COMPOSITIONS AND METHODS FOR PROMOTING GROWTH OF BENEFICIAL MICROBES TO TREAT OR PREVENT DISEASE OR PROLONG LIFE

20180000876 ยท 2018-01-04

    Inventors

    Cpc classification

    International classification

    Abstract

    Inoculation of ATM-deficient mice with probiotic microorganisms, such as L. johnsonii, changed immune parameters, decreased a marker of DNA damage and increased the lifespan of the mice. Compositions and methods described herein are useful for the treatment and prevention of Ataxia telangiectasia and other cancer-prone disease, such as p53 deficiency-associated cancers. Compositions and methods of the present invention are also useful for treating and preventing radiation-induced toxicity to normal tissue in a subject being exposed to radiation, Compositions and methods of the invention can increase lifespans in a simple, non-invasive manner.

    Claims

    1-97. (canceled)

    98. A food or beverage product comprising Lactobacillus johnsonii 456.

    99. The food or beverage product of claim 1, wherein the product is a nutritional whole food, drink, mineral water, soup, replacement food, nutritional bar, confectionery, fermented or unfermented milk-based product, yoghurt product, milk-based powder, enteral nutritional product, baby and/or infant composition, fermented or unfermented cereal-based product, ice cream, chocolate, coffee, mayonnaise, tomato puree, salad dressing, milk, yoghurt, cheese, fermented milks, milk-based fermented products, ice creams, cereal-based products, fermented cereal-based products, milk-based powders, baby and infant formulas, food product of confectionery type, chocolate, cereals or animal feed.

    100. The food or beverage product of claim 98, wherein the product is a fermented or unfermented milk-based product.

    101. The food or beverage product of claim 98, wherein the product is yogurt.

    102. The food or beverage product of claim 98, wherein the product is milk.

    103. The food or beverage product of claim 98, wherein the product is animal feed or food supplements for non-human animals.

    104. The food or beverage product of claim 98, wherein the product is chocolate.

    105. The food or beverage product of claim 98, wherein the composition further comprises at least one nutritional active agent.

    106. The food or beverage product of claim 105, wherein the nutritional active agent is selected from anti-aging nutritional active agents, food antioxidants, nutrients with radical-scavenging properties and cofactors of antioxidant endogenous enzymes, vitamins A, vitamin C, vitamin E, carotenoids, xanthophylls, isoflavones, minerals, zinc, copper, magnesium or selenium, lipoic acid, coenzyme Q10, superoxide dismutase (SOD) or taurine, unsaponifiable fractions extracted from fats of plant origin, Aloe vera, native or hydrolyzed marine collagen, plant or marine oils rich in omega-3 and omega-6 fatty acids, photoprotective nutritional active agents, antioxidants, free-radical scavengers, nutritional ingredients with moisturizing or immunomodulatory properties, and extract of Polypodium leucotomos.

    107. The food or beverage product of claim 98, wherein the product is a powder.

    108. The food or beverage product of claim 98, wherein the powder is formulated to dissolve in liquid.

    109. A probiotic composition comprising Lactobacillus johnsonii 456.

    110. The probiotic composition of claim 109, further comprising additional beneficial bacteria.

    111. The probiotic composition of claim 109, wherein the composition further comprises added sugar.

    112. The probiotic composition of claim 109, wherein the composition does not comprise added sugar.

    113. The probiotic composition of claim 109, wherein the composition is a powder.

    114. The probiotic composition of claim 109, wherein the composition is formulated to dissolve in liquid.

    115. The probiotic composition of claim 109, wherein the composition is a spray.

    116. The probiotic composition of claim 109, wherein composition is a sugar-coated tablet, gel capsule, gel, emulsion, tablet, wafer capsule, hydrogel, food bar, liquid suspension, liquid solution, confectionery, fermented milk, fermented cheese, chewing gum, or toothpaste.

    117. The probiotic composition of claim 109, wherein composition is chewing gum.

    118. The probiotic composition of claim 109, wherein composition is toothpaste.

    119. The probiotic composition of claim 109, wherein the composition further comprises an antibiotic.

    120. The probiotic composition of claim 109, wherein the composition further comprises one or more bacteriophages.

    121. The probiotic composition of claim 109, wherein the one or more bacteriophages target a detrimental microorganism in Enterobacter, Helicobacter, Pseudomonas, Escherichia, Klebsiella, Staphylococcus, Proteus, Salmonella, or Shigella genera, such as Enterobacter cloacae, Helicobacter acinonychis, Helicobacter anseris, Helicobacter aurati, Helicobacter bilis, Helicobacter bizzozeronii, Helicobacter brantae, Helicobacter canadensis, Helicobacter canis, Helicobacter cetorum, Helicobacter cholecystus, Helicobacter cinaedi, Helicobacter cynogastricus, Helicobacter felis, Helicobacter fennelliae, Helicobacter ganmani, Helicobacter hepaticus, Helicobacter mesocricetorum, Helicobacter marmotae, Helicobacter muridarum, Helicobacter mustelae, Helicobacter pametensis, Helicobacter pullorum, Helicobacter pylori, Helicobacter rappini, Helicobacter rodentium, Helicobacter salomonis, Helicobacter trogontum, Helicobacter typhlonius, Helicobacter winghamensis, Salmonella enterica, Salmonella bongori, Salmonella subterranean, Salmonella typhimurium, Shigella dysenteriae, Shigella flexneri, Shigella boydii, Shigella sonnei or Dysgonomonas gadei, Prevotellaceae bacterium P4P_62, Belliella sp. MIM10, Parabacteroides merdae, Clostridium sp. AN-AS17, Capnocytophaga ochracea, Pedobacter koreensis, Eubacterium sp. BU014, Riemerella anatipestifer, Helicobacter typhlonicus, Petrimonas sulfuriphila, Caminicella sporogenes, Nubsella zeaxanthinifaciens, Porphyromonas sp. MI10-1288x, Sphingobacterium sp. NBRC 15338, Proteiniphilum acetatigenes, Parabacteroides goldsteinii, Bacteroidetes bacterium P073B, Porphyromonas catoniae, and Bacteroides nordii.

    122. A method of altering a subject's microbiome, comprising administering to the subject a composition comprising Lactobacillus johnsonii 456.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0048] FIG. 1A shows genetic instability (DNA deletions) measured by Pun reversion assay (n=220, 83 and 62 for wildtype mice with conventional microbiota (Harvard University), SPF-S and SPF-N, respectively). n=122, 40 and 28 for ATM.sup./ mice with conventional microbiota (Harvard University), in sterile (SPF-S) conditions, and semi-conventionalized, respectively. Conventional microbiota fur-spot data was adapted from Bioshop et al. (2000, Cancer Res 60:395-399). DNA deletions were increased in Atm-deficient mice in non-sterile (SPF-N) facilities but not in a sterile (SPF-S) facility. Fur-spots, which are a visual measure of DNA deletions were increased in Atm-deficient mice compared to their wildtype littermates in non-sterile (SPF-N) facilities but not in a sterile (SPF-S) facility.

    [0049] FIG. 1B shows the Kaplan-Meier survival curve (n=34 and 31 for SPF-S and SPF-N, respectively) of semi-conventional (SPF-N) ATM.sup./ mice and mice housed in sterile (SPF-S) environment is significantly different.

    [0050] FIG. 1C shows lymphoma latency in a subset of mice developing lymphoma (n=13 and 15 for SPF-S and SPF-N, respectively) using the log-rank test. Lymphoma latency is decreased in mice housed in non-sterile (SPF-N) conditions. In the experiment shown, of the mice which developed lymphomas (75% of Atm-deficient mice in both sterile (SPF-S) and non-sterile (SPF-N) conditions), the median age at which Atm-deficient mice in the non-sterile (SPF-N) conditions developed lymphomas was 25 weeks versus 60 weeks in sterile (SPF-S) conditions.

    [0051] FIG. 1D shows an unweighted UniFrac analysis of bacteria in Atm+/ mice in SPF-S and SPF-N conditions. Spheres around points indicate the 95% confidence ranges estimated by bootstrap resampling of data sets. Details are described herein, e.g., in Example B.

    [0052] FIG. 2 depicts the relative abundance of indicator bacterial phylotypes in mice. Fecal bacteria of age- and litter-matched CM and RM mice (n=4-5 for each type) were subjected to an indicator analysis. All identified abundant bacterial indicators were for CM mice. Error bars indicate standard deviation. Details are described herein, e.g., in Example B.

    [0053] FIG. 3A shows the Kaplan-Meier survival of CM and RM Atm.sup./ mice (n=38 and 31 for CM and RM mice, respectively).

    [0054] FIG. 3B shows bone marrow erythrocyte micronuclei levels (n=5 and 6 for CM and RM mice, respectively).

    [0055] FIG. 3C shows olive tail moments in blood leucocytes (n=5 for both groups).

    [0056] FIG. 3D shows oxidative stress measured by GSH/GSSG ratios (n=2 and 3 for CM and RM mice, respectively). All measurements were in mice aged 4-6 months. Error bars indicate SE. Details are described herein, e.g., in Example C.

    [0057] FIG. 4A shows weighted UniFrac analysis of bacteria in mice in CM (circles) and RM (squares) conditions.

    [0058] FIG. 4B shows a weighted UniFrac analysis of bacteria in mice in CM (circles) and RM (squares) conditions.

    [0059] FIG. 4C shows area plot of phyla in CM and RM mice by genotype and intestinal region.

    [0060] FIG. 4D shows distribution and abundance of proteobacteria by genotype and intestinal region. For CM, n=3, 7, 3, 7 for small intestine (SI)-Atm.sup.+/+, SI-Atm/, colon (CLN)-Atm.sup.+/+, and CLN-Atm.sup./, respectively. For RM, n=3, 4, 3, 4 for SI-Atm.sup.+/+, SI-Atm.sup./, CLN-Atm.sup.+/+, and CLN-Atm.sup./, respectively. Details are described herein, e.g., in Example D.

    [0061] FIG. 5A depicts an area plot of the most abundant OTUs in CM and RM mice by genotype and intestinal region.

    [0062] FIG. 5B shows distribution and abundance of Porphyromonas asaccharolytica by genotype and intestinal region.

    [0063] FIG. 5C shows distribution and abundance of Lactobacillus johnsonii by genotype and intestinal region. See FIG. 4 legend for mouse numbers per genotype and intestinal region. Details are described herein, e.g., in Example D.

    [0064] FIG. 6A depicts systemic genotoxicity was measured by RBC micronuclei quantitation.

    [0065] FIG. 6B shows levels of hepatic quantitated by flow cytometry for CD335.

    [0066] FIG. 6C shows levels of T cells quantitated by flow cytometry for CD3 cells.

    [0067] FIG. 6D shows hepatic tissue levels of cytokines measured by ELISA, and fold-change was calculated for L. johnsonii relative to vehicle (PBS) control groups.

    [0068] FIG. 6E shows fecal pellet levels of L. johnsonii quantitated by qPCR. Error bars indicate SE. *=P<0.05 by Student's t tests. Details are described herein, e.g., in Example E.

    [0069] FIG. 7A shows levels of NK in blood or spleen quantitated by flow cytometry for CD335 cells.

    [0070] FIG. 7B shows levels of T cells in blood or spleen quantitated by flow cytometry for CD3 cells.

    [0071] FIG. 7C shows blood (serum) levels of cytokines were measured by ELISA, and fold-change was calculated for L. johnsonii relative to vehicle (PBS) control groups. Error bars indicate SE. Details are described herein, e.g., in Example E.

    [0072] FIG. 8 depicts that survival curves of Atm-deficient mice are different depending on housing conditions and microbiota they are exposed to. Semi-conventionalized (SPF-N) mice in a non-sterile (SPF-N) facility have a decreased median lifespan compared to mice housed in a sterile (SPF-S) facility. The grey lines represent mice, which were housed in sterile (SPF-S) conditions and the black lines represent mice that were housed in non-sterile (SPF-N) conditions. The survival curve of the mice with conventional microbiota is significantly different than all of the other curves (p<0.05). Details are described herein, e.g., in Example B.

    [0073] FIG. 9 depicts that the median lifespan of Atm-deficient mice decreases as their microbiota became less restricted. The median lifespan of the restricted microbiota mice is not yet defined because no mice have died. The RM mice have a median life expectancy of 80 weeks.

    [0074] FIG. 10 depicts a ribosomal intergenic spacer analysis (RISA) results showing mice in different facilities have different banding patterns of 18S rRNA. Marker lanes (1-4; 1 kb ladder; Invitrogen, Inc. USA) as well as samples from mice in a non-sterile (SPF-N) facility (lanes 5-13), conventional mice (CM) (lanes 14-17), and mice in a sterile (SPF-S) environment (lanes 18-26).

    [0075] FIG. 11A depicts that CM mice have a shorter lifespan than RM mice. Lanes 1-3 represent samples from RF mice, lanes 4-6 represent samples from conventionalized mice. Each lane represents a different mouse.

    [0076] FIG. 11B shows the Kaplan Meier survival curve of CM and RM mice is significantly different (p<0.05). n=35 and 30 for CM and RM mice, respectively. Details are described in Example F.

    [0077] FIG. 12A shows that micronuclei are increased in CM mice compared to RM mice. n=6 for RM mice and n=5 for CM mice.

    [0078] FIG. 12B shows oive tail moments are increased in CM mice compared to RM mice. n=5 for both groups. * indicates p<0.05 for both figures. Error bars represent the SEM. Details are described in Example G.

    [0079] FIG. 13A shows that iNKT cells are decreased in mice inoculated with L. johnsonii.

    [0080] FIG. 13B shows both iNKT and overall T cell ratios are decreased in the spleen of mice inoculated with L. johnsonii. n=3 for PBS-inoculated mice and n=6 for L. johnsonii-inoculated mice. * indicates p<0.05. Error bars represent the SEM. Details are described in Example E.

    [0081] FIG. 14 depicts that inoculation with L. Johnsonii decreases MN formation. n=3 for PBS-inoculated mice and n=6 for L. johnsonii-inoculated mice. * indicates p<0.05. Error bars represent the SEM. Details are described in Example H.

    [0082] FIG. 15 schematically depicts the survival of p53/ mice developing lymphoma using methods and compositions of the present invention. Solid line, conventional colony (CM) (n=35); dotted line, parental=restricted microbiota (RM) colony (see above) (n=33); p<0.01. Details are described in Example M.

    [0083] FIG. 16 schematically depicts that the frequency of chromosomal aberrations is increased in CM mice compared to mice housed in sterile (SPF-S) conditions. n=6 mice/group. *indicates p<0.05. Details are described in Example I.

    [0084] FIG. 17 schematically depicts that DNA Strand breaks and oxidative DNA damage are increased in CF mice 24 hours after 1 Gy -irradiation using the modified comet assay with hOGG1. Olive tail moments (comet assay) were normalized to an internal control to account for inter-experimental differences. Statistics was done by ANOVA and repeated measures ANOVA, n=4, sterile (SPF-S) mice, and n=5, CM mice, *, p<0.05. Details are described in Example J.

    DETAILED DESCRIPTION OF THE INVENTION

    I. Definitions

    [0085] Throughout the present specification and the accompanying claims the words comprise, include, and have and variations thereof such as comprises, comprising, includes, including, has, and having are to be interpreted inclusively. That is, these words are intended to convey the possible inclusion of other elements or integers not specifically recited, where the context allows. No language in the specification should be construed as indicating any non-claimed element essential to the practice of the invention.

    [0086] The terms a and an and the and similar referents used in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context.

    [0087] Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, each individual value is incorporated into the specification as if it were individually recited herein. Ranges may be expressed herein as from about (or approximately) one particular value, and/or to about (or approximately) another particular value. When such a range is expressed, another embodiment includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent about or approximately it will be understood that the particular value forms another embodiment. It will be further understood that the endpoints of each of the ranges are disclosed both in relation to the other endpoint, and independently of the other endpoint.

    [0088] All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. Further, all methods described herein and having more than one step can be performed by more than one person or entity. Thus, a person or an entity can perform step (a) of a method, another person or another entity can perform step (b) of the method, and a yet another person or a yet another entity can perform step (c) of the method, etc. The use of any and all examples, or exemplary language (e. g. such as) provided herein is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention otherwise claimed.

    [0089] Units, prefixes, and symbols are denoted in their Systme International de Unites (SI) accepted form. Unless otherwise indicated, nucleic acids are written left to right in 5 to 3 orientation; amino acid sequences are written left to right in amino to carboxy orientation.

    [0090] Groupings of alternative elements or embodiments of the invention disclosed herein are not to be construed as limitations. Each group member may be referred to and claimed individually or in any combination with other members of the group or other elements found herein. It is anticipated that one or more members of a group may be included in, or deleted from, a group for reasons of convenience and/or patentability. When any such inclusion or deletion occurs, the specification is herein deemed to contain the group as modified thus fulfilling the written description of all Markush groups used in the appended claims.

    [0091] The headings used herein are for organizational purposes only and are not meant to be used to limit the scope of the description or the claims, which can be had by reference to the specification as a whole. Accordingly, the terms defined immediately below are more fully defined by reference to the specification in its entirety.

    [0092] Illustrations are for the purpose of describing a preferred embodiment of the invention and are not intended to limit the invention thereto.

    [0093] Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by a person skilled in the art to which this invention belongs. The following references provide one of skill with a general definition of many of the terms used in this invention: Singleton et al., Dictionary of Microbiology and Molecular Biology (2nd ed. 1994); The Cambridge Dictionary of Science and Technology (Walker ed., 1988); The Glossary of Genetics, 5th Ed., R. Rieger et al. (eds.), Springer Verlag (1991); and Hale & Marham, The Harper Collins Dictionary of Biology (1991). As used herein, the following terms have the meanings ascribed to them unless specified otherwise.

    [0094] As used herein, the term about refers to a range of values of plus or minus 10% of a specified value. For example, the phrase about 200 includes plus or minus 10% of 200, or from 180 to 220, unless clearly contradicted by context.

    [0095] As used herein, the term administering means the actual physical introduction of a composition into or onto (as appropriate) a host or cell. Any and all methods of introducing the composition into the host or cell are contemplated according to the invention; the method is not dependent on any particular means of introduction and is not to be so construed. Means of introduction are well-known to those skilled in the art, and also are exemplified herein.

    [0096] As used herein, administration in combination refers to both simultaneous and sequential administration of two or more agents or compositions. Concurrent or combined administration, as used herein, means that two or more agents or compositions are administered to a subject either (a) simultaneously, or (b) at different times during the course of a common treatment schedule. In the latter case, the two or more agents or compositions are administered sufficiently close in time to achieve the intended effect.

    [0097] As used herein, the terms altering the immune response or regulating the immune response or grammatical equivalents thereof, refer to any alteration in any cell type involved in the immune response. The definition is meant to include an increase or decrease in the number of cells, an increase or decrease in the activity of the cells, or any other changes which can occur within the immune system. The cells may be, but are not limited to, T lymphocytes, B lymphocytes, natural killer (NK) cells, macrophages, eosinophils, mast cells, dendritic cells, or neutrophils.

    [0098] As used herein, the term bacteriophage refers to a virus that infects and replicates within bacteria. Bacteriophages are composed of proteins that encapsulate a genome comprising either DNA or RNA. Bacteriophages replicate within bacteria following the injection of their genome into the bacterial cytoplasm. Bacteriophages include lytic bacteriophages, which disrupt bacterial metabolism and cause the bacterium to lyse, i.e., break open.

    [0099] As used herein, the terms cancer cancer cell, tumor, transformed cell or transformation refer to spontaneous or induced phenotypic changes of a cell or tissue that do not necessarily involve the uptake of new genetic material. The phenotypic changes include, but are not limited to, immortalization of cells, aberrant growth control, nonmorphological changes, and/or malignancy. Cancer or tumor is intended to include any neoplastic growth in a patient, including an initial tumor and any metastases. The cancer can be of the liquid or solid tumor type. Specific cancers are amenable to treatment and/or prevention using methods and compositions of the invention are described herein.

    [0100] As used herein, the abbreviation CM means conventional mice and conventional conditions.

    [0101] As used herein, the terms effective amount, effective dose, sufficient amount, amount effective to, therapeutically effective amount or grammatical equivalents thereof mean a dosage sufficient to produce a desired result, to ameliorate, or in some manner, reduce a symptom or stop or reverse progression of a condition and provide either a subjective relief of a symptom(s) or an objectively identifiable improvement as noted by a clinician or other qualified observer. Amelioration of a symptom of a particular condition by administration of a pharmaceutical composition described herein refers to any lessening, whether permanent or temporary, lasting, or transitory, that can be associated with the administration of the pharmaceutical composition. With respect to effective amount, effective dose, sufficient amount, amount effective to, therapeutically effective amount of a probiotic microorganism, the dosing range varies with the probiotic microorganism used, the route of administration and the potency of the particular probiotic microorganism.

    [0102] Ataxia telangiectasia is abbreviated AT.

    [0103] As used herein, the term biologically active when referring to a probiotic microorganism or a composition comprising a probiotic microorganism refers to a probiotic microorganism or a composition comprising a probiotic microorganism that allows for it, or a portion thereof to be administered, to be absorbed by, incorporated to, or otherwise be made physiologically available to a subject or patient to whom it is administered.

    [0104] As used herein, the terms detrimental microorganism and pathogen are used interchangeably and refer to microorganisms, including some bacteria, that are harmful to human health. Preventing the growth of detrimental microorganisms may improve prognosis of diseases including, but not limited to, premature carcinogenesis as well as the health of the general population. Non-limiting examples of detrimental microorganisms include species of the Enterobacter, Helicobacter, Pseudomonas, Escherichia, Klebsiella, Staphylococcus, Proteus, Salmonella, and Shigella genera, such as Enterobacter cloacae, Helicobacter acinonychis, Helicobacter anseris, Helicobacter aurati, Helicobacter bilis, Helicobacter bizzozeronii, Helicobacter brantae, Helicobacter canadensis, Helicobacter canis, Helicobacter cetorum, Helicobacter cholecystus, Helicobacter cinaedi, Helicobacter cynogastricus, Helicobacter fells, Helicobacter fennelliae, Helicobacter ganmani, Helicobacter hepaticus, Helicobacter mesocricetorum, Helicobacter marmotae, Helicobacter muridarum, Helicobacter mustelae, Helicobacter pametensis, Helicobacter pullorum, Helicobacter pylori, Helicobacter rappini, Helicobacter rodentium, Helicobacter salomonis, Helicobacter trogontum, Helicobacter typhlonius, Helicobacter winghamensis, Salmonella enterica, Salmonella bongori, Salmonella subterranean, Salmonella typhimurium, Shigella dysenteriae, Shigella flexneri, Shigella boydii, and Shigella sonnei. The detrimental microorganism may be selected from Enterobacter cloacae, Helicobacter pylori, Helicobacter hepaticus, Salmonella typhimurium, and Shigella dysenteriae. In some embodiments, the detrimental microorganism is a microorganism listed in Table 7B.

    [0105] As used herein, disorder, disease or pathological condition are used inclusively and refer to any deviation from the normal structure or function of any part, organ or system of the body (or any combination thereof). A specific disease is manifested by characteristic symptoms and signs, including biological, chemical and physical changes, and is often associated with a variety of other factors including, but not limited to, demographic, environmental, employment, genetic and medically historical factors. Certain characteristic signs, symptoms, and related factors can be quantitated through a variety of methods to yield important diagnostic information. Preferred disorders, diseases or pathological conditions amenable to prevention and/or treatment using compositions and methods described herein are ataxia telangiectasia (AT) and cancer as well as radiation-induced toxicity to normal tissue during and/or caused by radiation treatment.

    [0106] By the term filler is meant a pharmaceutically acceptable bulking agent which may facilitate material handling during production and lyophilisation. Suitable fillers include inorganic salts such as sodium chloride, and water soluble sugars or sugar alcohols such as sucrose, maltose, mannitol or trehalose.

    [0107] As used herein, the term fraction denotes any fragment derived from a microorganism under consideration according to the invention and also endowed with efficacy for the treatment of AT, increasing longevity, decrease of lymphoma onset, and/or prevention of genetic instability, DNA damage, or genotoxicity.

    [0108] As used herein, the term genetic instability refers to a mutation in a nucleic acid caused by exposure of a subject to radiation, to a carcinogen, to a virus, etc. The term spontaneous genetic instability refers to any condition that arises spontaneously in a subject not being exposed to radiation, to a carcinogen or to a virus, etc. that leads to an increase of a risk of developing cancer in the subject or to an increase of developing cancer in the subject.

    [0109] As used herein, the term inactivated microorganism refers to a microorganism that is no longer capable, temporarily or definitively, of forming colonies in culture. As used herein, a dead microorganism is a microorganism that is no longer capable, definitively, of forming colonies in culture. Dead or inactivated microorganisms may have intact or ruptured cell membranes. Thus, the term inactivated also denotes microorganism extracts and lysates as detailed herein below. Dead or inactivated microorganisms may be produced via any method known to those skilled in the art. As used herein, the term at least partly inactivated or dead microorganism means a preparation of probiotic microorganisms in accordance with the invention comprising a t least 80%, in particular at least 85%, more particularly at least 90%, or even at least 95%, or at least 99% of inactivated or dead probiotic microorganisms relative to the total amount of non-inactivated live probiotic microorganisms. The degree of inactivation or of death obtained depends on the application of the method used, which are adjusted by a person skilled in the art according to the degree of inactivation or death sought to be obtained.

    [0110] The terms individual, subject, host, and patient, used interchangeably herein, refer to an animal, such as a mammal, including, but not limited to, murines, simians, felines, canines, equines, bovines, mammalian farm animals, mammalian sport animals, and mammalian pets and humans. Preferred is a human.

    [0111] As used herein, the terms inhibiting the growth of a cell, inhibiting the growth of a population of cells or grammatical equivalents thereof refer to inhibiting cell division and may include destruction of the cell. The term also refers to any inhibition in cell growth and proliferation characteristics in vitro or in vivo of a cell, preferably a cancer cell, such as inhibiting formation of foci, inhibiting anchorage independence, inhibiting semi-solid or soft agar growth, inhibiting loss of growth factor or serum requirements, inhibiting changes in cell morphology, inhibiting immortalization, inhibiting expression of tumor specific markers, and/or inhibiting formation of tumors of the cell. See, e.g., Freshney, Culture of Animal Cells a Manual of Basic Technique pp. 231-241 (3rd ed. 1994). Similarly, the terms inhibiting the growth of a microorganism, inhibiting the growth of a population of microorganisms or grammatical equivalents thereof refer to inhibiting division of the microorganism and may include destruction of the microorganism.

    [0112] The terms isolated, purified or biologically pure refer to material that is substantially or essentially free of components that normally accompany it as found in its native state.

    [0113] As used herein, a lysate commonly denotes a material obtained after the destruction or dissolution of biological cells via a phenomenon known as cell lysis, thus giving rise to the release of the intracellular biological constituents naturally contained in the cells of the microorganism under consideration. As used herein, the term lysate is used without preference to denote the whole lysate obtained via lysis of a microorganism under consideration or only a fraction thereof. Cell lysis may be accomplished via various techniques, such as an osmotic shock, a heat shock, via ultrasonication, or alternatively under a mechanical stress of centrifugation type.

    [0114] As used herein, the term metabolite denotes any substance derived from the metabolism of a microorganism, and especially secreted by the microorganism under consideration according to the invention and also endowed with efficacy for the treatment of AT, increasing longevity, decrease of lymphoma onset, and/or prevention of genetic instability, DNA damage, or genotoxicity.

    [0115] As used herein, the term microorganism refers to a single-celled organism (e.g., a bacterium) and includes both live, partly or completely inactivated and attenuated microorganisms.

    [0116] The terms modulate, modulation, or modulating are art-recognized and refer to up-regulation (i.e., activation, stimulation, increase), or down-regulation (i.e., inhibition, suppression, reduction, or decrease) of a response, or the two in combination or apart.

    [0117] As used herein, optional or optionally means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where said event or circumstance occurs and instances where it does not.

    [0118] As used herein, the term mutation means a change in a nucleic acid sequence (in comparison to a wildtype or normal nucleic acid sequence) that alters or eliminates the function of an encoded polypeptide, that alters or eliminates the amount of an encoded polypeptide produced, or that alters or eliminates a regulatory function of the nucleic acid having acquired a mutation. Mutations include, but are not limited to, point mutations, deletions, insertions, inversions, duplications, etc. as known in the art.

    [0119] As used herein, the terms p53 deficiency or p53-deficient mean (i) a lower than normal expression level of a p53 nucleic acid, (ii), a lower than normal expression level of a p53 polypeptide, (iii), a mutation in a gene encoding a p53 polypeptide that is not present in a wildtype or normal gene encoding a wildtype or normal p53 polypeptide, (iv) a mutation in a gene transcript encoding a p53 polypeptide that is not present in a wildtype or normal gene transcript encoding a wildtype or normal p53 polypeptide, and (v) a mutation in an amino acid sequence of a p53 polypeptide that is not present in an amino acid sequence of a wildtype or normal p53 polypeptide. A p53 deficiency may occur in an individual, subject, host, or patient, more specifically in a cell of an individual, subject, host, patient. Methods for determining a p53 deficiency are well known in the art.

