUMAN NECESSITIES
C07D519/00
CHEMISTRY; METALLURGY
A61K31/5513
HUMAN NECESSITIES
G01N2500/02
PHYSICS
International classification
C07D409/04
CHEMISTRY; METALLURGY
C07D405/04
CHEMISTRY; METALLURGY
A61K31/454
HUMAN NECESSITIES
A61K31/4402
HUMAN NECESSITIES
A61K31/437
HUMAN NECESSITIES
A61K31/352
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
C07D243/10
CHEMISTRY; METALLURGY
C07D213/74
CHEMISTRY; METALLURGY
C07D519/00
CHEMISTRY; METALLURGY
C07D261/20
CHEMISTRY; METALLURGY
A61K31/5513
HUMAN NECESSITIES
A61K31/5377
HUMAN NECESSITIES
Abstract
The present invention relates to MLL fusion proteins (e.g., AF9 and ENL), which activate target genes in part via recruitment of histone methyltransferase DOT1L. In particular, the present invention provides the AF9/ENL binding site in DOT1L and agents that block the protein-protein interactions between AF9/ENL and DOT1L, therefore inhibiting the activity of DOT1L, and inhibiting MLL-fusion protein associated leukemia.
Claims
1. A composition comprising a small molecule with the structure ##STR00050## and one or more therapeutic agents known to treat cancer.
2. The composition of claim 1, wherein said cancer is leukemia.
3. The composition of claim 2, wherein said leukemia is mixed lineage leukemia (MLL)-fusion protein associated leukemia.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
DEFINITIONS
(24) To facilitate an understanding of the present invention, a number of terms and phrases are defined below.
(25) As used herein, the term therapeutically effective dose is meant a dose that produces the desired effect for which it is administered. The exact dose will depend on the purpose of the treatment, and will be ascertainable by one skilled in the art using known techniques (see, e.g., Lloyd (1999) The Art, Science and Technology of Pharmaceutical Compounding).
(26) The term derivative of a small molecule, as used herein, refers to a chemically modified small molecule wherein the chemical modification takes place either at a functional group of the small molecule (e.g., compound) or on the aromatic ring.
(27) As used herein, the term subject refers to organisms to be treated by the methods and agents of the present invention. Such organisms preferably include, but are not limited to, mammals (e.g., murines, simians, equines, bovines, porcines, canines, felines, and the like), and most preferably includes humans. In the context of the invention, the term subject generally refers to an individual who will receive or who has received treatment (e.g., administration of an agent of the present invention and optionally one or more other agents) for a condition characterized by MLL-fusion protein associated recruitment of DOT1L, and/or MLL-fusion protein associated leukemia.
(28) As used herein, the term host cell refers to any eukaryotic or prokaryotic cell (e.g., mammalian cells, avian cells, amphibian cells, plant cells, fish cells, and insect cells), whether located in vitro or in vivo.
(29) As used herein, the term cell culture refers to any in vitro culture of cells. Included within this term are continuous cell lines (e.g., with an immortal phenotype), primary cell cultures, finite cell lines (e.g., non-transformed cells), and any other cell population maintained in vitro, including oocytes and embryos.
(30) In some embodiments, the target cells of the compositions and methods of the present invention include, refer to, but are not limited to, lymphoid cells or cancer cells. Lymphoid cells include B cells, T cells, and granulocytes. Granulocyctes include eosinophils and macrophages. In some embodiments, target cells are continuously cultured cells or uncultered cells obtained from patient biopsies.
(31) As used herein, the term co-administration refers to the administration of at least two agent(s) (e.g., an agent of the present invention) or therapies to a subject. In some embodiments, the co-administration of two or more agents/therapies is concurrent. In other embodiments, a first agent/therapy is administered prior to a second agent/therapy. Those of skill in the art understand that the formulations and/or routes of administration of the various agents/therapies used may vary. The appropriate dosage for co-administration can be readily determined by one skilled in the art. In some embodiments, when agents/therapies are co-administered, the respective agents/therapies are administered at lower dosages than appropriate for their administration alone. Thus, co-administration is especially desirable in embodiments where the co-administration of the agents/therapies lowers the requisite dosage of a known potentially harmful (e.g., toxic) agent(s).
(32) As used herein, the term toxic refers to any detrimental or harmful effects on a cell or tissue as compared to the same cell or tissue prior to the administration of the toxicant.
(33) As used herein, the term pharmaceutical composition refers to the combination of an active agent with a carrier, inert or active, making the composition especially suitable for diagnostic or therapeutic use in vivo, in vivo or ex vivo.
(34) As used herein, the term pharmaceutically acceptable carrier refers to any of the standard pharmaceutical carriers, such as a phosphate buffered saline solution, water, emulsions (e.g., such as an oil/water or water/oil emulsions), and various types of wetting agents. The compositions also can include stabilizers and preservatives. For examples of carriers, stabilizers and adjuvants. (See e.g., Martin, Remington's Pharmaceutical Sciences, 15th Ed., Mack Publ. Co., Easton, Pa. [1975]).
(35) As used herein, the term pharmaceutically acceptable salt refers to any pharmaceutically acceptable salt (e.g., acid or base) of a compound of the present invention which, upon administration to a subject, is capable of providing a compound of this invention or an active metabolite or residue thereof. As is known to those of skill in the art, salts of the compounds of the present invention may be derived from inorganic or organic acids and bases. Examples of acids include, but are not limited to, hydrochloric, hydrobromic, sulfuric, nitric, perchloric, fumaric, maleic, phosphoric, glycolic, lactic, salicylic, succinic, toluene-p-sulfonic, tartaric, acetic, citric, methanesulfonic, ethanesulfonic, formic, benzoic, malonic, naphthalene-2-sulfonic, benzenesulfonic acid, and the like. Other acids, such as oxalic, while not in themselves pharmaceutically acceptable, may be employed in the preparation of salts useful as intermediates in obtaining the compounds of the invention and their pharmaceutically acceptable acid addition salts.
(36) Examples of bases include, but are not limited to, alkali metals (e.g., sodium) hydroxides, alkaline earth metals (e.g., magnesium), hydroxides, ammonia, and compounds of formula NW.sub.4.sup.+, wherein W is C.sub.1-4 alkyl, and the like.
(37) Examples of salts include, but are not limited to: acetate, adipate, alginate, aspartate, benzoate, benzenesulfonate, bisulfate, butyrate, citrate, camphorate, camphorsulfonate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, fumarate, flucoheptanoate, glycerophosphate, hemisulfate, heptanoate, hexanoate, hydrochloride, hydrobromide, hydroiodide, 2-hydroxyethanesulfonate, lactate, maleate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, oxalate, palmoate, pectinate, persulfate, phenylpropionate, picrate, pivalate, propionate, succinate, tartrate, thiocyanate, tosylate, undecanoate, and the like. Other examples of salts include anions of the compounds of the present invention compounded with a suitable cation such as Na.sup.+, NH.sub.4.sup.+, and NW.sub.4.sup.+ (wherein W is a C.sub.1-4 alkyl group), and the like.
(38) For therapeutic use, salts of the compounds of the present invention are contemplated as being pharmaceutically acceptable. However, salts of acids and bases that are non-pharmaceutically acceptable may also find use, for example, in the preparation or purification of a pharmaceutically acceptable compound.
(39) As used herein, the terms non-specific binding and background binding when used in reference to the interaction of a molecule with a protein or enzyme refers to an interaction that is not dependent on the presence of a particular structure.
(40) As used herein, the term modulate refers to the activity of an agent (e.g., a peptide or small molecule of the present invention) to affect (e.g., to promote or retard) an aspect of cellular function, including, but not limited to, enzymatic activity, maturation, cell growth, replication, proliferation, and the like.
(41) The term test compound refers to any chemical entity, pharmaceutical, drug, and the like, that can be used to treat or prevent a disease, illness, sickness, or disorder of bodily function, or otherwise alter the physiological or cellular status of a sample (e.g., the level of dysregulation of apoptosis in a cell or tissue). Test compounds comprise both known and potential therapeutic compounds. A test compound can be determined to be therapeutic by using the screening methods of the present invention. A known therapeutic compound refers to a therapeutic compound that has been shown (e.g., through animal trials or prior experience with administration to humans) to be effective in such treatment or prevention.
DETAILED DESCRIPTION OF THE INVENTION
(42) The present invention relates to MLL fusion proteins (e.g., AF9 and ENL), which activate target genes in part via recruitment of histone methyltransferase DOT1L. In particular, the present invention provides the AF9/ENL binding site in DOT1L and agents that block the protein-protein interactions between AF9/ENL and DOT1L, therefore inhibiting the activity of DOT1L, and inhibiting MLL-fusion protein associated leukemia. These agents are suitable for treating patients or hosts infected with MLL-fusion protein associated leukemia. The agents and related compositions additionally find use in diagnostic and research settings.
(43) Exemplary compositions and methods of the present invention are described in more detail in the following sections: I. Targeting DOT1L Recruitment; II. Exemplary Agents; III. Pharmaceutical Compositions, Formulations, and Exemplary Administration Routes and Dosing Considerations; IV. Drug Screens; and V. Therapeutic Applications.
(44) The practice of the present invention employs, unless otherwise indicated, conventional techniques of organic chemistry, pharmacology, molecular biology (including recombinant techniques), cell biology, biochemistry, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature, such as, Molecular cloning: a laboratory manual Second Edition (Sambrook et al., 1989); Oligonucleotide synthesis (M. J. Gait, ed., 1984); Animal cell culture (R. I. Freshney, ed., 1987); the series Methods in enzymology (Academic Press, Inc.); Handbook of experimental immunology (D. M. Weir & C. C. Blackwell, eds.); Gene transfer vectors for mammalian cells (J. M. Miller & M. P. Calos, eds., 1987); Current protocols in molecular biology (F. M. Ausubel et al., eds., 1987, and periodic updates); PCR: the polymerase chain reaction (Mullis et al., eds., 1994); and Current protocols in immunology (J. E. Coligan et al., eds., 1991), each of which is herein incorporated by reference in its entirety.
(45) I. Targeting DOT1L Recruitment
(46) Emerging findings from a number of groups suggest that the common MLL fusions, including MLL-AF4, MLL-AF9 and MLL-ENL, use a similar strategy for leukemic transformation. This involves recruitment of the histone methyltransferase (HMT), DOT1L (Disruptor Of Telomeric silencing 1-Like), a non-SET domain containing HMT solely responsible for catalyzing the methylation of histone 3 at lysine 79 (H3K79) (see, e.g., Bitoun E, Oliver P L, Davies K E (2007) Human molecular genetics 16: 92-106; Mueller D, et al., (2007) Blood 110: 4445-4454; Okada Y, et al., (2005) Cell 121: 167-178; Zeisig D T, et al., (2005) Oncogene 24: 5525-5532). Several multi-protein complexes involved in transcriptional activation/elongation were independently identified and studied, showing that all of them contain MLL fusion proteins together with DOT1L and/or p-TEFb (a complex of cyclinT and CDK9, which phosphorylates stalled RNA polymerase II) (see, e.g., Biswas D, et al., (2011) PNAS 108: 15751-15756; Bitoun E, Oliver P L, Davies K E (2007) Human molecular genetics 16: 92-106; Lin C, et al., (2010) Mol Cell 37: 429-437; Mueller D, et al., (2007) Blood 110: 4445-4454; Okada Y, et al., (2005) Cell 121: 167-178; Yokoyama A, et al., (2010) Cancer cell 17: 198-212; Zeisig D T, et al., (2005) Oncogene 24: 5525-5532). It has been reported that the MLL translocation partners, AF4, AF9, AF5q31 and ENL interact in a complex named ENL associated protein complex (EAP), which in addition to the core translocation partners, contains the p-TEFb together with the DOT1L (see, e.g., Mueller D, et al., (2007) Blood 110: 4445-4454). These findings were modified by several following reported studies describing similar complexes associated with DOT1L and p-TEFb as effector units but importantly not both at the same time. For example, it was demonstrated that ENL exists in two distinct complexes, one with DOT1L and one within an endogenous higher ordered complex (designated AEP) in which ENL associates with AF4, AF5q31, and P-TEFb (see, e.g., Yokoyama A, et al., (2010) Cancer cell 17: 198-212). In this model, ENL has dual roles and interacts with AEP and DOT1L recruiting them sequentially to the same target chromatin. This study showed that the AEP complex is required for sustained transcription of target genes and transformation of hematopoietic progenitors, while the recruitment of DOT1L by ENL tethered to the MLL fusion protein plays a role in the maintenance of transcriptional memory. The C-terminal AF9 domain in MLL-AF9 was also shown to form distinct higher order complexes through direct associations with AF4/P-TEFb and with DOT1L (see, e.g., Biswas D, et al., (2011) PNAS 108: 15751-15756). Notably, MLL-AF9-mediated target gene (HOXA 9) expression and cell transformation depend on these protein-protein interactions and formation of the higher order complexes. These findings that DOT1L associates with MLL fusion proteins in several reported complexes, suggested that aberrant H3K79 methylation might be a shared mechanism of oncogenic transcriptional activation in MLL rearrangement leukemia. It is known that the recruitment of DOT1L results in hypermethylation of H3K79 on the prominent MLL-fusion downstream target loci Hoxa9 and Meis1 (see, e.g., Milne T A, et al., (2005) Cancer Res 65: 11367-11374). Genome-wide analysis revealed a distinct pattern of H3K79 methylation in human MLL-rearranged primary leukemia samples compared with normal proB cells and leukemia with other abnormalities (see, e.g., Krivtsov A V, et al., (2008) Cancer cell 14: 355-368). Transient knockdown or conditional knockout mice models have demonstrated that DOT1L is required for MLL-fusion mediated leukemic transformation and in vivo leukemia development and maintenance, indicating that there is a strong functional interconnection between complexes formed by MLL fusion proteins and DOT1L (see, e.g., Bernt K M, et al., (2011) Cancer cell 20: 66-78; Chang M J, et al., (2010) Cancer Res 70: 10234-10242; Jo S Y, et al., (2011) Blood 117: 4759-4768; Nguyen A T, et al., (2011) Blood 117: 6912-6922; Nguyen A T, Zhang Y (2011) Genes Dev 25: 1345-1358; Zeisig D T, et al., (2005) Oncogene 24: 5525-5532). These findings illustrate the central role of the DOT1L recruitment and H3K79 methylation in leukemogenesis by controlling transcription of hematopoietic genes and implicate protein-protein interactions (PPI) between DOT1L and MLL oncogenic fusion proteins as a potential therapeutic target.
