Recombinant adeno-associated virus delivery of exon 2-targeted U7SNRNA polynucleotide constructs

Abstract

The present invention relates to recombinant adeno-associated virus (rAAV) delivery of polynucleotides for treating Duchenne Muscular Dystrophy resulting from the duplication of DMD exon 2. The invention provides rAAV products and methods of using the rAAV in the treatment of Duchenne Muscular Dystrophy.

Claims

1. A method of ameliorating Duchenne Muscular Dystrophy in a patient with DMD exon 2 duplications in need thereof comprising the step of administering a recombinant adeno-associated virus (rAAV) to the patient, wherein the recombinant AAV comprises the genome insert set out in SEQ ID NO: 2.

2. A method of inhibiting the progression of dystrophic pathology associated with Duchenne Muscular Dystrophy in a patient with DMD exon 2 duplications in need thereof comprising the step of administering a rAAV to the patient, wherein the recombinant AAV comprises the genome insert set out in SEQ ID NO: 2.

3. A method of improving muscle function in a patient afflicted with Duchenne Muscular Dystrophy associated with DMD exon 2 duplications comprising the step of administering a rAAV to the patient, wherein the recombinant AAV comprises the genome insert set out in SEQ ID NO: 2.

4. The method of claim 3 wherein the improvement in muscle function is an improvement in muscle strength.

5. The method of claim 3 wherein the improvement in muscle function is an improvement in stability in standing and walking.

6. The method of any of claims 1-5 wherein the virus genome is a self-complementary genome.

7. A method of delivering an exon 2-targeted U7snRNA polynucleotide construct to an patient with DMD exon 2 duplications, comprising the step of administering a rAAV to the patient, wherein the recombinant AAV comprises the genome insert set out in SEQ ID NO: 2.

8. The method of claim 1, 2, 3, 4, 5 or 7 wherein genome of the rAAV lacks AAV rep and cap DNA.

9. The method of claim 7 wherein the virus genome is a self-complementary genome.

10. The method of claim 1, 2, 3, 4, 5 or 7 wherein the recombinant adeno-associated virus is a recombinant AAV rh74 virus, a recombinant AAV6 virus or a recombinant AAV9 virus.

11. A recombinant adeno-associated virus (AAV), wherein the recombinant AAV comprises the genome insert set out in SEQ ID NO: 2.

12. A recombinant adeno-associated virus (AAV) comprising an AAV rh.74 capsid, an AAV6 capsid or an AAV9 capsid; and the genome insert set out in SEQ ID NO: 2.

13. The rAAV of claim 11 or 12 wherein genome of the rAAV lacks AAV rep and cap DNA.

14. The rAAV of claim 11 or 12 wherein the genome is a self-complementary genome.

Description

BRIEF DESCRIPTION OF THE DRAWING

(1) FIG. 1 shows histology and immunofluorescence analysis of muscles in the Dup2 mouse.

(2) FIG. 2 shows immunoblots from Western blot analysis of muscles in the Dup 2 mouse.

(3) FIG. 3 shows that skipping of a duplicated exon 2 in a MyoD-transdifferentiated myoblast induced by an AON directed at an exon splice enhancer results in 39% wild type transcript. Dosage per lane shown in nMoles (25, 50, 100, 200, 300, 400, 500). The amount of the varying transcripts are shown under each lane, with the maximum shaded. TB=transfection buffer. NSM=normal skeletal muscle. The percentage of exon 2 duplication, wt, and exon 2 deletion is listed below each lane.

(4) FIG. 4 illustrates the U7snRNA vector approach to exon skipping. U7snRNA is used as a carrier to target the pre-messenger RNA. It is composed of a loop used for the nucleocytoplasmic export, a recognition sequence to bind the Sm proteins used for an efficient assembly between the U7snRNA and the target pre-mRNA and an antisense sequence to target the pre-mRNA. It has its own promoter and 3 downstream sequences. The U7 cassette is then cloned in an AAV plasmid, to produce the vector.

(5) FIG. 5 shows RT-PCR results for exon-skipping experiments using SC rAAV vectors to transduce Dup2 immortalized human fibromyoblasts with exemplary exon 2-targeted U7snRNA constructs.

(6) FIG. 6 (A-D) presents results for exon-skipping experiments in vivo in which U7_ACCA SC rAAV was delivered by intramuscular injection in Dup2 mice.