    [0120] As used herein, the terms p53-deficiency cancer or p53 deficient cancer mean a cancer in which at least one cell has a p53 deficiency.

    [0121] As used herein, the term parenteral route means a route other than the oral and topical routes. A parenteral route that is suitable for use in the invention may be, for example, the nasal route.

    [0122] As used herein, the term pharmaceutically acceptable refers to compositions that are physiologically tolerable and do not typically produce an allergic or similar untoward reaction when administered to a subject, preferably a human subject. Preferably, as used herein, the term pharmaceutically acceptable means approved by a regulatory agency of a federal or state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.

    [0123] As used herein, the term prebiotic refers to any compound, nutrient, or additional microbe applied as a single additive or as a mixture, together with probiotics or without probiotics, in order to augment a desired probiotic health effect or to stimulate the growth and activity of those bacteria in the digestive system which are assumed to be beneficial to the health of a host.

    [0124] The term preventing is art-recognized, and when used in relation to a condition, such as a local recurrence (e.g., pain), a disease such as cancer, a syndrome complex such as heart failure or any other medical condition, is well understood in the art, and includes administration of a composition which reduces the frequency of, or delays the onset of, symptoms of a medical condition in a subject relative to a subject which does not receive the composition. Thus, prevention of cancer includes, for example, reducing the number of detectable cancerous growths in a population of patients receiving a prophylactic treatment relative to an untreated control population, and/or delaying the appearance of detectable cancerous growths in a treated population versus an untreated control population, e.g., by a statistically and/or clinically significant amount. Prevention of an infection includes, for example, reducing the number of diagnoses of the infection in a treated population versus an untreated control population, and/or delaying the onset of symptoms of the infection in a treated population versus an untreated control population. Prevention of pain includes, for example, reducing the magnitude of, or alternatively delaying, pain sensations experienced by subjects in a treated population versus an untreated control population.

    [0125] As used herein, the term probiotic microorganism or simply probiotic means a live microorganism, which, when consumed by a host in an adequate amount, has a positive effect on the health of its host and which may in particular improve the intestinal microbial balance. The term refers to any bacterial species, strain or their combinations, with health supportive effects, not limited to currently accepted strains or to intestinal effects.

    [0126] As used herein, the term radiation refers to energy which may be selectively applied, including energy having a wavelength of between 10.sup.14 and 10.sup.4 meters including, for example, electron beam radiation, gamma radiation, x-ray radiation, light such as ultra-violet light, visible light, and infrared light, microwave radiation, and radio waves. The radiation is in particular an ionizing radiation which comprises subatomic particles and/or ions or electromagnetic waves which are energetic enough to ionize atoms or molecules. Irradiation refers to the application (exposure) of radiation to a subject, e.g., in radiation oncology for the treatment of cancer and/or during accidental or environmental radiation.

    [0127] As used herein, the term radiation treatment means a procedure including, but not limited to, radiotherapy, radiosurgery (i.e., radiation surgery) and/or any other (in particular) medical procedure, which uses ionizing radiation and in which a subject is treated by applying radiation to the subject's body. The radiation used for the treatment (the treatment radiation) is effective for a particular part(s) of the body. Radiation treatment comprises providing an energy value which depends on the radiation energy, in particular the energy of the treatment radiation, which is applied to the patient's body, and controlling the period of time over which radiation treatment is performed in accordance with the energy value. The ionizing radiation can be emitted by an irradiation device such as an x-ray tube and/or a particle accelerator and/or an antenna and/or a radioactive material.

    [0128] As used herein, the abbreviation RM means restricted microbiota.

    [0129] As used herein, the term radiation-induced toxicity means any damage to a cell, tissue, or any of its components, such as a nucleic acid, caused by radiation.

    [0130] As used herein, the abbreviation SPF-M means semi-conventional condition(s) and non-sterile condition(s).

    [0131] As used herein, the abbreviation SPF-S means sterile condition(s). This meaning includes conditions as described previously Kadhim et al., 1992, Nature 355(6362):738-40; Watson et al., 2001, Int J Radiat Biol 77(4):409-17).

    [0132] As used herein, the term substantially decreased and grammatical equivalents thereof refer to a level, amount, concentration of a parameter, such as a chemical compound, a metabolite, a nucleic acid, a polypeptide or a physical parameter (pH, temperature, viscosity, etc.) measured in a sample that has a decrease of at least 10%, preferably about 20%, more preferable about 40%, even more preferable about 50% and still more preferably a decrease of more than 75% when compared to the level, amount, or concentration of the same chemical compound, nucleic acid, polypeptide or physical parameter in a control sample.

    [0133] As used herein, the term substantially increased and grammatical equivalents thereof refer to a level, amount, concentration of a parameter, such as a chemical compound, a metabolite, a nucleic acid, a polypeptide or a physical parameter (pH, temperature, viscosity, etc.) measured in a sample that has an increase of at least 30%, preferably about 50%, more preferable about 75%, and still more preferably an increase of more than 100% when compared to the level, amount, or concentration of the same chemical compound, nucleic acid, polypeptide or physical parameter in a control sample.

    [0134] As used herein, the terms treat, treating, and treatment include inhibiting the pathological condition, disorder, or disease, e.g., arresting or reducing the development of the pathological condition, disorder, or disease or its clinical symptoms; or relieving the pathological condition, disorder, or disease, e.g., causing regression of the pathological condition, disorder, or disease or its clinical symptoms. These terms encompass also therapy and cure. Treatment means any manner in which the symptoms of a pathological condition, disorder, or disease are ameliorated or otherwise beneficially altered. Preferably, the subject in need of such treatment is a mammal, more preferably a human.

    [0135] w/v refers to weight/volume.

    II. Compositions

    [0136] The inventors have observed, surprisingly and unexpectedly, that the administration of a food supplement comprising a probiotic microorganism, especially of the genus Lactobacillus sp., in particular Lactobacillus johnsonii and more particularly Lactobacillus johnsonii 456, can substantially affect genetic instability, DNA damage, genotoxicity, immunological markers, longevity and lymphoma latency in an ATM deficient subject, in a subject having a p53 deficiency, or in a subject having a p53 deficiency-associated cancer. In addition, compositions described herein are useful for treating and preventing radiation-induced toxicity to normal tissues during irradiation of a subject.

    [0137] A. Probiotic, Prebiotic, and Synbiotic Microorganisms and Compositions

    [0138] Probiotic, prebiotic and synbiotic microorganism useful for composition and methods of the present invention have been described by de Vrese and Schrezenmeir (Adv Biochem Eng Biotechnol, 2008, 111:1-66), herewith incorporated by reference in its entirety.

    [0139] 1. Probiotic Microorganisms

    [0140] Probiotics are live microorganisms which can maintain intestinal microbial balance in the gastrointestinal tract of an animal host including a human. The probiotics, e.g., have beneficial effects in maintaining intestinal microbial balance, improving diarrhea caused by Rotavirus, alleviating antibiotic-related diarrhea, lactose intolerance and infant food allergic symptoms, and performing intestinal regulation. Applicants surprisingly and unexpectedly have found that probiotic formulations described herein are effective in treating and preventing certain disorders and conditions, including treating, preventing and delaying onset of AT-associated conditions and cancers as well as treating and/or preventing radiation-induced toxicity to normal tissue caused by exposure to radiation.

    [0141] In some embodiments of the present invention, a probiotic composition is a composition that is suitable for use in the invention and useful for treating and/or preventing a disease related to genome instability, such as an AT-associated condition, a p53 deficiency, a p53 deficiency-associated cancer and radiation-induced toxicity to normal tissue due to exposure to radiation.

    [0142] In some embodiments, the probiotic composition comprises at least one of the probiotic microorganisms listed in Table 6. In some embodiments, the probiotic composition comprises at least one of the probiotic microorganisms listed in Table 7A. In some embodiments, a probiotic composition advantageously comprises a Lactobacillus sp., especially Lactobacillus johnsonii and more particularly Lactobacillus johnsonii 456 as defined herein.

    [0143] In some embodiments of the present invention, a probiotic microorganism may be used in an isolated or purified form, i.e., not mixed with one or more compound(s) typically associated with it in its medium of origin. In some embodiments, a probiotic microorganism may be used in combination with an antibacterial agent, such as an antibiotic or a bacteriophage.

    [0144] In some embodiments of the present invention, a probiotic microorganism may be used in a live, semi-active, inactivated or dead form. A probiotic microorganism administered orally may advantageously be used in live form.

    [0145] A probiotic microorganism according to the invention may be used in whole form, i.e., essentially in its native form, or in the form of extracts or lysates of disintegrated suspensions comprising fractions and/or metabolites of this microorganism.

    [0146] In some embodiments of the present invention, a probiotic microorganism that is suitable for use in the invention may be used in the form of a lysate.

    [0147] i. Lactobacillus

    [0148] In some embodiments of the present invention, a probiotic composition that is suitable for use in the invention, for example topically or orally, and especially orally, comprises, or in some embodiments consists essentially of, a microorganism of the genus Lactobacillus sp., preferably selected from L. acidophilus, L. alimentarius, L. amylovorus, L. brevis, L. bulgaricus, L. casei, L. casei subsp. casei, L. casei shirota, L. crispatus, L. curvatus, L. delbrueckii subsp. lactis, L. fermentum, L. gallinarum, L. gasseri, L. helveticus, L. johnsonii, L. paracasei, L. plantarum, L. reuteri, L. rhamnosus, L. sake and L. salivarius and combinations thereof.

    [0149] A preferred Lactobacillus sp. is L. johnsonii. Thus, in some embodiments of the present invention, a probiotic composition that is suitable for use in the invention comprises L. johnsonii. A more preferred Lactobacillus sp. is L. johnsonii 456. Thus, in some embodiments of the present invention, a probiotic composition that is suitable for use in the invention comprises L. johnsonii 456.

    [0150] In some embodiments of the present invention, a probiotic composition comprising a Lactobacillus sp. does not include a Clostridium sp. In some embodiments of the present invention, a probiotic composition comprising a Lactobacillus sp. does not include a Eubacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Lactobacillus sp. does not include a Barnesiella sp. In some embodiments of the present invention, a probiotic composition comprising a Lactobacillus sp. does not include an Acetanaerobacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Lactobacillus sp. does not include a Porphyromonadaceae sp. In some embodiments of the present invention, a probiotic composition comprising a Lactobacillus sp. does not include a Butyrivibrio sp. In some embodiments of the present invention, a probiotic composition comprising a Lactobacillus sp. does not include a Butyricimimonas sp. In some embodiments of the present invention, a probiotic composition comprising a Lactobacillus sp. does not include a Lachnospiraceae sp. In some embodiments of the present invention, a probiotic composition comprising a Lactobacillus sp. does not include a Porpyromonas sp. In some embodiments of the present invention, a probiotic composition comprising a Lactobacillus sp. does not include a Prevotella sp. In some embodiments of the present invention, a probiotic composition comprising a Lactobacillus sp. does not include a Rumen bacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Lactobacillus sp. does not include a Filifactor sp. In some embodiments of the present invention, a probiotic composition comprising a Lactobacillus sp. does not include a Cyanobacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Lactobacillus sp. does not include a Alistipes sp. In some embodiments of the present invention, a probiotic composition comprising a Lactobacillus sp. does not include a microorganism listed in Table 7B.

    [0151] ii. Clostridium

    [0152] In some embodiments of the present invention, a probiotic composition that is suitable for use in the invention, for example topically or orally, and especially orally, comprises, or in some embodiments consists essentially of, a microorganism of the genus Clostridium sp., preferably selected from Clostridium polysaccharaolyticum, Clostridium populeti, Clostridium oroticum, Clostridium fimetarium, Clostridium chauvoei, and Chlostridium tyrobutyricum.

    [0153] In some embodiments of the present invention, a probiotic composition comprising a Clostridium sp. does not include a Lactobacillus sp. In some embodiments of the present invention, a probiotic composition comprising a Clostridium sp. does not include a Eubacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Clostridium sp. does not include a Barnesiella sp. In some embodiments of the present invention, a probiotic composition comprising a Clostridium sp. does not include an Acetanaerobacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Clostridium sp. does not include a Porphyromonadaceae sp. In some embodiments of the present invention, a probiotic composition comprising a Clostridium sp. does not include a Butyrivibrio sp. In some embodiments of the present invention, a probiotic composition comprising a Clostridium sp. does not include a Butyricimonas sp. In some embodiments of the present invention, a probiotic composition comprising a Clostridium sp. does not include a Lachnospiraceae sp. In some embodiments of the present invention, a probiotic composition comprising a Clostridium sp. does not include a Porpyromonas sp. In some embodiments of the present invention, a probiotic composition comprising a Clostridium sp. does not include a Prevotella sp. In some embodiments of the present invention, a probiotic composition comprising a Clostridium sp. does not include a Rumen bacteriyum sp. In some embodiments of the present invention, a probiotic composition comprising a Clostridium sp. does not include a Filifactor sp. In some embodiments of the present invention, a probiotic composition comprising a Clostridium sp. does not include a Cyanobacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Clostridium sp. does not include a Alistipes sp. In some embodiments of the present invention, a probiotic composition comprising a Clostridium sp. does not include a microorganism listed in Table 7B.

    [0154] iii. Eubacterium

    [0155] In some embodiments of the present invention, a probiotic composition that is suitable for use in the invention, for example topically or orally, and especially orally, comprises, or in some embodiments consists essentially of, a microorganism of the genus Eubacterium sp., preferably Eubacterium hadrum.

    [0156] In some embodiments of the present invention, a probiotic composition comprising a Eubacterium sp. does not include a Lactobacillus sp. In some embodiments of the present invention, a probiotic composition comprising a Eubacterium sp. does not include a Clostridium sp. In some embodiments of the present invention, a probiotic composition comprising a Eubacterium sp. does not include a Barnesiella sp. In some embodiments of the present invention, a probiotic composition comprising a Eubacterium sp. does not include an Acetanaerobacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Eubacterium sp. does not include a Porphyromonadaceae sp. In some embodiments of the present invention, a probiotic composition comprising a Eubacterium sp. does not include a Butyrivibrio sp. In some embodiments of the present invention, a probiotic composition comprising a Eubacterium sp. does not include a Butyricimonas sp. In some embodiments of the present invention, a probiotic composition comprising a Eubacterium sp. does not include a Lachnospiraceae sp. In some embodiments of the present invention, a probiotic composition comprising a Eubacterium sp. does not include a Porpyromonas sp. In some embodiments of the present invention, a probiotic composition comprising a Eubacterium sp. does not include a Prevotella sp. In some embodiments of the present invention, a probiotic composition comprising a Eubacterium sp. does not include a Rumen bacteriyum sp. In some embodiments of the present invention, a probiotic composition comprising a Eubacterium sp. does not include a Filifactor sp. In some embodiments of the present invention, a probiotic composition comprising a Eubacterium sp. does not include a Cyanobacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Eubacterium sp. does not include a Alistipes sp. In some embodiments of the present invention, a probiotic composition comprising a Eubacterium sp. does not include a microorganism listed in Table 7B.

    [0157] iv. Barnesiella

    [0158] In some embodiments of the present invention, a probiotic composition that is suitable for use in the invention, for example topically or orally, and especially orally, comprises, or in some embodiments consists essentially of, a microorganism of the genus Barnesiella sp., preferably selected from Barnesiella intestinihominis and Barnesiella viscericola.

    [0159] In some embodiments of the present invention, a probiotic composition comprising a Barnesiella sp. does not include a Lactobacillus sp. In some embodiments of the present invention, a probiotic composition comprising a Barnesiella sp. does not include a Clostridium sp. In some embodiments of the present invention, a probiotic composition comprising a Barnesiella sp. does not include a Eubacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Barnesiella sp. does not include an Acetanaerobacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Barnesiella sp. does not include a Porphyromonadaceae sp. In some embodiments of the present invention, a probiotic composition comprising a Barnesiella sp. does not include a Butyrivibrio sp. In some embodiments of the present invention, a probiotic composition comprising a Barnesiella sp. does not include a Butyricimonas sp. In some embodiments of the present invention, a probiotic composition comprising a Barnesiella sp. does not include a Lachnospiraceae sp. In some embodiments of the present invention, a probiotic composition comprising a Barnesiella sp. does not include a Porpyromonas sp. In some embodiments of the present invention, a probiotic composition comprising a Barnesiella sp. does not include a Prevotella sp. In some embodiments of the present invention, a probiotic composition comprising a Barnesiella sp. does not include a Rumen bacteriyum sp. In some embodiments of the present invention, a probiotic composition comprising a Barnesiella sp. does not include a Filifactor sp. In some embodiments of the present invention, a probiotic composition comprising a Barnesiella sp. does not include a Cyanobacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Barnesiella sp. does not include a Alistipes sp. In some embodiments of the present invention, a probiotic composition comprising a Barnesiella sp. does not include a microorganism listed in Table 7B.

    [0160] v. Acetanaerobacterium

    [0161] In some embodiments of the present invention, a probiotic composition that is suitable for use in the invention, for example topically or orally, and especially orally, comprises, or in some embodiments consists essentially of, a microorganism of the genus Acetanaerobacterium sp., preferably Acetanaerobacterium elongatum.

    [0162] In some embodiments of the present invention, a probiotic composition comprising an Acetanaerobacterium sp. does not include a Lactobacillus sp. In some embodiments of the present invention, a probiotic composition comprising a n Acetanaerobacterium sp. does not include a Clostridium sp. In some embodiments of the present invention, a probiotic composition comprising an Acetanaerobacterium sp. does not include a Barnesiella sp. In some embodiments of the present invention, a probiotic composition comprising an Acetanaerobacterium sp. does not include a Eubacterium sp. In some embodiments of the present invention, a probiotic composition comprising a n Acetanaerobacterium sp. does not include a Porphyromonadaceae sp. In some embodiments of the present invention, a probiotic composition comprising a n Acetanaerobacterium sp. does not include a Butyrivibrio sp. In some embodiments of the present invention, a probiotic composition comprising an Acetanaerobacterium sp. does not include a Butyricimonas sp. In some embodiments of the present invention, a probiotic composition comprising a Acetanaerobacterium sp. does not include a Lachnospiraceae sp. In some embodiments of the present invention, a probiotic composition comprising a Acetanaerobacterium sp. does not include a Porpyromonas sp. In some embodiments of the present invention, a probiotic composition comprising a Acetanaerobacterium sp. does not include a Prevotella sp. In some embodiments of the present invention, a probiotic composition comprising a Acetanaerobacterium sp. does not include a Rumen bacteriyum sp. In some embodiments of the present invention, a probiotic composition comprising a Acetanaerobacterium sp. does not include a Filifactor sp. In some embodiments of the present invention, a probiotic composition comprising a Acetanaerobacterium sp. does not include a Cyanobacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Acetanaerobacterium sp. does not include a Alistipes sp. In some embodiments of the present invention, a probiotic composition comprising a n Acetanaerobacterium sp. does not include a microorganism listed in Table 7B.

    [0163] vi. Porphyromonadaceae

    [0164] In some embodiments of the present invention, a probiotic composition that is suitable for use in the invention, for example topically or orally, and especially orally, comprises, or in some embodiments consists essentially of, a microorganism of the genus Porphyromonadaceae sp., preferably Porphyromonadaceae bacterium C941.

    [0165] In some embodiments of the present invention, a probiotic composition comprising a Porphyromonadaceae sp. does not include a Lactobacillus sp. In some embodiments of the present invention, a probiotic composition comprising a Porphyromonadaceae sp. does not include a Clostridium sp. In some embodiments of the present invention, a probiotic composition comprising a Porphyromonadaceae sp. does not include a Eubacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Porphyromonadaceae sp. does not include a n Acetanaerobacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Porphyromonadaceae sp. does not include a Barnesiella sp. In some embodiments of the present invention, a probiotic composition comprising a Porphyromonadaceae sp. does not include a Butyrivibrio sp. In some embodiments of the present invention, a probiotic composition comprising a Porphyromonadaceae sp. does not include a Butyricimonas sp. In some embodiments of the present invention, a probiotic composition comprising a Porphyromonadaceae sp. does not include a Lachnospiraceae sp. In some embodiments of the present invention, a probiotic composition comprising a Porphyromonadaceae sp. does not include a Porpyromonas sp. In some embodiments of the present invention, a probiotic composition comprising a Porphyromonadaceae sp. does not include a Prevotella sp. In some embodiments of the present invention, a probiotic composition comprising a Porphyromonadaceae sp. does not include a Rumen bacteriyum sp. In some embodiments of the present invention, a probiotic composition comprising a Porphyromonadaceae sp. does not include a Filifactor sp. In some embodiments of the present invention, a probiotic composition comprising a Porphyromonadaceae sp. does not include a Cyanobacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Porphyromonadaceae sp. does not include a Alistipes sp. In some embodiments of the present invention, a probiotic composition comprising a Porphyromonadaceae sp. does not include a microorganism listed in Table 7B.

    [0166] vii. Butyrivibrio

    [0167] In some embodiments of the present invention, a probiotic composition that is suitable for use in the invention, for example topically or orally, and especially orally, comprises, or in some embodiments consists essentially of, a microorganism of the genus Butyrivibrio sp., preferably Butyrivibrio crossotus.

    [0168] In some embodiments of the present invention, a probiotic composition comprising a Butyrivibrio sp. does not include a Lactobacillus sp. In some embodiments of the present invention, a probiotic composition comprising a Butyrivibrio sp. does not include a Clostridium sp. In some embodiments of the present invention, a probiotic composition comprising a Butyrivibrio sp. does not include a Eubacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Butyrivibrio sp. does not include a Barnesiella sp. In some embodiments of the present invention, a probiotic composition comprising a Butyrivibrio sp. does not include a n Acetanaerobacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Butyrivibrio sp. does not include a Porphyromonadaceae sp. In some embodiments of the present invention, a probiotic composition comprising a Butyrivibrio sp. does not include a Butyricimonas sp. In some embodiments of the present invention, a probiotic composition comprising a Butyrivibrio sp. does not include a Lachnospiraceae sp. In some embodiments of the present invention, a probiotic composition comprising a Butyrivibrio sp. does not include a Porpyromonas sp. In some embodiments of the present invention, a probiotic composition comprising a Butyrivibrio sp. does not include a Prevotella sp. In some embodiments of the present invention, a probiotic composition comprising a Butyrivibrio sp. does not include a Rumen bacteriyum sp. In some embodiments of the present invention, a probiotic composition comprising a Butyrivibrio sp. does not include a Filifactor sp. In some embodiments of the present invention, a probiotic composition comprising a Butyrivibrio sp. does not include a Cyanobacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Butyrivibrio sp. does not include a Alistipes sp. In some embodiments of the present invention, a probiotic composition comprising a Butyrivibrio sp. does not include a microorganism listed in Table 7B.

    [0169] viii. Butyricimonas

    [0170] In some embodiments of the present invention, a probiotic composition that is suitable for use in the invention, for example topically or orally, and especially orally, comprises, or in some embodiments consists essentially of, a microorganism of the genus Butyricimonas sp., preferably Butyricimonas syngergistica.

    [0171] In some embodiments of the present invention, a probiotic composition comprising a Butyricimonas sp. does not include a Lactobacillus sp. In some embodiments of the present invention, a probiotic composition comprising a Butyricimonas sp. does not include a Clostridium sp. In some embodiments of the present invention, a probiotic composition comprising a Butyricimonas sp. does not include a Eubacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Butyricimonas sp. does not include a Barnesiella sp. In some embodiments of the present invention, a probiotic composition comprising a Butyricimonas sp. does not include a n Acetanaerobacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Butyricimonas sp. does not include a Porphyromonadaceae sp. In some embodiments of the present invention, a probiotic composition comprising a Butyricimonas sp. does not include a Butyrivibrio sp. In some embodiments of the present invention, a probiotic composition comprising a Butyricimonas sp. does not include a Lachnospiraceae sp. In some embodiments of the present invention, a probiotic composition comprising a Butyricimonas sp. does not include a Porpyromonas sp. In some embodiments of the present invention, a probiotic composition comprising a Butyricimonas sp. does not include a Prevotella sp. In some embodiments of the present invention, a probiotic composition comprising a Butyricimonas sp. does not include a Rumen bacteriyum sp. In some embodiments of the present invention, a probiotic composition comprising a Butyricimonas sp. does not include a Filifactor sp. In some embodiments of the present invention, a probiotic composition comprising a Butyricimonas sp. does not include a Cyanobacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Butyricimonas sp. does not include a Alistipes sp. In some embodiments of the present invention, a probiotic composition comprising a Butyricimonas sp. does not include a microorganism listed in Table 7B.

    [0172] ix. Lachnospiraceae

    [0173] In some embodiments of the present invention, a probiotic composition that is suitable for use in the invention, for example topically or orally, and especially orally, comprises, or in some embodiments consists essentially of, a microorganism of the genus Lachnospiraceae sp., preferably Lachnospiraceae bacterium DJF_VP30.

    [0174] In some embodiments of the present invention, a probiotic composition comprising a Lachnospiraceae sp. does not include a Lactobacillus sp. In some embodiments of the present invention, a probiotic composition comprising a Lachnospiraceae sp. does not include a Clostridium sp. In some embodiments of the present invention, a probiotic composition comprising a Lachnospiraceae sp. does not include a Eubacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Lachnospiraceae sp. does not include a Barnesiella sp. In some embodiments of the present invention, a probiotic composition comprising a Lachnospiraceae sp. does not include an Acetanaerobacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Lachnospiraceae sp. does not include a Porphyromonadaceae sp. In some embodiments of the present invention, a probiotic composition comprising a Lachnospiraceae sp. does not include a Butyrivibrio sp. In some embodiments of the present invention, a probiotic composition comprising a Lachnospiraceae sp. does not include a Butyricimonas sp. In some embodiments of the present invention, a probiotic composition comprising a Lachnospiraceae sp. does not include a Porpyromonas sp. In some embodiments of the present invention, a probiotic composition comprising a Lachnospiraceae sp. does not include a Prevotella sp. In some embodiments of the present invention, a probiotic composition comprising a Lachnospiraceae sp. does not include a Rumen bacteriyum sp. In some embodiments of the present invention, a probiotic composition comprising a Lachnospiraceae sp. does not include a Filifactor sp. In some embodiments of the present invention, a probiotic composition comprising a Lachnospiraceae sp. does not include a Cyanobacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Lachnospiraceae sp. does not include a Alistipes sp. In some embodiments of the present invention, a probiotic composition comprising a Lachnospiraceae sp. does not include a microorganism listed in Table 7B.

    [0175] x. Porphyromonas

    [0176] In some embodiments of the present invention, a probiotic composition that is suitable for use in the invention, for example topically or orally, and especially orally, comprises, or in some embodiments consists essentially of, a microorganism of the genus Porphyromonas sp., preferably Porphyromonas sp. C1075.

    [0177] In some embodiments of the present invention, a probiotic composition comprising a Porphyromonas sp. does not include a Lactobacillus sp. In some embodiments of the present invention, a probiotic composition comprising a Porphyromonas sp. does not include a Clostridium sp. In some embodiments of the present invention, a probiotic composition comprising a Porphyromonas sp. does not include a Eubacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Porphyromonas sp. does not include a Barnesiella sp. In some embodiments of the present invention, a probiotic composition comprising a Porphyromonas sp. does not include an Acetanaerobacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Porphyromonas sp. does not include a Porphyromonadaceae sp. In some embodiments of the present invention, a probiotic composition comprising a Porphyromonas sp. does not include a Butyrivibrio sp. In some embodiments of the present invention, a probiotic composition comprising a Porphyromonas sp. does not include a Butyricimonas sp. In some embodiments of the present invention, a probiotic composition comprising a Porphyromonas sp. does not include a Lachnospiraceae sp. In some embodiments of the present invention, a probiotic composition comprising a Porphyromonas sp. does not include a Prevotella sp. In some embodiments of the present invention, a probiotic composition comprising a Porphyromonas sp. does not include a Rumen bacteriyum sp. In some embodiments of the present invention, a probiotic composition comprising a Porphyromonas sp. does not include a Filifactor sp. In some embodiments of the present invention, a probiotic composition comprising a Porphyromonas sp. does not include a Cyanobacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Porphyromonas sp. does not include a Alistipes sp. In some embodiments of the present invention, a probiotic composition comprising a Porphyromonas sp. does not include a microorganism listed in Table 7B.