(47) In experiments conducted during the course of developing embodiments for the present invention, the AF9/ENL-DOT1L interaction on biochemical, biophysical and functional level was characterized. It was demonstrated that only 10 amino acids in DOT1L are essential for the recruitment of DOT1L by MLL-AF9 and this interaction is required for transformation of MLL-AF9. Indeed, using SPR and FP based binding assays, ITC, HSQC NMR, immunoprecipitation and pull-down experiments, the binding affinity of these PPI were determined and the AF9/ENL interaction site defined to the region corresponding to DOT1L 865LPISIPLSTV874(SEQ ID NO:1). Importantly, the functional studies show that this interaction is required for transformation by MLL-AF9. These results indicate that disruption of this PPI represents a therapeutic strategy for MLL-fusion protein associated leukemia.
(48) Accordingly, in certain embodiments, the present invention provides methods for treating and/or preventing MLL-fusion protein associated leukemia through, for example, inhibiting MLL-fusion protein associated recruitment of DOT1L. The present invention is not limited to a particular manner of inhibiting MLL-fusion protein associated recruitment of DOT1L. In some embodiments, inhibiting MLL-fusion protein associated recruitment of DOT1L is accomplished through preventing binding of DOT1L with AF9, ENL, and/or AF9/ENL. In some embodiments, preventing binding of DOT1L with AF9, ENL, and/or AF9/ENL is accomplished through blocking the region of AF9, ENL, and/or AF9/ENL that binds DOT1L with, for example, an agent (e.g., a peptide, a small molecule, peptidomimetic, a cyclic peptide) that binds the AF9/ENL interaction site thereby preventing DOT1L binding. In some embodiments, such an agent has binding properties similar to the region of DOT1L corresponding to DOT1L 865LPISIPLSTV874(SEQ ID NO:1). In some embodiments, such binding of the region of AF9, ENL, and/or AF9/ENL that binds with DOT1L furthermore results in prevention of an AEP complex (e.g., wherein ENL associates with AF4, AF5q31, P-TEFb, and DOT1L). In some embodiments, such binding of the region of AF9, ENL, and/or AF9/ENL that binds with DOT1L furthermore results in prevention aberrant H3K79 methylation. In some embodiments, such binding of the region of AF9, ENL, and/or AF9/ENL that binds with DOT1L furthermore results in prevention of MLL-fusion associated leukemogenesis.
(49) II. Exemplary Agents
(50) The recent development of a specific small molecule inhibitor of DOT1L, EPZ004777, which is a competitive inhibitor of the methyl donor Sadenosyl-methionine provide proof of principle for the development of DOT1L inhibitors as targeted therapeutics for MLL-rearranged leukemia (see, e.g., Daigle S R, et al., (2011) Cancer cell 20: 53-65). However, constitutive and conditional knockout studies of DOT1L, which is the only known H3K79 methyltransferase, have shown it is essential for embryonic development, prenatal and postnatal hematopoiesis and cardiac function (see, e.g., Bernt, et al., (2011) Cancer Cell 20, 66-78; Jo, S. Y., et al., (2011) Blood 117, 4759-4768; Nguyen, A. T., et al., (2011) Blood 117, 6912-6922; Feng, Y., et al., (2010) Blood 116, 4483-4491; Jones, B., et al., (2008) PLoS Genet 4, e1000190). This universal and essential function of DOT1L in multiple cell types (see, e.g., Nguyen, A. T., and Zhang, Y. (2011) Genes Dev 25, 1345-1358) suggests that directly inhibiting DOT1L histone methyltransferase activity might be toxic. Consequently, development of therapeutic strategies allowing selective inhibition of DOT1L function is important and necessary.
(51) In experiments conducted during the course of developing embodiments for the present invention, the PPI between DOT1L and AF9 or ENL, respectively, was validated as a promising therapeutic target and potential strategy for pharmacological targeting of DOT1L. The results indicate that disruption of AF9-DOT1L interaction abolishes MLL-AF9 leukemia transformation, without affecting the global level of H3K79 methylation level. More importantly, the results also suggest that selective disruption of this PPI is a promising therapeutic strategy with potentially fewer adverse effects than enzymatic inhibition of DOT1L for MLL-fusion protein associated leukemia.
(52) As such, in certain embodiments, the present invention provides agents capable of targeting the MLL-fusion protein interaction site for DOT1L (e.g., an agent having binding properties similar to the region of DOT1L corresponding to DOT1L 865LPISIPLSTV874(SEQ ID NO:1)). In some embodiments, the MLL-fusion protein is AF9. In some embodiments, the MLL-fusion protein is ENL. In some embodiments, the present invention provides methods for treating MLL-fusion protein associated leukemia through inhibiting or blocking the biological activity of DOT1L, thereby inhibiting MLL-fusion protein associated leukemia. In certain embodiments, the present invention provides methods for screening drugs through identifying agents capable of, for example, binding with the MLL-fusion protein interaction site for DOT1L (e.g., the AF9/ENL interaction site for DOT1L) (e.g., an agent having binding properties similar to the region of DOT1L corresponding to DOT1L 865LPISIPLSTV874(SEQ ID NO:1)).
(53) The present invention is not limited to certain types or kinds of agents capable of binding the MLL-fusion protein interaction site for DOT1L (e.g., the AF9/ENL interaction site for DOT1L).
(54) In some embodiments, the agent is a peptide capable of binding the MLL-fusion protein interaction site for DOT1L (e.g., the AF9/ENL interaction site for DOT1L). In some embodiments, the peptide comprises 865LPISIPLSTV874(SEQ ID NO:1) of DOT1L.
(55) In some embodiments, the agent is a peptidomimetic designed and synthesized to mimic a peptide capable of binding a region of AF9 or ENL known to interact with DOT1L (e.g., 865LPISIPLSTV874(SEQ ID NO:1) of DOT1L).
(56) In some embodiments, the agent is a cyclic peptide designed and synthesized to mimic a peptide capable of binding a region of AF9 or ENL known to interact with DOT1L (e.g., 865LPISIPLSTV874(SEQ ID NO:1) of DOT1L).
(57) In some embodiments, the agent is a small molecule capable of binding the MLL-fusion protein interaction site for DOT1L (e.g., the AF9/ENL interaction site for DOT1L). Indeed, experiments conducted during the course of developing embodiments for the present invention identified and validated lead small molecules (e.g., compounds) targeting PPI between DOT1L and MLL-AF9 by employing the optimized FP-based assay (see, Examples 12, 13, 14 and 15). Such experiments identified the following small molecules (e.g., compounds) capable of targeting a MLL-fusion protein interaction site for DOT1L (e.g., the AF9/ENL interaction site for DOT1L) (e.g., a small molecule having binding properties similar to the region of DOT1L corresponding to DOT1L 865LPISIPLSTV874(SEQ ID NO:1)):
(58) ##STR00026## ##STR00027## ##STR00028## ##STR00029## ##STR00030## ##STR00031## ##STR00032##
including salts, esters, and prodrugs thereof, and including both R and S enantiomeric forms and racemic mixtures thereof.
III. Pharmaceutical Compositions, Formulations, and Exemplary Administration Routes and Dosing Considerations
(59) Exemplary embodiments of various contemplated medicaments and pharmaceutical compositions are provided below.
(60) A. Preparing Medicaments
(61) It is contemplated that the agents of the present invention are useful in the preparation of medicaments to treat a variety of conditions associated with MLL-fusion protein associated recruitment of DOT1L, and/or MLL-fusion protein associated leukemia.
(62) In addition, it is contemplated that the agents are also useful for preparing medicaments for treating other disorders wherein the effectiveness of the compounds are known or predicted. The methods and techniques for preparing medicaments of an agent of the present invention are well-known in the art. Exemplary pharmaceutical formulations and routes of delivery are described below.
(63) One of skill in the art will appreciate that any one or more of the agents described herein, including the many specific embodiments, are prepared by applying standard pharmaceutical manufacturing procedures. Such medicaments can be delivered to the subject by using delivery methods that are well-known in the pharmaceutical arts.
(64) B. Exemplary Pharmaceutical Compositions and Formulation
(65) In some embodiments of the present invention, the compositions are administered alone, while in some other embodiments, the compositions are preferably present in a pharmaceutical formulation comprising at least one active ingredient/agent, as defined above, together with a solid support or alternatively, together with one or more pharmaceutically acceptable carriers and optionally other therapeutic agents. Each carrier must be acceptable in the sense that it is compatible with the other ingredients of the formulation and not injurious to the subject.
(66) Contemplated formulations include those suitable oral, rectal, nasal, topical (including transdermal, buccal and sublingual), vaginal, parenteral (including subcutaneous, intramuscular, intravenous and intradermal) and pulmonary administration. In some embodiments, formulations are conveniently presented in unit dosage form and are prepared by any method known in the art of pharmacy. Such methods include the step of bringing into association the active ingredient with the carrier which constitutes one or more accessory ingredients. In general, the formulations are prepared by uniformly and intimately bringing into association (e.g., mixing) the active ingredient with liquid carriers or finely divided solid carriers or both, and then if necessary shaping the product.
(67) Formulations of the present invention suitable for oral administration may be presented as discrete units such as capsules, cachets or tablets, wherein each preferably contains a predetermined amount of the active ingredient; as a powder or granules; as a solution or suspension in an aqueous or non-aqueous liquid; or as an oil-in-water liquid emulsion or a water-in-oil liquid emulsion. In other embodiments, the active ingredient is presented as a bolus, electuary, or paste, etc.
(68) In some embodiments, tablets comprise at least one active ingredient and optionally one or more accessory agents/carriers are made by compressing or molding the respective agents. In some embodiments, compressed tablets are prepared by compressing in a suitable machine the active ingredient in a free-flowing form such as a powder or granules, optionally mixed with a binder (e.g., povidone, gelatin, hydroxypropylmethyl cellulose), lubricant, inert diluent, preservative, disintegrant (e.g., sodium starch glycolate, cross-linked povidone, cross-linked sodium carboxymethyl cellulose) surface-active or dispersing agent. Molded tablets are made by molding in a suitable machine a mixture of the powdered compound (e.g., active ingredient) moistened with an inert liquid diluent. Tablets may optionally be coated or scored and may be formulated so as to provide slow or controlled release of the active ingredient therein using, for example, hydroxypropylmethyl cellulose in varying proportions to provide the desired release profile. Tablets may optionally be provided with an enteric coating, to provide release in parts of the gut other than the stomach.
(69) Formulations suitable for topical administration in the mouth include lozenges comprising the active ingredient in a flavored basis, usually sucrose and acacia or tragacanth; pastilles comprising the active ingredient in an inert basis such as gelatin and glycerin, or sucrose and acacia; and mouthwashes comprising the active ingredient in a suitable liquid carrier.
(70) Pharmaceutical compositions for topical administration according to the present invention are optionally formulated as ointments, creams, suspensions, lotions, powders, solutions, pastes, gels, sprays, aerosols or oils. In alternatively embodiments, topical formulations comprise patches or dressings such as a bandage or adhesive plasters impregnated with active ingredient(s), and optionally one or more excipients or diluents. In some embodiments, the topical formulations include a compound(s) that enhances absorption or penetration of the active agent(s) through the skin or other affected areas. Examples of such dermal penetration enhancers include dimethylsulfoxide (DMSO) and related analogues.
(71) If desired, the aqueous phase of a cream base includes, for example, at least about 30% w/w of a polyhydric alcohol, i.e., an alcohol having two or more hydroxyl groups such as propylene glycol, butane-1,3-diol, mannitol, sorbitol, glycerol and polyethylene glycol and mixtures thereof.
(72) In some embodiments, oily phase emulsions of this invention are constituted from known ingredients in a known manner. This phase typically comprises a lone emulsifier (otherwise known as an emulgent), it is also desirable in some embodiments for this phase to further comprises a mixture of at least one emulsifier with a fat or an oil or with both a fat and an oil.