(7) FIG. 7 is the rh74 genome sequence (SEQ ID NO: 1) wherein nucleotides 210-2147 are the Rep 78 gene open reading frame, 882-208 are the Rep52 open reading frame, 2079-2081 are the Rep78 stop, 2145-2147 are the Rep78 stop, 1797-1800 are a splice donor site, 2094-2097 are a splice acceptor site, 2121-2124 are a splice acceptor site, 174-181 are the p5 promoter +1 predicted, 145-151 are the p5 TATA box, 758-761 are the p19 promoter +1 predicted, 732-738 are the p19 TATA box, 1711-1716 are the p40 TATA box, 2098-4314 are the VP1 Cap gene open reading frame, 2509-2511 are the VP2 start, 2707-2709 are the VP3 start and 4328-4333 are a polyA signal.

(8) FIG. 8 shows a map of a plasmid with an AAV genome insert of an exemplary exon 2-targeted U7snRNA.

(9) FIG. 9 shows the DNA sequence of the AAV genome insert (SEQ ID NO: 2) of the plasmid of FIG. 8.

(10) FIG. 10 shows vertical bars indicating the approximate position of an MLPA probe.

(11) FIG. 11 shows a schematic of a vector used in creation of a mdx.sup.dup2 (Dup2) mouse.

(12) FIG. 12(a-e) shows the results of intramuscular delivery to Dup2 mice of AAV1 U7-ACCA.

(13) FIG. 13(a-f) shows the results of intravenous injection of AAV9 U7_ACCA in the Dup2 mouse model.

EXAMPLES

(14) Aspects and embodiments of the invention are illustrated by the following examples.

Example 1

Isolation of AAV rh.74

(15) A unique AAV serotype was isolated from a rhesus macaque lymph node using a novel technique termed Linear Rolling Circle Amplification. Using the LRCA process, double-stranded circular AAV genomes were amplified from several rhesus macaques. The method is predicated on the ability to amplify circular AAV genomes by isothermic rolling circle amplification using phi29 phage DNA polymerase and AAV specific primers. LRCA products are contiguous head-to-tail arrays of the circular AAV genomes from which full-length AAV Rep-Cap molecular clones were isolated. Four isolates were sequenced and the predicted amino acid sequences for Rep and Cap ORFs were aligned and compared to previously published serotypes (Table). VP1 protein sequences were analyzed and revealed homology to the NHP AAV clades D, E, and AAV 4-like virus isolates. Analysis of the Rep78 (top portion of Table) ORF revealed strong homology to AAV 1 (98-99%).

(16) TABLE-US-00002 TABLE 1 AAV 1 AAV 4 AAV 7 AAV 8 rh.73 rh.74 rh.75 rh.76 AAV 1 90 98 95 98 98 99 AAV 4 63 90 87 90 90 90 AAV 7 85 63 96 97 98 98 AAV 8 84 63 88 97 97 95 rh.73 79 61 83 80 99 99 rh.74 84 63 88 93 80 99 rh.75 65 82 82 64 62 64 rh.76 85 63 91 86 84 86 84 Similarity of published AAV sequences and the new AAV sequences determined using one-pair alignment according to the Lipman-Pearson method implemented in the MegAlgn software in DNASTAR (DNASTAR Inc.) Light faced numbers (top, right) represent similarity in Rep78 sequences, whereas bold-faced numbers (lower, left) represent similarity in VP1 capsid sequences.

(17) One macaque tissue sample (rh426-M) yielded a divergent AAV8-like isolate termed rh.74 that shares 93% sequence identity with AAV8. The nucleotide sequence of the rh.74 genome is set out in FIG. 7 and in SEQ ID NO: 1.

(18) The rh.74 capsid gene sequence was cloned into an AAV helper plasmid containing the Rep gene from AAV2 to provide vector replication functions for recombinant AAV vector production.

Example 2

DMD Models

(19) Examples of models of the DMD exon 2 duplication include in vivo and in vitro models as follows.

(20) mdx.sup.dup2 Mouse Model

(21) Mice carrying a duplication of exon 2 within the Dmd locus were developed. The exon 2 duplication mutation is the most common human duplication mutation and results in relatively severe DMD.