    [0178] xi. Prevotella

    [0179] In some embodiments of the present invention, a probiotic composition that is suitable for use in the invention, for example topically or orally, and especially orally, comprises, or in some embodiments consists essentially of, a microorganism of the genus Prevotella sp., preferably Prevotella sp. oral clone CY006.

    [0180] In some embodiments of the present invention, a probiotic composition comprising a Prevotella sp. does not include a Lactobacillus sp. In some embodiments of the present invention, a probiotic composition comprising a Prevotella sp. does not include a Clostridium sp. In some embodiments of the present invention, a probiotic composition comprising a Prevotella sp. does not include a Eubacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Prevotella sp. does not include a Barnesiella sp. In some embodiments of the present invention, a probiotic composition comprising a Prevotella sp. does not include an Acetanaerobacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Prevotella sp. does not include a Porphyromonadaceae sp. In some embodiments of the present invention, a probiotic composition comprising a Prevotella sp. does not include a Butyrivibrio sp. In some embodiments of the present invention, a probiotic composition comprising a Prevotella sp. does not include a Butyricimonas sp. In some embodiments of the present invention, a probiotic composition comprising a Prevotella sp. does not include a Lachnospiraceae sp. In some embodiments of the present invention, a probiotic composition comprising a Prevotella sp. does not include a Porphyromonas sp. In some embodiments of the present invention, a probiotic composition comprising a Prevotella sp. does not include a Rumen bacteriyum sp. In some embodiments of the present invention, a probiotic composition comprising a Prevotella sp. does not include a Filifactor sp. In some embodiments of the present invention, a probiotic composition comprising a Prevotella sp. does not include a Cyanobacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Prevotella sp. does not include a Alistipes sp. In some embodiments of the present invention, a probiotic composition comprising a Prevotella sp. does not include a microorganism listed in Table 7B.

    [0181] xii. Rumen bacterium

    [0182] In some embodiments of the present invention, a probiotic composition that is suitable for use in the invention, for example topically or orally, and especially orally, comprises, or in some embodiments consists essentially of, a microorganism of the genus Rumen bacterium sp., preferably Rumen bacterium NK4A66.

    [0183] In some embodiments of the present invention, a probiotic composition comprising a Rumen bacterium sp. does not include a Lactobacillus sp. In some embodiments of the present invention, a probiotic composition comprising a Rumen bacterium sp. does not include a Clostridium sp. In some embodiments of the present invention, a probiotic composition comprising a Rumen bacterium sp. does not include a Eubacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Rumen bacterium sp. does not include a Barnesiella sp. In some embodiments of the present invention, a probiotic composition comprising a Rumen bacterium sp. does not include an Acetanaerobacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Rumen bacterium sp. does not include a Porphyromonadaceae sp. In some embodiments of the present invention, a probiotic composition comprising a Rumen bacterium sp. does not include a Butyrivibrio sp. In some embodiments of the present invention, a probiotic composition comprising a Rumen bacterium sp. does not include a Butyricimonas sp. In some embodiments of the present invention, a probiotic composition comprising a Rumen bacterium sp. does not include a Lachnospiraceae sp. In some embodiments of the present invention, a probiotic composition comprising a Rumen bacterium sp. does not include a Porphyromonas sp. In some embodiments of the present invention, a probiotic composition comprising a Rumen bacterium sp. does not include a Prevotella sp. In some embodiments of the present invention, a probiotic composition comprising a Rumen bacterium sp. does not include a Filifactor sp. In some embodiments of the present invention, a probiotic composition comprising a Rumen bacterium sp. does not include a Cyanobacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Rumen bacterium sp. does not include a Alistipes sp. In some embodiments of the present invention, a probiotic composition comprising a Rumen bacterium sp. does not include a microorganism listed in Table 7B.

    [0184] xiii. Filifactor

    [0185] In some embodiments of the present invention, a probiotic composition that is suitable for use in the invention, for example topically or orally, and especially orally, comprises, or in some embodiments consists essentially of, a microorganism of the genus Filifactor sp., preferably Filifactor alocis.

    [0186] In some embodiments of the present invention, a probiotic composition comprising a Filifactor sp. does not include a Lactobacillus sp. In some embodiments of the present invention, a probiotic composition comprising a Filifactor sp. does not include a Clostridium sp. In some embodiments of the present invention, a probiotic composition comprising a Filifactor sp. does not include a Eubacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Filifactor sp. does not include a Barnesiella sp. In some embodiments of the present invention, a probiotic composition comprising a Filifactor sp. does not include an Acetanaerobacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Filifactor sp. does not include a Porphyromonadaceae sp. In some embodiments of the present invention, a probiotic composition comprising a Filifactor sp. does not include a Butyrivibrio sp. In some embodiments of the present invention, a probiotic composition comprising a Filifactor sp. does not include a Butyricimonas sp. In some embodiments of the present invention, a probiotic composition comprising a Filifactor sp. does not include a Lachnospiraceae sp. In some embodiments of the present invention, a probiotic composition comprising a Filifactor sp. does not include a Porphyromonas sp. In some embodiments of the present invention, a probiotic composition comprising a Filifactor sp. does not include a Prevotella sp. In some embodiments of the present invention, a probiotic composition comprising a Filifactor sp. does not include a Rumen bacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Filifactor sp. does not include a Cyanobacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Filifactor sp. does not include a Alistipes sp. In some embodiments of the present invention, a probiotic composition comprising a Filifactor sp. does not include a microorganism listed in Table 7B.

    [0187] xiv. Cyanobacterium

    [0188] In some embodiments of the present invention, a probiotic composition that is suitable for use in the invention, for example topically or orally, and especially orally, comprises, or in some embodiments consists essentially of, a microorganism of the genus Cyanobacterium sp., preferably Cyanobacterium sp. MS-B-20.

    [0189] In some embodiments of the present invention, a probiotic composition comprising a Cyanobacterium sp. does not include a Lactobacillus sp. In some embodiments of the present invention, a probiotic composition comprising a Cyanobacterium sp. does not include a Clostridium sp. In some embodiments of the present invention, a probiotic composition comprising a Cyanobacterium sp. does not include a Eubacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Cyanobacterium sp. does not include a Barnesiella sp. In some embodiments of the present invention, a probiotic composition comprising a Cyanobacterium sp. does not include an Acetanaerobacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Cyanobacterium sp. does not include a Porphyromonadaceae sp. In some embodiments of the present invention, a probiotic composition comprising a Cyanobacterium sp. does not include a Butyrivibrio sp. In some embodiments of the present invention, a probiotic composition comprising a Cyanobacterium sp. does not include a Butyricimonas sp. In some embodiments of the present invention, a probiotic composition comprising a Cyanobacterium sp. does not include a Lachnospiraceae sp. In some embodiments of the present invention, a probiotic composition comprising a Cyanobacterium sp. does not include a Porphyromonas sp. In some embodiments of the present invention, a probiotic composition comprising a Cyanobacterium sp. does not include a Prevotella sp. In some embodiments of the present invention, a probiotic composition comprising a Cyanobacterium sp. does not include a Rumen bacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Cyanobacterium sp. does not include a Filifactor sp. In some embodiments of the present invention, a probiotic composition comprising a Cyanobacterium sp. does not include a Alistipes sp. In some embodiments of the present invention, a probiotic composition comprising a Cyanobacterium sp. does not include a microorganism listed in Table 7B.

    [0190] xv. Alistipes

    [0191] In some embodiments of the present invention, a probiotic composition that is suitable for use in the invention, for example topically or orally, and especially orally, comprises, or in some embodiments consists essentially of, a microorganism of the genus Alistipes sp., preferably Alistipes onderdonkii.

    [0192] In some embodiments of the present invention, a probiotic composition comprising a Alistipes sp. does not include a Lactobacillus sp. In some embodiments of the present invention, a probiotic composition comprising a Alistipes sp. does not include a Clostridium sp. In some embodiments of the present invention, a probiotic composition comprising a Alistipes sp. does not include a Eubacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Alistipes sp. does not include a Barnesiella sp. In some embodiments of the present invention, a probiotic composition comprising a Alistipes sp. does not include an Acetanaerobacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Alistipes sp. does not include a Porphyromonadaceae sp. In some embodiments of the present invention, a probiotic composition comprising a Alistipes sp. does not include a Butyrivibrio sp. In some embodiments of the present invention, a probiotic composition comprising a Alistipes sp. does not include a Butyricimonas sp. In some embodiments of the present invention, a probiotic composition comprising a Alistipes sp. does not include a Lachnospiraceae sp. In some embodiments of the present invention, a probiotic composition comprising a Alistipes sp. does not include a Porphyromonas sp. In some embodiments of the present invention, a probiotic composition comprising a Alistipes sp. does not include a Prevotella sp. In some embodiments of the present invention, a probiotic composition comprising a Alistipes sp. does not include a Rumen bacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Alistipes sp. does not include a Filifactor sp. In some embodiments of the present invention, a probiotic composition comprising a Alistipes sp. does not include a Cyano bacterium sp. In some embodiments of the present invention, a probiotic composition comprising a Alistipes sp. does not include a microorganism listed in Table 7B.

    [0193] xvi. Combinations of Beneficial Microorganisms

    [0194] In some embodiments of the present invention, a probiotic composition that is suitable for use in the invention, for example topically or orally, and especially orally, comprises a combination of beneficial microorganisms. Any beneficial microorganisms described herein, in particular in Table 7A can be used in compositions and methods of the present invention. In addition, beneficial microorganisms are described in Example D. Any beneficial microorganisms described herein, in particular in Example D can be used in compositions and methods of the present invention.

    [0195] In some embodiments, a probiotic composition that is suitable for use in the invention, for example topically or orally, and especially orally, comprises, or in some embodiments consists essentially of, a combination of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 microorganisms selected from microorganisms listed in Table 7A.

    [0196] B. Fungal Microbiota

    [0197] Abundant and diverse fungal microbiota in the murine intestine useful for composition and methods of the present invention have been described by Scupham et al. (Appl Environ Microbiol, 2006, 72:793-801), herewith incorporated by reference in its entirety.

    [0198] C. Commensal Microbiota

    [0199] Commensal microbiota altering the abundance and TCR responsiveness of splenic nave CD4.sup.+ T lymphocytes useful for composition and methods of the present invention have been described by Huang et al. (Clin Immunol, 2005, 117:221-230), herewith incorporated by reference in its entirety.

    [0200] D. Antibiotics

    [0201] In some embodiments, a method of the present comprises the step of inhibiting the growth of a detrimental microorganism in a subject by administering to the subject an antibiotic inhibiting the growth of the detrimental microorganism.

    [0202] Antibiotics refer to a group of agents, but are not limited to, aminoglycoside antibiotics, glycopeptide antibiotics, macrolide antibiotics, and combinations thereof. Exemplary antibiotics may be active against gram-negative bacteria, as well as, active against both gram-positive and gram negative bacteria. Non-limiting examples of antibiotics include erythromycin, garamycin, gentamicin, kanamycin, neomycin, netilmicin, paramomycin, tobramycin, vancomycin, and their analogs, and a combination thereof. There are a variety of antibiotics that can be used in a method of the present invention. In some embodiments, an antibiotic or a combination of antibodies is selected from penicillins, cephalosporins, carbapenems, aminoglycosides, sulfonamides, quinolones, macrolides, tetracyclines, lipopeptides and oxazolidinones. Suitable antibiotics can be substituted in cases wherein a subject has a known or suspected hypersensitivity to a class of antibiotics, such as cephalosporins and combinations thereof,

    [0203] In some embodiments, the antibiotic or combination of antibiotics may be specifically selected based on the resistance profile of a subject's bacterial microbiota.

    [0204] In some embodiments, an antibiotic or an antibiotic cocktail (comprising a t least two antibiotics) is selected from amoxicillin, ampicillin, bacampicillin, carbenicillin, cloxacillin, dicloxacillin, flucloxacillin, mezlocillin, nafcillin, oxacillin, penicillin G, penicillin V, Piperacillin, Pivampicillin, Pivmecillinam, Ticarcillin, cefacetrile, cefadroxil, cephalexin, cefaloglycin, cefalonium, cefaloridine, cefalotin, cefamandole, cefapirin, cefatoxin, cefatrizine, cefazaflur, cephalexin, cefazedone, cefazolin, cefepime, cefradine, cefroxadine, ceftezole, cefaclor, cefonicid, cefprozil, cefuroxime, cefuzonam, cefinetazole, cefotetan, cefoxitin, loracarbef, cefbuperazone, cefinetazole, cefminox, cefotetan, cefoxitin, cefcapene, cefdaloxime, cefdinir, cefditoren, cefetamet, cefixime, cefinenoxime, cefodizime, cefotaxime, cefovecin, cefpimizole, cefpodoxime, cefteram, ceftibuten, ceftiofur, ceftiolene, ceftizoxime, ceftriaxone, cefoperazone, ceftazidime, latamoxef, cefclidine, cefepime, cefluprenam, cefoselis, cefozopran, cefpirome, cefquinome, flomoxef, ceftobiprole, ceftaroline, imipenem, meropenem, ertapenem, doripenem, panipenem, betamipron, biapenem, razupenem, amikacin, arbekacin, gentamicin, kanamycin, neomycin, netilmicin, paromomycin, rhodostreptomycin, streptomycin, tobramycin, apramycin, framycetin, ribostamycin, bekanamycin, dibekacin, tobramycin, spectinomycin, hygromycin B, paromomycin sulfate, sisomicin, isepamicin, verdamicin, astromicin, sulfasalazine, sulfamethoxazole, sulfamethizole, sulfisoxazole, fluoroquinolone, ketolide, ceftobiprole, flumequine, nalidixic acid, oxolinic acid, piromidic acid, pipemidic acid, rosoxacin, ciprofloxacin, enoxacin, lomefloxacin, nadifloxacin, norfloxacin, pefloxacin, rufloxacin, balofloxacin, gatifloxacin, grepafloxacin, levofloxacin, moxifloxacin, pazufloxacin, sparfloxacin, temafloxacin, tosufloxacin, clinafloxacin, gemifloxacin, sitafloxacin, trovafloxacin, prulifloxacin, azithromycin, erythromycin, clarithromycin, dirithromycin, roxithromycin, telithromycin, demeclocycline, doxycycline, minocycline, oxytetracycline, tetracycline, linezolid, clindamycin, metronidazole, vancomycin, rifabutin, rifampin, nitrofurantoin, chloramphenicol, and combinations thereof.

    [0205] In some embodiments, a composition comprises an antibiotic having an elimination half-life of less than 20 hours. In some embodiments, a composition comprises an antibiotic having an elimination half-life of about 1 to 12 hours. The following are examples of some antibiotics with half-lives of about 1 to 12 hours from which an antibiotic or a combination of antibiotics can be selected: Cefadroxil, cefazolin, cephalexin, cephalothin, cephapirin, cephacelor, cephprozil, cephadrine, cefamandole, cefonicid, ceforanide, cefuroxime, cefixime, cefoperazone, cefotaxime, cefpodoxime, ceftaxidime, ceftibuten, ceftizoxime, ceftriaxone, cefepime, cefinetazole, cefotetan, cefoxitin, loracarbef, imipenem, erythromycin (and erythromycin salts such as estolate, ethylsuccinate, gluceptate, lactobionate, stearate), azithromycin, clarithromycoin, dirithromycin, troleanomycin, penicillin V, penicillin salts, and complexes, methicillin, nafcillin, oxacillin, cloxacillin, dicloxacillin, amoxicillin, amoxicillin and clavulanate potassium, ampicillin, bacampicillin, carbenicillin indanyl sodium (and other salts of carbenicillin) mezlocillin, piperacillin, piperacillin and taxobactam, ticarcillin, ticarcillin and clavulanate potassium, clindamycin, vancomycin, novobiocin, aminosalicylic acid, capreomycin, cycloserine, ethambutol HCl and other salts, ethionamide, and isoniazid, ciprofloxacin, levofloxacin, lomefloxacin, nalidixic acid, norfloxacin, ofloxacin, sparfloxacin, sulfacytine, sulfamerazine, sulfamethazine, sulfamethixole, sulfasalazine, sulfisoxazole, sulfapyrizine, sulfadiazine, sulfinethoxazole, sulfapyridine, metronidazole, methenamine, fosfomycin, nitrofurantoin, trimethoprim, clofazimine, co-triamoxazole, pentamidine, and trimetrexate.

    [0206] In some embodiments, the antibiotic is selected from an aminoglycoside antibiotic, a glycopeptide antibiotic, a macrolide antibiotic, and a combination thereof. In some embodiments, the antibiotic is selected from erythromycin, gentamicin, tobramycin, vancomycin, and a combination thereof. In some embodiments, the antibiotic is gentamicin.

    [0207] The antibiotic or a combination of at least two antibiotics (sometimes referred to as antibiotic cocktail) can be administered to a subject per se, or in a pharmaceutical composition where they are mixed with suitable carriers or excipients.

    [0208] D. Bacteriophages

    [0209] In some embodiments, a method of the present comprises inhibiting the growth of a detrimental microorganism in a subject by administering to the subject a bacteriophage, preferably a lytic bacteriophage, e.g., a bacteriophage that targets a detrimental microorganism such as a species of the Enterobacter, Helicobacter, Pseudomonas, Escherichia, Klebsiella, Staphylococcus, Proteus, Salmonella, Listeria, Clostridium or Shigella genera, such as Enterobacter cloacae, Helicobacter acinonychis, Helicobacter anseris, Helicobacter aurati, Helicobacter bilis, Helicobacter bizzozeronii, Helicobacter brantae, Helicobacter canadensis, Helicobacter canis, Helicobacter cetorum, Helicobacter cholecystus, Helicobacter cinaedi, Helicobacter cynogastricus, Helicobacter fells, Helicobacter fennelliae, Helicobacter ganmani, Helicobacter hepaticus, Helicobacter mesocricetorum, Helicobacter marmotae, Helicobacter muridarum, Helicobacter mustelae, Helicobacter pametensis, Helicobacter pullorum, Helicobacter pylori, Helicobacter rappini, Helicobacter rodentium, Helicobacter salomonis, Helicobacter trogontum, Helicobacter typhlonius, Helicobacter winghamensis, Escherichia coli, Escherichia coli O157:H7, Salmonella enterica, Salmonella bongori, Salmonella subterranean, Salmonella typhimurium, Listeria fleischmannii, Listeria grayi, Listeria innocua, Listeria ivanovii, Listeria marthii, Listeria monocytogenes, Listeria rocourtiae, Listeria seeligeri, Listeria weihenstephanensis, Listeria welshimeri, Clostridium acetobutylicum, Clostridium argentinense, Clostridium aerotolerans, Clostridium baratii, Clostridium beijerinckii, Clostridium bifermentans, Clostridium botulinum, Clostridium butyricum, Clostridium cadaveris, Clostridium cellulolyticum, Clostridium chauvoei, Clostridium clostridioforme, Clostridium colicanis, Clostridium difficile, Clostridium estertheticum, Clostridium fallax, Clostridium feseri, Clostridium formicaceticum, Clostridium histolyticum, Clostridium innocuum, Clostridium kluyveri, Clostridium ljungdahlii, Clostridium lavalense, Clostridium novyi, Clostridium oedematiens, Clostridium paraputrificum, Clostridium perfringensi, Clostridium phytofermentans, Clostridium piliforme, Clostridium ragsdalei, Clostridium ramosum, Clostridium scatologenes, Clostridium septicum, Clostridium sordellii, Clostridium sporogenes, Clostridium sticklandii, Clostridium tertium, Clostridium tetani, Clostridium thermocellum, Clostridium thermosaccharolyticum, Clostridium tyrobutyricum, Shigella dysenteriae, Shigella jlexneri, Shigella boydii, and Shigella sonnei. Optionally, the bacteriophage targets a detrimental microorganism selected from Enterobacter cloacae, Helicobacter pylori, Helicobacter hepaticus, Salmonella typhimurium, and Shigella dysenteriae, such as Helicobacter pylori. In some embodiments, the bacteriophage targets a microorganism listed in Table 7B. Preferably, the bacteriophage targets Helicobacter pylori, Helicobacter hepaticus, Salmonella typhimurium, Shigella, E. coli O157:H7, Listeria monocytogenes or Clostridium perfringens

    [0210] Bacteriophages refer to viruses capable of invading bacterial cells. Preferably, the bacteriophage destroys the bacteria by causing it to lyse, i.e. break open.

    [0211] In some embodiments, the bacteriophages are used in combination with one or more other bacteriophages. The combinations of bacteriophages can target the same detrimental microorganism or different detrimental microorganisms. Preferably, the combination of bacteriophages targets the same detrimental microorganism.

    [0212] In some embodiments, the bacteriophage or combination of bacteriophages are used in combination with one or more probiotic microorganisms. The probiotic microorganism may be selected from Lactobacillus sp., Clostridium sp., Eubacterium sp., Barnesiella sp., Acetanaerobacterium sp., Porphyromonadaceae sp., Butyrivibrio sp., Butyricimimonas sp., Lachnospiraceae sp., Porpyromonas sp., Prevotella sp., Rumen bacterium sp., Filifactor sp., Cyanobacterium sp., and Alistipes sp. The probiotic microorganism may be at least one of the probiotic microorganisms listed in Table 6 or at least one of the probiotic microorganisms listed in Table 7A. In some embodiments, probiotic microorganism is a Lactobacillus sp. A preferred Lactobacillus sp is Lactobacillus johnsonii. A preferred Lactobacillus johnsonii is Lactobacillus johnsonii 456.

    [0213] The bacteriophage or combination of bacteriophages may used in combination with one or more antibiotics. In some embodiments, an antibiotic or a combination of antibodies is selected from penicillins, cephalosporins, carbapenems, aminoglycosides, sulfonamides, quinolones, macrolides, tetracyclines, lipopeptides and oxazolidinones.

    III. Formulation, Dosage and Administration

    [0214] A. Formulation and Dosage

    [0215] A microorganism of the invention may be formulated in a composition in a proportion of at least 0.0001% expressed as dry weight, in particular in a proportion from 0.0001% to 30%, in particular in a proportion from 0.001% to 20% and more particularly in a proportion from 0.01% to 15% by weight, in particular from 0.1% to 10% by weight and especially from 1% to 5% by weight relative to the total weight of the composition containing it.

    [0216] In general, a composition according to the invention intended to be administered orally may comprise for the live microorganisms from 10.sup.3 to 10.sup.15 colony forming units (cfu)/g, in particular from 10.sup.5 to 10.sup.15 cfu/g and more particularly from 10.sup.7 to 10.sup.12 cfu/g (colony forming units per gram) of live microorganisms per gram of composition, or equivalent doses calculated for inactivated or dead microorganisms or for microorganism fractions or for produced metabolites. In some embodiments, the composition according to the invention intended to be administered orally may comprise bacteriophages from 10.sup.5 to 10.sup.10 plaque-forming units (PFU)/g, preferably 10.sup.7 to 10.sup.8 PFU/g.

    [0217] In particular, in a composition administered orally, the corresponding microorganism and/or fraction and/or metabolite concentration may be adjusted so as to correspond to doses, expressed as microorganism equivalent, ranging from 10.sup.5 to 10.sup.13 cfu/day and in particular from 10.sup.8 to 10.sup.11 cfu/day. In some embodiments, the bacteriophages are administered at a dose of 10.sup.5 to 10.sup.10 PFU/day, preferably 10.sup.7 to 10.sup.8 PFU/day.

    [0218] A use of a microorganism according to the invention necessarily takes place in an effective amount, i.e. an amount that allows the probiotic microorganism to display its active properties with regard to the conditions that are to be prevented and/or treated.

    [0219] A microorganism may also be included in a composition in the form of fractions of cell components or in the form of metabolites, in particular in the form of a lysate. The microorganism(s), metabolite(s) or fraction(s) may also be introduced in the form of a lyophilized powder, a culture supernatant and/or, where appropriate, in a concentrated form.

    [0220] When a composition comprises metabolites, the contents of metabolites in the compositions correspond substantially to the contents that may be produced by 10.sup.3 to 10.sup.15 cfu, in particular 10.sup.5 to 10.sup.15 cfu and more particularly 10.sup.7 to 10.sup.12 cfu of live microorganisms per gram of composition.

    [0221] A microorganism of the invention may be formulated in a composition with one or more fungal microbiota, one or more commensal microbiota, one or more antibiotics, one or more bacteriophages or a combination thereof. Preferably, the microorganism of the invention is formulated in a composition with one or more antibiotics, one or more bacteriophages, or a combination thereof. Optionally, the composition comprises 10.sup.5 to 10.sup.10 PFU of the one or more bacteriophages, preferably 10.sup.7 to 10.sup.8 PFU.

    [0222] A composition according to the invention may comprise a physiologically or pharmaceutically acceptable medium or carrier.

    [0223] A probiotic microorganism of the invention may be formulated with an excipient and component that is common for such oral compositions or food supplements, e.g., especially fatty and/or aqueous components, humectants, thickeners, preserving agents, texturizers, flavor enhancers and/or coating agents, antioxidants and preserving agents. Formulating agents and excipients for oral compositions, and especially for food supplements, are known in this field and will not be the subject of a detailed description herein.

    [0224] In the case of a composition in accordance with the invention for oral administration, the use of an ingestible support is preferred. The ingestible support may be of diverse nature according to the type of composition under consideration. Tablets, gel capsules or lozenges, suspensions, oral supplements in dry form and oral supplements in liquid form are especially suitable for use as food supports.

    [0225] Milk, yoghurt, cheese, fermented milks, milk-based fermented products, ice creams, cereal-based products or fermented cereal-based products, milk-based powders, baby and infant formulas, food products of confectionery type, chocolate, cereals or animal feed, in particular for pets, are also suitable for use as food supports.

    [0226] Formulation of the oral compositions according to the invention may be performed via any usual process known to those skilled in the art for producing drinkable solutions, sugar-coated tablets, gel capsules, gels, emulsions, tablets to be swallowed or chewed, wafer capsules, especially soft or hard wafer capsules, granules to be dissolved, syrups, solid or liquid foods, and hydrogels allowing controlled release.

    [0227] In particular, a probiotic microorganism according to the invention may be incorporated into any form of food supplement or enriched food, for example food bars, or compacted or loose powders. The powders may be diluted with water, with soda, with dairy products or soybean derivatives, or may be incorporated into food bars.

    [0228] In some embodiments, a composition according to the invention administered orally may be formulated in the form of sugar-coated tablets, gel capsules, gels, emulsions, tablets, wafer capsules, hydrogels, food bars, compacted or loose powders, liquid suspensions or solutions, confectioneries, fermented milks, fermented cheeses, chewing gum, toothpaste or spray solutions.

    [0229] In particular, a composition according to the invention may be a food composition for human consumption. It may in particular be a case of nutritional whole foods, drinks, mineral waters, soups, dietary supplements and replacement foods, nutritional bars, confectioneries, fermented or unfermented milk-based products, yoghurt products, milk-based powders, enteral nutritional products, baby and/or infant compositions, fermented or unfermented cereal-based products, ice creams, chocolate, coffee, or culinary products such as mayonnaise, tomato puree or salad dressings.

    [0230] The composition according to the invention may also be intended for animals, especially pets, such as cats and dogs, and may be formulated in the form of feed or food supplements for animals.

    [0231] An oral composition of the invention may also comprise other nutritional active agents chosen from (i) anti-aging nutritional active agents, such as food antioxidants, nutrients with radical-scavenging properties and cofactors of antioxidant endogenous enzymes, vitamins A, C and E, carotenoids, xanthophylls, isoflavones, certain minerals such as zinc, copper, magnesium or selenium, lipoic acid, coenzyme Q10, superoxide dismutase (SOD) or taurine, unsaponifiable fractions extracted from fats of plant origin, Aloe vera, native or hydrolyzed marine collagen, and plant or marine oils rich in omega-3 and omega-6 fatty acids (including gamma.-linolenic acid), (ii) photoprotective nutritional active agents such as antioxidants and free-radical scavengers: vitamins A, C and E, carotenoids, xanthophylls, certain minerals such as zinc, copper, magnesium or selenium, coenzyme Q10 and superoxide dismutase (SOD), (iii) nutritional ingredients with moisturizing or immunomodulatory properties such as the extract of Polypodium leucotomos, plant or marine oils rich in omega-3 or omega-6 fatty acids, including gamma-linolenic acid.

    [0232] B. Administration

    [0233] In some embodiments of the present invention, a probiotic microorganism that is suitable for use in the invention may be administered orally, topically or parenterally, and in particular orally. A microorganism of the invention may be administered in a composition with one or more fungal microbiota, one or more commensal microbiota, one or more antibiotics, one or more bacteriophages or a combination thereof. Preferably, the microorganism of the invention is administered in a composition with one or more antibiotics, one or more bacteriophages, or a combination thereof.

    [0234] In some embodiments of the present invention, a probiotic microorganism is used orally, parenterally or topically.