(73) Preferably, a hydrophilic emulsifier is included together with a lipophilic emulsifier so as to act as a stabilizer. In some embodiments it is also preferable to include both an oil and a fat. Together, the emulsifier(s) with or without stabilizer(s) make up the so-called emulsifying wax, and the wax together with the oil and/or fat make up the so-called emulsifying ointment base which forms the oily dispersed phase of the cream formulations.
(74) Emulgents and emulsion stabilizers suitable for use in the formulation of the present invention include Tween 60, Span 80, cetostearyl alcohol, myristyl alcohol, glyceryl monostearate and sodium lauryl sulfate.
(75) The choice of suitable oils or fats for the formulation is based on achieving the desired properties (e.g., cosmetic properties), since the solubility of the active compound/agent in most oils likely to be used in pharmaceutical emulsion formulations is very low. Thus creams should preferably be a non-greasy, non-staining and washable products with suitable consistency to avoid leakage from tubes or other containers. Straight or branched chain, mono- or dibasic alkyl esters such as di-isoadipate, isocetyl stearate, propylene glycol diester of coconut fatty acids, isopropyl myristate, decyl oleate, isopropyl palmitate, butyl stearate, 2-ethylhexyl palmitate or a blend of branched chain esters known as Crodamol CAP may be used, the last three being preferred esters. These may be used alone or in combination depending on the properties required. Alternatively, high melting point lipids such as white soft paraffin and/or liquid paraffin or other mineral oils can be used.
(76) Formulations suitable for topical administration to the eye also include eye drops wherein the active ingredient is dissolved or suspended in a suitable carrier, especially an aqueous solvent for the agent.
(77) Formulations for rectal administration may be presented as a suppository with suitable base comprising, for example, cocoa butter or a salicylate.
(78) Formulations suitable for vaginal administration may be presented as pessaries, creams, gels, pastes, foams or spray formulations containing in addition to the agent, such carriers as are known in the art to be appropriate.
(79) Formulations suitable for nasal administration, wherein the carrier is a solid, include coarse powders having a particle size, for example, in the range of about 20 to about 500 microns which are administered in the manner in which snuff is taken, i.e., by rapid inhalation (e.g., forced) through the nasal passage from a container of the powder held close up to the nose. Other suitable formulations wherein the carrier is a liquid for administration include, but are not limited to, nasal sprays, drops, or aerosols by nebulizer, an include aqueous or oily solutions of the agents.
(80) Formulations suitable for parenteral administration include aqueous and non-aqueous isotonic sterile injection solutions which may contain antioxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents, and liposomes or other microparticulate systems which are designed to target the compound to blood components or one or more organs. In some embodiments, the formulations are presented/formulated in unit-dose or multi-dose sealed containers, for example, ampoules and vials, and may be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example water for injections, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets of the kind previously described.
(81) Preferred unit dosage formulations are those containing a daily dose or unit, daily subdose, as herein above-recited, or an appropriate fraction thereof, of an agent.
(82) It should be understood that in addition to the ingredients particularly mentioned above, the formulations of this invention may include other agents conventional in the art having regard to the type of formulation in question, for example, those suitable for oral administration may include such further agents as sweeteners, thickeners and flavoring agents. It also is intended that the agents, compositions and methods of this invention be combined with other suitable compositions and therapies. Still other formulations optionally include food additives (suitable sweeteners, flavorings, colorings, etc.), phytonutrients (e.g., flax seed oil), minerals (e.g., Ca, Fe, K, etc.), vitamins, and other acceptable compositions (e.g., conjugated linoelic acid), extenders, and stabilizers, etc.
(83) In some embodiments, the agents of the present invention are provided in unsolvated form or are in non-aqueous solutions (e.g., ethanol). The agents may be generated to allow such formulations through the production of specific crystalline polymorphs compatible with the formulations.
(84) In certain embodiments, the present invention provides instructions for administering an agent to a subject. In certain embodiments, the present invention provides instructions for using the compositions contained in a kit for the treatment of conditions characterized by the dysregulation of apoptotic processes in a cell or tissue (e.g., providing dosing, route of administration, decision trees for treating physicians for correlating patient-specific characteristics with therapeutic courses of action). In certain embodiments, the present invention provides instructions for using the compositions contained in the kit to treat a variety of disorders associated with MLL-fusion protein associated recruitment of DOT1L, and/or MLL-fusion protein associated leukemia.
(85) C. Exemplary Administration Routes and Dosing Considerations
(86) Various delivery systems are known and can be used to administer therapeutic agents (e.g., exemplary agents as described in Section II above) of the present invention, e.g., encapsulation in liposomes, microparticles, microcapsules, receptor-mediated endocytosis, and the like. Methods of delivery include, but are not limited to, intra-arterial, intra-muscular, intravenous, intranasal, and oral routes. In specific embodiments, it may be desirable to administer the pharmaceutical compositions of the invention locally to the area in need of treatment; this may be achieved by, for example, and not by way of limitation, local infusion during surgery, injection, or by means of a catheter.
(87) It is contemplated that the agents identified can be administered to subjects or individuals susceptible to or at risk of developing a variety of conditions associated with MLL-fusion protein associated recruitment of DOT1L, and/or MLL-fusion protein associated leukemia. When the agent is administered to a subject such as a mouse, a rat or a human patient, the agent can be added to a pharmaceutically acceptable carrier and systemically or topically administered to the subject. To determine patients that can be beneficially treated, a tissue sample is removed from the patient and the cells are assayed for sensitivity to the agent.
(88) Therapeutic amounts are empirically determined and vary with the pathology being treated, the subject being treated and the efficacy and toxicity of the agent. When delivered to an animal, the method is useful to further confirm efficacy of the agent.
(89) In some embodiments, in vivo administration is effected in one dose, continuously or intermittently throughout the course of treatment. Methods of determining the most effective means and dosage of administration are well known to those of skill in the art and vary with the composition used for therapy, the purpose of therapy, the target cell being treated, and the subject being treated. Single or multiple administrations are carried out with the dose level and pattern being selected by the treating physician.
(90) Suitable dosage formulations and methods of administering the agents are readily determined by those of skill in the art. Preferably, the compounds are administered at about 0.01 mg/kg to about 200 mg/kg, more preferably at about 0.1 mg/kg to about 100 mg/kg, even more preferably at about 0.5 mg/kg to about 50 mg/kg. When the compounds described herein are co-administered with another agent, the effective amount may be more or less than when the agent is used alone.
(91) The pharmaceutical compositions can be administered orally, intranasally, parenterally or by inhalation therapy, and may take the form of tablets, lozenges, granules, capsules, pills, ampoules, suppositories or aerosol form. They may also take the form of suspensions, solutions and emulsions of the active ingredient in aqueous or nonaqueous diluents, syrups, granulates or powders. In addition to an agent of the present invention, the pharmaceutical compositions can also contain other pharmaceutically active compounds or a plurality of compounds of the invention.
(92) More particularly, an agent of the present invention also referred to herein as the active ingredient, may be administered for therapy by any suitable route including, but not limited to, oral, rectal, nasal, topical (including, but not limited to, transdermal, aerosol, buccal and sublingual), vaginal, parental (including, but not limited to, subcutaneous, intramuscular, intravenous and intradermal) and pulmonary. It is also appreciated that the preferred route varies with the condition and age of the recipient, and the disease being treated.
(93) Ideally, the agent should be administered to achieve peak concentrations of the active compound at sites of disease. This may be achieved, for example, by the intravenous injection of the agent, optionally in saline, or orally administered, for example, as a tablet, capsule or syrup containing the active ingredient.
(94) Desirable blood levels of the agent may be maintained by a continuous infusion to provide a therapeutic amount of the active ingredient within disease tissue. The use of operative combinations is contemplated to provide therapeutic combinations requiring a lower total dosage of each component antiviral agent than may be required when each individual therapeutic compound or drug is used alone, thereby reducing adverse effects.
(95) D. Exemplary Co-Administration Routes and Dosing Considerations
(96) The present invention also includes methods involving co-administration of the agents described herein with one or more additional active agents. Indeed, it is a further aspect of this invention to provide methods for enhancing prior art therapies and/or pharmaceutical compositions by co-administering an agent of this invention. In co-administration procedures, the agents may be administered concurrently or sequentially. In one embodiment, the agents described herein are administered prior to the other active agent(s). The pharmaceutical formulations and modes of administration may be any of those described above. In addition, the two or more co-administered chemical agents, biological agents or radiation may each be administered using different modes or different formulations.
(97) The agent or agents to be co-administered depends on the type of condition being treated. For example, when the condition being treated is associated with MLL-fusion protein associated recruitment of DOT1L, and/or MLL-fusion protein associated leukemia, the agent is known to treat cancer (e.g., leukemia) (e.g., MLL-fusion protein associated leukemia). A number of suitable therapeutic or anticancer agents are contemplated for use in the methods provided herein. Indeed, the methods provided herein can include but are not limited to, administration of numerous therapeutic agents such as: agents that induce apoptosis; polynucleotides (e.g., anti-sense, ribozymes, siRNA); polypeptides (e.g., enzymes and antibodies); biological mimetics; alkaloids; alkylating agents; antitumor antibiotics; antimetabolites; hormones; platinum compounds; monoclonal or polyclonal antibodies (e.g., antibodies conjugated with anticancer drugs, toxins, defensins), toxins; radionuclides; biological response modifiers (e.g., interferons (e.g., IFN-) and interleukins (e.g., IL-2)); adoptive immunotherapy agents; hematopoietic growth factors; agents that induce tumor cell differentiation (e.g., all-trans-retinoic acid); gene therapy reagents (e.g., antisense therapy reagents and nucleotides); tumor vaccines; angiogenesis inhibitors; proteosome inhibitors: NF-KB modulators; anti-CDK compounds; HDAC inhibitors; and the like. Numerous other examples of therapeutic agents such as chemotherapeutic compounds and anticancer therapies suitable for co-administration with the disclosed compounds are known to those skilled in the art.
(98) In certain embodiments, anticancer agents comprise agents that induce or stimulate apoptosis. Agents that induce or stimulate apoptosis include, for example, agents that interact with or modify DNA, such as by intercalating, cross-linking, alkylating, or otherwise damaging or chemically modifying DNA. Agents that induce apoptosis include, but are not limited to, radiation (e.g., X-rays, gamma rays, UV); tumor necrosis factor (TNF)-related factors (e.g., TNF family receptor proteins, TNF family ligands, TRAIL, antibodies to TRAIL-R1 or TRAIL-R2); kinase inhibitors (e.g., epidermal growth factor receptor (EGFR) kinase inhibitor. Additional anticancer agents include: vascular growth factor receptor (VGFR) kinase inhibitor, fibroblast growth factor receptor (FGFR) kinase inhibitor, platelet-derived growth factor receptor (PDGFR) kinase inhibitor, and Bcr-Abl kinase inhibitors (such as GLEEVEC)); antisense molecules; antibodies (e.g., HERCEPTIN, RITUXAN, ZEVALIN, and AVASTIN); anti-estrogens (e.g., raloxifene and tamoxifen); anti-androgens (e.g., flutamide, bicalutamide, finasteride, aminoglutethamide, ketoconazole, and corticosteroids); cyclooxygenase 2 (COX-2) inhibitors (e.g., celecoxib, meloxicam, NS-398, and non-steroidal anti-inflammatory drugs (NSAIDs)); anti-inflammatory drugs (e.g., butazolidin, DECADRON, DELTASONE, dexamethasone, dexamethasone intensol, DEXONE, HEXADROL, hydroxychloroquine, METICORTEN, ORADEXON, ORASONE, oxyphenbutazone, PEDIAPRED, phenylbutazone, PLAQUENIL, prednisolone, prednisone, PRELONE, and TANDEARIL); and cancer chemotherapeutic drugs (e.g., irinotecan (CAMPTOSAR), CPT-11, fludarabine (FLUDARA), dacarbazine (DTIC), dexamethasone, mitoxantrone, MYLOTARG, VP-16, cisplatin, carboplatin, oxaliplatin, 5-FU, doxorubicin, gemcitabine, bortezomib, gefitinib, bevacizumab, TAXOTERE or TAXOL); cellular signaling molecules; ceramides and cytokines; staurosporine, and the like.
(99) In still other embodiments, the compositions and methods provided herein include one or more agents provided herein and at least one anti-hyperproliferative or antineoplastic agent selected from alkylating agents, antimetabolites, and natural products (e.g., herbs and other plant and/or animal derived compounds).
(100) Alkylating agents suitable for use in the present compositions and methods include, but are not limited to: 1) nitrogen mustards (e.g., mechlorethamine, cyclophosphamide, ifosfamide, melphalan (L-sarcolysin); and chlorambucil); 2) ethylenimines and methylmelamines (e.g., hexamethylmelamine and thiotepa); 3) alkyl sulfonates (e.g., busulfan); 4) nitrosoureas (e.g., carmustine (BCNU); lomustine (CCNU); semustine (methyl-CCNU); and streptozocin (streptozotocin)); and 5) triazenes (e.g., dacarbazine (DTIC; dimethyltriazenoimid-azolecarboxamide).