(22) First, from White et al., Hum. Mutat., 27(9): 938-945 (2006), the maximum extent of the 11 different human exon 2 duplications was examined by MLPA and long-range PCR. Results are shown in FIG. 10. In FIG. 10, each vertical bar indicates the approximate position of an MLPA probe. The shaded columns indicate the two hotspot regions identified; they were used to determine the location of the insertion by homology of an exon 2 cassette in mouse.

(23) A map of the insertion vector is shown in FIG. 11. In the map, the numbers indicate the relative positions of cloning sites and exons and restriction sites. The neo cassette is in the same direction of the gene and the insertion point is precisely at 32207/32208 bp in the intron2. At least 150 bp extra intronic sequences are kept on each side of inserted exon 2, E2 region is 1775-2195 bp. Sizes of exon 2 and intron 2 are 62 bp and 209572 bp respectively.

(24) Male C57BL/6 ES cells were transfected with the vector carrying the exon2 construct and then insertion was checked by PCR. One good clone was found, amplified and injected in dozens of albino BL/6 blastocysts. Injected blastocysts were implanted into recipient mice. The dystrophin gene from chimeric males was checked by PCR and then by RT-PCR. The colony was expanded and includes some female mice bred to homozygosity.

(25) FIG. 1 and FIG. 2 demonstrate the dystrophin expression in muscles from a 4 week old hemizygous mdxdup2 mouse is essentially absent. (As seen in FIG. 2, traces of expression can be detected using an C-terminal antibody but not the exon 1-specific Manex1A antibody, consistent with a very small amount of translation from the exon 6 alternate translational initiation site we previously described)

(26) Immortalized and Conditionally Inducible fibroMyoD Cell Lines

(27) Expression of the MyoD gene in mammalian fibroblasts results in transdifferentiation of cells into the myogenic lineage. Such cells can be further differentiated into myotubes, and they express muscle genes, including the DMD gene.

(28) Immortalized cell lines that conditionally express MyoD under the control of a tetracycline-inducible promoter were generated. This is achieved by stable transfection of the primary fibroblast lines of a lentivirus the tet-inducible MyoD and containing the human telomerase gene (TER). The resultant stable line allows MyoD expression to be initiated by treatment with doxycycline. Such cell lines were generated from patients with DMD who carry a duplication of exon 2.

(29) Using the line, duplication skipping using 2-O-methyl antisense oligomers (AONs) provided by Dr. Steve Wilton (Perth, Australia) was demonstrated. Multiple cell lines were tested. Results from exemplary cells lines are shown in FIG. 3.

(30) Transiently MyoD-Transfected Primary Cell Lines

(31) Proof-of-principle experiments using primary fibroblast lines transiently transfected with adenovirus-MyoD were conducted. The adenovirus constructs were not integrated in the cell genomes, yet MyoD was transiently expressed. The resulting DMD expression was sufficient to perform exon skipping experiments (although reproducibility favors the stably transfected lines.)

Example 3

Effectiveness of U7 snRNA-Mediated Skipping on Exon 2 Duplication Mutations

(32) Products and methods for virally-mediated exon skipping of duplicated exons were developed. The products and methods were modified compared to the U7snRNA systems described in Goyenvalle et al., Science, 306(5702): 1796-1799 (2004) or Goyenvalle et al., Mol. Ther., 20(6): 179601799 (2004).

(33) U7snRNA was modified to include a target antisense sequence to interfere with splicing at a given target exon (FIG. 4). Specifically, four new exon 2 targeting sequences were designed based upon the results of the AON studies described in Example 2.

(34) TABLE-US-00003 U7B (SEQIDNO:3) TCAAAAGAAAACATTCACAAAATGGGTA U7Along (SEQIDNO:4) GTTTTCTTTTGAAGATCTTCTCTTTCATcta U7Ashort (SEQIDNO:5) AGATCTTCTCTTTCATcta U7C (SEQIDNO:6) GCACAATTTTCTAAGGTAAGAAT
U7 snRNA constructs including the exon 2 target sequences were generated. Each U7 snRNA construct included one of the target sequences. U7 snRNA constructs targeted to selected other exons were also generated (based upon MyoD-transdifferentiated cell line studies, above). Self complementary (SC) AAV vectors with genomes including one or more of the U7 snRNA constructs were then produced.