    [0235] An effective amount of microorganism may be administered in a single dose per day or in fractional doses over the day, for example two to three times a day. By way of example, the oral administration of a probiotic microorganism according to the invention may be performed at a rate, for example, of 3 times a day or more, generally over a prolonged period of at least 4 weeks, or even 4 to 15 weeks, optionally comprising one or more periods of stoppage or being repeated after a period of stoppage.

    [0236] As one of skill in the art will appreciate, compositions of the present invention, not having adverse effects upon administration to a subject, may be administered daily to the subject.

    III. Methods

    [0237] A. Overview

    [0238] The invention described herein can be used to improve prognosis of a disease, such as a disease related to genome instability, such as ataxia telangiectasia, p53 deficiency, or exposure to radiation. For example, the invention can be used to improve the prognosis of ataxia telangiectasia (AT), by prolonging life expectancy as well as cancer onset and is applicable to a variety of cancer-prone diseases as well as delaying cancer in the general population. Ataxia telangiectasia is a debilitating genetic disease characterized by neurological and cardiovascular disorders, immune deficiency, early-onset of carcinogenesis, as well as a shortened lifespan. So far a cure for AT does not exist: symptoms can be treated, however care is mainly supportive. Preventive care is virtually non-existent, although high vitamin doses are sometimes used. Applicants propose that a specific cocktail of pre-biotics, pro-biotics and/or anti-biotics can be used as a prophylactic to delay carcinogenesis and mortality. The mechanistic interaction between intestinal microbiota and cancer is difficult to understand, however, there is substantial cross-talk between microbiota and the immune system which can lead to inflammation and cytotoxicity. The immune response can both promote and mitigate carcinogenesis. In a similar manner, it is believed that promoting the growth of beneficial bacteria and preventing the growth of detrimental bacteria will improve prognosis of other diseases involving premature carcinogenesis as well as the health of the general population.

    [0239] Methods altering the intestinal microbiota of patients suffering from genomic instability, such as AT patients, using specific combinations of pre-biotics, pro-biotics, bacteriophages and/or anti-biotics to establish a defined intestinal microbiota can increase their lifespan in a simple, non-invasive manner. In addition, the processes altered by the intestinal microbiota, namely inflammation and oxidative stress are responsible for all major killers, such as almost all cancers, heart disease, neurodegenerative diseases and ageing itself. Without being bound by theory, it is believed that effects of intestinal microbiota are exacerbated in Atm-deficient mice since they are cancer-prone and that changes in the intestinal microbiota may add 20 to 30% in the life expectancy in wildtype mice or humans.

    [0240] The inventors have observed, surprisingly, that the administration of a food supplement comprising a probiotic microorganism, especially of the genus Lactobacillus sp., in particular Lactobacillus johnsonii and more particularly Lactobacillus johnsonii 456, can substantially affect genetic instability, DNA damage, genotoxicity, immunological markers, longevity and lymphoma latency in an ATM deficient host.

    [0241] The use of probiotic microorganisms according to the invention advantageously makes it possible to modulate genetic instability, DNA damage, genotoxicity, immunological markers, longevity and lymphoma latency in a subject, such as an ATM deficient host.

    [0242] As will be appreciated further herein, compositions of the present invention can be used advantageously in methods of treating and preventing symptoms arising in a subject having AT.

    [0243] As will be appreciated further herein, compositions of the present invention can be used advantageously in methods of treating and preventing symptoms arising in a subject having a p53-deficiency-associated cancer.

    [0244] As will be appreciated further herein, compositions of the present invention can be used advantageously in methods of treating and preventing symptoms arising in a subject having radiation-induced toxicity to normal tissue during or caused by radiation treatment.

    [0245] B. Method for Treating, Preventing, or Delaying the Onset of an Ataxia-Telangiectasia (AT)-Associated Condition in a Subject Having AT

    [0246] The present invention provides a method for treating, preventing, or delaying the onset of an ataxia-telangiectasia (AT)-associated condition in a subject having AT. In some embodiments, this method comprises administering to a subject having AT and diagnosed with an AT-associated condition a therapeutically effective amount of a composition comprising a probiotic microorganism. Thereby the AT-associated condition in the subject is treated, prevented or delayed. In some embodiments, this method comprises administering to a subject having AT and at risk of developing an AT-associated condition a therapeutically effective amount of a composition comprising a probiotic microorganism. Thereby the AT-associated condition in the subject is treated, prevented or delayed.

    [0247] In some embodiments, this method comprises sustaining a beneficial level of a probiotic microorganism in a subject having AT and diagnosed with an AT-associated condition by administering to the subject a therapeutically effective amount of a composition comprising a probiotic microorganism. Thereby the AT-associated condition in the subject is treated, prevented or delayed. In some embodiments, this method comprises sustaining a beneficial level of a probiotic microorganism in a subject having AT and at risk of developing an AT-associated condition by administering to the subject a therapeutically effective amount of a composition comprising a probiotic microorganism. Thereby the AT-associated condition in the subject is treated, prevented or delayed.

    [0248] In some embodiments, this method comprises restoring the presence of a beneficial level of a probiotic microorganism in a subject having AT and diagnosed with an AT-associated condition by administering to the subject a therapeutically effective amount of a composition comprising a probiotic microorganism. Thereby the AT-associated condition in the subject is treated, prevented or delayed. In some embodiments, this method comprises restoring the presence of a beneficial level of a probiotic microorganism in a subject having AT and at risk of developing an AT-associated condition by administering to the subject a therapeutically effective amount of a composition comprising a probiotic microorganism. Thereby the AT-associated condition in the subject is treated, prevented or delayed.

    [0249] In some embodiments, this method comprises inhibiting the growth of detrimental microorganisms in a subject having AT and diagnosed with an AT-associated condition by administering to the subject a cocktail comprising a therapeutically effective amount of antibiotics. Thereby the AT-associated condition in the subject is treated, prevented or delayed. In some embodiments, this method comprises inhibiting the growth of detrimental microorganisms in a subject having AT and at risk of developing an AT-associated condition by administering to the subject a cocktail comprising a therapeutically effective amount of antibiotics. Thereby the AT-associated condition in the subject is treated, prevented or delayed.

    [0250] In some embodiments, this method comprises inhibiting the growth of a detrimental microorganism in a subject having AT and diagnosed with an AT-associated condition by administering to the subject a therapeutically effective amount of an antibiotic inhibiting the growth of the detrimental microorganism. Thereby the AT-associated condition in the subject is treated, prevented or delayed. In some embodiments, this method comprises inhibiting the growth of a detrimental microorganism in a subject having AT and at risk of developing an AT-associated condition by administering to the subject a therapeutically effective amount of an antibiotic inhibiting the growth of the detrimental microorganism. Thereby the AT-associated condition in the subject is treated, prevented or delayed.

    [0251] In some embodiments, this method comprises inhibiting the growth of detrimental microorganisms in a subject having AT and diagnosed with an AT-associated condition by administering to the subject a therapeutically effective amount of one or more bacteriophages, as described herein. Thereby the AT-associated condition in the subject is treated, prevented or delayed. In some embodiments, this method comprises inhibiting the growth of detrimental microorganisms in a subject having AT and at risk of developing an AT-associated condition by administering to the subject a therapeutically effective amount of one or more bacteriophages, as described herein. Thereby the AT-associated condition or any other condition in the subject is treated, prevented or delayed.

    [0252] In some embodiments, the AT-associated condition is selected from the group consisting of a cancerous condition, a neurological degeneration, an immunodeficiency, an inflammatory condition, an inflammation-induced genotoxicity, a radiation sensitivity, an abundance of hepatic and/or migratory cells, and a genetic instability.

    [0253] In some embodiments, the AT-associated condition comprises neurological degeneration. In some embodiments, the neurological degeneration is a condition selected from inability or difficulty of a subject to walk, inability or difficulty of a subject to move, inability or difficulty of a subject to swallow. A subject unable or having difficulty to walk or a subject unable or having difficulty to move may be a subject who is wheelchair bound.

    [0254] In some embodiments, the AT-associated condition is radiation sensitivity.

    [0255] In some embodiments, the AT-associated condition is a genetic instability.

    [0256] While many genetic instabilities can be treated, mitigated or prevented using methods and compositions of the present invention, in some embodiments, the genetic instability is selected from Nijmegen Breakage Syndrome, Fanconi's anemia, Werner Syndrome, Blooms Syndrome, and Li Fraumeni Disease.

    [0257] In some embodiments, the genetic instability is Nijmegen Breakage Syndrome.

    [0258] In some embodiments, the genetic instability is Fanconi's anemia.

    [0259] In some embodiments, the genetic instability is Werner Syndrome.

    [0260] In some embodiments, the genetic instability is Blooms Syndrome.

    [0261] In some embodiments, the genetic instability is Li Fraumeni Disease.

    [0262] C. Method for Treating, Preventing, or Delaying the Onset of a Cancerous Condition in a Subject Having AT

    [0263] In some embodiments, the AT-associated condition is a cancerous condition. Methods of the present invention can be practiced in vitro and in vivo. In one aspect of the present invention, a method for treating or preventing a cancerous condition in a subject suffering from a cancerous condition is provided. This method comprises administering to a subject having been diagnosed with a cancer or at risk of developing a cancer a therapeutically effective amount of a composition of the present invention, wherein the cancerous condition is characterized by unwanted growth or proliferation of a cell expressing one or more cell surface marker, and wherein administering results in the treatment of the subject or in preventing the cancerous condition from occurring in the subject or in delaying the onset of the cancerous condition.

    [0264] In some embodiments, this method comprises the step of selecting a subject having AT and diagnosed with a cancerous condition. In some embodiments, this method comprises selecting a subject having AT and at risk of developing a cancerous condition.

    [0265] In some embodiments of the present invention, a composition of the present invention is used to treat a subject suffering from a hematologic cancer expressing one or more cell surface marker. Hematologic cancers include, but are not limited to cancer of blood (myeloid leukemia (acute and chronic), acute lymphoblastic leukemia, chronic lymphocytic leukemia, myeloproliferative diseases, multiple myeloma, myelodysplastic syndrome), Hodgkin's disease, and non-Hodgkin's lymphoma (malignant lymphoma).

    [0266] A hematologic cancer includes any malignancy associated with cells in the bloodstream. Examples thereof include B and T cell lymphomas, leukemias including but not limited to low grade/follicular non-Hodgkin's lymphoma (NHL), small lymphocytic (SL) NHL, intermediate grade/follicular NHL, intermediate grade diffuse NHL, high grade immunoblastic NHL, high grade lymphoblastic NHL, high grade small non-cleaved cell NHL, bulky disease NHL and Waldenstrom's Macroglobulinemia, chronic leukocytic leukemia, acute myelogenous leukemia, acute lymphoblastic leukemia, chronic lymphocytic leukemia, chronic myelogenous leukemia, lymphoblastic leukemia, lymphocytic leukemia, monocytic leukemia, myelogenous leukemia, and promyelocytic leukemia. It should be clear to those of skill in the art that these lymphomas will often have different names due to changing systems of classification, and that patients having lymphomas and leukemias classified under different names may also benefit from the therapeutic regimens of the present invention.

    [0267] In some embodiments, the cancerous condition is a hematologic cancer.

    [0268] In some embodiments, the cancerous condition is a lymphoid malignancy.

    [0269] In some embodiments, the cancerous condition is a neoplasia.

    [0270] In some embodiments, the cancerous condition is non-Hodgkin's B cell lymphoma.

    [0271] In some embodiments, the cancerous condition is acute lymphocytic leukemia.

    [0272] In some embodiments, the cancerous condition is a Hodgkin's lymphoma.

    [0273] D. Method for Treating, Preventing, or Delaying the Onset of an Inflammatory Condition in a Subject Having AT

    [0274] In some embodiments, the AT-associated condition is an inflammatory condition.

    [0275] In some embodiments, this method comprises selecting a subject having AT and diagnosed with an inflammatory condition. In some embodiments, this method comprises selecting a subject having AT and at risk of developing an inflammatory condition.

    [0276] In some embodiments, the inflammatory condition is selected from a substantially increased expression level of transforming growth factor type beta, a substantially increased expression level of interleukin (IL)-10, a substantially increased expression level of IL-4, a substantially decreased expression level of myeloid differentiation primary response 88, a substantially decreased expression level of IL-12, a substantially decreased expression level IL-1, and a substantially decreased expression level of interferon gamma, wherein the substantially increased and substantially decreased expression levels are in comparison to the respective expression levels in a subject not having AT.

    [0277] In some embodiments, the inflammatory condition is a substantially increased expression level of TGF- (Transforming Growth Factor Type Beta) nucleic acid and/or TGF- polypeptide) in the subject having AT when compared to a subject not having AT.

    [0278] In some embodiments, the inflammatory condition is a substantially increased expression level of IL-10 (Interleukin-10) nucleic acid and/or IL-10 polypeptide in the subject having AT when compared to a subject not having AT.

    [0279] In some embodiments, the inflammatory condition is a substantially increased expression level of IL-4 (Interleukin-4) nucleic acid and/or IL-4 polypeptide in the subject having AT when compared to a subject not having AT.

    [0280] In some embodiments, the inflammatory condition is a substantially decreased expression level of MyD-88 (Myeloid Differentiation Primary Response Gene/Polypeptide (88)) nucleic acid and/or MyD-88 polypeptide in the subject having AT when compared to a subject not having AT.

    [0281] In some embodiments, the inflammatory condition is a substantially decreased expression level of IL-12 (Interleukin 12) nucleic acid and/or IL-12 polypeptide in the subject having AT when compared to a subject not having AT.

    [0282] In some embodiments, the inflammatory condition is a substantially decreased expression level of IL-1 (Interleukin-1 Beta) nucleic acid and/or IL-1 polypeptide in the subject having AT when compared to a subject not having AT.

    [0283] In some embodiments, the inflammatory condition is a substantially decreased expression level of IFN- (Interferon Gamma) nucleic acid and/or IFN- polypeptide in the subject having AT when compared to a subject not having AT.

    [0284] E. Method for Treating, Preventing, or Delaying the Onset of Inflammation-Induced Genotoxicity in a Subject Having AT

    [0285] In some embodiments, the AT-associated condition is inflammation-induced genotoxicity.

    [0286] In some embodiments, this method comprises the step of selecting a subject having AT and being diagnosed with inflammation-induced genotoxicity. In some embodiments, this method comprises the step of selecting a subject having AT and being at risk of developing inflammation-induced genotoxicity.

    [0287] In some embodiments, the inflammation-induced genotoxicity is accompanied by a substantially increased expression level of TGF- nucleic acid and/or TGF- polypeptide in the subject having AT when compared to a subject not having AT.

    [0288] In some embodiments, the inflammation-induced genotoxicity is accompanied by a substantially increased expression level of IL-10 nucleic acid and/or IL-10 polypeptide in the subject having AT when compared to a subject not having AT.

    [0289] In some embodiments, the inflammation-induced genotoxicity is accompanied by a substantially increased expression level of IL-4 nucleic acid and/or IL-4 polypeptide in the subject having AT when compared to a subject not having AT.

    [0290] In some embodiments, the inflammation-induced genotoxicity is accompanied by a substantially decreased expression level of MyD-88 nucleic acid and/or MyD-88 polypeptide in the subject having AT when compared to a subject not having AT.

    [0291] In some embodiments, the inflammation-induced genotoxicity is accompanied by a substantially decreased expression level of IL-12 nucleic acid and/or IL-12 polypeptide in the subject having AT when compared to a subject not having AT.

    [0292] In some embodiments, the inflammation-induced genotoxicity is accompanied by a substantially decreased expression level of IL-1 nucleic acid and/or IL-1 polypeptide in the subject having AT when compared to a subject not having AT.

    [0293] In some embodiments, the inflammation-induced genotoxicity is accompanied by a substantially decreased expression level of IFN- nucleic acid and/or IFN- polypeptide in the subject having AT when compared to a subject not having AT.

    [0294] In some embodiments, the inflammation-induced genotoxicity comprises DNA damage, in particular DNA instability and DNA breakage. DNA breakage can include double-strand DNA breakage and single-strand DNA breakage. In some embodiments of the present invention chromosomal breakage is substantially reduced upon administration to a subject of a composition of the present invention, in particular a composition comprising Lactobacillus johnsonii.

    [0295] In some embodiments, the inflammation-induced genotoxicity comprises deletion of DNA.

    [0296] F. Method for Reducing the Abundance of Hepatic and/or Migratory Cells in a Subject Having AT

    [0297] In some embodiments, the AT-associated condition is abundance of hepatic and/or migratory cells in a subject.

    [0298] In some embodiments, this method comprises selecting a subject having AT and diagnosed with a substantial increase of hepatic and/or migratory cells. In some embodiments, this method comprises selecting a subject having AT and at risk of developing a substantial increase of hepatic and/or migratory cells.

    [0299] G. Method for Treating, Preventing, or Delaying the Onset of a Cancer in a Subject Having a p53 Deficiency or Having a p53 Deficiency-Associated Cancer

    [0300] The present invention provides a method for treating, preventing, or delaying the onset of cancer in a subject having a p53 deficiency. In some embodiments, this method comprises administering to a subject having a p53 deficiency and diagnosed with a p53 deficiency a therapeutically effective amount of a composition comprising a probiotic microorganism. Thereby the p53 deficiency-associated cancer in the subject is treated, prevented or delayed. In some embodiments, this method comprises administering to a subject having a p53 deficiency and at risk of developing a p53-deficiency-associated cancer a therapeutically effective amount of a composition comprising a probiotic microorganism. Thereby the p53-deficiency-associated cancer in the subject is treated, prevented or delayed.

    [0301] In some embodiments, this method comprises selecting a subject having a p53 deficiency and diagnosed with a p53 deficiency-associated cancer. In some embodiments, this method comprises selecting a subject having a p53 deficiency and being at risk of developing a p53 deficiency-associated cancer.

    [0302] In some embodiments, selecting a subject having or suspected of having a p53 deficiency comprises obtaining a biological sample from that subject and determining in the biological sample obtained from the subject if the subject has a p53 deficiency. Determining a p53 deficiency in a biological sample can be done in a variety of ways. Non-limiting examples, e.g., include, determining a p53 nucleic acid expression level, determining a nucleotide sequence for a gene encoding a p53 polypeptide, determining the level of a p53 polypeptide expression, or determining the amino acid sequence of a p53 polypeptide. Methods for such determination are known in the art and include, but are not limited to, e.g., Northern blot analysis, Southern blot analysis, PCR analysis, RNA sequencing, DNA sequencing, amino acid sequencing, mass spectrometry, etc. A p53 deficiency will be evidenced by (i) a lower than normal expression level of a p53 nucleic acid, (ii), a lower than normal expression level of a p53 polypeptide, (iii), a mutation in a gene encoding a p53 polypeptide that is not present in a wildtype or normal gene encoding a wildtype or normal p53 polypeptide, (iv) a mutation in a gene transcript encoding a p53 polypeptide that is not present in a wildtype or normal gene transcript encoding a wildtype or normal p53 polypeptide, (v) a mutation in an amino acid sequence of a p53 polypeptide that is not present in an amino acid sequence of a wildtype or normal p53 polypeptide. One of skill in the art will appreciate that along with the biological samples being analyzed for a p53 deficiency, appropriate control sample(s) will be analyzed under same conditions and that the results obtained analyzing the biological sample(s) will be compared to the results obtained by analyzing appropriate control sample(s). Thus, a substantially reduced expression of a p53 nucleic acid or a p53 polypeptide and/or a substantially increased expression of a mutated p53 nucleic acid or p53 polypeptide can be determined in a sample obtained from a subject.

    [0303] In some embodiments, this method comprises sustaining a beneficial level of a probiotic microorganism in a subject having a p53 deficiency and diagnosed with a p53 deficiency-associated cancer by administering to the subject a therapeutically effective amount of a composition comprising a probiotic microorganism. Thereby the p53 deficiency-associated cancer in the subject is treated, prevented or delayed. In some embodiments, this method comprises sustaining a beneficial level of a probiotic microorganism in a subject having a p53 deficiency and at risk of developing p53 deficiency-associated cancer by administering to the subject a therapeutically effective amount of a composition comprising a probiotic microorganism. Thereby the p53 deficiency-associated cancer in the subject is treated, prevented or delayed.

    [0304] In some embodiments, this method comprises restoring the presence of a beneficial level of a probiotic microorganism in a subject having a p53 deficiency and diagnosed with p53 deficiency-associated cancer by administering to the subject a therapeutically effective amount of a composition comprising a probiotic microorganism. Thereby the p53 deficiency-associated cancer in the subject is treated, prevented or delayed. In some embodiments, this method comprises restoring the presence of a beneficial level of a probiotic microorganism in a subject having a p53 deficiency and at risk of developing p53 deficiency-associated cancer by administering to the subject a therapeutically effective amount of a composition comprising a probiotic microorganism. Thereby the p53 deficiency-associated cancer in the subject is treated, prevented or delayed.

    [0305] In some embodiments, this method comprises inhibiting the growth of detrimental microorganisms in a subject having a p53 deficiency and diagnosed with p53 deficiency-associated cancer by administering to the subject a therapeutically effective amount of a composition comprising two or more antibiotics. Thereby the p53 deficiency-associated cancer in the subject is treated, prevented or delayed. In some embodiments, this method comprises inhibiting the growth of detrimental microorganisms in a subject having a p53 deficiency and at risk of developing a p53 deficiency-associated cancer by administering to the subject a therapeutically effective amount of a composition comprising two or more antibiotics. Thereby the p53 deficiency-associated cancer in the subject is treated, prevented or delayed.

    [0306] In some embodiments, this method comprises inhibiting the growth of a detrimental microorganism in a subject having a p53 deficiency and diagnosed with a p53 deficiency-associated cancer by administering to the subject a therapeutically effective amount of an antibiotic inhibiting the growth of the detrimental microorganism. Thereby the p53 deficiency-associated cancer in the subject is treated, prevented or delayed. In some embodiments, this method comprises inhibiting the growth of a detrimental microorganism in a subject having a p53 deficiency and at risk of developing a p53 deficiency-associated cancer by administering to the subject a therapeutically effective amount of an antibiotic inhibiting the growth of the detrimental microorganism. Thereby the p53 deficiency-associated cancer in the subject is treated, prevented or delayed.

    [0307] In some embodiments, this method comprises inhibiting the growth of detrimental microorganisms in a subject having a p53 deficiency and diagnosed with p53 deficiency-associated cancer by administering to the subject a therapeutically effective amount of one or more bacteriophages, as described herein. Thereby the p53 deficiency-associated cancer in the subject is treated, prevented or delayed. In some embodiments, this method comprises inhibiting the growth of detrimental microorganisms in a subject having a p53 deficiency and at risk of developing a p53 deficiency-associated cancer by administering to the subject a therapeutically effective amount of one or more bacteriophages, as described herein. Thereby the p53 deficiency-associated cancer in the subject is treated, prevented or delayed.

    [0308] Compositions of the present invention can be used to treat any cancer having a p53 deficiency as described herein and referred to as a p53 deficiency-associated cancer. In some embodiments of the present invention, a p53 deficiency-associated cancer is selected from a lung cancer, a sarcoma, a gastrointestinal cancer, a cancer of the genitourinary tract, a liver cancer, a skin cancer, a gynecological cancer, a bone cancer, a cancer of the nervous system, a hematologic cancer, a cancer of the adrenal glands, and a cancer associated with Li Fraumeni Disease.

    [0309] In some embodiment of the present invention, a composition of the present invention is used to treat a subject suffering from a lung cancer having a p53 deficiency. A p53 deficiency-associated lung cancer includes, but is not limited to, bronchogenic carcinoma (squamous cell, undifferentiated small cell, undifferentiated large cell, adenocarcinoma), alveolar (bronchiolar) carcinoma, bronchial adenoma, sarcoma, lymphoma, chondromatous hamartoma, mesothelioma, SCLC, and NSCLC.

    [0310] In some embodiments of the present invention, a composition of the present invention is used to treat a subject suffering from a sarcoma having a p53 deficiency. A p53 deficiency-associated sarcoma includes, but is not limited to, cancers such as angiosarcoma, fibrosarcoma, rhabdomyosarcoma, liposarcoma, myxoma, rhabdomyoma, fibroma, lipoma and teratoma.

    [0311] In some embodiments of the present invention, a composition of the present invention is used to treat a subject suffering from a gastrointestinal cancer having a p53 deficiency. A p53 deficiency-associated gastrointestinal cancer includes, but is not limited to cancers of esophagus (squamous cell carcinoma, adenocarcinoma, leiomyosarcoma, lymphoma), stomach (carcinoma, lymphoma, leiomyosarcoma), pancreas (ductal adenocarcinoma, insulinoma, glucagonoma, gastrinoma, carcinoid tumors, VIPoma), small bowel (adenocarcinoma, lymphoma, carcinoid tumors, Kaposi's sarcoma, leiomyoma, hemangioma, lipoma, neurofibroma, fibroma), and large bowel (adenocarcinoma, tubular adenoma, villous adenoma, hamartoma, leiomyoma).

    [0312] In some embodiments of the present invention, a composition of the present invention is used to treat a subject suffering from a cancer of the genitourinary tract having a p53 deficiency. A p53 deficiency-associated cancer of the genitourinary tract includes, but is not limited to cancers of kidney (adenocarcinoma, Wilms tumor (nephroblastoma), lymphoma, leukemia, renal cell carcinoma), bladder and urethra (squamous cell carcinoma, transitional cell carcinoma, adenocarcinoma), prostate (adenocarcinoma, sarcoma), and testis (seminoma, teratoma, embryonal carcinoma, teratocarcinoma, choriocarcinoma, sarcoma, Leydig cell tumor, fibroma, fibroadenoma, adenomatoid tumors, lipoma).

    [0313] In some embodiments of the present invention, a composition of the present invention is used to treat a subject suffering from a liver cancer having a p53 deficiency. A p53 deficiency-associated liver cancer includes, but is not limited to, hepatocellular carcinoma, cholangiocarcinoma, hepatoblastoma, angiosarcoma, hepatocellular adenoma, and hemangioma.

    [0314] In some embodiments of the present invention, a composition of the present invention is used to treat a subject suffering from a skin cancer having a p53 deficiency. A p53 deficiency-associated skin cancer includes, but is not limited to, malignant melanoma, basal cell carcinoma, squamous cell carcinoma, Kaposi's sarcoma, nevi, dysplastic nevi, lipoma, angioma, dermatofibroma, keloids, and psoriasis.

    [0315] In some embodiments of the present invention, a composition of the present invention is used to treat a subject suffering from a gynecological cancer having a p53 deficiency. A p53 deficiency-associated gynecological cancer includes, but is not limited to, cancer of uterus (endometrial carcinoma), cervix (cervical carcinoma, pre-invasive cervical dysplasia), ovaries (ovarian carcinoma (serous cystadenocarcinoma, mucinous cystadenocarcinoma, endometrioid carcinoma, clear cell adenocarcinoma, unclassified carcinoma), granulosa-theca cell tumors, Sertoli-Leydig cell tumors, dysgerminoma, malignant teratoma and other germ cell tumors), vulva (squamous cell carcinoma, intraepithelial carcinoma, adenocarcinoma, fibrosarcoma, melanoma), vagina (clear cell carcinoma, squamous cell carcinoma, sarcoma botryoides (embryonal rhabdomyosarcoma), and fallopian tubes (carcinoma).

    [0316] In some embodiments of the present invention, a composition of the present invention is used to treat a subject suffering from a bone cancer having a p53 deficiency. p53 deficiency-associated bone cancer includes, but is not limited to, osteogenic sarcoma (osteosarcoma), fibrosarcoma, malignant fibrous histiocytoma, chondrosarcoma, Ewing's sarcoma, malignant lymphoma (reticulum cell sarcoma), multiple myeloma, malignant giant cell tumor, chordoma, osteochondroma (osteocartilaginous exostoses), benign chondroma, chondroblastoma, chondromyxoid fibroma, osteoid osteoma, and giant cell tumors.

    [0317] In some embodiments of the present invention, a composition of the present invention is used to treat a subject suffering from a cancer of the nervous system having a p53 deficiency. A p53 deficiency-associated cancer of the nervous system includes, but is not limited to cancers of skull (osteoma, hemangioma, granuloma, xanthoma, Paget's disease of bone), meninges (meningioma, meningiosarcoma, gliomatosis), brain (astrocytoma, medulloblastoma, glioma, ependymoma, germinoma (pinealoma), glioblastoma multiforme, oligodendroglioma, schwannoma, retinoblastoma, congenital tumors), and spinal cord (neurofibroma, meningioma, glioma, sarcoma.

    [0318] In some embodiments of the present invention, a composition of the present invention is used to treat a subject suffering from a hematologic cancer having a p53 deficiency. A p53 deficiency-associated hematologic cancer includes, but is not limited to cancer of blood (myeloid leukemia (acute and chronic), acute lymphoblastic leukemia, chronic lymphocytic leukemia, myeloproliferative diseases, multiple myeloma, myelodysplastic syndrome), Hodgkin's disease, and non-Hodgkin's lymphoma (malignant lymphoma).