(101) In some embodiments, antimetabolites suitable for use in the present compositions and methods include, but are not limited to: 1) folic acid analogs (e.g., methotrexate (amethopterin)); 2) pyrimidine analogs (e.g., fluorouracil (5-fluorouracil; 5-FU), floxuridine (fluorode-oxyuridine; FudR), and cytarabine (cytosine arabinoside)); and 3) purine analogs (e.g., mercaptopurine (6-mercaptopurine; 6-MP), thioguanine (6-thioguanine; TG), and pentostatin (2-deoxycoformycin)).
(102) In still further embodiments, chemotherapeutic agents suitable for use in the compositions and methods of the present invention include, but are not limited to: 1) vinca alkaloids (e.g., vinblastine (VLB), vincristine); 2) epipodophyllotoxins (e.g., etoposide and teniposide); 3) antibiotics (e.g., dactinomycin (actinomycin D), daunorubicin (daunomycin; rubidomycin), doxorubicin, bleomycin, plicamycin (mithramycin), and mitomycin (mitomycin C)); 4) enzymes (e.g., L-asparaginase); 5) biological response modifiers (e.g., interferon-alfa); 6) platinum coordinating complexes (e.g., cisplatin (cis-DDP) and carboplatin); 7) anthracenediones (e.g., mitoxantrone); 8) substituted ureas (e.g., hydroxyurea); 9) methylhydrazine derivatives (e.g., procarbazine (N-methylhydrazine; MIH)); 10) adrenocortical suppressants (e.g., mitotane (o,p-DDD) and aminoglutethimide); 11) adrenocorticosteroids (e.g., prednisone); 12) progestins (e.g., hydroxyprogesterone caproate, medroxyprogesterone acetate, and megestrol acetate); 13) estrogens (e.g., diethylstilbestrol and ethinyl estradiol); 14) antiestrogens (e.g., tamoxifen); 15) androgens (e.g., testosterone propionate and fluoxymesterone); 16) antiandrogens (e.g., flutamide): and 17) gonadotropin-releasing hormone analogs (e.g., leuprolide).
(103) Any oncolytic agent that is routinely used in a cancer therapy context finds use in the compositions and methods of the present invention. For example, the U.S. Food and Drug Administration maintains a formulary of oncolytic agents approved for use in the United States. International counterpart agencies to the U.S.F.D.A. maintain similar formularies. Table 1 provides a list of exemplary antineoplastic agents approved for use in the U.S. Those skilled in the art will appreciate that the product labels required on all U.S. approved chemotherapeutics describe approved indications, dosing information, toxicity data, and the like, for the exemplary agents.
(104) TABLE-US-00001 TABLE 1 Aldesleukin Proleukin (des-alanyl-1, serine-125 human interleukin-2) Alemtuzumab Campath (IgG1 anti CD52 antibody) Alitretinoin Panretin (9-cis-retinoic acid) Allopurinol Zyloprim (1,5-dihydro-4H-pyrazolo[3,4-d]pyrimidin-4-one monosodium salt) Altretamine Hexalen (N,N,N,N,N,N,-hexamethyl-1,3,5-triazine-2,4,6- triamine) Amifostine Ethyol (ethanethiol, 2-[(3-aminopropyl)amino]-, dihydrogen phosphate (ester)) Anastrozole Arimidex (1,3-Benzenediacetonitrile,a,a,a,a-tetramethyl-5-(1H- 1,2,4-triazol-1-ylmethyl)) Arsenic trioxide Trisenox Asparaginase Elspar (L-asparagine amidohydrolase, type EC-2) BCG Live TICE BCG (lyophilized preparation of an attenuated strain of Mycobacterium bovis (Bacillus Calmette-Gukin [BCG], substrain Montreal) bexarotene capsules Targretin (4-[1-(5,6,7,8-tetrahydro-3,5,5,8,8-pentamethyl-2- napthalenyl) ethenyl] benzoic acid) bexarotene gel Targretin Bleomycin Blenoxane (cytotoxic glycopeptide antibiotics produced by Streptomyces verticillus; bleomycin A.sub.2 and bleomycin B.sub.2) Capecitabine Xeloda (5-deoxy-5-fluoro-N-[(pentyloxy)carbonyl]-cytidine) Carboplatin Paraplatin (platinum, diammine [1,1-cyclobutanedicarboxylato(2-)- 0,0]-,(SP-4-2)) Carmustine BCNU, (1,3-bis(2-chloroethyl)-1-nitrosourea) BiCNU Carmustine with Polifeprosan 20 Implant Gliadel Wafer Celecoxib Celebrex (as 4-[5-(4-methylphenyl)-3-(trifluoromethyl)-1H-pyrazol- 1-yl] benzenesulfonamide) Chlorambucil Leukeran (4-[bis(2chlorethyl)amino]benzenebutanoic acid) Cisplatin Platinol (PtCl.sub.2H.sub.6N.sub.2) Cladribine Leustatin, (2-chloro-2-deoxy-b-D-adenosine) 2-CdA Cyclophosphamide Cytoxan, (2-[bis(2-chloroethyl)amino] tetrahydro-2H-13,2- Neosar oxazaphosphorine 2-oxide monohydrate) Cytarabine Cytosar-U (1-b-D-Arabinofuranosylcytosine, C.sub.9H.sub.13N.sub.3O.sub.5) cytarabine liposomal DepoCyt Dacarbazine DTIC-Dome (5-(3,3-dimethyl-1-triazeno)-imidazole-4-carboxamide (DTIC)) Dactinomycin, actinomycin D Cosmegen (actinomycin produced by Streptomyces parvullus, C.sub.62H.sub.86N.sub.12O.sub.16) Darbepoetin alfa Aranesp (recombinant peptide) daunorubicin liposomal DanuoXome ((8S-cis)-8-acetyl-10-[(3-amino-2,3,6-trideoxy--L-lyxo- hexopyranosyl)oxy]-7,8,9,10-tetrahydro-6,8,11-trihydroxy- 1-methoxy-5,12-naphthacenedione hydrochloride) Daunorubicin HCl, daunomycin Cerubidine ((1S,3S)-3-Acetyl-1,2,3,4,6,11-hexahydro-3,5,12- trihydroxy-10-methoxy-6,11-dioxo-1-naphthacenyl 3- amino-2,3,6-trideoxy-(alpha)-L-lyxo-hexopyranoside hydrochloride) Denileukin diftitox Ontak (recombinant peptide) Dexrazoxane Zinecard ((S)-4,4-(1-methyl-1,2-ethanediyl)bis-2,6-piperazinedione) Docetaxel Taxotere ((2R,3S)-N-carboxy-3-phenylisoserine, N-tert-butyl ester, 13-ester with 5b-20-epoxy-12a,4,7b,10b,13a- hexahydroxytax-11-en-9-one 4-acetate 2-benzoate, trihydrate) Doxorubicin HCl Adriamycin, (8S,10S)-10-[(3-amino-2,3,6-trideoxy-a-L-lyxo- Rubex hexopyranosyl)oxy]-8-glycolyl-7,8,9,10-tetrahydro-6,8,11- trihydroxy-1-methoxy-5,12-naphthacenedione hydrochloride) doxorubicin Adriamycin PFS Intravenous injection doxorubicin liposomal Doxil dromostanolone propionate Dromostanolone (17b-Hydroxy-2a-methyl-5a-androstan-3-one propionate) dromostanolone propionate Masterone injection Elliott's B Solution Elliott's B Solution Epirubicin Ellence ((8S-cis)-10-[(3-amino-2,3,6-trideoxy-a-L-arabino- hexopyranosyl)oxy]-7,8,9,10-tetrahydro-6,8,11-trihydroxy- 8-(hydroxyacetyl)-1-methoxy-5,12-naphthacenedione hydrochloride) Epoetin alfa Epogen (recombinant peptide) Estramustine Emcyt (estra-1,3,5(10)-triene-3,17-diol(17(beta))-, 3-[bis(2- chloroethyl)carbamate] 17-(dihydrogen phosphate), disodium salt, monohydrate, or estradiol 3-[bis(2- chloroethyl)carbamate] 17-(dihydrogen phosphate), disodium salt, monohydrate) Etoposide phosphate Etopophos (4-Demethylepipodophyllotoxin 9-[4,6-O-(R)-ethylidene- (beta)-D-glucopyranoside], 4-(dihydrogen phosphate)) etoposide, VP-16 Vepesid (4-demethylepipodophyllotoxin 9-[4,6-0-(R)-ethylidene- (beta)-D-glucopyranoside]) Exemestane Aromasin (6-methylenandrosta-1,4-diene-3,17-dione) Filgrastim Neupogen (r-metHuG-CSF) floxuridine (intraarterial) FUDR (2-deoxy-5-fluorouridine) Fludarabine Fludara (fluorinated nucleotide analog of the antiviral agent vidarabine, 9-b-D-arabinofuranosyladenine (ara-A)) Fluorouracil, 5-FU Adrucil (5-fluoro-2,4(1H,3H)-pyrimidinedione) Fulvestrant Faslodex (7-alpha-[9-(4,4,5,5,5-penta fluoropentylsulphinyl) nonyl]estra-1,3,5-(10)-triene-3,17-beta-diol) Gemcitabine Gemzar (2-deoxy-2,2-difluorocytidine monohydrochloride (b-isomer)) Gemtuzumab Ozogamicin Mylotarg (anti-CD33 hP67.6) Goserelin acetate Zoladex Implant Hydroxyurea Hydrea Ibritumomab Tiuxetan Zevalin (immunoconjugate resulting from a thiourea covalent bond between the monoclonal antibody Ibritumomab and the linker-chelator tiuxetan [N-[2-bis(carboxymethyl)amino]- 3-(p-isothiocyanatophenyl)-propyl]-[N-[2- bis(carboxymethyl)amino]-2-(methyl)-ethyl]glycine) Idarubicin Idamycin (5,12-Naphthacenedione,9-acetyl-7-[(3-amino-2.3,6- trideoxy-(alpha)-L-lyxo-hexopyranosyl)oxy]-7,8,9,10- tetrahydro-6,9,11-trihydroxyhydrochloride,(7S-cis)) Ifosfamide IFEX (3-(2-chloroethyl)-2-[(2-chloroethyl)amino]tetrahydro-2H- 1,3,2-oxazaphosphorine 2-oxide) Imatinib Mesilate Gleevec (4-[(4-Methyl-1-piperazinyl)methyl]-N-[4-methyl-3-[[4-(3- pyridinyl)-2-pyrimidinyl]amino]-phenyl]benzamide methanesulfonate) Interferon alfa-2a Roferon-A (recombinant peptide) Interferon alfa-2b Intron A (recombinant peptide) (Lyophilized Betaseron) Irinotecan HCl Camptosar ((4S)-4,11-diethyl-4-hydroxy-9-[(4-piperi- dinopiperidino)carbonyloxy]-1H-pyrano[3,4: 6,7] indolizino[1.2-b] quinoline-3,14(4H, 12H) dione hydrochloride trihydrate) Letrozole Femara (4,4-(1H-1,2,4-Triazol-1-ylmethylene) dibenzonitrile) Leucovorin Wellcovorin, (L-Glutamic acid, N[4[[(2amino-5-formyl],4,5,6,7,8- Leucovorin hexahydro4oxo6-pteridinyl)methyl]amino]benzoyl], calcium salt (1:1)) Levamisole HCl Ergamisol (()-(S)-2,3,5,6-tetrahydro-6-phenylimidazo [2,1-b] thiazole monohydrochloride C.sub.11H.sub.12N.sub.2SHCl) Lomustine CeeNU (1-(2-chloro-ethyl)-3-cyclohexyl-1-nitrosourea) Meclorethamine, nitrogen mustard Mustargen (2-chloro-N-(2-chloroethyl)-N-methylethanamine hydrochloride) Megestrol acetate Megace 17(acetyloxy)-6-methylpregna-4,6-diene-3,20-dione Melphalan, L-PAM Alkeran (4-[bis(2-chloroethyl) amino]-L-phenylalanine) Mercaptopurine, 6-MP Purinethol (1,7-dihydro-6H-purine-6-thione monohydrate) Mesna Mesnex (sodium 2-mercaptoethane sulfonate) Methotrexate Methotrexate (N-[4-[[(2,4-diamino-6-pteridinyl)methyl]methylamino] benzoyl-L-glutamic acid) Methoxsalen Uvadex (9-methoxy-7H-furo[3,2-g][1]-benzopyran-7-one) Mitomycin C Mutamycin mitomycin C Mitozytrex Mitotane Lysodren (1,1-dichloro-2-(o-chlorophenyl)-2-(p-chlorophenyl) ethane) Mitoxantrone Novantrone (1,4-dihydroxy-5,8-bis[[2-[(2-hydroxyethyl)amino] ethyl]amino]-9,10-anthracenedione dihydrochloride) Nandrolone phenpropionate Durabolin-50 Nofetumomab Verluma Oprelvekin Neumega (IL-11) Oxaliplatin Eloxatin (cis-[(1R,2R)-1,2-cyclohexanediamine-N,N] [oxalato(2-)- O,O] platinum) Paclitaxel TAXOL (5,20-Epoxy-1,2a,4,7,10,13a-hexahydroxytax-11-en- 9-one 4,10-diacetate 2-benzoate 13-ester with (2R, 3 S)-N- benzoyl-3-phenylisoserine) Pamidronate Aredia (phosphonic acid (3-amino-1-hydroxypropylidene) bis-, disodium salt, pentahydrate, (APD)) Pegademase Adagen ((monomethoxypolyethylene glycol succinimidyl) 11-17- (Pegademase adenosine deaminase) Bovine) Pegaspargase (monomethoxypolyethylene Oncaspar glycol succinimidyl L-asparaginase) Pegfilgrastim Neulasta (covalent conjugate of recombinant methionyl human G- CSF (Filgrastim) and monomethoxypolyethylene glycol) Pentostatin Nipent Pipobroman Vercyte Plicamycin, Mithramycin Mithracin (antibiotic produced by Streptomyces plicatus) Porfimer sodium Photofrin Procarbazine Matulane (N-isopropyl--(2-methylhydrazino)-p-toluamide monohydrochloride) Quinacrine Atabrine (6-chloro-9-(1-methyl-4-diethyl-amine) butylamino-2- methoxyacridine) Rasburicase Elitek (recombinant peptide) Rituximab Rituxan (recombinant anti-CD20 antibody) Sargramostim Prokine (recombinant peptide) Streptozocin Zanosar (streptozocin 2-deoxy-2-[[(methylnitrosoamino)carbonyl] amino]-a(and b)-D-glucopyranose and 220 mg citric acid anhydrous) Talc Sclerosol (Mg.sub.3Si.sub.4O.sub.10 (OH).sub.2) Tamoxifen Nolvadex ((Z)2-[4-(1,2-diphenyl-1-butenyl) phenoxyl-N,N- dimethylethanamine 2-hydroxy-1,2,3- propanetricarboxylate (1:1)) Temozolomide Temodar (3,4-dihydro-3-methyl-4-oxoimidazo[5,1-d]-as-tetrazine- 8-carboxamide) teniposide, VM-26 Vumon (4-demethylepipodophyllotoxin 9-[4,6-0-(R)-2- thenylidene-(beta)-D-glucopyranoside]) Testolactone Teslac (13-hydroxy-3-oxo-13,17-secoandrosta-1,4-dien-17-oic acid [dgr]-lactone) Thioguanine, 6-TG Thioguanine (2-amino-1,7-dihydro-6H-purine-6-thione) Thiotepa Thioplex (Aziridine, 1,1,1-phosphinothioylidynetris-, or Tris (1-aziridinyl) phosphine sulfide) Topotecan HCl Hycamtin ((S)-10-[(dimethylamino)methyl]-4-ethyl-4,9-dihydroxy- 1H-pyrano[3,4: 6,7] indolizino [1,2-b] quinoline-3,14- (4H,12H)-dione monohydrochloride) Toremifene Fareston (2-(p-[(Z)-4-chloro-1,2-diphenyl-1-butenyl]-phenoxy)- N,N-dimethylethylamine citrate (1:1)) Tositumomab, I 131 Tositumomab Bexxar (recombinant murine immunotherapeutic monoclonal IgG.sub.2a lambda anti-CD20 antibody (I 131 is a radioimmunotherapeutic antibody)) Trastuzumab Herceptin (recombinant monoclonal IgG.sub.1 kappa anti-HER2 antibody) Tretinoin, ATRA Vesanoid (all-trans retinoic acid) Uracil Mustard Uracil Mustard Capsules Valrubicin, N-trifluoroacetyladriamycin-14-valerate Valstar ((2S-cis)-2-[1,2,3,4,6,11-hexahydro-2,5,12-trihydroxy-7 methoxy-6,11-dioxo-[[4 2,3,6-trideoxy-3-[(trifluoroacetyl)- amino--L-lyxo-hexopyranosyl]oxyl]-2-naphthacenyl]-2- oxoethyl pentanoate) Vinblastine, Leurocristine Velban (C.sub.46H.sub.56N.sub.4O.sub.10H.sub.2SO.sub.4) Vincristine Oncovin (C.sub.46H.sub.56N.sub.4O.sub.10H.sub.2SO.sub.4) Vinorelbine Navelbine (3,4-didehydro-4-deoxy-C-norvincaleukoblastine [R- (R*,R*)-2,3-dihydroxybutanedioate (1:2)(salt)]) Zoledronate, Zoledronic acid Zometa ((1-Hydroxy-2-imidazol-1-yl-phosphonoethyl) phosphonic acid monohydrate)