(35) For experiments in cell culture and for intramuscular injection in Dup2 mice, rAAV1 vectors were utilized. Recombinant SC AAV vectors of a desired AAV serotype were produced by a modified cross-packaging approach using a plasmid comprising a desired vector genome by an adenovirus-free, triple plasmid DNA transfection (CaPO.sub.4 precipitation) method in HEK293 cells [Rabinowitz et al., J. Virol., 76:791-801 (2002)]. Vector was produced by co-transfecting with an AAV helper plasmid and an adenovirus helper plasmid in similar fashion as that previously described [Wang et al., Gene. Ther., 10:1528-1534 (2003)]. The adenovirus helper plasmid (pAdhelper) expresses the adenovirus type 5 E2A, E4ORF6, and VA I/II RNA genes which are required for high-titer rAAV production.

(36) Vectors were purified from clarified 293 cell lysates by sequential iodixanol gradient purification and anion-exchange column chromatography using a linear NaCl salt gradient as previously described [Clark et al., Hum. Gene Ther, 10:1031-1039 (1999)]. Vector genome (vg) titers were measured using QPCR based detection with a specific primer/probe set utilizing the Prism 7500 Taqman detector system (PE Applied Biosystems) as previously described (Clark et al., supra). Vector stock titers ranged between 1-1010.sup.12 vg/mL.

(37) Initial exon-skipping analysis was by RT-PCR using the SC rAAV vectors to transduce Dup2 immortalized human fibromyoblasts. Dup 2 immortalized human fibroblasts that were able to transdifferentiate into muscle lineage cells under the control of doxycycline were produced by transduction with both telomerase-expressing and tet-inducible-MyoD expressing vectors. The converted human fibromyoblasts (FM) were then transduced with the SC rAAV carrying different U7 constructs incorporating exon 2 antisense sequences.

(38) RT-PCR results are shown in FIG. 5 for SC rAAV.1-U7 constructs with three different antisense sequences. In FIG. 5, (4C) indicates four copies of the U7 construct were included in a vector genome, + indicates a higher dose and U7_ACCA A=Along indicates a vector genome (shown in a plasmid map in FIG. 8 and the sequence of which, SEQ ID NO: 2, is set out in FIG. 9) comprising in sequence four exon 2-targeted U7 snRNA polynucleotide constructs: a first U7Along construct, a first U7C construct, a second U7C construct and a second U7Along construct. As shown, the U7_ACCA A-Along SC rAAV (abbreviated U7_ACCA SC rAAV1 elsewhere herein) achieved a higher percentage of exon 2 skipping in comparison to any other vector construct.

(39) In subsequent experiments, exon-skipping efficiency was analyzed in vivo. The most efficient AAV-U7 vector, U7_ACCA SC rAAV1, was chosen for intramuscular injection in Dup2 mice. Results are shown below in FIG. 6 (A-D) wherein (A) shows dystrophin staining where the protein expression is restored, and is properly localized at the membrane in many muscle fibers; (B) protein restoration was confirmed by western blot. RT-PCR shows (C) dose-dependent single or double skipping in Dup2 mice, as well as (D) efficient skipping in the wild-type mouse.

(40) Thus, a highly efficient AAV-mediated U7snRNA was designed to skip exon 2 allowing subsarcolemmal dystrophin restoration. Cardiac function; EDL and diaphragm force assessments; and treadmill and grip tests will be compared between untreated and treated mice.

(41) Based upon the degree of dystrophin expression detectable within the injected muscle, U7_ACCA SC rAAV was chosen for further experiments to be delivered intraveneously to a first cohort at 1E11 vg/kg, followed by dosing one log higher in a second cohort. Injection will be performed at four weeks, and animals evaluated by physiologic assessment and histopathology at 10 and 24 weeks (n=8 animals per cohort) as described above.

Example 4

Intramuscular Delivery of U7-ACCA by AAV1 Results in Significant N-Truncated Dystrophin Expression in Dup2 Mice

(42) A rAAV1 comprising the genome insert of FIG. 9 was produced by the methods described in Example 3. The AAV.1U7-ACCA was then administered to Dup2 mice via intramuscular injection.

(43) RT-PCR performed on DMD mRNA 4 weeks after TA intramuscular injection of 5e11vg AAV.1U7-ACCA showed nearly complete skipping of both copies of exon 2 in Dup2 animals [FIG. 12(a)].