    [0319] In some embodiments of the present invention, a composition of the present invention is used to treat a subject suffering from a cancer of adrenal glands having a p53 deficiency. A p53 deficiency-associated cancer of adrenal glands includes, but is not limited to, neuroblastoma.

    [0320] Li Fraumeni Disease is a heterozygous p53 deficiency in humans who, when afflicted, in almost 100%, develop cancer. p53 homozygosity in humans, however, has not been described, as it is possibly lethal. Applicants have shown the beneficial effects of administering a composition of the present invention to homozygous p53 deficient mice. Thus, in some embodiments of the present invention, a p53 deficiency associated cancer is Li Fraumeni Disease.

    [0321] H. Method for Treating, Mitigating, and Preventing Damage to Normal Tissue in a Subject being Exposed to Radiation

    [0322] When a subject is exposed to radiation cells and tissue of that subject become irradiated and, as a consequence thereof damaged or killed. Exposure to radiation includes, but is not limited to radiation oncology for the treatment of cancer, exposure caused by accidental radiation, and exposure caused by environmental radiation. Particularly when treating a subject to radiation, e.g., in oncology treatment when treating a cancer patient, not only are the tumor or cancer cells of the patient exposed to radiation (a desired result), but, as an unwanted result of such treatment, normal tissue is also exposed to radiation and will be damaged when not treated or when such damage is not prevented.

    [0323] The present invention provides methods for treating, mitigating, and preventing damage to normal tissue in a subject previously exposed, being exposed, or intended to be exposed to radiation. In some embodiments, this method comprises administering to the subject previously exposed, being exposed, or intended to be exposed to radiation a therapeutically effective amount of a composition comprising a probiotic microorganism. Thereby the damage to normal tissue in the subject is treated, mitigated or prevented.

    [0324] In some embodiments, this method comprises sustaining a beneficial level of a probiotic microorganism in a subject previously exposed, being exposed, or intended to be exposed to radiation comprising administering to the subject a therapeutically effective amount of a probiotic microorganism. Thereby the damage in the subject is treated, mitigated, or prevented.

    [0325] In some embodiments, this method comprises restoring the presence of a beneficial level of a probiotic microorganism in a subject previously exposed, being exposed, or intended to be exposed to radiation by administering to the subject a therapeutically effective amount of a composition comprising a probiotic microorganism. Thereby the damage in the subject is treated, mitigated, or prevented.

    [0326] In some embodiments, this method comprises inhibiting the growth of at least one detrimental microorganism in a subject previously exposed, being exposed, or intended to be exposed to radiation by administering to the subject a therapeutically effective amount of a composition comprising two or more antibiotics, sometimes referred to herein as a combination of antibiotics or as a cocktail of antibiotics. Thereby the damage in the subject is treated, mitigated or prevented.

    [0327] In some embodiments, this method comprises inhibiting the growth of a detrimental microorganism in a subject previously exposed, being exposed, or intended to be exposed to radiation by administering to the subject a therapeutically effective amount of an antibiotic inhibiting the growth of the detrimental microorganism. Thereby the damage in the subject is treated, mitigated or prevented.

    [0328] In some embodiments, this method comprises inhibiting the growth of at least one detrimental microorganism in a subject previously exposed, being exposed, or intended to be exposed to radiation by administering to the subject a therapeutically effective amount of one or more bacteriophages, as described herein. Thereby the damage in the subject is treated, mitigated or prevented.

    [0329] In some embodiments, this method comprises selecting a subject being exposed to radiation. In some embodiments, this method comprises selecting a subject having a condition requiring exposure to radiation. In some embodiments, the condition requiring exposure to radiation is a cancer. All cancers described herein can be treated by radiation treatment.

    [0330] In some embodiments, the exposure to radiation is exposure to natural or environmental radiation. In some embodiments, the exposure to radiation is exposure caused by accidental radiation, such as a nuclear fall-out or a nuclear accident.

    [0331] I. Method for Reducing or Preventing the Occurrence of a Spontaneous Genetic Instability in a Subject

    [0332] The present invention provides methods for reducing or preventing the occurrence of a spontaneous genetic instability in a subject. In some embodiments, this method comprises administering to a subject in need of having the occurrence of a spontaneous genetic instability reduced or prevented a therapeutically effective amount of a composition comprising a probiotic microorganism. Thereby the occurrence of the spontaneous genetic instability is reduced or prevented. As one of ordinary skill in the art will appreciate, methods and compositions of the present invention can be used in methods for reducing or preventing the occurrence of two or more spontaneous genetic instabilities in a subject or in methods for reducing or preventing the occurrence of a combination of spontaneous genetic instabilities in a subject.

    [0333] In some embodiments, this method comprises sustaining a beneficial level of a probiotic microorganism in the subject in need of having the occurrence of a spontaneous genetic instability reduced or prevented by administering to the subject a therapeutically effective amount of a probiotic microorganism. Thereby the occurrence of the spontaneous genetic instability is reduced or prevented.

    [0334] In some embodiments, this method comprises restoring the presence of a beneficial level of a probiotic microorganism in a subject in need of having the occurrence of a spontaneous genetic instability reduced or prevented by administering to the subject a therapeutically effective amount of a composition comprising a probiotic microorganism. Thereby the occurrence of the spontaneous genetic instability is reduced or prevented.

    [0335] In some embodiments, this method comprises inhibiting the growth of at least one detrimental microorganism in a subject in need of having the occurrence of a spontaneous genetic instability reduced or prevented by administering to the subject a therapeutically effective amount of a composition comprising two or more antibiotics, sometimes referred to herein as a combination of antibiotics or as a cocktail of antibiotics. Thereby the occurrence of the spontaneous genetic instability is reduced or prevented.

    [0336] In some embodiments, this method comprises inhibiting the growth of a detrimental microorganism in a subject in need of having the occurrence of a spontaneous genetic instability reduced or prevented by administering to the subject a therapeutically effective amount of an antibiotic inhibiting the growth of the detrimental microorganism. Thereby the occurrence of the spontaneous genetic instability is reduced or prevented.

    [0337] In some embodiments, this method comprises inhibiting the growth of at least one detrimental microorganism in a subject in need of having the occurrence of a spontaneous genetic instability reduced or prevented by administering to the subject a therapeutically effective amount of one or more bacteriophages, as described herein. Thereby the occurrence of the spontaneous genetic instability is reduced or prevented.

    [0338] In some embodiments, this method comprises selecting a subject in need of having a spontaneous genetic instability reduced or prevented. In some embodiments, the spontaneous genetic instability causes a spontaneous cancer in the subject. In some embodiments, the spontaneous cancer is a lymphoma.

    [0339] J. Methods for Determining and Monitoring Responsiveness and Non-Responsiveness of a Subject being Treated

    [0340] The invention further provides methods for determining and monitoring whether a subject is responsive to a method of treatment or prevention as described herein. As one of ordinary skill in the art will appreciate those methods depend on the underlying disease being treated, such as AT, a p53 deficiency, a p53 deficiency-associated cancer or radiation-induced toxicity to normal tissue. For example, such methods comprise measuring the level of expression of at least one predictive marker in a subject's cancer, determining expression of p53 in a subject's cell, determining the extent of DNA damage in a subject's cell or tissue or determining the composition of a subject's microbiota as described herein. An informative expression level of a predictive marker in a subject's sample is an indication that the subject is a responsive subject and would benefit from a method of treatment or prevention as described herein.

    [0341] Preferred embodiments of this invention are described herein. Of course, variations, changes, modifications and substitution of equivalents of those preferred embodiments will become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations, changes, modifications and substitution of equivalents as appropriate, and the inventors intend for the invention to be practiced otherwise than specifically described herein. Those of skill in the art will readily recognize a variety of non-critical parameters that could be changed, altered or modified to yield essentially similar results. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.

    [0342] While each of the elements of the present invention is described herein as containing multiple embodiments, it should be understood that, unless indicated otherwise, each of the embodiments of a given element of the present invention is capable of being used with each of the embodiments of the other elements of the present invention and each such use is intended to form a distinct embodiment of the present invention.

    [0343] The referenced patents, patent applications, and scientific literature referred to herein are hereby incorporated by reference in their entirety as if each individual publication, patent or patent application were specifically and individually indicated to be incorporated by reference. Any conflict between any reference cited herein and the specific teachings of this specification shall be resolved in favor of the latter. Likewise, any conflict between an art-understood definition of a word or phrase and a definition of the word or phrase as specifically taught in this specification shall be resolved in favor of the latter.

    [0344] As can be appreciated from the disclosure above, the present invention has a wide variety of applications. The invention is further illustrated by the following examples, which are only illustrative and are not intended to limit the definition and scope of the invention in any way.

    [0345] For all of the methods described herein, the probiotic microorganism may be administered in a composition such as any of the compositions described herein, e.g., comprising one or more fungal microbiota, one or more commensal microbiota, one or more antibiotics, one or more bacteriophages or a combination thereof. Preferably, the microorganism of the invention is administered in a composition with one or more antibiotics, one or more bacteriophages, or a combination thereof

    [0346] In some embodiments, the composition comprising a probiotic microorganism comprises a Lactobacillus sp.

    [0347] In some embodiments, the composition comprising a probiotic microorganism comprises Lactobacillus johnsonii.

    [0348] In some embodiments, the composition comprising a probiotic microorganism comprises Lactobacillus johnsonii 456.

    [0349] The compositions are administered to the subject in a therapeutically effective amount.

    IV. Examples

    [0350] The below examples are meant to illustrate specific embodiments of the methods and compositions described herein and should not be construed as limiting the scope of the invention in any way.

    Example A. General Experimental Procedures

    [0351] 1. Animal Housing and Husbandry

    [0352] Atm.sup./ mice were obtained by intercrossing Atm.sup.+/ mice and identified by genotyping as described (Liao et al., 1999, Mol Cell Biol 19:3095-3102). Mice were housed under standard conditions in accordance with the Animal Research Committee at UCLA. Mice were housed under two types of specific pathogen free (SPF) conditions, where either sterile (SPF-S) or non-sterile (SPF-N) food, water, and bedding were employed. Atm.sup./ mice harboring RM and CM microbiota were created by rederivation as described in Fujiwara et al. (2008, J Immunol 180:5843-5852) and by antibiotic treatment (Rakoff-Nahoum et al., 2004, Cell 118:229-241) followed by orogastric gavage of CM feces, respectively.

    [0353] 2. Mouse Longevity Studies

    [0354] For the Atm.sup./ mice longevity studies, animals were kept until they were found dead, developed signs of tumors or became sick, at which time they were euthanized. Mice were sent to a veterinary pathologist for necropsy. Differences in longevity and lymphoma latency were analyzed using the log-rank test.

    [0355] 3. Pun Reversion Assay

    [0356] Pun reversions were counted in mice that were 10 days old. Pun reversions can be seen as a black spot on the fur and were counted as described previously (Bishop et al., 2000, Cancer Res 60:395-399). Statistics were done using the 2 test.

    [0357] 4. Oxidative Stress and DNA Damage

    [0358] Frozen blood was prepared for enzymatic measurement of the oxidized form of glutathione using the Bioxytech GSH:GSSG-412 kit assay (Oxis, Beverly Hills, Calif., USA). Reduced GSH and GSSG were determined separately by reaction with glutathione reductase. The colorimetric assay was performed in triplicate for each blood sample from all male experimental Atm.sup./ mice. Data was expressed as the ratio of free GSH to GSSG.

    [0359] For determination of oxidative DNA damage, enzyme Ogg1-modified Comet assay was used. Samples loaded onto Gelbond film are incubated in the enzyme-containing buffer according to manufacturer's recommendation and then lysed and electrophoresed.

    [0360] -H2AX is a measure of DNA double-strand breaks (DSBs; Rogakou et al., 1998, J Biol Chem 273(10):5858-68). Since ATM deficient cells have problems repairing DSBs this method can be used to detect any difference in genotoxicity conferred by the different intestinal microbiota conditions. Cells with more than four distinct foci are considered positive cells. The number of positive cells is then compared for control groups versus treated groups via a paired Student's t-test.

    [0361] 5. Micronucleus Assay

    [0362] Micronuclei (MN) formation in peripheral blood erythrocytes to assess chromosomal instability can be determined using an in vivo micronucleus assay. The incidence of micronuclei as measured in the in vivo MN assay has commonly been used as an index of cytogenetic damage, including chromosome breaks, spindle abnormalities, or structurally abnormal chromosomes in many cell types; most frequently in erythroblasts/erythrocytes from peripheral blood or bone marrow (Hayashi et al., 1994, Mutat Res 312(3):293-304; Steinheider et al., 1985, Cell Biol Toxicol 1(3):197-211). The frequency of MN formation is calculated as a number of micronucleated erythrocytes per 2000 erythrocytes per mouse. Micronuclei were examined in peripheral blood erythrocytes stained with Wright-Giemsa (Sigma-Aldrich, St. Louis, Mo., USA). At least 2,000 erythrocytes were counted at 100 magnification as described previously (Westbrook et al., 2009, Cancer Res 69:4827-4834). Statistics were done using Student's t-tests.

    [0363] 6. Alkaline Comet Assay

    [0364] DNA strand breaks were measured in peripheral blood cells using the alkaline comet assay. The alkaline comet assay detects single and double DNA strand breaks and was performed essentially as described (McNamee et al., 2000, Mutat Res 466(1):63-9). Blood was collected from the facial vein of mice approximately 6-months-old and diluted 1:1 with RPMI+20% DMSO for storage at 80 C. until the assay was performed. The comet assay was basically performed as previously described (Westbrook et al., 2009, Cancer Res 69:4827-4834). Statistical analyses were done using Student's t-tests.

    [0365] 7. Bacteria Community Analyses of SPF-N and SPF-S Mice

    [0366] Fecal pellets from Atm.sup.+/ mice (SPF-N and SPF-S) were collected and immediately snap-frozen in liquid nitrogen and stored at 80 C. Nucleic acids from fecal pellets were purified using a phenol-chloroform extraction with bead-beating (Griffiths et al., 2000, Appl Environ Microbiol 66:5488-5491) and a fragment of the 16S rRNA gene targeting the V6-V9 region of most bacteria was amplified with PCR primers 909F (5-ACTCAAAKGAATWGACGG-3 (SEQ ID NO: 1)) and 1492R (5-NTACCTTGTTACGACT-3 (SEQ ID NO: 2)). The template was amplified and tagged with a sample-specific 8-nt barcode sequence via a 2-step, low cycle number barcoded PCR protocol described previously (Berry et al., 2011, Appl Environ Microbiol 77:7846-7849). Pyrosequencing was performed on a GS FLX 454 sequencer at the Norwegian Sequencing Centre.

    [0367] Pyrosequencing data was analyzed as previously described (Berry et al., 2012, ISME J. doi:10.1038/ismey.2012.39). Briefly, reads were quality-filtered using LUCY (Chou and Holmes, 2001, Bioinformatics 17, 1093-1104) and clustered into phylotypes at 97% identity using UCLUST (Edgar, 2010, Bioinformatics 26, 2460-2461). Taxonomic classifications were assigned and alpha and beta diversity metrics were produced using the QIIME software package (Caporaso et al., 2010, Nat Meth 7:335-336). The VEGAN package (Dixon, 2003, J Vegetation Science 14:927-930) was used for permutational multivariate analysis of variance and the indispecies package (De Caceres and Legendre, 2009, Ecology 90:3566-3574) was used to identify phylotypes that were indicators for a colony type. To focus on abundant indicators, only indicators that had an elevated relative abundance of at least 1% (e.g., 0.5% to 1.5%) were considered.

    [0368] 8. Bacteria Community Analyses of CM and RM Mice

    [0369] Intestinal mucosa samples of CM and RM mice were obtained as described in Presley et al. (2010, Appl Environ Microbiol 76:936-941). DNA was extracted from these samples using the PowerSoil DNA Isolation Kit (MO BIO Laboratories, Carlsbad, Calif., USA), and a 30-second bead-beating step using a Mini-Beadbeater-16 (BioSpec Products, Bartlesville, Okla., USA). One hundred microliter PCR amplification reactions were performed in an MJ Research PTC-200 thermal cycler (Bio-Rad Inc., Hercules, Calif., USA) and contained: 50 mM Tris (pH 8.3), 500 g/ml bovine serum albumin (BSA), 2.5 mM MgCl2, 250 M of each deoxynucleotide triphosphate (dNTP), 400 nM of forward PCR primer, 200 nM of each reverse PCR primer, 4 l of DNA template, and 2.5 units JumpStart Taq DNA polymerase (Sigma-Aldrich, St. Louis, Mo., USA). PCR primers targeted a portion of the 16S and 23S rRNA genes and the hypervariable intergenic region, with the reverse primers including a 12-bp barcode (Tables 1 and 2).

    TABLE-US-00001 TABLE1 ReversePCRPrimersusedintheIllumina-basedhighthroughput sequenceanalysisofbacterialrRNAgenes(eachreversePCRprimer iscomprisedofthe4adjoiningsegmentsineachrowshownbelow). Reverse SEQID No. 3 IlluminaAdapter Barcode Spacer 23SPrimer(23SR) NO: 1 CAAGCAGAAGACGGCATACGAGAT CTAGCGTGCGTT AGTCAGTCAGCC GGGTTBCCCCATTCRG 3 2 CAAGCAGAAGACGGCATACGAGAT TCGACATCTCTT AGTCAGTCAGCC GGGTTBCCCCATTCRG 4 3 CAAGCAGAAGACGGCATACGAGAT ACGAGACTGATT AGTCAGTCAGCC GGGTTBCCCCATTCRG 5 4 CAAGCAGAAGACGGCATACGAGAT CGAGTCACGATT AGTCAGTCAGCC GGGTTBCCCCATTCRG 6 5 CAAGCAGAAGACGGCATACGAGAT GCCATAGTGTGT AGTCAGTCAGCC GGGTTBCCCCATTCRG 7 6 CAAGCAGAAGACGGCATACGAGAT GTAGACATGTGT AGTCAGTCAGCC GGGTTBCCCCATTCRG 8 7 CAAGCAGAAGACGGCATACGAGAT TAGACACCGTGT AGTCAGTCAGCC GGGTTBCCCCATTCRG 9 8 CAAGCAGAAGACGGCATACGAGAT CGGATCTAGTGT AGTCAGTCAGCC GGGTTBCCCCATTCRG 10 9 CAAGCAGAAGACGGCATACGAGAT GACCACTGCTGT AGTCAGTCAGCC GGGTTBCCCCATTCRG 11 10 CAAGCAGAAGACGGCATACGAGAT ATGAAGCACTGT AGTCAGTCAGCC GGGTTBCCCCATTCRG 12 11 CAAGCAGAAGACGGCATACGAGAT TCGCGCAACTGT AGTCAGTCAGCC GGGTTBCCCCATTCRG 13 12 CAAGCAGAAGACGGCATACGAGAT GCTAAGTGATGT AGTCAGTCAGCC GGGTTBCCCCATTCRG 14 13 CAAGCAGAAGACGGCATACGAGAT CACGTGACATGT AGTCAGTCAGCC GGGTTBCCCCATTCRG 15 14 CAAGCAGAAGACGGCATACGAGAT TGCGCTGAATGT AGTCAGTCAGCC GGGTTBCCCCATTCRG 16 15 CAAGCAGAAGACGGCATACGAGAT GATGTATGTGGT AGTCAGTCAGCC GGGTTBCCCCATTCRG 17 16 CAAGCAGAAGACGGCATACGAGAT GCATCGTCTGGT AGTCAGTCAGCC GGGTTBCCCCATTCRG 18 17 CAAGCAGAAGACGGCATACGAGAT CTAGTCGCTGGT AGTCAGTCAGCC GGGTTBCCCCATTCRG 19 18 CAAGCAGAAGACGGCATACGAGAT TCTGATCGAGGT AGTCAGTCAGCC GGGTTBCCCCATTCRG 20 19 CAAGCAGAAGACGGCATACGAGAT GATAGCACTCGT AGTCAGTCAGCC GGGTTBCCCCATTCRG 21 20 CAAGCAGAAGACGGCATACGAGAT TGGTCGCATCGT AGTCAGTCAGCC GGGTTBCCCCATTCRG 22 21 CAAGCAGAAGACGGCATACGAGAT TAGCAGTTGCGT AGTCAGTCAGCC GGGTTBCCCCATTCRG 23 22 CAAGCAGAAGACGGCATACGAGAT GTATCTGCGCGT AGTCAGTCAGCC GGGTTBCCCCATTCRG 24 23 CAAGCAGAAGACGGCATACGAGAT TCCAGATAGCGT AGTCAGTCAGCC GGGTTBCCCCATTCRG 25 24 CAAGCAGAAGACGGCATACGAGAT GACACTCACCGT AGTCAGTCAGCC GGGTTBCCCCATTCRG 26 25 CAAGCAGAAGACGGCATACGAGAT TGCTACAGACGT AGTCAGTCAGCC GGGTTBCCCCATTCRG 27 26 CAAGCAGAAGACGGCATACGAGAT TCTACGGCACGT AGTCAGTCAGCC GGGTTBCCCCATTCRG 28 27 CAAGCAGAAGACGGCATACGAGAT GTGTGCTAACGT AGTCAGTCAGCC GGGTTBCCCCATTCRG 29 28 CAAGCAGAAGACGGCATACGAGAT ATAGGCTGTAGT AGTCAGTCAGCC GGGTTBCCCCATTCRG 30 29 CAAGCAGAAGACGGCATACGAGAT ACCACACGTAGT AGTCAGTCAGCC GGGTTBCCCCATTCRG 31 30 CAAGCAGAAGACGGCATACGAGAT TATGGAGCTAGT AGTCAGTCAGCC GGGTTBCCCCATTCRG 32 31 CAAGCAGAAGACGGCATACGAGAT GAGTATCTGAGT AGTCAGTCAGCC GGGTTBCCCCATTCRG 33 32 CAAGCAGAAGACGGCATACGAGAT ATCGAATCGAGT AGTCAGTCAGCC GGGTTBCCCCATTCRG 34 33 CAAGCAGAAGACGGCATACGAGAT CTCTAGAAGAGT AGTCAGTCAGCC GGGTTBCCCCATTCRG 35 34 CAAGCAGAAGACGGCATACGAGAT ATGGCTGTCAGT AGTCAGTCAGCC GGGTTBCCCCATTCRG 36 35 CAAGCAGAAGACGGCATACGAGAT ACTAGGATCAGT AGTCAGTCAGCC GGGTTBCCCCATTCRG 37 36 CAAGCAGAAGACGGCATACGAGAT TACGCGTACAGT AGTCAGTCAGCC GGGTTBCCCCATTCRG 38 37 CAAGCAGAAGACGGCATACGAGAT AGTACGCAGTCT AGTCAGTCAGCC GGGTTBCCCCATTCRG 39 38 CAAGCAGAAGACGGCATACGAGAT CACTTGCTCTCT AGTCAGTCAGCC GGGTTBCCCCATTCRG 40 39 CAAGCAGAAGACGGCATACGAGAT TGCTCTTGCTCT AGTCAGTCAGCC GGGTTBCCCCATTCRG 41 40 CAAGCAGAAGACGGCATACGAGAT CTTAGCTACTCT AGTCAGTCAGCC GGGTTBCCCCATTCRG 42 41 CAAGCAGAAGACGGCATACGAGAT GCTCAGGACTCT AGTCAGTCAGCC GGGTTBCCCCATTCRG 43 42 CAAGCAGAAGACGGCATACGAGAT GCGCGTGTATCT AGTCAGTCAGCC GGGTTBCCCCATTCRG 44 43 CAAGCAGAAGACGGCATACGAGAT TCGAGCCGATCT AGTCAGTCAGCC GGGTTBCCCCATTCRG 45 44 CAAGCAGAAGACGGCATACGAGAT ATGCAGAGATCT AGTCAGTCAGCC GGGTTBCCCCATTCRG 46 45 CAAGCAGAAGACGGCATACGAGAT AGCAGAACATCT AGTCAGTCAGCC GGGTTBCCCCATTCRG 47 46 CAAGCAGAAGACGGCATACGAGAT TAGGCTCGTGCT AGTCAGTCAGCC GGGTTBCCCCATTCRG 48 47 CAAGCAGAAGACGGCATACGAGAT CTCTCATATGCT AGTCAGTCAGCC GGGTTBCCCCATTCRG 49 48 CAAGCAGAAGACGGCATACGAGAT TGCACAGTCGCT AGTCAGTCAGCC GGGTTBCCCCATTCRG 50 49 CAAGCAGAAGACGGCATACGAGAT AGATAGCTCGCT AGTCAGTCAGCC GGGTTBCCCCATTCRG 51 50 CAAGCAGAAGACGGCATACGAGAT TCGTGGATAGCT AGTCAGTCAGCC GGGTTBCCCCATTCRG 52 51 CAAGCAGAAGACGGCATACGAGAT CCTCTGAGAGCT AGTCAGTCAGCC GGGTTBCCCCATTCRG 53 52 CAAGCAGAAGACGGCATACGAGAT GACTAGTCAGCT AGTCAGTCAGCC GGGTTBCCCCATTCRG 54 53 CAAGCAGAAGACGGCATACGAGAT ACAGTGCGTCCT AGTCAGTCAGCC GGGTTBCCCCATTCRG 55 54 CAAGCAGAAGACGGCATACGAGAT GTCGTGTAGCCT AGTCAGTCAGCC GGGTTBCCCCATTCRG 56 55 CAAGCAGAAGACGGCATACGAGAT GCGATCACACCT AGTCAGTCAGCC GGGTTBCCCCATTCRG 57 56 CAAGCAGAAGACGGCATACGAGAT AGTGATGTGACT AGTCAGTCAGCC GGGTTBCCCCATTCRG 58 57 CAAGCAGAAGACGGCATACGAGAT CAGCTATGGACT AGTCAGTCAGCC GGGTTBCCCCATTCRG 59 58 CAAGCAGAAGACGGCATACGAGAT TCAGAGTAGACT AGTCAGTCAGCC GGGTTBCCCCATTCRG 60 59 CAAGCAGAAGACGGCATACGAGAT GCTTCTCTCACT AGTCAGTCAGCC GGGTTBCCCCATTCRG 61 60 CAAGCAGAAGACGGCATACGAGAT ACGCATCGCACT AGTCAGTCAGCC GGGTTBCCCCATTCRG 62 61 CAAGCAGAAGACGGCATACGAGAT AGAGCATCCACT AGTCAGTCAGCC GGGTTBCCCCATTCRG 63 62 CAAGCAGAAGACGGCATACGAGAT CACCGTGACACT AGTCAGTCAGCC GGGTTBCCCCATTCRG 64 63 CAAGCAGAAGACGGCATACGAGAT CGATCGAACACT AGTCAGTCAGCC GGGTTBCCCCATTCRG 65 64 CAAGCAGAAGACGGCATACGAGAT GACGCACTAACT AGTCAGTCAGCC GGGTTBCCCCATTCRG 66 65 CAAGCAGAAGACGGCATACGAGAT CGCCACGTGTAT AGTCAGTCAGCC GGGTTBCCCCATTCRG 67 66 CAAGCAGAAGACGGCATACGAGAT TCGAAGACGTAT AGTCAGTCAGCC GGGTTBCCCCATTCRG 68 67 CAAGCAGAAGACGGCATACGAGAT GCGCAATAGTAT AGTCAGTCAGCC GGGTTBCCCCATTCRG 69 68 CAAGCAGAAGACGGCATACGAGAT CTGAGTGAGTAT AGTCAGTCAGCC GGGTTBCCCCATTCRG 70 69 CAAGCAGAAGACGGCATACGAGAT GTATGGAGCTAT AGTCAGTCAGCC GGGTTBCCCCATTCRG 71 70 CAAGCAGAAGACGGCATACGAGAT GAGATCGCCTAT AGTCAGTCAGCC GGGTTBCCCCATTCRG 72 71 CAAGCAGAAGACGGCATACGAGAT GCACTGGCATAT AGTCAGTCAGCC GGGTTBCCCCATTCRG 73 72 CAAGCAGAAGACGGCATACGAGAT GTGACTAGTGAT AGTCAGTCAGCC GGGTTBCCCCATTCRG 74 73 CAAGCAGAAGACGGCATACGAGAT CTGTGATCGGAT AGTCAGTCAGCC GGGTTBCCCCATTCRG 75 74 CAAGCAGAAGACGGCATACGAGAT ACTACTGAGGAT AGTCAGTCAGCC GGGTTBCCCCATTCRG 76 75 CAAGCAGAAGACGGCATACGAGAT ATCGTCCGCGAT AGTCAGTCAGCC GGGTTBCCCCATTCRG 77 76 CAAGCAGAAGACGGCATACGAGAT GAGTTGTACGAT AGTCAGTCAGCC GGGTTBCCCCATTCRG 78 77 CAAGCAGAAGACGGCATACGAGAT ACCAGCTCAGAT AGTCAGTCAGCC GGGTTBCCCCATTCRG 79 78 CAAGCAGAAGACGGCATACGAGAT ATAGCACCAGAT AGTCAGTCAGCC GGGTTBCCCCATTCRG 80 79 CAAGCAGAAGACGGCATACGAGAT CACGATGGTCAT AGTCAGTCAGCC GGGTTBCCCCATTCRG 81 80 CAAGCAGAAGACGGCATACGAGAT GAGCGTATCCAT AGTCAGTCAGCC GGGTTBCCCCATTCRG 82 81 CAAGCAGAAGACGGCATACGAGAT TAGAGCTGCCAT AGTCAGTCAGCC GGGTTBCCCCATTCRG 83 82 CAAGCAGAAGACGGCATACGAGAT TGTGCACGCCAT AGTCAGTCAGCC GGGTTBCCCCATTCRG 84 83 CAAGCAGAAGACGGCATACGAGAT GTAGTAGACCAT AGTCAGTCAGCC GGGTTBCCCCATTCRG 85 84 CAAGCAGAAGACGGCATACGAGAT AGTCGTGCACAT AGTCAGTCAGCC GGGTTBCCCCATTCRG 86 85 CAAGCAGAAGACGGCATACGAGAT AAGTCGACACAT AGTCAGTCAGCC GGGTTBCCCCATTCRG 87 86 CAAGCAGAAGACGGCATACGAGAT GTGCACGATAAT AGTCAGTCAGCC GGGTTBCCCCATTCRG 88 87 CAAGCAGAAGACGGCATACGAGAT CGCTCACAGAAT AGTCAGTCAGCC GGGTTBCCCCATTCRG 89 88 CAAGCAGAAGACGGCATACGAGAT TCGTGCGTGTTG AGTCAGTCAGCC GGGTTBCCCCATTCRG 90 89 CAAGCAGAAGACGGCATACGAGAT TGCTCACGTGTG AGTCAGTCAGCC GGGTTBCCCCATTCRG 91 90 CAAGCAGAAGACGGCATACGAGAT ACGTCCACTGTG AGTCAGTCAGCC GGGTTBCCCCATTCRG 92 91 CAAGCAGAAGACGGCATACGAGAT GTGTTAGATGTG AGTCAGTCAGCC GGGTTBCCCCATTCRG 93 92 CAAGCAGAAGACGGCATACGAGAT GCTCACAATGTG AGTCAGTCAGCC GGGTTBCCCCATTCRG 94 93 CAAGCAGAAGACGGCATACGAGAT TAGCCTGTCGTG AGTCAGTCAGCC GGGTTBCCCCATTCRG 95 94 CAAGCAGAAGACGGCATACGAGAT ACATGTCACGTG AGTCAGTCAGCC GGGTTBCCCCATTCRG 96 95 CAAGCAGAAGACGGCATACGAGAT TCAACAGTAGTG AGTCAGTCAGCC GGGTTBCCCCATTCRG 97 96 CAAGCAGAAGACGGCATACGAGAT CTAATCAGAGTG AGTCAGTCAGCC GGGTTBCCCCATTCRG 98