(105) Anticancer agents further include compounds which have been identified to have anticancer activity. Examples include, but are not limited to, 3-AP, 12-O-tetradecanoylphorbol-13-acetate, 17AAG, 852A, ABI-007, ABR-217620, ABT-751, ADI-PEG 20, AE-941, AG-013736, AGRO100, alanosine, AMG 706, antibody G250, antineoplastons, AP23573, apaziquone, APC8015, atiprimod, ATN-161, atrasenten, azacitidine, BB-10901, BCX-1777, bevacizumab, BG00001, bicalutamide, BMS 247550, bortezomib, bryostatin-1, buserelin, calcitriol, CCI-779, CDB-2914, cefixime, cetuximab, CG0070, cilengitide, clofarabine, combretastatin A4 phosphate, CP-675,206, CP-724,714, CpG 7909, curcumin, decitabine, DENSPM, doxercalciferol, E7070, E7389, ecteinascidin 743, efaproxiral, eflornithine, EKB-569, enzastaurin, erlotinib, exisulind, fenretinide, flavopiridol, fludarabine, flutamide, fotemustine, FR901228, G17DT, galiximab, gefitinib, genistein, glufosfamide, GTI-2040, histrelin, HKI-272, homoharringtonine, HSPPC-96, hul4.18-interleukin-2 fusion protein, HuMax-CD4, iloprost, imiquimod, infliximab, interleukin-12, IPI-504, irofulven, ixabepilone, lapatinib, lenalidomide, lestaurtinib, leuprolide, LMB-9 immunotoxin, lonafarnib, luniliximab, mafosfamide, MB07133, MDX-010, MLN2704, monoclonal antibody 3F8, monoclonal antibody J591, motexafin, MS-275, MVA-MUC 1-IL2, nilutamide, nitrocamptothecin, nolatrexed dihydrochloride, nolvadex, NS-9,06-benzylguanine, oblimersen sodium, ONYX-015, oregovomab, OSI-774, panitumumab, paraplatin, PD-0325901, pemetrexed, PHY906, pioglitazone, pirfenidone, pixantrone, PS-341, PSC 833, PXD101, pyrazoloacridine, R115777, RAD001, ranpirnase, rebeccamycin analogue, rhuAngiostatin protein, rhuMab 2C4, rosiglitazone, rubitecan, S-1, S-8184, satraplatin, SB-, 15992, SGN-0010, SGN-40, sorafenib, SR31747A, ST1571, SU011248, suberoylanilide hydroxamic acid, suramin, talabostat, talampanel, tariquidar, temsirolimus, TGFa-PE38 immunotoxin, thalidomide, thymalfasin, tipifarnib, tirapazamine, TLK286, trabectedin, trimetrexate glucuronate, TroVax, UCN-1, valproic acid, vinflunine, VNP40101M, volociximab, vorinostat, VX-680, ZD1839, ZD6474, zileuton, and zosuquidar trihydrochloride.
(106) For a more detailed description of anticancer agents and other therapeutic agents, those skilled in the art are referred to any number of instructive manuals including, but not limited to, the Physician's Desk Reference and to Goodman and Gilman's Pharmaceutical Basis of Therapeutics tenth edition, Eds. Hardman et al., 2002.
(107) In some embodiments, methods provided herein comprise administering one or more agents provided herein with radiation therapy. The methods provided herein are not limited by the types, amounts, or delivery and administration systems used to deliver therapeutic dose of radiation to an animal. For example, the animal may receive photon radiotherapy, particle beam radiation therapy, other types of radiotherapies, and combinations thereof. In some embodiments, the radiation is delivered to the animal using a linear accelerator. In still other embodiments, the radiation is delivered using a gamma knife.
(108) The source of radiation can be external or internal to the animal. External radiation therapy is most common and involves directing a beam of high-energy radiation to a tumor site through the skin using, for instance, a linear accelerator. While the beam of radiation is localized to the tumor site, it is nearly impossible to avoid exposure of normal, healthy tissue. However, external radiation is usually well tolerated by animals. Internal radiation therapy involves implanting a radiation-emitting source, such as beads, wires, pellets, capsules, particles, and the like, inside the body at or near the tumor site including the use of delivery systems that specifically target cancer cells (e.g., using particles attached to cancer cell binding ligands). Such implants can be removed following treatment, or left in the body inactive. Types of internal radiation therapy include, but are not limited to, brachytherapy, interstitial irradiation, intracavity irradiation, radioimmunotherapy, and the like.
(109) The animal may optionally receive radiosensitizers (e.g., metronidazole, misonidazole, intra-arterial Budr, intravenous iododeoxyuridine (IudR), nitroimidazole, 5-substituted-4-nitroimidazoles, 2H-isoindolediones, [[(2-bromoethyl)-amino]methyl]-nitro-1H-imidazole-1-ethanol, nitroaniline derivatives, DNA-affinic hypoxia selective cytotoxins, halogenated DNA ligand, 1,2,4 benzotriazine oxides, 2-nitroimidazole derivatives, fluorine-containing nitroazole derivatives, benzamide, nicotinamide, acridine-intercalator, 5-thiotretrazole derivative, 3-nitro-1,2,4-triazole, 4,5-dinitroimidazole derivative, hydroxylated texaphrins, cisplatin, mitomycin, tiripazamine, nitrosourea, mercaptopurine, methotrexate, fluorouracil, bleomycin, vincristine, carboplatin, epirubicin, doxorubicin, cyclophosphamide, vindesine, etoposide, paclitaxel, heat (hyperthermia), and the like), radioprotectors (e.g., cysteamine, aminoalkyl dihydrogen phosphorothioates, amifostine (WR 2721), IL-1, IL-6, and the like). Radiosensitizers enhance the killing of tumor cells. Radioprotectors protect healthy tissue from the harmful effects of radiation.
(110) Any type of radiation can be administered to an animal, so long as the dose of radiation is tolerated by the animal without unacceptable negative side-effects. Suitable types of radiotherapy include, for example, ionizing (electromagnetic) radiotherapy (e.g., X-rays or gamma rays) or particle beam radiation therapy (e.g., high linear energy radiation). Ionizing radiation is defined as radiation comprising particles or photons that have sufficient energy to produce ionization, i.e., gain or loss of electrons (as described in, for example, U.S. Pat. No. 5,770,581 incorporated herein by reference in its entirety). The effects of radiation can be at least partially controlled by the clinician. In one embodiment, the dose of radiation is fractionated for maximal target cell exposure and reduced toxicity.
(111) In one embodiment, the total dose of radiation administered to an animal is about 0.01 Gray (Gy) to about 100 Gy. In another embodiment, about 10 Gy to about 65 Gy (e.g., about 15 Gy, 20 Gy, 25 Gy, 30 Gy, 35 Gy, 40 Gy, 45 Gy, 50 Gy, 55 Gy, or 60 Gy) are administered over the course of treatment. While in some embodiments a complete dose of radiation can be administered over the course of one day, the total dose is ideally fractionated and administered over several days. Desirably, radiotherapy is administered over the course of at least about 3 days, e.g., at least 5, 7, 10, 14, 17, 21, 25, 28, 32, 35, 38, 42, 46, 52, or 56 days (about 1-8 weeks). Accordingly, a daily dose of radiation will comprise approximately 1-5 Gy (e.g., about 1 Gy, 1.5 Gy, 1.8 Gy, 2 Gy, 2.5 Gy, 2.8 Gy, 3 Gy, 3.2 Gy, 3.5 Gy, 3.8 Gy, 4 Gy, 4.2 Gy, or 4.5 Gy), or 1-2 Gy (e.g., 1.5-2 Gy). The daily dose of radiation should be sufficient to induce destruction of the targeted cells. If stretched over a period, in one embodiment, radiation is not administered every day, thereby allowing the animal to rest and the effects of therapy to be realized. For example, radiation desirably is administered on 5 consecutive days, and not administered on 2 days, for each week of treatment, thereby allowing 2 days of rest per week. However, radiation can be administered 1 day/week, 2 days/week, 3 days/week, 4 days/week, 5 days/week, 6 days/week, or all 7 days/week, depending on the animal's responsiveness and any potential side effects. Radiation therapy can be initiated at any time in therapeutic period. In one embodiment, radiation is initiated in week 1 or week 2, and is administered for the remaining duration of therapeutic period. For example, radiation is administered in weeks 1-6 or in weeks 2-6 of a therapeutic period comprising 6 weeks for treating, for instance, a solid tumor. Alternatively, radiation is administered in weeks 1-5 or weeks 2-5 of a therapeutic period comprising 5 weeks. These exemplary radiotherapy administration schedules are not intended, however, to limit the methods provided herein.
(112) In some embodiments of the methods provided herein, one or more agents provided herein and one or more therapeutic agents or anticancer agents are administered to an animal under one or more of the following conditions: at different periodicities, at different durations, at different concentrations, by different administration routes, etc. In some embodiments, the agent is administered prior to therapeutic or anticancer agent, e.g., 0.5, 1, 2, 3, 4, 5, 10, 12, or 18 hours, 1, 2, 3, 4, 5, or 6 days, or 1, 2, 3, or 4 weeks prior to the administration of therapeutic or anticancer agent. In some embodiments, the agent is administered after therapeutic or anticancer agent, e.g., 0.5, 1, 2, 3, 4, 5, 10, 12, or 18 hours, 1, 2, 3, 4, 5, or 6 days, or 1, 2, 3, or 4 weeks after the administration of the anticancer agent. In some embodiments, the agent and therapeutic or anticancer agent are administered concurrently but on different schedules, e.g., the agent is administered daily while therapeutic or anticancer agent is administered once a week, once every two weeks, once every three weeks, or once every four weeks. In other embodiments, the agent is administered once a week while therapeutic or anticancer agent is administered daily, once a week, once every two weeks, once every three weeks, or once every four weeks.