(44) Immunoblot using a C-terminal antibody (PA1-21011, ThermoScientific) performed a month after infection showed significant expression of the N-truncated isoform (asterisk) in both Dup2 and control Bl6 mice [FIG. 12(b)]. The protein induced in Bl6 males injected with U7-ACCA was of the same size as that expressed in the Dup2 treated animals, confirming the size difference between this protein and the full-length isoform.

(45) Immunofluorescent staining of dystrophin, -dystroglycan, and neuronal nitric oxide synthase demonstrated restoration of members of the dystrophin associated complex [FIG. 12(c)].

(46) Normalized specific force following tetanic contraction in untreated Dup2 animals was significantly less than in Bl6 mice Intramuscular injection of AAV1.U7-ACCA, either alone or with prednisone, significantly increased force to levels that were not significantly different from that seen in Bl6 mice. No significant difference was observed between untreated Dup2 mice and those treated with prednisone along (Dup2+PDN) [FIG. 12(d)]. For this assay, normalized specific force was evaluated using a published protocol [Hakim et al., Journal of Applied Physiology, 110: 1656-1663 (2011)].

(47) Treatment significantly protected Dup2 muscle from loss of force following repetitive eccentric contractions, as assessed by published protocols (Hakim et al., supra). Treatment of Dup2 mice with AAV1.U7-ACCA alone resulted in a statistically significant improvement compared to untreated Dup2 mice. The combination of AAV1.U7-ACCA and prednisone resulted in no significant difference in comparison to control Bl6 mice in force retention following contractions #3 to #10 [FIG. 12(e)].

Example 5

Intravenous Injection of AAV9-U7_ACCA in the Dup2 Mouse Model Results in Significant Expression of the N-Truncated Isoform and Correction of Strength Deficit

(48) Based upon the degree of dystrophin expression detectable within injected muscle, we chose to deliver U7_ACCA SC rAAV intraveneously for further experiments, and selected the serotype rAAV9 based upon known tissue distribution properties.

(49) A rAAV9 comprising the genome insert of FIG. 9 was produced by the methods described in Example 3. The AAV.9U7-ACCA was then administered to Dup2 mice. A first cohort was injected via tail vein with 3.3E112 vg/kg. Injection was performed at four weeks of age.

(50) RT-PCR was performed on five different Dup2 mouse muscles one month after tail vein injection of AAV9.U7-ACCA (3.3E12 vg/kg) [FIG. 13(a)]. As demonstrated by the presence of multiple transcripts (labeled Dup2, wt, and De12), U7-ACCA treatment was able to force skipping of one or both copies of exon 2 in all muscles tested. (TA: tibialis anterior; Gas: gastrocnemius; : heart; Tri: triceps; dia: diaphragm.)

(51) Western blot using a C-terminal antibody (PA1-21011, ThermoScientific) performed on five different muscles one month after injection demonstrated the presence of dystrophin in all tested muscles[FIG. 13(b)].

(52) Immunostaining using a C-terminal antibody (PA1-21011, ThermoScientific) of dystrophin on the same samples confirmed dystrophin expression and its proper localization at the sarcolemma [FIG. 13(c)].

(53) Evaluation of both forelimb and hindlimb grip strength demonstrated a complete correction of grip strength in Dup2 animals treated with AAV9.U7-ACCA [FIG. 13(d)]. This assay was performed using a published protocol [Spurney, et al., Muscle & Nerve, 39, 591-602 (2009)].

(54) Normalized specific and total forces following tetanic contraction showed improvement in muscle force in comparison to untreated Dup2 animals [FIG. 13(e)], using a published protocol [Hakim et al., supra).

(55) Cardiac papillary muscles demonstrated improvements in length-dependent force generation in treated animals [FIG. 13(f)], using a published protocol [Janssen et al., Am J Physiol Heart Circ Physiol., 289(6):H2373-2378 (2005)].

(56) While the present invention has been described in terms of specific embodiments, it is understood that variations and modifications will occur to those skilled in the art. Accordingly, only such limitations as appear in the claims should be placed on the invention.

(57) All documents referred to in this application are hereby incorporated by reference in their entirety with particular attention to the content for which they are referred.