    TABLE-US-00002 TABLE2 ForwardPCRprimerusedintheIllumina-basedhighthroughput sequenceanalysisofbacterialrRNAgenes(TheforwardPCRprimeris comprisedofthe3adjoiningsegmentsshownbelow). Forward SEQID Name 5' IlluminaAdapter Spacer 16SPrimer(1507F) NO: IL- AATGATACGGCGACCACCGAGATCTACAC TATCGCCGTTGT GGTGAAGTCGTAACAAGGTA 99 ITS- PCR- F

    [0370] Thermal cycling parameters were 94 C. for 5 min; 35 cycles of 94 C. for 20 sec, 56 C. for 20 sec, and 72 C. for 40 sec, and followed by 72 C. for 5 min. PCR products were purified using a MinElute 96 UF PCR Purification Kit (Qiagen, Valencia, Calif., USA). DNA sequencing was performed using an Illumina HiSeq 2000 (Illumina, Inc., San Diego, Calif.). Clusters were created using a template concentration of 2.5 pM. One hundred base sequencing reads of the 5 end of the amplicons and seven base barcode reads were obtained using the sequencing primers listed in Table 3. De-multiplexing, quality control, and OTU binning were performed using QIIME (Caporaso et al. 2010). OTUs were binned at 97% identity.

    TABLE-US-00003 TABLE3 SequencingprimersusedintheIllumina-basedhighthroughput sequenceanalysisofbacterialrRNAgenes Name Purpose Sequence SEQIDNO: IL-ITS- 5 sequencing CACTATCGCCGTTGTGGTGAAGTCGTAACAAGGTA 100 Read-1 primer IL-ITS- Barcode YGAATGGGGVAACCCGGCTGACTGACT 101 Index sequencingprimer

    [0371] 9. Lactobacillus johnsonii Isolation and Koch's Postulates Experimentation

    [0372] Lactobacillus johnsonii (strain RM 6-1) was isolated from RM wildtype mouse feces using Lactobacillus Selection Agar (BD, Franklin Lakes, N.J., USA). For the Koch's postulates experiments, this bacterium was grown on LB agar supplemented with 2% glucose and 0.05% (wt/vol) cysteine at 37 C. under anaerobic conditions. The strain was grown overnight and suspended in phosphate-buffered saline (PBS). Prior to inoculation with L. johnsonii, CM Atm.sup./ mice were treated with 1 g/L ampicillin (Sigma-Aldrich), neomycin (Thermo Fisher Scientific, Waltham, Mass., USA), and metronidazole (Baxter, Deerfield, Ill., USA) and 500 mg/L vancomycin (Hospira, Lake Forest, Ill.) in their drinking water for 1 week as described previously (Rakoff-Nahoum et al., 2004, Cell 118:229-241). Then, 109 CFU of L. johnsonii was administrated every other day by orogastric gavage to a group of eight animals for four successive weeks; in addition, the drinking water for same group of animals contained 109 CFU/ml of L. johnsonii. Fecal population densities of L. johnsonii were measured before, during, and after L. johnsonii administration, using a previously described sequence-selective qPCR assay (Presley et al., 2010, Appl Environ Microbiol 76:936-941). After four weeks, mice were euthanized using 3% isoflurane and analyzed as described herein.

    [0373] 10. Gene Expression by RT-PCR

    [0374] RNA from peripheral blood mononuclear cells (PBMC) or tissue was collected using phenol-chloroform extraction followed by ethanol precipitation. Pellets were resuspended in nucleotide-free water, and RNA was treated with 200 units of DNase I (Ambion, Huntingdon, United Kingdom) for 2 hours at 37 C. RNA levels of transforming growth factor (TGF-), interleukin-1 (IL-1), interleukin-4 (IL-4), interleukin-10 (IL-10), interleukin-10 (IL-10), interferon gamma (IFN-), and myeloid differentiation primary response gene 88 (MYD88) were determined from cDNA and compared as relative expression changes in L. johnsonii-treated animals compared to PBS-treated animals. Taqman real-time PCR validation of gene expression was performed using the TaqMan Gene Expression Assays system (Applied Biosystems, Carlsbad, Calif., USA). The level of gene transcription was normalized to GAPDH (glyceraldehyde-3-phosphate dehydrogenase).

    [0375] 11. Flow Cytometry

    [0376] PBMC or tissue cell pellets were resuspended in staining buffer. Lymphocytes were stained with CD3, CD4, CD19, and CD335 antibodies (Biolegend, San Diego, Calif., USA). Cells were fixed in 4% paraformaldehyde-phosphate-buffered saline (PBS) and scanned on a Becton Dickinson FACS Calibur flow cytometer. A minimum of 25,000 events were collected. Flow cytometry data were analyzed using Tree Star FlowJo software. Statistical analyses (Student's t test) were used to determine if mean values were different (P<0.05).

    [0377] 12. Sequence Data

    [0378] DNA sequence data has been deposited at the NCBI Short Read Archive under accession number (to be determined).

    Example B. Housing Affects Genetic Instability, Lifespan, Glutathione Levels, and Lymphoma Latency of Atm Mice

    [0379] When Applicants moved mice from Harvard University to the University of California Los Angeles (UCLA) in the year 2000, the median lifespan of their Atm.sup./ mice began to increase over a seven-year period from approximately 4 to 12 months (unpublished observations). At Harvard, mice were housed in non-sterile conditions (SPF-N; Table 4) compared to a sterile condition at UCLA (SPF-S):

    TABLE-US-00004 TABLE 4 Four isogenic mouse colonies harboring different bacterial communities Sterile Name Description Housing* Sterile Harvard colony moved to sterile Yes (SPF-S) housing at UCLA. Semi- Harvard colony exposed to conventional No Conventional mice for 24-hours, and then bred in (SPF-N) conventional housing at UCLA. Conventional Harvard colony treated with antibiotics, No Microbiota inoculated with conventional mouse feces, (CM) and then bred in conventional housing at UCLA. Restricted Atm/ rederived with restricted Yes Microbiota microbiota (RM) *Autoclaved Bedding, Cages, Food, Water

    [0380] To examine the influence of housing conditions on traits associated with ATM deficiency, Atm.sup./ and wildtype mice from three housing conditions were compared: (i) Harvard housing and (ii and iii) UCLA housing in specific pathogen free (SPF) conditions with either sterile (SPF-S) or non-sterile (SPF-N) food, water and bedding. Genetic instability was assessed using the pun reversion assay, which measures DNA deletion events repaired by homologous recombination (Bishop et al., 2000, Cancer Res 60:395-399). While lifespan increased in the Atm.sup./ mice over seven years under SPF-S conditions, DNA deletion frequency decreased to 10%. These levels are comparable to the wildtype mice (FIG. 1A), indicating loss of the abnormally high genetic instability that is a hallmark of Atm.sup./ mice and human cells from A-T subjects (Bishop et al., 2000, Cancer Res 60:395-399; Guo et al., 2010, Science 330:517-521). Conversely, DNA deletion frequencies of Atm.sup./ mice housed under SPF-N conditions were 43%, a level even higher than those observed in the Harvard colony (FIG. 1A).

    [0381] Focusing on the two UCLA Atm.sup./ mouse colonies, lifespan and lymphoma latency were compared. SPF-N mice exhibited significantly shorter lifespan than SPF-S mice (FIG. 1B, see also FIGS. 8 and 9). Since Atm.sup./ mice primarily die from lymphomas (Barlow et al., 1996, Cell 86:159-171), we examined the cause of mortality or morbidity. Although the incidence of lymphomas was similar between mice housed in SPF-N(74%) and SPF-S(76.5%) conditions, time of onset was significantly shorter in the SPF-N mice (FIG. 1C). The median age at which SPF-N mice died of lymphoma was 25 weeks compared to 60 weeks for SPF-S mice. These results are consistent with the observed increase in SPF-N genetic instability (FIG. 1A), likely the primary driver of accelerated carcinogenesis.

    [0382] The roles of diet and microbiota to test possible causes of the increased lifespan and decreased genetic instability observed in the mice was examined. Since N-acetyl cysteine, an anti-oxidant, can decrease genetic instability (Reliene et al., 2004, Cancer Res 64:5148-5153) and increase longevity (Ito et al., 2007, J Immunol 178:103-110; Reliene and Schiestl, 2006a, DNA Repair (Amst) 5:852-859), it was reasoned that the excess vitamin E, also an anti-oxidant, in the normal diet (Harlan Teklad 8650) may also be protective. Therefore, mice were put on a customized diet (Harlan Teklad TD.05171) decreasing the excess level of vitamin E to levels that mice require (134 IU/kg compared to <50 IU/kg). The diet that animals were given at Harvard University (PicoLab 5LJ5) was also used. Neither diet had an effect on genetic instability or lifespan (data not shown).

    [0383] After observing the striking effects of housing on ATM-deficient traits, the intestinal bacteria inhabiting the two UCLA Atm.sup./ mouse colonies were examined. High throughput sequence analysis of rRNA genes revealed that these two colonies harbor distinct microbial communities (FIG. 1D). An indicator analysis identified several bacterial phylotypes whose populations correlated with genetic instability, suggesting a possible role. One correlate is a member of the Helicobacteriaceae, which are bacteria known to promote cancer (FIG. 2).

    [0384] To test the role of microbiota, in some experiments, mice from the sterile (SPF-S) facility were exposed to mice with a conventional microbiota for 24 hours. Mice can incorporate microbiota from the bedding and fur of the mice they are co-housed with and they have a habit of coprophagia. The bacterial populations were examined using two types of rRNA gene analyses. High throughput sequencing provided an extensive analysis at relatively low taxonomic resolution while ribosomal intergenic spacer analysis (RISA) provided an examination at relatively high taxonomic resolution, but only for the most abundant phylotypes. Co-housing sterile mice (SPF-S) with conventional mice (CM) was enough to stably (over at least 2 generations) change the spectrum of bacterial rRNA genes in fecal samples (FIG. 1D and data not shown). Because these mice were only passively exposed to conventional microbiota, these mice are referred to herein as semi-conventionalized (SPF-N, Table 4). These mice are isogenic to mice housed in the sterile (SPF-S) facility, decreasing the chance that genetics is a factor in the experiments described herein.

    [0385] To determine if genetic instability was affected by exposing mice to conventional microbiota, in some experiments the pink-eyed unstable mutation reversion assay was used. This assay measures DNA deletions of one 70 kb tandem repeat in the p allele leading to reversion back to the functional protein. These reversions can be seen as black spots in the fur and represent a DNA deletion event repaired by homologous recombination (Bishop et al., 2000, Cancer Res 60:395-399). Increases in fur-spots have been seen in cancer prone mouse models as well as in response to carcinogens (Reliene et al., 2007, Adv Genet 58:67-87). Bishop et al. found that 30.3% of Atm.sup./ mice had fur-spots while only 17.7% of wildtype littermates had fur-spots (P<0.05) (as previously described (Bishop et al., 2000, Cancer Res 60:395-399) and FIG. 1A). After the mice were housed in sterile (SPF-S) conditions for seven years, DNA deletion frequency decreased in Atm.sup./ mice to 10%, even slightly lower than the wildtype mice (FIG. 1A, sterile (SPF-S) conditions), indicating a complete disappearance of genetic instability, which is a hallmark of Atm-deficient mice and human cells (Bishop et al., 2000, Cancer Res 60:395-399; Lavin et al., 2007, Br Med Bull 81-82:129-147). After mice were exposed to conventional microbiota however, the frequency of DNA deletions was again elevated in Atm.sup./ mice to about 43% (P<0.01) (FIG. 1A, semi-conventional mice). As a comparison, exposure of mice to conventional microbiota on DNA deletions had a similar effect as almost lethal doses of the potent carcinogen benzo(a)pyrene to wildtype mice (Schiestl et al., 1997, Proc Natl Acad Sci USA 94:4576-4581).

    [0386] Since oxidative stress can be produced by intestinal microbiota both directly and indirectly (Federico et al., 2007, Int J Cancer 121:2381-2386; Kullisaar et al., 2003, Br J Nutr 90:449-456; Kullisaar et al., 2002, Int J Food Microbiol 72:215-224), and oxidative stress is associated with both DNA damage and carcinogenesis (Evans et al., 2004, Mutat Res 567:1-61; Klaunig et al., Toxicol Pathol 38:96-109), the antioxidant state of Atm.sup./ mice in sterile (SPF-S) conditions and semi-conventional Atm mice was assessed. Glutathione (GSH) is a major antioxidant in the cell and decreased levels of GSH are associated with several diseases including cancer (Ballatori et al., 2009, Biol Chem 390:191-214). It was found that GSH levels in the peripheral blood of semi-conventional Atm.sup./ mice are significantly lower than in Atm.sup./ mice housed in sterile (SPF-S) conditions (data not shown, p<0.01). Therefore oxidative stress may play a role in the increased genetic instability and decreased lymphoma latency in semi-conventional Atm.sup./ mice.

    Example C. Atm.SUP./ .Mice with Restricted Microbiota (RM) have Increased Lifespan and Decreased Systemic Genotoxicity and Oxidative Stress

    [0387] To further the investigation into the role of intestinal microbiota in lymphoma penetrance, Atm.sup./ mice harboring intestinal microbiota from the conventional microbiota (CM) and restricted microbiota (RM) mouse models were created. These models were chosen because CM and RM harbor distinct intestinal microbiota (Fujiwara et al., 2008, J Immunol 180:5843-5852; Presley et al., 2010, Appl Environ Microbiol 76:936-941; Wei et al., 2010, J Immunol; 184:1218-1226), and RM mice possess immunologic traits that can potentially influence lymphoma penetrance, including unusually high levels of cytolytic central memory CD8.sup.+ T cells that target neoplastic cells. Moreover, RM mice are carefully maintained in an isolated facility and these immunologic traits have persisted for many years, thus providing a stable platform for Applicants' investigations.

    [0388] Lifespan in the two mouse colonies was significantly different, with median survival of CM mice (32 weeks) being shorter than RM mice (80 weeks) (FIG. 3A). Examination of systemic genotoxicity using three different metrics showed that Atm.sup./ mice with CM microbiota exhibited higher DNA damage than those with RM microbiota. Clastogenic DNA damage, determined by the presence of micronuclei in peripheral blood erythrocytes, was nearly 85% higher in CM versus RM mice (FIG. 3B). DNA strand breaks, measured by the alkaline comet assay, were also higher in CM than RM mice (FIG. 3C). A third indicator of DNA damage in cells, percent tail DNA at the 80th percentile using the alkaline comet assay, was likewise higher in CM over RM mice (data not shown).

    [0389] Since oxidative stress can be produced by intestinal microbiota both directly and indirectly (Kullisaar et al., 2002, Int J Food Microbiol 72:215-224; Kullisaar et al., 2003, Br J Nutr 90:449-456; Federico et al., 2007, Int J Cancer 121:2381-2386), and oxidative stress is associated with both genotoxicity and carcinogenesis (Evans et al., 2004, Mutat Res 567:1-61; Klaunig et al., 2010, Toxicol Pathol 38:96-109), the antioxidant state of Atm.sup./ mice harboring CM and RM microbiota was also assessed. Glutathione (GSH) is a major cellular antioxidant and decreased levels of GSH are associated with several diseases including cancer (Ballatori et al., 2009, Biol Chem 390:191-214). A metric of oxidative stress can be expressed as the ratio of GSH and the dimeric oxidized form GSSG in peripheral blood. It was found that Atm.sup./ mice harboring CM microbiota had higher ratios of oxidative stress compared to RM mice (FIG. 3D), suggesting it may also play a role in lymphoma penetrance in this model system.

    [0390] The results presented in FIGS. 1 to 3 suggest that the intestinal microbiota is a major contributor to the phenotypic differences observed within and among Atm.sup./ mouse colonies (Reliene and Schiestl, 2006b, DNA Repair (Amst) 5:651-653).

    Example D. Microbiota in CM and RM Mice are Distinct

    [0391] A high throughput sequence analysis revealed broad taxonomic differences in bacterial rRNA gene composition from the intestinal mucosa of CM and RM mice. This analysis was performed because all prior investigations of CM and RM microbiota were relatively shallow in depth (Fujiwara et al., 2008, J Immunol 180:5843-5852; Presley et al., 2010, Appl Environ Micrbiol 76:936-941; Wei et al., 2010, J Immunol 184:1218-1226). A weighted UniFrac analysis showed distinct grouping and tighter clustering in RM than CM mice (FIGS. 4A and 4B). These results are consistent with the manner in which RM mice were created and maintained, including isolated housing conditions and initial oral inoculum containing relatively few bacterial taxa (Fujiwara et al., 2008, J Immunol 180:5843-5852). The majority of rRNA gene sequences were classified into the phyla Bacteroidetes (dark shaded) and Firmicutes (light shaded) (FIG. 4C). However, the most consistent phyla-level difference between CM and RM was in the Proteobacteria (see asterisks in FIG. 4C), with the most statistically significant difference occurring in the colon (FIG. 4D). Although compositional differences were detected between mouse genotypes (Atm.sup./ versus Atm.sup.+/+) and intestinal regions (small intestine versus colon), CM versus RM provided the most distinct groupings (FIGS. 4A and 4B). A more comprehensive taxonomic analysis is provided in Table 5.

    TABLE-US-00005 TABLE 5 Taxonomic Analysis. Data was generated by an Illumina-based high throughput sequence analysis of rRNA genes. Values in the table indicate number of sequencing reads. Taxon ID Taxon CM Atm+/+ Small Intestine RM Atm+/+ Small Intestine 1 No blast hit; Other 5.2E03 2.2E03 8.9E03 2.6E03 5.0E03 1.0E03 2 Actinobacteria 1.1E04 3.4E04 8.9E04 2.7E04 2.9E04 5.2E05 3 Aquificae 0.0E+00 0.0E+00 0.0E+00 4.6E07 5.1E07 0.0E+00 4 Bacteroidetes 6.7E03 2.4E02 6.2E02 9.7E04 2.4E02 1.9E03 5 Bacteroidetes/Chlorobi group 5.0E02 8.1E02 2.5E01 3.8E01 5.5E01 9.8E02 6 Chlamydiae/Verrucomicrobia group 1.9E06 7.1E06 7.3E05 0.0E+00 0.0E+00 0.0E+00 7 Chloroflexi 1.9E06 0.0E+00 1.1E06 4.8E05 6.2E05 2.6E06 8 Chrysiogenetes 0.0E+00 2.1E05 0.0E+00 0.0E+00 0.0E+00 0.0E+00 9 Cyanobacteria 1.9E05 4.4E05 1.1E03 7.4E06 1.9E05 2.6E06 10 Deferribacteres 9.4E05 2.6E07 1.9E04 0.0E+00 0.0E+00 0.0E+00 11 Fibrobacteres/Acidobacteria group 4.7E07 5.3E07 0.0E+00 1.8E06 0.0E+00 0.0E+00 12 Firmicutes 4.3E01 8.6E01 4.7E01 6.1E01 3.9E01 8.9E01 13 Gemmatimonadetes 4.7E07 4.5E06 1.5E05 4.3E05 1.6E05 1.4E05 14 NOT_LABELED 2.5E03 1.6E03 3.5E02 2.5E03 2.3E02 5.5E03 15 Planctomycetes 1.1E05 5.8E06 3.5E05 0.0E+00 2.0E06 0.0E+00 16 Proteobacteria 4.8E01 1.6E02 7.5E02 1.1E03 4.2E03 1.3E03 17 Spirochaetes 0.0E+00 0.0E+00 0.0E+00 7.8E06 3.8E04 8.8E07 18 Synergistetes 0.0E+00 5.3E07 0.0E+00 0.0E+00 0.0E+00 0.0E+00 19 Tenericutes 2.4E02 1.2E02 9.8E02 2.4E05 6.1E04 3.6E05 20 Thermodesulfobacteria 1.4E06 2.4E06 5.4E07 5.1E06 1.0E06 2.6E06 21 Thermotogae 1.4E06 5.3E07 0.0E+00 9.2E07 5.1E07 1.5E06 22 Verrucomicrobia 2.3E04 1.3E04 1.0E03 2.4E05 1.8E04 3.0E05 Taxon ID CM Atm+/+ Colon RM Atm+/+ Colon 1 1.5E03 1.2E03 1.3E03 2.4E03 1.8E03 1.3E03 2 4.0E04 5.3E04 5.7E04 3.3E04 1.3E04 2.4E04 3 0.0E+00 0.0E+00 0.0E+00 1.7E06 8.1E07 9.9E07 4 4.6E02 9.2E02 7.8E02 9.8E03 1.5E02 6.8E03 5 4.5E01 2.9E01 4.6E01 7.8E01 8.4E01 6.4E01 6 2.0E04 1.6E04 1.2E04 0.0E+00 0.0E+00 0.0E+00 7 3.7E06 1.8E05 7.6E07 1.0E04 2.8E05 2.1E04 8 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 9 2.2E04 3.0E03 9.9E04 2.7E05 2.4E05 9.9E06 10 7.8E05 6.3E05 6.6E05 0.0E+00 0.0E+00 0.0E+00 11 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 12 4.0E01 4.3E01 3.5E01 1.9E01 1.3E01 3.3E01 13 0.0E+00 3.4E05 1.6E05 2.4E05 1.3E05 0.0E+00 14 9.9E03 1.5E02 2.5E02 1.7E02 1.3E02 2.4E02 15 2.8E05 2.8E05 2.1E05 0.0E+00 8.1E07 5.0E07 16 9.9E02 1.6E01 8.4E02 1.0E03 4.3E04 1.2E03 17 9.2E07 0.0E+00 0.0E+00 2.9E04 5.2E05 2.5E04 18 0.0E+00 3.3E06 0.0E+00 3.3E06 8.1E07 4.0E06 19 4.6E04 1.8E03 7.6E04 5.7E05 2.0E04 1.8E05 20 9.2E07 0.0E+00 0.0E+00 2.2E06 0.0E+00 0.0E+00 21 4.6E07 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 22 1.2E05 2.4E05 3.7E05 7.2E06 1.1E05 4.8E05 CM Atm/ Small Intestine 1 1.0E03 9.4E03 9.2E04 9.1E05 5.8E03 6.3E03 4.9E03 2 8.5E05 6.0E04 1.1E04 1.8E06 8.8E04 5.2E04 3.4E04 3 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 4 3.6E04 6.5E03 6.5E03 3.9E05 1.1E01 6.1E02 7.5E02 5 2.2E04 4.5E02 2.9E02 9.1E05 2.7E01 4.9E01 3.3E01 6 5.3E06 4.7E05 2.1E05 0.0E+00 2.9E05 1.5E05 3.8E05 7 0.0E+00 9.4E05 7.7E07 0.0E+00 5.5E05 1.2E05 7.7E05 8 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 9 4.8E05 9.4E04 3.4E05 7.8E07 3.8E04 6.6E05 3.0E04 10 0.0E+00 2.7E06 5.8E06 0.0E+00 2.9E05 0.0E+00 1.7E06 11 1.3E06 1.8E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 4.3E07 12 1.1E01 5.1E01 7.5E01 1.7E03 3.1E01 3.7E01 3.6E01 13 6.3E07 4.4E06 8.6E05 0.0E+00 1.1E05 2.9E05 3.0E06 14 6.9E03 3.8E03 1.7E01 2.5E05 9.6E03 1.4E02 1.1E02 15 1.3E06 2.8E05 4.6E06 0.0E+00 1.8E05 4.4E06 1.7E05 16 5.9E01 1.6E01 4.7E02 1.0E+00 1.7E01 4.2E02 9.8E02 17 0.0E+00 2.5E05 3.8E07 0.0E+00 0.0E+00 0.0E+00 2.1E05 18 0.0E+00 1.9E04 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 19 2.9E01 2.6E01 6.2E04 5.3E05 1.2E01 1.8E02 1.1E01 20 0.0E+00 4.4E07 8.8E06 0.0E+00 1.2E04 0.0E+00 8.5E07 21 0.0E+00 4.4E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 4.3E07 22 2.3E05 7.3E04 1.3E05 3.1E06 2.4E04 3.2E04 2.6E04 RM Atm/ Small Intestine 1 4.2E02 2.5E03 6.3E04 8.7E04 2 8.0E03 5.8E04 1.7E04 8.0E05 3 1.9E06 6.8E07 9.4E07 0.0E+00 4 3.8E04 5.5E03 6.4E03 1.3E02 5 5.9E02 3.6E01 4.2E01 4.7E01 6 0.0E+00 0.0E+00 0.0E+00 0.0E+00 7 1.8E03 9.2E05 3.0E05 2.1E05 8 0.0E+00 0.0E+00 0.0E+00 0.0E+00 9 5.6E06 1.2E05 6.6E06 1.1E05 10 0.0E+00 0.0E+00 0.0E+00 0.0E+00 11 0.0E+00 1.4E05 0.0E+00 0.0E+00 12 7.1E01 6.1E01 5.6E01 4.8E01 13 7.7E05 9.7E05 3.0E04 3.3E05 14 3.3E02 1.7E02 1.5E02 3.0E02 15 1.2E05 0.0E+00 0.0E+00 0.0E+00 16 1.4E01 2.1E03 5.1E04 3.3E04 17 9.0E04 1.1E05 2.2E06 0.0E+00 18 8.6E06 6.8E07 0.0E+00 0.0E+00 19 1.5E04 2.0E05 3.0E05 1.6E05 20 2.5E06 6.8E07 6.3E07 1.3E06 21 0.0E+00 6.8E07 0.0E+00 3.2E07 22 6.3E03 3.6E05 6.0E06 4.5E06 CM Atm/ Colon 1 3.9E03 2.5E03 2.7E03 9.4E04 3.9E03 3.6E03 1.3E03 2 1.1E03 4.6E04 9.4E04 1.3E04 8.3E04 4.0E04 5.2E04 3 0.0E+00 0.0E+00 0.0E+00 1.5E06 7.7E07 0.0E+00 0.0E+00 4 2.7E02 2.0E02 8.2E02 1.9E02 1.1E01 6.3E02 5.1E02 5 1.1E02 3.1E01 1.4E01 3.6E02 4.2E01 5.3E01 3.2E01 6 1.4E04 1.8E04 1.5E04 3.3E06 1.0E04 3.7E05 2.3E04 7 9.3E05 2.4E05 4.2E05 1.7E05 2.6E05 8.6E06 1.8E05 8 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 9 3.7E03 1.5E03 5.0E03 6.5E05 1.0E03 3.7E04 5.6E04 10 1.3E04 9.5E05 1.6E04 9.9E05 6.8E05 2.9E05 1.0E04 11 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 12 5.1E01 4.5E01 4.9E01 2.0E02 2.9E01 1.6E01 5.0E01 13 6.1E06 1.1E05 2.0E05 3.0E07 9.2E06 2.3E05 1.9E06 14 2.0E02 8.4E03 4.3E02 3.7E03 1.6E02 1.5E02 9.1E03 15 2.4E05 2.3E05 4.7E05 9.1E07 2.2E05 5.4E06 3.5E05 16 4.2E01 2.0E01 2.4E01 9.2E01 1.5E01 2.3E01 1.2E01 17 1.8E05 3.6E05 0.0E+00 0.0E+00 6.9E06 0.0E+00 2.6E05 18 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 19 1.3E03 1.1E03 8.2E05 8.0E04 2.1E03 5.6E04 3.3E04 20 0.0E+00 0.0E+00 1.8E04 3.1E05 1.5E04 1.1E05 0.0E+00 21 0.0E+00 1.0E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 22 1.0E04 4.9E05 4.3E05 9.4E06 6.9E05 4.2E04 1.7E05 RM Atm/ Colon 1 2.3E03 3.1E03 2.6E03 1.7E03 2 7.0E04 5.4E04 3.2E04 2.0E04 3 4.9E06 1.9E06 1.1E06 2.1E06 4 1.9E02 1.7E02 2.6E02 1.0E02 5 5.8E01 4.9E01 6.9E01 6.5E01 6 0.0E+00 0.0E+00 0.0E+00 0.0E+00 7 1.2E04 6.2E05 1.4E04 1.2E04 8 0.0E+00 0.0E+00 0.0E+00 0.0E+00 9 1.5E05 1.4E05 2.5E05 9.4E06 10 0.0E+00 0.0E+00 0.0E+00 0.0E+00 11 0.0E+00 0.0E+00 0.0E+00 0.0E+00 12 3.7E01 4.7E01 2.5E01 3.1E01 13 4.5E05 1.4E05 5.7E06 1.1E05 14 2.5E02 2.1E02 3.0E02 2.9E02 15 3.8E06 4.7E06 2.9E06 1.3E06 16 1.8E03 1.2E03 1.1E03 4.0E04 17 1.5E04 1.7E04 5.1E05 1.2E04 18 7.5E07 4.7E07 0.0E+00 0.0E+00 19 6.9E04 2.7E04 1.0E04 3.3E05 20 1.5E06 0.0E+00 5.7E07 0.0E+00 21 7.5E07 0.0E+00 1.1E06 0.0E+00 22 4.7E05 2.7E05 1.7E05 1.7E05