(113) IV. Drug Screens
(114) In some embodiments of the present invention, potential agents (e.g., peptides, small molecules, peptidomimetics, and/or cyclic peptides) are screened for their binding affinity to the MLL-fusion protein interaction site for DOT1L (e.g., the AF9/ENL interaction site for DOT1L). In particularly preferred embodiments, agents are selected for use in the methods of the present invention by measuring their biding affinity to the MLL-fusion protein interaction site for DOT1L (e.g., the AF9/ENL interaction site for DOT1L). In some embodiments, binding affinity screens are conducted in in vitro systems. In other embodiments, these screens are conducted in in vivo or ex vivo systems. In some embodiments, an optimized FP-based assay is used to screen agents that target the C-terminal domains of AF9 and ENL and block the DOT1L recruitment (see, e.g., Examples 12, 13, 14 and 15).
(115) In some embodiments, agents of the present invention, and other potentially useful agents, are screened for an ability to displace agents bound to the C terminal domains of AF9/ENL. In some embodiments, agents of the present invention, and other potentially useful agents, are screened for an ability to displace fluorescent labeled DOT1L peptide (e.g., DOT1L 865LPISIPLSTV874(SEQ ID NO:1)) bound to the C terminal domains of AF9/ENL.
(116) In some embodiments, potential agents (e.g., peptides, small molecules, peptidomimetics, and/or cyclic peptides) are screened for an ability to treat disorders associated with DOT1L binding with AF9/ENL (e.g., MLL-fusion protein associated leukemia) through binding the MLL-fusion protein interaction site for DOT1L (e.g., the AF9/ENL interaction site for DOT1L).
(117) In some embodiments, structure-based virtual screening methodologies are contemplated for predicting the binding affinity of potential agents (e.g., peptides, small molecules, peptidomimetics, and/or cyclic peptides) with the MLL-fusion protein interaction site for DOT1L (e.g., the AF9/ENL interaction site for DOT1L). In some embodiments, small molecule structures are predicted from a molecular modeling software (e.g., MacroModel, MOE, Glide, Gold, Autodock, DOCK, Unity, Cerius2, Daylight, PipelinePilot, ChemAxon, Sprout, Hook, MCSS, AMBER, BOSS).
(118) The present invention also provides methods of modifying and derivatizing the agents of the present invention to increase desirable properties (e.g., ability to bind the MLL-fusion protein interaction site for DOT1L (e.g., the AF9/ENL interaction site for DOT1L) or to minimize undesirable properties. The principles of chemical derivatization are well understood. In some embodiments, iterative design and chemical synthesis approaches are used to produce a library of derivatized child compounds from a parent compound.
(119) V. Therapeutic Application
(120) In certain embodiments, the present invention provides methods (e.g., therapeutic applications) for treating and/or preventing disorders related to MLL-fusion protein associated recruitment of DOT1L, and/or MLL-fusion protein associated leukemia. In some embodiments, the methods involve administering one or more agents (see, e.g., Section II- Exemplary Agents) of the present invention to a subject having a disorder related to MLL-fusion protein associated recruitment of DOT1L and/or MLL-fusion protein associated leukemia. In such embodiments, binding of the MLL-fusion protein interaction site for DOT1L (e.g., the AF9/ENL interaction site for DOT1L) (e.g., with an agent having binding properties similar to the region of DOT1L corresponding to DOT1L 865LPISIPLSTV874(SEQ ID NO:1)) modulates (e.g., inhibits) the binding of DOT1L with AF9/ENL, thereby inhibiting, for example, development of an AEP complex (e.g., wherein ENL associates with AF4, AF5q31, P-TEFb, and DOT1L), aberrant H3K79 methylation, and/or MLL-fusion protein associated leukemia. In some embodiments, modulation (e.g., inhibition) of the MLL-fusion protein interaction site for DOT1L (e.g., the AF9/ENL interaction site for DOT1L) is associated with a general reduction of symptoms associated with MLL-fusion protein associated leukemia.
(121) The present invention also includes methods involving co-administration of the agents described herein with one or more additional active agents. Indeed, it is a further aspect of this invention to provide methods for enhancing prior art therapies and/or pharmaceutical compositions by co-administering a agent of this invention. In co-administration procedures, the agents may be administered concurrently or sequentially. In one embodiment, the agents described herein are administered prior to the other active agent(s). The pharmaceutical formulations and modes of administration may be any of those described above. In addition, the two or more co-administered chemical agents, biological agents or radiation may each be administered using different modes or different formulations.
(122) The agent or agents to be co-administered depends on the type of condition being treated. For example, when the condition being treated is associated with MLL-fusion protein associated recruitment of DOT1L, and/or MLL-fusion protein associated leukemia, the agent is known to treat cancer (e.g., leukemia) (e.g., MLL-fusion protein associated leukemia) (e.g., any type of disorder related to MLL-fusion protein associated recruitment of DOT1L) (e.g., any type of cancer related to MLL-fusion protein associated recruitment of DOT1L).
EXPERIMENTAL
Example 1
(123) This example shows that DOT1L binds MLL-fusion proteins, AF9 and ENL, through 10 residues in the C-terminal unstructured region. AF9 and ENL are two of the most common MLL fusion proteins (see, e.g., Daser A, Rabbitts T H (2004) Genes & development 18: 965-974) and belong to the YEATS protein family (see, e.g., Schulze J M, et al., (2009) Biochem Cell Biol 87: 65-75). Both of these two proteins consist of N-terminal YEATS domain and a C-terminal hydrophobic domain (see, e.g., Zhang W, et al., (2007) J Clin Invest 117: 773-783). AF9 and ENL shared high homology in the C-terminal domain and it had been shown that through this domain AF9/ENL are involved in the PPI which is crucial for MLL leukemia transformation (see, e.g., Dobson C L, et al., (1999) Embo J 18: 3564-3574; Mueller D, et al., (2007) Blood 110: 4445-4454; Yokoyama A, et al., (2010) Cancer cell 17: 198-212). The interaction of AF9 or ENL with DOT1L has been reported previously by co-immunoprecipitation and yeast 2-hybrid studies (see, e.g., Biswas D, et al., (2011) PNAS 108: 15751-15756; Yokoyama A, et al., (2010) Cancer cell 17: 198-212; Zhang W, et al., (2006) J Biol Chem 281: 18059-18068; Zhang W, et al., (2007) J Clin Invest 117: 773-783; Mueller D, et al., (2007) Blood 110: 4445-4454). However, there is a lack of detailed biochemical and biophysical characterization of this interaction. To understand the molecular basis of DOT1L interaction with MLL-fusion proteins, these PPIs were analyzed using surface plasma resonance (SPR). An SPR assay was developed to quantify the binding affinity between full length DOT1L protein and MLL-fusion proteins. For that purpose, the flag-tagged full length DOT1L protein was transiently transfected in HEK 293 cells and after 48 hours transfection the flag-tagged DOT1L protein was captured from the HEK 293 whole cell lysate on an anti-flag antibody-coated biosensor chip (
(124) The C-terminal unstructured region of DOT1L has been reported to be involved in the interaction with AF9 and ENL (see, e.g., Mueller D, et al., (2007) Blood 110: 4445-4454; Yokoyama A, et al., (2010) Cancer cell 17: 198-212). Therefore the DOT1L 826-1095 fragment was cloned and expressed, and the interaction of this recombinant protein with AF9/ENL studied. SPR analysis showed that this segment of the DOT1L protein has K.sub.d values of 111 nM and 238 nM to AF9 and ENL protein respectively, which are similar to that of the full length DOT1L (
(125) To further map the minimum region of DOT1L that is involved in the AF9/ENL interaction, a series of truncated constructs of DOT1L (826-1095), devised according to predicted stability, were designed, cloned, expressed and tested for their binding to AF9 and ENL (see, Table 2,
(126) TABLE-US-00002 TABLE 2 Binding affinities of AF9 and ENL proteins to full length DOT1L and different constructs of DOT1L immobilized on a CM5 sensor chip and determined by SPR Recombinant AF9 (497-568) ENL (489-559) Immobilized Proteins K.sub.d SD K.sub.d SD (residues) [nM] [nM] DOT1L (1-1537)* 33 4 206 80 DOT1L (826-1095) 111 10 238 72 DOT1L (826-958) 92 8 122 16 DOT1L (826-937) 78 15 81 6 DOT1L (854-1095) 135 4 148 14 DOT1L (925-1095) 1,825 276 6,220 113 DOT1L (854-925) 42 2 90 12 *This is Flag-tagged full length human DOT1L protein.
Example 2
(127) This example describes identification of a conserved peptide motif in DOT1L essential for binding AF9/ENL. It is known that the C-terminal hydrophobic AF9/ENL domains in MLL-fusions retain the ability to form independently higher order complexes with AF4/p-TEFb and with DOT1L, demonstrating that the associations of AF9/ENL with AF4 and DOT1L are mutually exclusive (see, e.g., Biswas D, et al., (2011) PNAS 108: 15751-15756; Yokoyama A, et al., (2010) Cancer cell 17: 198-212). The AF9-binding domain of AF4 is already mapped and identified interaction domain is conserved among the AF4 homologs (see, e.g., Srinivasan R S, et al., (2004) Leukemia: official journal of the Leukemia Society of America, Leukemia Research Fund, UK 18: 1364-1372). Based on these findings it was predicted that the AF9/ENL interacting site in DOT1L might share certain similarity to AF4 protein. By aligning the minimum amino acid sequence of DOT1L (854-925) involved in AF9/ENL interactions, with the AF9-binding domain of AF4 (761-774), a small 16-residue region in DOT1L (865-880) was identified to share high homology with AF4, consisting of four conserved and four similar residues (
(128) Since the identified DOT1L peptide shows sequence homology with the reported AF4 peptide, and the associations of AF9 and ENL with AF4 and DOT1L through their conserved C-terminal domain reportedly are mutually exclusive (see, e.g., Biswas D, et al., (2011) PNAS 108: 15751-15756; Yokoyama A, et al., (2010) Cancer cell 17: 198-212), competition experiments were carried out between DOT1L and AF4 for binding to MLL-fusion proteins. For this purpose AF4 recombinant protein (749-775 residues) were expressed and purified, and the AF4 14-mer peptide (761-774) synthesized (see, e.g., Srinivasan, R. S., et al., (2004) Leukemia 18, 1364-1372). As was expected, it was found that the recombinant AF4 protein and AF4 14 mer peptide efficiently competed away the binding of DOT1L 10-mer fluorescein-labeled peptide to the C-terminal domain of AF9 protein with similar IC.sub.50 values of 0.56 and 0.28 M (
Example 3
(129) This example describes Alanine-scanning mutagenesis studies of the interaction between DOT1L 10 mer peptide and MLL-fusion proteins. Alanine-scanning mutagenesis can yield important functional insight about PPI for which there is no structural information. Therefore, systematic alanine mutagenesis was performed to identify positions in DOT1L that make essential contacts to MLL-fusion proteins, AF9 and ENL. The DOT1L residues were mutated from Leu865 to Val874 to alanine, thus creating 10 different DOT1L mutants and determined their potency to inhibit the PPI in SPR-based competitive assay. Using wild type DOT1L-10-mer peptide as a standard, the binding affinities of each of these ten alanine mutated DOT1L-based peptides were compared (
(130) TABLE-US-00003 TABLE3 PeptidesequenceandIC.sub.50valuesofwildtypeandalaninemutatedDOT1L peptidesagainstAF9andENLproteinsobtainedbycompetitiveSPR basedassayusingCM5chipwithimmobilizedDOT1Lprotein. IC.sub.50 SD[m] Peptide Sequence AF9 ENL DOT1L Ac-LPISIPLSTV-NH.sub.2(a.a.865-874) 0.49 0.22 1.34 0.34 10mer (SEQIDNO:1) L865A Ac-APISIPLSTV-NH.sub.2(SEQIDNO:2) 98.5 15.1 27.5 6.8 P866A Ac-LAISIPLSTV-NH.sub.2(SEQIDNO:3) 3.3 0.6 6.5 1.2 I867A Ac-LPASIPLSTV-NH.sub.2(SEQIDNO:4) 57.2 17.3 >200 S868A Ac-LPIAIPLSTV-NH.sub.2(SEQIDNO:5) 5.3 1.7 29.1 0.8 I869A Ac-LPISAPLSTV-NH.sub.2(SEQIDNO:6) >200 >200 P870A Ac-LPISIALSTV-NH.sub.2(SEQIDNO:7) 2.8 0.1 11.6 1.7 L871A Ac-LPISIPASTV-NH.sub.2(SEQIDNO:8) 30.7 10.3 146.8 11.5 S872A Ac-LPISIPLATV-NH.sub.2(SEQIDNO:9) 0.55 0.21 2.8 0.6 T873A Ac-LPISIPLSAV-NH.sub.2(SEQIDNO:10) 0.058 0.017 0.36 0.02 V874A Ac-LPISIPLSTA-NH.sub.2(SEQIDNO:11) 0.7 0.02 4.2 0.6 DOT1L Ac-LPISIPL-NH.sub.2(SEQIDNO:12) 3.9 0.1 7.3 0.3 7mer DOT1L Ac-LPISIPLSTVQPNKLP-NH.sub.2 0.32 0.01 1.56 0.09 16mer (a.a.865-880)(SEQIDNO:13) AF4 Ac-LMVKITLDLLSRIP-NH.sub.2 0.20 0.06 0.43 0.15 14mer (a.a.760-773)(SEQIDNO:14)
Example 4
(131) This example shows that the intact homology C-terminal hydrophobic domain of AF9 and ENL is required for the interaction with DOT1L. Secondary structure predictions of the C-terminal hydrophobic domain in AF9 and ENL indicate the presence of two highly conserved helical segments (
(132) To further map and determined the residues in C-terminal domain of ENL that are essential for the interaction with DOT1L (so called hot-spots), an ENL mutant, L550E (
Example 5
(133) This example describes how binding of DOT1L to ENL C-terminus domain induces folding of ENL. To gain more information and understanding of the DOT1L-ENL PPI on the structural level, and to conclusively determine whether DOT1L peptides specifically interact with ENL, NMR spectroscopy was used. High-quality HSQC spectra of .sup.15N-labeled ENL (489-559) protein was obtained. The .sup.1H-.sup.15N HSQC spectra of .sup.15N-labeled ENL (489-559) protein alone showed poor signal dispersion, indicating that the protein, on its own is intrinsically disordered, i.e. unstructured (black spectrum in
Example 6
(134) This example shows that DOT1L 10 mer peptide binds cellular MLL-AF9 fusion protein and disrupts the interaction between full length DOT1L and MLL-AF9 fusion protein. To assess whether DOT1L 10-mer peptide can bind and block the interaction between full length DOT1L and MLL-fusion proteins HEK 293 cells were transiently co-transfected ith Flag-tagged human DOT1L protein and Myc-tagged CxxC-AF9 protein. The whole cell lysate was pre-incubated with different concentrations of DOT1L 10-mer peptide and co-immunoprecipitation (co-IP) experiments were performed. The obtained results demonstrate that the DOT1L 10-mer peptide blocks the interaction of cellular DOT1L with CxxC-AF9 in a dose dependent manner (
Example 7
(135) This example describes that the identified 10 residues are essential for DOT1L recruitment and MLL-AF9 leukemic transformation. To assess further the functional importance of the recruitment of DOT1L by MLL-fusion proteins and determine whether identified 10 residues segment of DOT1L is required for MLL-AF9 transformation, colony forming unit (CFU) assays were performed. In these experiments MSCV-based vectors were used to transduce mouse bone marrow cells with leukemogenic MLL-AF9 fusion protein from floxed Dot1l mice generated as described previously (see, e.g., Jo S Y, et al., (2011) Blood 117: 4759-4768). HA-tagged wild-type mouse DOT1L, methytransferase inactive full-length mDOT1L (RCR) with GSG to RCR mutation in the S-adenosylmethionine binding domain and lack enzymatic activity (see, e.g., Min J, et al., (2003) Cell 112: 711-723; Okada Y, et al., (2005) Cell 121: 167-178), full-length mDOT1L 10aa lacking ten amino acid AF9 interacting residues (863 to 872 which are conserved and correspond to the human DOT1L 865 to 874,
(136) Furthermore, the binding studies clearly demonstrate that DOT1L and AF4 proteins, as well as the DOT1L 10-mer and AF4 14-mer peptide bind to the same C-terminal hydrophobic domain of AF9 and ENL (
Example 8
(137) This example describes the materials and methods for Examples 1-7.
(138) Plasmids and CloningAll different DOT1L plasmids, tested in this study (Table 2), were constructed using full length hDOT1L as a template. The plasmids for AF9, ENL and AF4, were made using MLL-AF9, MLL-ENL and MLL-AF4 fusion proteins as templates. All these constructs for protein expression were cloned by ligation independent cloning (LIC) methods as described before (see, e.g. DelProposto, J., Majmudar, C. Y., Smith, J. L., and Brown, W. C. (2009) Protein Expr Purif 63, 40-49). Different DOT1L constructs (Table 1) and AF4 proteins (749-775) were cloned into pMocr-LIC vector. ENL (489-559) was cloned into pMSCG9-LIC vector and AF9 (497-568) was cloned into pGB 1-LIC vector. MSCV based HA tagged wild type mouse DOT1L, methyltransferase mutant DOT1L (RCR), and neomycin vector constructs are reported before (see, e.g., Jo, S. Y., et al., (2011) Blood 117, 4759-4768). MSCV-HA-mDOT1L 10aa construct where 10 residues identified as AF9/ENL interaction site (863-872 aa) were deleted by using the QuickChange site-directed mutagenesis kit (Agilent Technologies). These residues in mouse are conserved and correspond to the identified human DOT1L interaction site, 865-874 aa (
(139) Protein expression and purificationAll recombinant proteins were expressed in Escherichia coli strain BL21 (DE3) (Invitrogen). The medium for bacterial growth was Luria Broth (for all binding studies) and M9 minimal medium supplemented with .sup.15NH.sub.4Cl (Cambridge Isotope Laboratories) (for HSQC NMR studies). All the proteins were induced with 200 M IPTG at 20 C. except GB1-AF9 (489-497) was induced at 16 C. The cells were harvested after 20 h and resuspended in cold lysis buffer (50 mM Tris HCl, pH 7.5, 150 mM NaCl, 0.01% -mercatoethanol) and purified by affinity chromatography employing Ni-agarose (Qiagen). Mocr-DOT1L and -AF4 proteins were further purified by ion exchange chromatography in 25 mM Tris HCl pH 7.5, with NaCl gradient ranging from 25 mM to 1 M, and 3 mM DTT, while MBP-ENL (489-559), MBP-ENL (489-559) L550E, and GB1-AF9 (497-568) proteins were further purified with size exclusion chromatography in 50 mM Tris HCl, pH 7.5, 150 mM NaCl, 3 mM DTT. The MBP and Mocr-tags from ENL (489-559) and AF9 (497-568), respectively, were removed by proteolysis using tobacco etch virus (TEV) protease, followed by nickel-column and size exclusion chromatography using the same buffer as above to obtain purified cleaved proteins. All purified recombinant proteins were stored at 80 C. for further experiments.
(140) Peptide synthesisPeptides were synthesized using standard F-moc solid phase peptide synthesis techniques on an ABI 433A automated peptide synthesizer. NovaPEG Rink amide resin (EMD) was used to prepare all C-terminal amide-capped peptides. Standard side chain protecting groups were used for all amino acids. All the peptides were acetylated on the N-terminal. Peptides containing an N-terminal biotin group or fluorescein are coupled to lysine and two -alanine residues as a spacer. All crude peptides were purified by semi-preparative reverse-phase high-performance liquid chromatography (RP-HPLC) and their sequence and purity were verified by electrospray ionization mass spectrometry (ESI-MS) and analytical RP-HPLC.
(141) Surface Plasmon Resonance (SPR) binding studiesAll SPR based experiments were performed on a BIAcore 2000 (BIAcore, GE Healthcare) instrument. Different tested DOT1L recombinant proteins were immobilized on a CM5 sensor chip by standard EDC/NHS coupling chemistry followed by ethanolamine deactivation of the surfaces. For immobilization of full length Flag-DOT1L protein, anti-Flag antibody (Sigma, Anti-FLAG M2) was immobilized on CM5 chip by the same amine coupling chemistry. HEK293 whole cells lysate with overexpressed Flag-DOT1L at 2.4 g/l total protein concentration was injected over the Flag antibody surface, followed by injecting of AF9 and ENL in different concentrations. For determination of their binding affinity AF9 and ENL were tested in concentration from 0.01 to 3 M in HBS-P buffer (10 mM HEPES pH 7.4, 150 mM NaCl, 0.005% v/v P20, GE Healthcare). The Fcl surface was used as a control surface and was treated in the same manner as the active surfaces but in the absence of immobilized protein. Binding parameters, k.sub.on, k.sub.off and K.sub.d were calculated by simultaneous non-linear regression using BIAEvaluation software.
(142) Solution competitive SPR based assay was performed to determine the IC.sub.50 values of DOT1L peptides. The tested DOT1L wild type and alanine mutated peptides were pre-incubated with AF9 or ENL proteins (500 nM) for at least 30 minutes and then the reaction mixture was injected over the surface of Mocr-DOT1L (826-1095) immobilized CM5 chip. Response units (RU) were measured at 15 seconds in the dissociation phase and the specific binding was calculated by subtracting the control surface (Fcl) signal from the surfaces with immobilized Mocr-DOT1L. IC.sub.50 values were determined by non-linear least squares analysis using Graph Pad Prism 5.0 software.
(143) Fluorescence polarization (FP) assayFP experiments were performed in 96-well, black, round-bottom plates (Corning) using the plate reader (Biotek H1 hybrid). Fluorescein tagged DOT1L 10 mer peptide (Flu-DOT1L) was used as a fluorescent probe in the FP based binding assays. The K.sub.d values of GB1-AF9, MBP-ENL wild type and L550E mutated proteins, were determined using a fixed concentration of the tracer (10 nM Flu-DOT1L) and different concentrations of the tested proteins, in a final volume of 125 l and assay buffer (100 mM Na.sub.2HPO.sub.4, pH 7.4, 150 mM NaCl, 0.01% Triton X-100 and 4% DMSO). The plate was mixed on a shaker and incubated at room temperature to reach equilibrium. The polarization values in milli-polarization units (mP) were measured at an excitation wavelength at 485 nm and an emission wavelength at 530 nm. Polarization data were analyzed using GraphPad Prism 5.0 by non-linear fitting with a one-site binding model.
(144) AF4 (749-775) protein and several peptides (AF4 14 mer, un-labeled and biotin-labeled DOT1L 10 mer peptide) were tested for their ability to displace the Flu-DOT1L from GB1-AF9 protein. The dose-dependent binding experiments were carried out in 96-well plates with serial dilutions of tested protein or peptides, GB1-AF9 protein (500 nM) and Flu-DOT1L (10 nM) in the same assay buffer and final volume of 125 L. The polarization values were measured after 3 h incubation. Negative controls containing GB1-AF9 protein and probe (equivalent to 0% inhibition), and positive controls containing only free Flu-DOT1L probe (equivalent to 100% inhibition), were included on each assay plate. IC.sub.50 values were determined by nonlinear regression fitting of the competition curves (GraphPad Prism 5.0).
(145) Isothermal titration calorimetryITC was carried out using a Nano-ITC Micro Calorimeter (TA Instruments) at 20 C. MBP-ENL (489-559) was dialysed extensively against 50 mM Na.sub.2HPO.sub.4, (pH 7.5) and 100 mM NaCl, and 80 M was used for titration studies of DOT1L 16-mer and 10-mer peptides, and 110 M for DOT1L 7-mer titration. Tested peptides dissolved in the same buffer at 400 M (DOT1L 16-mer and 10-mer) or 500 M (DOT1L 7-mer) were tested by injecting 2 l aliquots into the protein sample, at time intervals of 30 seconds, to ensure that the titration peak returned to the baseline. The ITC data were analyzed by NanoAnalyze software package using a one site-binding model.
(146) NMR spectroscopy.sup.15N-labeled ENL protein sample was prepared in a 50 mM Na.sub.2HPO.sub.4, pH 7.5, 50 mM NaCl in 7% D.sub.2O. The binding of DOT1L protein and peptides has been characterized by recording .sup.1H,.sup.15N-HSQC spectra of uniformly .sup.15N-labeled ENL in the absence and presence of tested protein and peptides in 1:1 molar ratio. The presence of tested peptides in solution was confirmed by .sup.1H-1D NMR. All spectra were acquired at 30 C. on a Bruker 600 MHz NMR spectrometer equipped with a cryogenic probe, processed using Bruker TopSpin and rNMR (see, e.g., Lewis, I. A., Schommer, S. C., and Markley, J. L. (2009) Magn Reson Chem 47 Suppl 1, S123-126), and were analyzed with Sparky (see, e.g., Goddard, T. D., and Kneller, D. G. SPARKY 3. in University of California, San Francisco).
(147) Circular dichroismDOT1L peptides were dissolved in phosphate buffer (50 mM Na.sub.2HPO.sub.4, pH 7.4, 100 mM NaCl). ENL and AF9 protein were dialyzed against the above phosphate buffer overnight. CD measurements were performed at room temperature using a Jasco J-715 and a quartz flow cell with a 1 mm path length. The spectra were averaged over 10 scans and the baseline (buffer scan) was subtracted from each spectrum. The percentage of a helicity was calculated by K2D2 online tool.
(148) Cell Culture, Transfections, and ImmunoprecipitationHEK293 cells were plated in 100 mm culture dishes and cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% FBS and antibiotics. Co-transfection with FLAG-DOTL and Myc-CxxC-AF9 was performed using Lipofectamine 2000 (Invitrogen). Forty eight hours post-transfection, cells were collected and lysed using BC-300 lysis buffer: 20 mM Tris-HCl pH 8.0, 300 mM KCl, 1 mM EDTA, 10% glycerol, 0.1% NP-40 and protease inhibitor cocktail (Roche). The lysates was pre-cleared for 2 h in Mouse IgG Agarose (Sigma-Aldrich). The pre-cleared lysates were incubated with different concentrations of DOT1L 10 mer peptide at 4 C. overnight. The next day, the cell lysates were immunoprecipitated with Anti-FLAG M2 magnetic beads (Sigma-Aldrich) at 4 C. for 2 h. After incubation, the beads were washed extensively, boiled in SDS loading buffer and analyzed by western blotting using mouse monoclonal anti-FLAG M2 (Sigma-Aldrich) and goat monoclonal anti-Myc tag (Abcam) antibody.
(149) Pull-down assayHEK293 cells transfected with Myc-CxxC-AF9 were lysed in BC-300 lysis buffer in a same way as the immunoprecipitation experiment. The supernatant was pre-cleared for 2 h in streptavidin agarose beads (Thermal Scientific). The pre-cleared lysates were incubated with different concentrations of biotin-labeled DOT1L 10 mer peptide at 4 C. overnight. The next day, the cell lysate were incubated with streptavidin agarose at 4 C. for 2 h. After extensive washing the beads with the BC-300 lysis buffer without NP-40, the pull down samples were applied to SDS-PAGE electrophoresis and pull-down Myc-CxxC-AF9 protein was probed with goat monoclonal anti-Myc tag antibody (Abcam).
(150) Retroviral Transductions and CFUAssayRetroviral production and transduction of bone marrow progenitor cells were carried out as described (see, e.g., Jo, S. Y., et al., (2011) Blood 117, 4759-4768). Briefly, retroviruses were generated by transfecting MSCV-HA wild type mouse DOT1L, methyltransferase mutant mDOT1L (RCR), mDOT1L deletion (10aa; deletion of the residues 863-872 aa) constructs, and neomycin vector control into Plat-E cell line with Fugene 6 (Roche). Fresh viral supernatants were used for transducing MLL-AF9 transformed cells described (see, e.g., Jo, S. Y., et al., (2011) Blood 117, 4759-4768). 150,000 cells were used for transduction per viral supernatant from 10 cm dish. Cells were then plated on Methocult media (Stem Cell Technologies, M3234) with 1% penicillin/streptomycin (Invitrogen), 10 ng/ml IL3 (R & D Systems), 5 nM 4-OHT (Sigma) or 100% ethanol, and 1 mg/ml G418 (Invitrogen). Colonies were scored 5-7 days after plating for two rounds. In the final round, colonies were stained with 0.1% p-iodonitrotetrazolium violet (Sigma) for visualization.
(151) RNA extraction, cDNA generation, and Protein extractionRNA was extracted from cells using TRIzol Reagent (Invitrogen) and converted to cDNA using SuperScript II (Invitrogen) according to manufacturer's instructions. Whole cell lysate samples were prepared by directly resuspending cells in Tris-Glycine SDS sample buffer (Novex) and sonicating for 15 minutes (Bioruptor, Diagenode). Primers for quantitative PCR (qPCR) are provided:
(152) TABLE-US-00004 PrimersforandQuantitativePCR(qPCR): 5SrRNA: (SEQIDNO:23) TCTACGGCCATACCACCCTGA and (SEQIDNO:24) GCCTACAGCACCCGGTATTCC; HA-Dot1l: (SEQIDNO:25) GCCACCATGTACCCCTACGACGTG and (SEQIDNO:26) GATTTCCTCGCAGACCCACCGGAT
Example 9
(153) This example describes the development and optimization of a quantitative fluorescence polarization (FP)-based binding assay for screening compounds targeting the PPI between DOT1L and AF9 fusion protein. Based on the detailed biochemical characterization of the DOT1L/AF9 interactions (see, e.g., Shen C, Jo S Y, Liao C, Hess J L, Nikolovska-Coleska Z. (2013) J Biol Chem. 288 (42): 30585-96), an FP-based binding assay was established and optimized. For the development of this assay, the recombinant GB1-AF9 protein (residues 497-568), a minimal AF9 fragment necessary for the transformation ability of MLL-fusion protein, was expressed and purified.
(154) The binding studies with synthetic DOT1L peptides demonstrate that the DOT1L-10 mer peptide is sufficient to disrupt the PPI between DOT1L and AF9. Design and synthesis of two fluorescently labeled DOT1L-10 mer peptides, labeled either on the N-terminal (N-Flu-DOT 1L) or C-terminal (C-Flu-DOT1L) enabled selection of the tracer that will give us the best dynamic range and signal-to-noise ratio in the assay. Using the FP based method, the dissociation constant (K.sub.d) of recombinant GB1-AF9 protein and the fluorescently-labeled DOT1L peptides was determined. Saturation experiments showed that N-Flu-DOT1L and C-Flu-DOT1L bind to AF9 with similar K.sub.d values, 0.0950.002 M and 0.1270.009 M, respectively (
Example 10
(155) This example shows miniaturization of FP based assays to 1536-well format for HTS. The FP based assay was optimized in 384-well format, which has a Z factor of 0.77 and remained >0.7 after overnight incubation. In order for the screen to be more cost effective, the FP assay was successfully miniaturized to 1536-well format using 4 l total volume, significantly reducing reagent consumption, without compromising assay reliability. Z factor value determined for the FP assay in 1536-well format was found to be 0.65 (
Example 11
(156) The example describes the screening library of compounds. Screening efforts were continued in order to identify and validate good lead compounds targeting PPI between DOT1L and MLL-AF9 by employing the optimized FP-based assay. This screen was performed at the Center for Chemical Genomics at the University of Michigan using following libraries: BioFocus NCC (NIH clinical collection), focused collection (Autophagy, Wnt Pathway, Epigenetics, Protein Kinase, Protease, REDOX, Cannabinoid, Natural Products) and MS Spectrum 2000 (MicroSource bioactive compounds), in total 3,500 structurally diverse, small molecules. Initial screening of these compounds at a single concentration of 20 M identified 24 of them as achieving 50% or greater inhibition of the binding of the N-Flu-DOT1L to AF9. The secondary, dose-response experiments confirmed 13 compounds. Based on their chemical structures and commercial availability 6 compounds were ordered and confirmed 3 compounds using new fresh stock solutions (
(157) Several secondary assays have already been developed to support hit confirmation and the hit-to-probe optimization process. The established and optimized SPR-based competitive assay utilizing DOT1L protein (826-1095) immobilized on the CM5 sensor chip was used as a secondary counter screen assay to validate binding of compounds to AF9. CCG-38505 and CCG-208095 bind to AF9 and inhibit the AF9-DOT1L interaction with IC.sub.50 values of 5.72 M and 6.27 M, respectively (
Example 12
(158) The example describes the screening library of compounds.
(159) Using the optimized competitive FP binding assay, a library of 101,000 structurally diverse small molecules was screened at the Center for Chemical Genomics, University of Michigan. Primary screening of these compounds at a single concentration of 20 M identified 1,191 potential active compounds (1.2% hit rate) defined by >30% displacement of Flu-DOT1L/AF9 interaction (>3 standard deviations). The compounds identified in this way were advanced to increasingly stringent confirmatory in vitro binding assays, including: 1) repeat single-dose testing of 1,191 compounds in triplicates; 2) identify and filter compounds with auto fluorescence, quenchers and compounds with reactive functional groups; and then 3) dose-response competitive binding of the 164 confirmed compounds. 39 compounds competed with Flu-DOT1L 10 mer peptide for AF9 binding and demonstrated dose-dependent inhibition, giving a 0.04% overall hit rate. The analysis of their chemical structures using Tripos BenchWare DataMiner, showed that the majority of hits fell into the following five structural classes:
(160) ##STR00033##
(161) An important step after performing HTS to identify small-molecule modulator of protein function is the follow-up of the hits and their characterization and validation into high-content lead series. Based on the potency, chemical structure and availability of these 39 compounds, the following 8 compounds were purchased and new stock solutions were prepared:
(162) ##STR00034## ##STR00035##
(163) Their chemical structures were confirmed by NMR or LC-MS and re-tested using the FP-based binding assay. Three of these compounds, belonging to the chemical clusters I, IV and V, demonstrated reproducible dose-dependent inhibition of the AF9-DOT1L interaction with IC.sub.50 in the 30-50 M range (
(164) ##STR00036##
confirming the results obtained in HTS. Compound 38 has one chiral center and can be found in two distinct stereogenic configurations, R and S. Racemic mixture of both isomers was used in the inhibition assays.
(165) To further validate the binding of the confirmed compounds and identify potential promiscuous inhibitors, several secondary assays have been developed to support hit confirmation and the hit-to-probe optimization process. In order to determine that the compounds bind effectively to the target and disrupt protein-protein interaction, a SPR competitive binding assay was used. This assay uses a platform that differs from the FP-based assay where DOT1L recombinant protein (residues 865-1085) is immobilized on a CM5 chip, allowing for testing of the inhibitors for their ability to disrupt AF9-DOT1L protein-protein interactions. Compounds confirmed in FP showed similar potency in disrupting the PPI with IC.sub.50 from 40 to 72 M (
(166) To provide further validation of the hit selection in addition to the biochemical assays Saturation Transfer Difference (STD), NMR spectroscopy was used. NMR spectroscopy has been successfully utilized to detect and characterize the direct binding of small-molecule compounds to large biomolecules. This technique is also allowing characterization of the binding interactions and maps the ligand-protein contacts in the bound state, delineating which chemical moieties of the ligand molecule are key for molecular recognition by the protein (group epitope mapping,
(167) Finally, an orthogonal measure of the disruption of the DOT1L/AF9 protein interaction was obtained using OctetRed system with Bio-Layer Interferometry (BLI) technology. This technology is allowing label-free, real-time biomolecular analysis and determination of binding kinetics and affinity. Using this technology, the binding affinity (K.sub.D) of compound 38 calculated with steady state analysis was determined to be 35 M (
Example 13
(168) This example describes the initial structure activity relationship (SAR) of the benzodiazepinone series of compounds.
(169) Recently, the NMR structure of the fusion AF9-AF4 protein was reported (see, e.g., Leach, et al., Structure 21, 176-183 (2013)). Using this structure and applying GOLD molecular docking, the predicted binding model of lead compound 38 was obtained (
(170) After confirmation of the initial binding results and after obtaining a predicted binding model, the hit-to-probe process was initiated by an analog-by-catalog approach. A limited number of available analogs were identified and purchased to obtain initial SAR around the benzodiazepinone series (Table 4). Replacement of the R.sub.1 substituent, ethyl phenyl, with propyl phenyl or methyl phenyl in 42 and 41 respectively, showed that they had a similar favorable interaction with AF9 and did not affect binding. Similar to R.sub.1, replacement of the R.sub.2 substituent furan group with thiophen was well tolerated and the corresponding compound 48 showed similar IC.sub.50 value in disrupting DOT1L-AF9 PPI as lead compound 38. However, deletion of the bulky substituted phenyl hydrophobic group in R.sub.1 position is detrimental for binding to AF9, thus compound 51 did not show binding up to 200 M, consistent with the STD NMR results and predicted binding model of 38 in complex with AF9 showing that this substituent is involved in hydrophobic interactions. Docking studies of these analogs showed that the same structural characteristics of molecular recognition were observed throughout the compound class.
(171) TABLE-US-00005 TABLE 4 IC.sub.50 values of several commercially available analogs obtained in SPR competitive based assay.
(172) ##STR00049##
(173) This class of compounds was also tested for their binding against ENL protein, which is highly homologous with AF9. As expected based on previous studies with DOT1L 10 mer peptide (see, e.g., Shen, et al., J Biol Chem. 2013, 288 (42), 30585-96)), the compounds showed a similar pattern in their binding affinities to ENL and to AF9 (Table 4).
(174) For optimization of this class of inhibitors besides testing their binding affinity, the physico-chemical properties and microsomal stability will be tested in order to obtain improvement at multiple levels, as necessary for fully optimized compounds. To obtain initial information about the stability of this chemical class of compounds, compounds 42 and 48 have been tested in microsomal stability using mouse liver microsome. Interestingly the half time for these two compounds differs significantly: 2 min and >60 min respectively (
Example 14
(175) This example involves the assessment of cellular effects of compound 38. To start investigating the specificity and selectivity of compound 38, MLL-AF9 (highly dependent on DOT1L) transformed mouse cell lines were used (see, e.g., Jo, et al., Blood 117, 4759-4768 (2011)) and HM2 cells stably expressing Hoxa9 and Meis 1, which do not depend on DOT1L. Compound 38 inhibited growth of MLL-AF9 cells in a dose-dependent manner (
INCORPORATION BY REFERENCE
(176) The entire disclosure of each of the patent documents and scientific articles referred to herein is incorporated by reference for all purposes.
EQUIVALENTS
(177) The invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. The foregoing embodiments are therefore to be considered in all respects illustrative rather than limiting the invention described herein. Scope of the invention is thus indicated by the appended claims rather than by the foregoing description, and all changes that come within the meaning and range of equivalency of the claims are intended to be embraced therein.