    [0392] An analysis of the rRNA gene sequences at a finer taxonomic level revealed several large operational taxonomic units (OTUs) from the intestinal mucosa that were differentially abundant in CM and RM mice (FIG. 5A). Differentially abundant OTUs were considered worthy of further study because they might represent individual bacterial species participating in the enhancement or inhibition of systemic genotoxicity or other pertinent CM-RM metrics. The closest BLAST hit of one of the most abundant OTUs in many RM habitats was Porphyromonas asaccharolytica (98% identity to CP002689, 43% coverage) (see black asterisks in FIG. 5A). This phylotype was significantly more abundant in the colon of RM than CM in both Atm.sup./ and Atm.sup.+/+ mice, and comprised at least 50% of the total sequencing reads from these habitats (FIG. 5B), warranting further investigation as a potential inhibitor of systemic genotoxicity. Similarly, another OTU exhibiting higher populations in most of the RM habitats (FIG. 5C, and see white asterisks in FIG. 5A) had high sequence identity to Lactobacillus johnsonii (100% identity to CP002464, 100% coverage). A phylotype that was more abundant in CM than RM mice, and therefore a candidate for causing the observed genotoxicity, included a member of the Helicobacteriaceae (FIG. 2). A more comprehensive taxonomic analysis is provided in the Table 6:

    TABLE-US-00006 TABLE 6 Taxonomic Analysis Taxon ID Taxon 1 No blast hit; Other; Other; Other; Other; Other; Other 2 Actinobacteria; c_Actinobacteria; o_Acidimicrobiales; f_Acidimicrobiaceae; g_Acidimicrobium; s_NOT_LABELED 3 Actinobacteria; c_Actinobacteria; o_Acidimicrobiales; f_Acidimicrobiaceae; g_NOT_LABELED; s_NOT_LABELED 4 Actinobacteria; c_Actinobacteria; o_Acidimicrobiales; f_NOT_LABELED; g_NOT_LABELED; s_NOT_LABELED 5 Actinobacteria; c_Actinobacteria; o_Actinomycetales; f_Actinomycetaceae; g_Trueperella; s_NOT_LABELED 6 Actinobacteria; c_Actinobacteria; o_Actinomycetales; f_Corynebacteriaceae; g_Corynebacterium; s_Corynebacterium amycolatum 7 Actinobacteria; c_Actinobacteria; o_Actinomycetales; f_Corynebacteriaceae; g_Corynebacterium; s_Corynebacterium aurimucosum 8 Actinobacteria; c_Actinobacteria; o_Actinomycetales; f_Corynebacteriaceae; g_Corynebacterium; s_Corynebacterium diphtheriae 9 Actinobacteria; c_Actinobacteria; o_Actinomycetales; f_Corynebacteriaceae; g_Corynebacterium; s_Corynebacterium glutamicum 10 Actinobacteria; c_Actinobacteria; o_Actinomycetales; f_Corynebacteriaceae; g_Corynebacterium; s_Corynebacterium jeikeium 11 Actinobacteria; c_Actinobacteria; o_Actinomycetales; f_Corynebacteriaceae; g_Corynebacterium; s_Corynebacterium kroppenstedtii 12 Actinobacteria; c_Actinobacteria; o_Actinomycetales; f_Corynebacteriaceae; g_Corynebacterium; s_Corynebacterium resistens 13 Actinobacteria; c_Actinobacteria; o_Actinomycetales; f_Corynebacteriaceae; g_Corynebacterium; s_Corynebacterium ulcerans 14 Actinobacteria; c_Actinobacteria; o_Actinomycetales; f_Corynebacteriaceae; g_Corynebacterium; s_Corynebacterium variabile 15 Actinobacteria; c_Actinobacteria; o_Actinomycetales; f_Corynebacteriaceae; g_Corynebacterium; s_NOT_LABELED 16 Actinobacteria; c_Actinobacteria; o_Actinomycetales; f_Dermabacteraceae; g_Dermabacter; s_NOT_LABELED 17 Actinobacteria; c_Actinobacteria; o_Actinomycetales; f_Frankiaceae; g_Frankia; s_NOT_LABELED 18 Actinobacteria; c_Actinobacteria; o_Actinomycetales; f_Frankiaceae; g_NOT_LABELED; s_NOT_LABELED 19 Actinobacteria; c_Actinobacteria; o_Actinomycetales; f_Geodermatophilaceae; g_Geodermatophilus; s_Geodermatophilus obscurus 20 Actinobacteria; c_Actinobacteria; o_Actinomycetales; f_Gordoniaceae; g_Gordonia; s_Gordonia polyisoprenivorans 21 Actinobacteria; c_Actinobacteria; o_Actinomycetales; f_Intrasporangiaceae; g_NOT_LABELED; s_NOT_LABELED 22 Actinobacteria; c_Actinobacteria; o_Actinomycetales; f_Kineosporiaceae; g_Kineococcus; s_NOT_LABELED 23 Actinobacteria; c_Actinobacteria; o_Actinomycetales; f_Kineosporiaceae; g_NOT_LABELED; s_NOT_LABELED 24 Actinobacteria; c_Actinobacteria; o_Actinomycetales; f_Microbacteriaceae; g_Clavibacter; s_Clavibacter michiganensis 25 Actinobacteria; c_Actinobacteria; o_Actinomycetales; f_Microbacteriaceae; g_Microbacterium; s_NOT_LABELED 26 Actinobacteria; c_Actinobacteria; o_Actinomycetales; f_Microbacteriaceae; g_Rathayibacter; s_NOT_LABELED 27 Actinobacteria; c_Actinobacteria; o_Actinomycetales; f_Micrococcaceae; g_Renibacterium; s_Renibacterium salmoninarum 28 Actinobacteria; c_Actinobacteria; o_Actinomycetales; f_Micromonosporaceae; g_Actinoplanes; s_NOT_LABELED 29 Actinobacteria; c_Actinobacteria; o_Actinomycetales; f_Micromonosporaceae; g_Asanoa; s_NOT_LABELED 30 Actinobacteria; c_Actinobacteria; o_Actinomycetales; f_Micromonosporaceae; g_Micromonospora; s_NOT_LABELED 31 Actinobacteria; c_Actinobacteria; o_Actinomycetales; f_Mycobacteriaceae; g_Mycobacterium; s_Mycobacterium parascrofulaceum 32 Actinobacteria; c_Actinobacteria; o_Actinomycetales; f_Mycobacteriaceae; g_Mycobacterium; s_NOT_LABELED 33 Actinobacteria; c_Actinobacteria; o_Actinomycetales; f_NOT_LABELED; g_NOT_LABELED; s_NOT_LABELED 34 Actinobacteria; c_Actinobacteria; o_Actinomycetales; f_Nakamurellaceae; g_Humicoccus; s_NOT_LABELED 35 Actinobacteria; c_Actinobacteria; o_Actinomycetales; f_Nocardiaceae; g_Nocardia; s_NOT_LABELED 36 Actinobacteria; c_Actinobacteria; o_Actinomycetales; f_Nocardiaceae; g_Rhodococcus; s_Rhodococcus erythropolis 37 Actinobacteria; c_Actinobacteria; o_Actinomycetales; f_Nocardioidaceae; g_Nocardioides; s_NOT_LABELED 38 Actinobacteria; c_Actinobacteria; o_Actinomycetales; f_Promicromonosporaceae; g_Xylanimonas; s_Xylanimonas cellulosilytica 39 Actinobacteria; c_Actinobacteria; o_Actinomycetales; f_Propionibacteriaceae; g_Microlunatus; s_Microlunatus phosphovorus 40 Actinobacteria; c_Actinobacteria; o_Actinomycetales; f_Propionibacteriaceae; g_Propionibacterium; s_Propionibacterium granulosum 41 Actinobacteria; c_Actinobacteria; o_Actinomycetales; f_Pseudonocardiaceae; g_Saccharomonospora; s_Saccharomonospora viridis 42 Actinobacteria; c_Actinobacteria; o_Actinomycetale s; f_Pseudonocardiaceae; g_Saccharopolyspora; s_Saccharopolyspora erythraea 43 Actinobacteria; c_Actinobacteria; o_Actinomycetales; f_Streptomycetaceae; g_Kitasatospora; s_Kitasatospora setae 44 Actinobacteria; c_Actinobacteria; o_Actinomycetales; f_Streptomycetaceae; g_Streptomyces; s_NOT_LABELED 45 Actinobacteria; c_Actinobacteria; o_Actinomycetales; f_Streptomycetaceae; g_Streptomyces; s_Streptomyces avermitilis 46 Actinobacteria; c_Actinobacteria; o_Actinomycetales; f_Streptomycetaceae; g_Streptomyces; s_Streptomyces scabiei 47 Actinobacteria; c_Actinobacteria; o_Actinomycetales; f_Streptomycetaceae; g_Streptomyces; s_Streptomyces turgidiscabies 48 Actinobacteria; c_Actinobacteria; o_Bifidobacteriales; f_Bifidobacteriaceae; g_Bifidobacterium; s_Bifidobacterium pseudolongum 49 Actinobacteria; c_Actinobacteria; o_Bifidobacteriales; f_Bifidobacteriaceae; g_Gardnerella; s_Gardnerella vaginalis 50 Actinobacteria; c_Actinobacteria; o_Coriobacteriales; f_Coriobacteriaceae; g_Atopobium; s_Atopobium parvulum 51 Actinobacteria; c_Actinobacteria; o_Coriobacteriales; f_Coriobacteriaceae; g_Coriobacterium; s_Coriobacterium glomerans 52 Actinobacteria; c_Actinobacteria; o_Coriobacteriales; f_Coriobacteriaceae; g_Eggerthella; s_NOT_LABELED 53 Actinobacteria; c_Actinobacteria; o_Coriobacteriales; f_Coriobacteriaceae; g_Olsenella; s_Olsenella uli 54 Actinobacteria; c_Actinobacteria; o_NOT_LABELED; f_NOT_LABELED; g_NOT_LABELED; s_NOT_LABELED 55 Actinobacteria; c_Actinobacteria; o_Solirubrobacterales; f_Conexibacteraceae; g_Conexibacter; s_NOT_LABELED 56 Actinobacteria; c_Actinobacteria; o_environmental samples; f_NOT_LABELED; g_NOT_LABELED; s_NOT_LABELED 57 Aquificae; c_Aquificae; o_Aquificales; f_Desulfurobacteriaceae; g_Desulfurobacterium; s_Desulfurobacterium thermolithotrophum 58 Bacteroidetes; c_Bacteroidia; o_Bacteroidales; f_Bacteroidaceae; g_Bacteroides; s_Bacteroides fragilis 59 Bacteroidetes; c_Bacteroidia; o_Bacteroidales; f_Bacteroidaceae; g_Bacteroides; s_Bacteroides helcogenes 60 Bacteroidetes; c_Bacteroidia; o_Bacteroidales; f_Bacteroidaceae; g_Bacteroides; s_Bacteroides salanitronis 61 Bacteroidetes; c_Bacteroidia; o_Bacteroidales; f_Bacteroidaceae; g_Bacteroides; s_Bacteroides thetaiotaomicron 62 Bacteroidetes; c_Bacteroidia; o_Bacteroidales; f_Bacteroidaceae; g_Bacteroides; s_Bacteroides vulgatus 63 Bacteroidetes; c_Bacteroidia; o_Bacteroidales; f_Porphyromonadaceae; g_Odoribacter; s_Odoribacter splanchnicus 64 Bacteroidetes; c_Bacteroidia; o_Bacteroidales; f_Porphyromonadaceae; g_Parabacteroides; s_Parabacteroides distasonis 65 Bacteroidetes; c_Bacteroidia; o_Bacteroidales; f_Porphyromonadaceae; g_Porphyromonas; s_Porphyromonas gingivalis 66 Bacteroidetes; c_Bacteroidia; o_Bacteroidales; f_Porphyromonadaceae; g_Tannerella; s_Tannerella forsythia 67 Bacteroidetes; c_Bacteroidia; o_Bacteroidales; f_Prevotellaceae; g_Prevotella; s_Prevotella ruminicola 68 Bacteroidetes; c_Cytophagia; o_Cytophagales; f_Cyclobacteriaceae; g_Cyclobacterium; s_Cyclobacterium marinum 69 Bacteroidetes; c_Cytophagia; o_Cytophagales; f_Cytophagaceae; g_Dyadobacter; s_Dyadobacter fermentans 70 Bacteroidetes; c_Cytophagia; o_Cytophagales; f_Cytophagaceae; g_Spirosoma; s_Spirosoma linguale 71 Bacteroidetes; c_Cytophagia; o_Cytophagales; f_Flammeovirgaceae; g_Marivirga; s_Marivirga tractuosa 72 Bacteroidetes; c_Flavobacteriia; o_Flavobacteriales; f_Blattabacteriaceae; g_Blattabacterium; s_Blattabacterium punctulatus 73 Bacteroidetes; c_Flavobacteriia; o_Flavobacteriales; f_Blattabacteriaceae; g_Blattabacterium; s_Blattabacterium sp. (Periplaneta americana) 74 Bacteroidetes; c_Flavobacteriia; o_Flavobacteriales; f_Cryomorphaceae; g_NOT_LABELED; s_Owenweeksia hongkongensis 75 Bacteroidetes; c_Flavobacteriia; o_Flavobacteriales; f_Flavobacteriaceae; g_Capnocytophaga; s_Capnocytophaga canimorsus 76 Bacteroidetes; c_Flavobacteriia; o_Flavobacteriales; f_Flavobacteriaceae; g_Croceibacter; s_Croceibacter atlanticus 77 Bacteroidetes; c_Flavobacteriia; o_Flavobacteriales; f_Flavobacteriaceae; g_Gramella; s_Gramella forsetii 78 Bacteroidetes; c_Sphingobacteriia; o_Sphingobacteriales; f_Sphingobacteriaceae; g_Pedobacter; s_Pedobacter saltans 79 Bacteroidetes/Chlorobi group; c_Bacteroidia; o_Bacteroidales; f_Bacteroidaceae; g_Bacteroides; s_Bacteroides caccae 80 Bacteroidetes/Chlorobi group; c_Bacteroidia; o_Bacteroidales; f_Bacteroidaceae; g_Bacteroides; s_Bacteroides fragilis 81 Bacteroidetes/Chlorobi group; c_Bacteroidia; o_Bacteroidales; f_Bacteroidaceae; g_Bacteroides; s_Bacteroides uniformis 82 Bacteroidetes/Chlorobi group; c_Bacteroidia; o_Bacteroidales; f_Bacteroidaceae; g_Bacteroides; s_NOT_LABELED 83 Bacteroidetes/Chlorobi group; c_Bacteroidia; o_Bacteroidales; f_NOT_LABELED; g_NOT_LABELED; s_NOT_LABELED 84 Bacteroidetes/Chlorobi group; c_Bacteroidia; o_Bacteroidales; f_Porphyromonadaceae; g_Dysgonomonas; s_NOT_LABELED 85 Bacteroidetes/Chlorobi group; c_Bacteroidia; o_Bacteroidales f_Porphyromonadaceae; g_Porphyromonas; s_NOT_LABELED 86 Bacteroidetes/Chlorobi group; c_Bacteroidia; o_Bacteroidales; f_Porphyromonadaceae; g_Porphyromonas; s_Porphyromonas asaccharolytica 87 Bacteroidetes/Chlorobi group; c_Bacteroidia; o_Bacteroidales; f_Porphyromonadaceae; g_Porphyromonas; s_Porphyromonas endodontalis 88 Bacteroidetes/Chlorobi group; c_Bacteroidia; o_Bacteroidales; f_Porphyromonadaceae; g_Porphyromonas; s_Porphyromonas levii 89 Bacteroidetes/Chlorobi group; c_Bacteroidia; o_Bacteroidales; f_Prevotellaceae; g_Prevotella; s_Prevotella intermedia 90 Bacteroidetes/Chlorobi group; c_Bacteroidia; o_Bacteroidales; f_Prevotellaceae; g_Prevotella; s_Prevotella melaninogenica 91 Bacteroidetes/Chlorobi group; c_Flavobacteriia; o_Flavobacteriales; f_Flavobacteriaceae; g_Bergeyella; s_NOT_LABELED 92 Bacteroidetes/Chlorobi group; c_Flavobacteriia; o_Flavobacteriales; f_Flavobacteriaceae; g_Chryseobacterium; s_NOT_LABELED 93 Bacteroidetes/Chlorobi group; c_Flavobacteriia; o_Flavobacteriales; f_Flavobacteriaceae; g_Elizabethkingia; s_NOT_LABELED 94 Bacteroidetes/Chlorobi group; c_Flavobacteriia; o_Flavobacteriales; f_Flavobacteriaceae; g_Flavobacterium; s_Flavobacterium columnare 95 Bacteroidetes/Chlorobi group; c_Flavobacteriia; o_Flavobacteriales; f_Flavobacteriaceae; g_Riemerella; s_Riemerella anatipestifer 96 Bacteroidetes/Chlorobi group; c_NOT_LABELED; o_NOT_LABELED; f_NOT_LABELED; g_NOT_LABELED; s_NOT_LABELED 97 Bacteroidetes/Chlorobi group; c_Sphingobacteriia; o_Sphingobacteriales; f_NOT_LABELED; g_NOT_LABELED; s_NOT_LABELED 98 Chlamydiae/Verrucomicrobia group; c_Opitutae; o_NOT_LABELED; f_Opitutaceae; g_Opitutus; s_NOT_LABELED 99 Chlamydiae/Verrucomicrobia group; c_Verrucomicrobiae; o_Verrucomicrobiales; f_NOT_LABELED; g_NOT_LABELED; s_NOT_LABELED 100 Chloroflexi; c_Caldilineae; o_Caldilineales; f_Caldilineaceae; g_Caldilinea; s_Caldilinea aerophila 101 Chloroflexi; c_Chloroflexi; o_Chloroflexales; f_Chloroflexaceae; g_Chloroflexus; s_NOT_LABELED 102 Chloroflexi; c_Chloroflexi; o_Chloroflexales; f_Chloroflexaceae; g_Roseiflexus; s_Roseiflexus castenholzii 103 Chloroflexi; c_Chloroflexi; o_Herpetosiphonales; f_Herpetosiphonaceae; g_Herpetosiphon; s_Herpetosiphon aurantiacus 104 Chrysiogenetes; c_Chrysiogenetes; o_Chrysiogenales; f_Chrysiogenaceae; g_Desulfuris pirillum; s_Desulfurispirillum indicum 105 Cyanobacteria; c_NOT_LABELED; o_Chroococcales; f_NOT_LABELED; g_Acaryochloris; s_NOT_LABELED 106 Cyanobacteria; c_NOT_LABELED; o_NOT_LABELED; f_NOT_LABELED; g_NOT_LABELED; s_NOT_LABELED 107 Cyanobacteria; c_NOT_LABELED; o_Oscillatoriales; f_NOT_LABELED; g_Lyngbya; s NOT LABELED 108 Cyanobacteria; c_NOT_LABELED; o_Oscillatoriales; f_NOT_LABELED; g_Microcoleus; s_Microcoleus steenstrupii 109 Deferribacteres; c_Deferribacteres; o_Deferribacterales; f_Deferribacteraceae; g_Denitrovibrio; s_Denitrovibrio acetiphilus 110 Deferribacteres; c_Deferribacteres; o_Deferribacterales; f_Deferribacteraceae; g_Flexistipes; s_Flexistipes sinusarabici 111 Fibrobacteres/Acidobacteria group; c_Acidobacteriia; o_Acidobacteriales; f_Acidobacteriaceae; g_NOT_LABELED; s_NOT_LABELED 112 Fibrobacteres/Acidobacteria group; c_NOT_LABELED; o_NOT_LABELED; f_NOT_LABELED; g_NOT_LABELED; s_NOT_LABELED 113 Fibrobacteres/Acidobacteria group; c_Solibacteres; o_Solibacterales; f_Solibacteraceae; g_Candidatus Solibacter; s_NOT_LABELED 114 Firmicutes; c_Bacilli; o_Bacillales; f_Alicyclobacillaceae; g_Alicyclobacillus; s_Alicyclobacillus acidocaldarius 115 Firmicutes; c_Bacilli; o_Bacillales; f_Alicyclobacillaceae; g_Alicyclobacillus; s_NOT_LABELED 116 Firmicutes; c_Bacilli; o_Bacillales; f_Alicyclobacillaceae; g_Kyrpidia; s_Kyrpidia tusciae 117 Firmicutes; c_Bacilli; o_Bacillales; f_Bacillaceae; g_Amphibacillus; s_NOT_LABELED 118 Firmicutes; c_Bacilli; o_Bacillales; f_Bacillaceae; g_Anoxybacillus; s_Anoxybacillus flavithermus 119 Firmicutes; c_Bacilli; o_Bacillales; f_Bacillaceae; g_Bacillus; s_Bacillus cellulosilyticus 120 Firmicutes; c_Bacilli; o_Bacillales; f_Bacillaceae; g_Bacillus; s_Bacillus cereus 121 Firmicutes; c_Bacilli; o_Bacillales; f_Bacillaceae; g_Bacillus; s_Bacillus circulans 122 Firmicutes; c_Bacilli; o_Bacillales; f_Bacillaceae; g_Bacillus; s_Bacillus coagulans 123 Firmicutes; c_Bacilli; o_Bacillales; f_Bacillaceae; g_Bacillus; s_Bacillus halodurans 124 Firmicutes; c_Bacilli; o_Bacillales; f_Bacillaceae; g_Bacillus; s_Bacillus megaterium 125 Firmicutes; c_Bacilli; o_Bacillales; f_Bacillaceae; g_Bacillus; s_Bacillus pseudofirmus 126 Firmicutes; c_Bacilli; o_Bacillales; f_Bacillaceae; g_Bacillus; s_Bacillus pumilus 127 Firmicutes; c_Bacilli; o_Bacillales; f_Bacillaceae; g_Bacillus; s_Bacillus subtilis group 128 Firmicutes; c_Bacilli; o_Bacillales; f_Bacillaceae; g_Bacillus; s_NOT_LABELED 129 Firmicutes; c_Bacilli; o_Bacillales; f_Bacillaceae; g_Geobacillus; s_Geobacillus stearothermophilus 130 Firmicutes; c_Bacilli; o_Bacillales; f_Bacillaceae; g_Geobacillus; s_Geobacillus thermoglucosidasius 131 Firmicutes; c_Bacilli; o_Bacillales; f_Bacillaceae; g_Geobacillus; s_NOT_LABELED 132 Firmicutes; c_Bacilli; o_Bacillales; f_Bacillaceae; g_Gracilibacillus; s_NOT_LABELED 133 Firmicutes; c_Bacilli; o_Bacillales; f_Bacillaceae; g_Halobacillus; s_Halobacillus halophilus 134 Firmicutes; c_Bacilli; o_Bacillales; f_Bacillaceae; g_Halobacillus; s_NOT_LABELED 135 Firmicutes; c_Bacilli; o_Bacillales; f_Bacillaceae; g_Lysinibacillus; s_Lysinibacillus sphaericus 136 Firmicutes; c_Bacilli; o_Bacillales; f_Bacillaceae; g_Lysinibacillus; s_NOT_LABELED 137 Firmicutes; c_Bacilli; o_Bacillales; f_Bacillaceae; g_NOT_LABELED; s_NOT_LABELED 138 Firmicutes; c_Bacilli; o_Bacillales; f_Bacillaceae; g_Oceanobacillus; s_Oceanobacillus iheyensis 139 Firmicutes; c_Bacilli; o_Bacillales; f_Bacillaceae; g_Virgibacillus; s_NOT_LABELED 140 Firmicutes; c_Bacilli; o_Bacillales; f_Listeriaceae; g_Listeria; s_Listeria ivanovii 141 Firmicutes; c_Bacilli; o_Bacillales; f_NOT_LABELED; g_Exiguobacterium; s_NOT_LABELED 142 Firmicutes; c_Bacilli; o_Bacillales; f_NOT_LABELED; g_Gemella; s_Gemella haemolysans 143 Firmicutes; c_Bacilli; o_Bacillales; f_NOT_LABELED; g_Gemella; s_Gemella morbillorum 144 Firmicutes; c_Bacilli; o_Bacillales; f_NOT_LABELED; g_Gemella; s_Gemella sanguinis 145 Firmicutes; c_Bacilli; o_Bacillales; f_NOT_LABELED; g_Gemella; s_NOT_LABELED 146 Firmicutes; c_Bacilli; o_Bacillales; f_Paenibacillaceae; g_Brevibacillus; s_Brevibacillus brevis 147 Firmicutes; c_Bacilli; o_Bacillales; f_Paenibacillaceae; g_Brevibacillus; s_NOT_LABELED 148 Firmicutes; c_Bacilli; o_Bacillales; f_Paenibacillaceae; g_Paenibacillus; s_NOT_LABELED 149 Firmicutes; c_Bacilli; o_Bacillales; f_Paenibacillaceae; g_Paenibacillus; s_Paenibacillus larvae 150 Firmicutes; c_Bacilli; o_Bacillales; f_Pasteuriaceae; g_Pasteuria; s_NOT_LABELED 151 Firmicutes; c_Bacilli; o_Bacillales; f_Planococcaceae; g_Ureibacillus; s_NOT_LABELED 152 Firmicutes; c_Bacilli; o_Bacillales; f_Planococcaceae; g_Ureibacillus; s_Ureibacillus thermosphaericus 153 Firmicutes; c_Bacilli; o_Bacillales; f_Sporolactobacillaceae; g_Sporolactobacillus; s_NOT_LABELED 154 Firmicutes; c_Bacilli; o_Bacillales; f_Staphylococcaceae; g_Staphylococcus; s_NOT_LABELED 155 Firmicutes; c_Bacilli; o_Bacillales; f_Staphylococcaceae; g_Staphylococcus; s_Staphylococcus aureus 156 Firmicutes; c_Bacilli; o_Bacillales; f_Staphylococcaceae; g_Staphylococcus; s_Staphylococcus epidermidis 157 Firmicutes; c_Bacilli; o_Bacillales; f_Staphylococcaceae; g_Staphylococcus; s_Staphylococcus saprophyticus 158 Firmicutes; c_Bacilli; o_Bacillales; f_Staphylococcaceae; g_Staphylococcus; s_Staphylococcus simulans 159 Firmicutes; c_Bacilli; o_Lactobacillales; f_Aerococcaceae; g_Abiotrophia; s_Abiotrophia defectiva 160 Firmicutes; c_Bacilli; o_Lactobacillales; f_Carnobacteriaceae; g_Atopostipes; s_NOT_LABELED 161 Firmicutes; c_Bacilli; o_Lactobacillales; f_Carnobacteriaceae; g_Granulicatella; s_Granulicatella adiacens 162 Firmicutes; c_Bacilli; o_Lactobacillales; f_Carnobacteriaceae; g_Granulicatella; s_Granulicatella elegans 163 Firmicutes; c_Bacilli; o_Lactobacillales; f_Enterococcaceae; g_Enterococcus; s_Enterococcus faecalis 164 Firmicutes; c_Bacilli; o_Lactobacillales; f_Enterococcaceae; g_Enterococcus; s_NOT_LABELED 165 Firmicutes; c_Bacilli; o_Lactobacillales; f_Enterococcaceae; g_Melissococcus; s_Melissococcus plutonius 166 Firmicutes; c_Bacilli; o_Lactobacillales; f_Lactobacillaceae; g_Lactobacillus; s_Lactobacillus acidophilus 167 Firmicutes; c_Bacilli; o_Lactobacillales; f_Lactobacillaceae; g_Lactobacillus; s_Lactobacillus animalis 168 Firmicutes; c_Bacilli; o_Lactobacillales; f_Lactobacillaceae; g_Lactobacillus; s_Lactobacillus delbrueckii 169 Firmicutes; c_Bacilli; o_Lactobacillales; f_Lactobacillaceae; g_Lactobacillus; s_Lactobacillus gasseri 170 Firmicutes; c_Bacilli; o_Lactobacillales; f_Lactobacillaceae; g_Lactobacillus; s_Lactobacillus hilgardii 171 Firmicutes; c_Bacilli; o_Lactobacillales; f_Lactobacillaceae; g_Lactobacillus; s_Lactobacillus jensenii 172 Firmicutes; c_Bacilli; o_Lactobacillales; f_Lactobacillaceae; g_Lactobacillus; s_Lactobacillus johnsonii 173 Firmicutes; c_Bacilli; o_Lactobacillales; f_Lactobacillaceae; g_Lactobacillus; s_Lactobacillus kefiranofaciens 174 Firmicutes; c_Bacilli; o_Lactobacillales; f_Lactobacillaceae; g_Lactobacillus; s_Lactobacillus reuteri 175 Firmicutes; c_Bacilli; o_Lactobacillales; f_Lactobacillaceae; g_Lactobacillus; s_NOT_LABELED 176 Firmicutes; c_Bacilli; o_Lactobacillales; f_Lactobacillaceae; g_Pediococcus; s_Pediococcus acidilactici 177 Firmicutes; c_Bacilli; o_Lactobacillales; f_Leuconostocaceae; g_Leuconostoc; s_Leuconostoc mesenteroides 178 Firmicutes; c_Bacilli; o_Lactobacillales; f_Leuconostocaceae; g_Weissella; s_NOT_LABELED 179 Firmicutes; c_Bacilli; o_Lactobacillales; f_Streptococcaceae; g_Lactococcus; s_Lactococcus lactis 180 Firmicutes; c_Bacilli; o_Lactobacillales; f_Streptococcaceae; g_Streptococcus; s_Streptococcus agalactiae 181 Firmicutes; c_Bacilli; o_Lactobacillales; f_Streptococcaceae; g_Streptococcus; s_Streptococcus anginosus 182 Firmicutes; c_Bacilli; o_Lactobacillales; f_Streptococcaceae; g_Streptococcus; s_Streptococcus australis 183 Firmicutes; c_Bacilli; o_Lactobacillales; f_Streptococcaceae; g_Streptococcus; s_Streptococcus criceti 184 Firmicutes; c_Bacilli; o_Lactobacillales; f_Streptococcaceae; g_Streptococcus; s_Streptococcus cristatus 185 Firmicutes; c_Bacilli; o_Lactobacillales; f_Streptococcaceae; g_Streptococcus; s_Streptococcus dysgalactiae group 186 Firmicutes; c_Bacilli; o_Lactobacillales; f_Streptococcaceae; g_Streptococcus; s_Streptococcus gordonii 187 Firmicutes; c_Bacilli; o_Lactobacillales; f_Streptococcaceae; g_Streptococcus; s_Streptococcus infantarius 188 Firmicutes; c_Bacilli; o_Lactobacillales; f_Streptococcaceae; g_Streptococcus; s_Streptococcus infantis 189 Firmicutes; c_Bacilli; o_Lactobacillales; f_Streptococcaceae; g_Streptococcus; s_Streptococcus intermedius 190 Firmicutes; c_Bacilli; o_Lactobacillales; f_Streptococcaceae; g_Streptococcus; s_Streptococcus pneumoniae 191 Firmicutes; c_Bacilli; o_Lactobacillales; f_Streptococcaceae; g_Streptococcus; s_Streptococcus pyogenes 192 Firmicutes; c_Bacilli; o_Lactobacillales; f_Streptococcaceae; g_Streptococcus; s_Streptococcus sanguinis 193 Firmicutes; c_Bacilli; o_Lactobacillales; f_Streptococcaceae; g_Streptococcus; s_Streptococcus sobrinus 194 Firmicutes; c_Bacilli; o_Lactobacillales; f_Streptococcaceae; g_Streptococcus; s_Streptococcus thermophilus 195 Firmicutes; c_Bacilli; o_Lactobacillales; f_Streptococcaceae; g_Streptococcus; s_Streptococcus uberis 196 Firmicutes; c_Clostridia; o_Clostridiales; f_Clostridiaceae; g_Alkaliphilus; s_Alkaliphilus metalliredigens 197 Firmicutes; c_Clostridia; o_Clostridiales; f_Clostridiaceae; g_Alkaliphilus; s_Alkaliphilus oremlandii 198 Firmicutes; c_Clostridia; o_Clostridiales; f_Clostridiaceae; g_Alkaliphilus; s_NOT_LABELED 199 Firmicutes; c_Clostridia; o_Clostridiales; f_Clostridiaceae; g_Candidatus Arthromitus; s_James_SFB 200 Firmicutes; c_Clostridia; o_Clostridiales; f_Clostridiaceae; g_Candidatus Arthromitus; s_NOT_LABELED 201 Firmicutes; c_Clostridia; o_Clostridiales; f_Clostridiaceae; g_Clostridium; s_Clostridium botulinum 202 Firmicutes; c_Clostridia; o_Clostridiales; f_Clostridiaceae; g_Clostridium; s_Clostridium cellulolyticum 203 Firmicutes; c_Clostridia; o_Clostridiales; f_Clostridiaceae; g_Clostridium; s_Clostridium innocuum 204 Firmicutes; c_Clostridia; o_Clostridiales; f_Clostridiaceae; g_Clostridium; s_Clostridium kluyveri 205 Firmicutes; c_Clostridia; o_Clostridiales; f_Clostridiaceae; g_Clostridium; s_Clostridium ljungdahlii 206 Firmicutes; c_Clostridia; o_Clostridiales; f_Clostridiaceae; g_Clostridium; s_Clostridium novyi 207 Firmicutes; c_Clostridia; o_Clostridiales; f_Clostridiaceae; g_Clostridium; s_Clostridium phytofermentans 208 Firmicutes; c_Clostridia; o_Clostridiales; f_Clostridiaceae; g_Clostridium; s_Clostridium saccharolyticum 209 Firmicutes; c_Clostridia; o_Clostridiales; f_Clostridiaceae; g_Clostridium; s_Clostridium thermocellum 210 Firmicutes; c_Clostridia; o_Clostridiales; f_Clostridiaceae; g_Clostridium; s_NOT_LABELED 211 Firmicutes; c_Clostridia; o_Clostridiales; f_Clostridiaceae; g_NOT_LABELED; s_NOT_LABELED 212 Firmicutes; c_Clostridia; o_Clostridiales; f_Clostridiales Family XI. Incertae Sedis; g_Anaerococcus; s_Anaerococcus prevotii 213 Firmicutes; c_Clostridia; o_Clostridiales; f_Clostridiales Family XI. Incertae Sedis; g_Finegoldia; s_Finegoldia magna 214 Firmicutes; c_Clostridia; o_Clostridiales; f_Clostridiales Family XI. Incertae Sedis; g_NOT_LABELED; s_Parvimonas micra 215 Firmicutes; c_Clostridia; o_Clostridiales; f_Clostridiales Family XI. Incertae Sedis; g_Peptoniphilus; s_Peptoniphilus asaccharolyticus 216 Firmicutes; c_Clostridia; o_Clostridiales; f_Eubacteriaceae; g_Eubacterium; s_Eubacterium eligens 217 Firmicutes; c_Clostridia; o_Clostridiales; f_Eubacteriaceae; g_Eubacterium; s_Eubacterium limosum 218 Firmicutes; c_Clostridia; o_Clostridiales; f_Eubacteriaceae; g_Eubacterium; s_Eubacterium rectale 219 Firmicutes; c_Clostridia; o_Clostridiales; f_Eubacteriaceae; g_Eubacterium; s_NOT_LABELED 220 Firmicutes; c_Clostridia; o_Clostridiales; f_Heliobacteriaceae; g_Heliobacterium; s_Heliobacterium modesticaldum 221 Firmicutes; c_Clostridia; o_Clostridiales; f_Lachnospiraceae; g_Butyrivibrio; s_Clostridium proteoclasticum 222 Firmicutes; c_Clostridia; o_Clostridiales; f_Lachnospiraceae; g_Roseburia; s_Roseburia hominis 223 Firmicutes; c_Clostridia; o_Clostridiales; f_NOT_LABELED; g_NOT_LABELED; s_Clostridiales genomosp. BVAB3 224 Firmicutes; c_Clostridia; o_Clostridiales; f_NOT_LABELED; g_NOT_LABELED; s_NOT_LABELED 225 Firmicutes; c_Clostridia; o_Clostridiales; f_Oscillospiraceae; g_Oscillibacter; s_Oscillibacter valericigenes 226 Firmicutes; c_Clostridia; o_Clostridiales; f_Peptococcaceae; g_Cryptanaerobacter; s_NOT_LABELED 227 Firmicutes; c_Clostridia; o_Clostridiales; f_Peptococcaceae; g_Dehalobacter; s_Dehalobacter restrictus 228 Firmicutes; c_Clostridia; o_Clostridiales; f_Peptococcaceae; g_Desulfitobacterium; s_Desulfitobacterium hafniense 229 Firmicutes; c_Clostridia; o_Clostridiales; f_Peptococcaceae; g_Desulfosporosinus; s_Desulfosporosinus orientis 230 Firmicutes; c_Clostridia; o_Clostridiales; f_Peptococcaceae; g_Desulfotomaculum; s_Desulfotomaculum carboxydivorans 231 Firmicutes; c_Clostridia; o_Clostridiales; f_Peptococcaceae; g_Desulfotomaculum; s_Desulfotomaculum reducens 232 Firmicutes; c_Clostridia; o_Clostridiales; f_Peptococcaceae; g_Desulfotomaculum; s_Desulfotomaculum ruminis 233 Firmicutes; c_Clostridia; o_Clostridiales; f_Peptococcaceae; g_Syntrophobotulus; s_Syntrophobotulus glycolicus 234 Firmicutes; c_Clostridia; o_Clostridiales; f_Peptostreptococcaceae; g_Filifactor; s_Filifactor alocis 235 Firmicutes; c_Clostridia; o_Clostridiales; f_Peptostreptococcaceae; g_NOT_LABELED; s_(Clostridium) difficile 236 Firmicutes; c_Clostridia; o_Clostridiales; f_Ruminococcaceae; g_Ethanoligenens; s_Ethanoligenens harbinense 237 Firmicutes; c_Clostridia; o_Clostridiales; f_Ruminococcaceae; g_Ruminococcus; s_Ruminococcus albus 238 Firmicutes; c_Clostridia; o_Halanaerobiales; f_Halobacteroidaceae; g_Acetohalobium; s_Acetohalobium arabaticum 239 Firmicutes; c_Clostridia; o_NOT_LABELED; f_NOT_LABELED; g_NOT_LABELED; s_NOT_LABELED 240 Firmicutes; c_Clostridia; o_Thermoanaerobacterales; f_Thermoanaerobacteraceae; g_Ammonifex; s_Ammonifex degensii 241 Firmicutes; c_Clostridia; o_Thermoanaerobacterales; f_Thermoanaerobacteraceae; g_Carboxydothermus; s_Carboxydothermus hydrogenoformans 242 Firmicutes; c_Clostridia; o_Thermoanaerobacterales; f_Thermoanaerobacteraceae; g_Moorella; s_Moorella thermoacetica 243 Firmicutes; c_Clostridia; o_Thermoanaerobacterales; f_Thermoanaerobacteraceae; g_Thermoanaerobacter; s_Thermoanaerobacter brockii 244 Firmicutes; c_Clostridia; o_Thermoanaerobacterales; f_Thermoanaerobacterales Family III. Incertae Sedis; g_Thermoanaerobacterium; s_Thermoanaerobacterium xylanolyticum 245 Firmicutes; c_Clostridia; o_Thermoanaerobacterales; f_Thermoanaerobacterales Family III. Incertae Sedis; g_Thermosediminibacter; s_Thermosediminibacter oceani 246 Firmicutes; c_Clostridia; o_Thermoanaerobacterales; f_Thermoanaerobacterales Family IV. Incertae Sedis; g_Mahella; s_Mahella australiensis 247 Firmicutes; c_Clostridia; o_Thermoanaerobacterales; f_Thermodesulfobiaceae; g_Coprothermobacter; s_Coprothermobacter proteolyticus 248 Firmicutes; c_Erysipelotrichi; o_Erysipelotrichales; f_Erysipelotrichaceae; g_Bulleidia; s_NOT_LABELED 249 Firmicutes; c_Erysipelotrichi; o_Erysipelotrichales; f_Erysipelotrichaceae; g_Erysipelothrix; s_Erysipelothrix rhusiopathiae 250 Firmicutes; c_Erysipelotrichi; o_Erysipelotrichales; f_Erysipelotrichaceae; g_Erysipelothrix; s_Erysipelothrix tonsillarum 251 Firmicutes; c_Erysipelotrichi; o_Erysipelotrichales; f_Erysipelotrichaceae; g_Turicibacter; s_NOT_LABELED 252 Firmicutes; c_Erysipelotrichi; o_Erysipelotrichales; f_Erysipelotrichaceae; g_Turicibacter; s_Turicibacter sanguinis 253 Firmicutes; c_Erysipelotrichi; o_Erysipelotrichales; f_Erysipelotrichaceae; g_unclassified Erysipelotrichaceae; s_C10-JB-F 254 Firmicutes; c_Erysipelotrichi; o_Erysipelotrichales; f_Erysipelotrichaceae; g_unclassified Erysipelotrichaceae; s_D05-JB-F 255 Firmicutes; c_Erysipelotrichi; o_Erysipelotrichales; f_Erysipelotrichaceae; g_unclassified Erysipelotrichaceae; s_D07-JB-F 256 Firmicutes; c_Erysipelotrichi; o_Erysipelotrichales; f_Erysipelotrichaceae; g_unclassified Erysipelotrichaceae; s_E10-SI-F 257 Firmicutes; c_Erysipelotrichi; o_Erysipelotrichales; f_Erysipelotrichaceae; g_unclassified Erysipelotrichaceae; s_H04-C3H-DTT 258 Firmicutes; c_Erysipelotrichi; o_Erysipelotrichales; f_Erysipelotrichaceae; g_unclassified Erysipelotrichaceae; s_H07-A-CM-Large-DTT 259 Firmicutes; c_Erysipelotrichi; o_Erysipelotrichales; f_Erysipelotrichaceae; g_unclassified Erysipelotrichaceae; s_H08-A-CM-Large-DTT 260 Firmicutes; c_Erysipelotrichi; o_Erysipelotrichales; f_Erysipelotrichaceae; g_unclassified Erysipelotrichaceae; s_H08-C3H-DTT 261 Firmicutes; c_Erysipelotrichi; o_Erysipelotrichales; f_Erysipelotrichaceae; g_unclassified Erysipelotrichaceae; s_H09-A-RM-Sm-DTT 262 Firmicutes; c_Erysipelotrichi; o_Erysipelotrichales; f_Erysipelotrichaceae; g_unclassified Erysipelotrichaceae; s_H11-A-RM-Large-DTT 263 Firmicutes; c_NOT_LABELED; o_NOT_LABELED; f_NOT_LABELED; g_NOT_LABELED; s_NOT_LABELED 264 Firmicutes; c_Negativicutes; o_Selenomonadales; f_Acidaminococcaceae; g_Acidaminococcus; s_Acidaminococcus fermentans 265 Firmicutes; c_Negativicutes; o_Selenomonadales; f_Veillonellaceae; g_Megasphaera; s_NOT_LABELED 266 Firmicutes; c_Negativicutes; o_Selenomonadales; f_Veillonellaceae; g_Pectinatus; s_NOT_LABELED 267 Firmicutes; c_Negativicutes; o_Selenomonadales; f_Veillonellaceae; g_Veillonella; s_Veillonella parvula 268 Firmicutes; c_Negativicutes; o_Selenomonadales; f_Veillonellaceae; g_Zymophilus; s_NOT_LABELED 269 Gemmatimonadetes; c_Gemmatimonadetes; o_Gemmatimonadales; f_Gemmatimonadaceae; g_Gemmatimonas; s_NOT_LABELED 270 Gemmatimonadetes; c_Gemmatimonadetes; o_Gemmatimonadales; f_Gemmatimonadaceae; g_NOT_LABELED; s_NOT_LABELED 271 NOT_LABELED; c_NOT_LABELED; o_NOT_LABELED; f_NOT_LABELED; g_NOT_LABELED; s_NOT_LABELED 272 Planctomycetes; c_Planctomycetia; o_Planctomycetales; f_NOT_LABELED; g_NOT_LABELED; s_NOT_LABELED 273 Proteobacteria; c_Alphaproteobacteria; o_Caulobacterales; f_Caulobacteraceae; g_Caulobacter; s_Caulobacter segnis 274 Proteobacteria; c_Alphaproteobacteria; o_NOT_LABELED; f_NOT_LABELED; g_NOT_LABELED; s_NOT_LABELED 275 Proteobacteria; c_Alphaproteobacteria; o_Rhizobiales; f_Bradyrhizobiaceae; g_Bradyrhizobium; s_Bradyrhizobium japonicum 276 Proteobacteria; c_Alphaproteobacteria; o_Rhizobiales; f_Bradyrhizobiaceae; g_Bradyrhizobium; s_NOT_LABELED 277 Proteobacteria; c_Alphaproteobacteria; o_Rhizobiales; f_Bradyrhizobiaceae; g_NOT_LABELED; s_NOT_LABELED 278 Proteobacteria; c_Alphaproteobacteria; o_Rhizobiales; f_Bradyrhizobiaceae; g_Rhodopseudomonas; s_Rhodopseudomonas palustris 279 Proteobacteria; c_Alphaproteobacteria; o_Rhizobiales; f_NOT_LABELED; g_NOT_LABELED; s_NOT_LABELED 280 Proteobacteria; c_Alphaproteobacteria; o_Rhizobiales; f_Rhizobiaceae; g_Candidatus Liberibacter; s_Candidatus Liberibacter asiaticus 281 Proteobacteria; c_Alphaproteobacteria; o_Rhizobiales; f_Rhizobiaceae; g_Candidatus Liberibacter; s_NOT_LABELED 282 Proteobacteria; c_Alphaproteobacteria; o_Rhizobiales; f_Rhizobiaceae; g_Rhizobium; s_Rhizobium etli 283 Proteobacteria; c_Alphaproteobacteria; o_Rhizobiales; f_Xanthobacteraceae; g_NOT_LABELED; s_NOT_LABELED 284 Proteobacteria; c_Alphaproteobacteria; o_Rhodobacterales; f_Rhodobacteraceae; g_Paracoccus; s_Paracoccus denitrificans 285 Proteobacteria; c_Alphaproteobacteria; o_Rhodobacterales; f_Rhodobacteraceae; g_Rhodobacter; s_Rhodobacter sphaeroides 286 Proteobacteria; c_Alphaproteobacteria; o_Sphingomonadales; f_Sphingomonadaceae; g_NOT_LABELED; s_NOT_LABELED 287 Proteobacteria; c_Alphaproteobacteria; o_Sphingomonadales; f_Sphingomonadaceae; g_Sphingobium; s_Sphingobium chlorophenolicum 288 Proteobacteria; c_Alphaproteobacteria; o_Sphingomonadales; f_Sphingomonadaceae; g_Sphingomonas; s_NOT_LABELED 289 Proteobacteria; c_Alphaproteobacteria; o_Sphingomonadales; f_Sphingomonadaceae; g_Sphingopyxis; s_Sphingopyxis alaskensis 290 Proteobacteria; c_Betaproteobacteria; o_Burkholderiales; f_Alcaligenaceae; g_Achromobacter; s_Achromobacter xylosoxidans 291 Proteobacteria; c_Betaproteobacteria; o_Burkholderiales; f_Alcaligenaceae; g_Bordetella; s_Bordetella pertussis 292 Proteobacteria; c_Betaproteobacteria; o_Burkholderiales; f_Burkholderiaceae; g_Burkholderia; s_Burkholderia cepacia complex 293 Proteobacteria; c_Betaproteobacteria; o_Burkholderiales; f_Burkholderiaceae; g_Burkholderia; s_Burkholderia rhizoxinica 294 Proteobacteria; c_Betaproteobacteria; o_Burkholderiales; f_Burkholderiaceae; g_Cupriavidus; s_Cupriavidus metallidurans 295 Proteobacteria; c_Betaproteobacteria; o_Burkholderiales; f_Burkholderiaceae; g_Ralstonia; s_Ralstonia pickettii 296 Proteobacteria; c_Betaproteobacteria; o_Burkholderiales; f_Comamonadaceae; g_Delftia; s_Delftia acidovorans 297 Proteobacteria; c_Betaproteobacteria; o_Burkholderiales; f_Comamonadaceae; g_NOT_LABELED; s_NOT_LABELED 298 Proteobacteria; c_Betaproteobacteria; o_Burkholderiales; f_Comamonadaceae; g_Variovorax; s_NOT_LABELED 299 Proteobacteria; c_Betaproteobacteria; o_Burkholderiales; f_Comamonadaceae; g_Variovorax; s_Variovorax paradoxus 300 Proteobacteria; c_Betaproteobacteria; o_Burkholderiales; f_NOT_LABELED; g_Methylibium; s_Methylibium petroleiphilum 301 Proteobacteria; c_Betaproteobacteria; o_Burkholderiales; f_NOT_LABELED; g_Thiomonas; s_NOT_LABELED 302 Proteobacteria; c_Betaproteobacteria; o_Burkholderiales; f_Oxalobacteraceae; g_Collimonas; s_Collimonas fungivorans 303 Proteobacteria; c_Betaproteobacteria; o_Burkholderiales; f_Oxalobacteraceae; g_Herbaspirillum; s_NOT_LABELED 304 Proteobacteria; c_Betaproteobacteria; o_Burkholderiales; f_Oxalobacteraceae; g_Herminiimonas; s_NOT_LABELED 305 Proteobacteria; c_Betaproteobacteria; o_Burkholderiales; f_Oxalobacteraceae; g_Janthinobacterium; s_NOT_LABELED 306 Proteobacteria; c_Betaproteobacteria; o_Hydrogenophilales; f_Hydrogenophilaceae; g_Thiobacillus; s_NOT_LABELED 307 Proteobacteria; c_Betaproteobacteria; o_NOT_LABELED; f_NOT_LABELED; g_Kinetoplastibacterium; s_NOT_LABELED 308 Proteobacteria; c_Betaproteobacteria; o_NOT_LABELED; f_NOT_LABELED; g_NOT_LABELED; s_NOT_LABELED 309 Proteobacteria; c_Betaproteobacteria; o_Neisseriales; f_Neisseriaceae; g_Neisseria; s_Neisseria gonorrhoeae 310 Proteobacteria; c_Betaproteobacteria; o_Neisseriales; f_Neisseriaceae; g_Neisseria; s_Neisseria meningitidis 311 Proteobacteria; c_Betaproteobacteria; o_Nitrosomonadales; f_Nitrosomonadaceae; g_NOT_LABELED; s_NOT_LABELED 312 Proteobacteria; c_Betaproteobacteria; o_Rhodocyclales; f_Rhodocyclaceae; g_Azoarcus; s_NOT_LABELED 313 Proteobacteria; c_Deltaproteobacteria; o_Desulfovibrionales; f_Desulfovibrionaceae; g_Bilophila; s_Bilophila wadsworthia 314 Proteobacteria; c_Deltaproteobacteria; o_Desulfovibrionales; f_Desulfovibrionaceae; g_Desulfovibrio; s_Desulfovibrio desulfuricans 315 Proteobacteria; c_Deltaproteobacteria; o_Desulfovibrionales; f_Desulfovibrionaceae; g_Desulfovibrio; s_Desulfovibrio vulgaris 316 Proteobacteria; c_Deltaproteobacteria; o_Desulfovibrionales; f_Desulfovibrionaceae; g_Lawsonia; s_Lawsonia intracellularis 317 Proteobacteria; c_Deltaproteobacteria; o_Desulfuromonadales; f_Geobacteraceae; g_Geobacter; s_Geobacter uraniireducens 318 Proteobacteria; c_Deltaproteobacteria; o_Desulfuromonadales; f_NOT_LABELED; g_NOT_LABELED; s_NOT_LABELED 319 Proteobacteria; c_Deltaproteobacteria; o_Myxococcales; f_Kofleriaceae; g_Haliangium; s_NOT_LABELED 320 Proteobacteria; c_Deltaproteobacteria; o_Myxococcales; f_Myxococcaceae; g_Anaeromyxobacter; s_NOT_LABELED 321 Proteobacteria; c_Deltaproteobacteria; o_Myxococcales; f_Myxococcaceae; g_Corallococcus; s_Corallococcus coralloides 322 Proteobacteria; c_Deltaproteobacteria; o_Myxococcales; f_NOT_LABELED; g_NOT_LABELED; s_NOT_LABELED 323 Proteobacteria; c_Deltaproteobacteria; o_Myxococcales; f_Polyangiaceae; g_Sorangium; s_NOT_LABELED 324 Proteobacteria; c_Deltaproteobacteria; o_NOT_LABELED; f_NOT_LABELED; g_NOT_LABELED; s_NOT_LABELED 325 Proteobacteria; c_Epsilonproteobacteria; o_Campylobacterales; f_Helicobacteraceae; g_Helicobacter; s_Helicobacter hepaticus 326 Proteobacteria; c_Epsilonproteobacteria; o_Campylobacterales; f_Helicobacteraceae; g_Helicobacter; s_NOT_LABELED 327 Proteobacteria; c_Epsilonproteobacteria; o_Campylobacterales; f_Helicobacteraceae; g_Wolinella; s_Wolinella succinogenes 328 Proteobacteria; c_Gammaproteobacteria; o_Acidithiobacillales; f_Acidithiobacillaceae; g_Acidithiobacillus; s_Acidithiobacillus caldus 329 Proteobacteria; c_Gammaproteobacteria; o_Acidithiobacillales; f_Acidithiobacillaceae; g_Acidithiobacillus; s_Acidithiobacillus ferrooxidans 330 Proteobacteria; c_Gammaproteobacteria; o_Cardiobacteriales; f_Cardiobacteriaceae; g_Dichelobacter; s_Dichelobacter nodosus 331 Proteobacteria; c_Gammaproteobacteria; o_Enterobacteriales; f_Enterobacteriaceae; g_Citrobacter; s_Citrobacter koseri 332 Proteobacteria; c_Gammaproteobacteria; o_Enterobacteriales; f_Enterobacteriaceae; g_Enterobacter; s_Enterobacter aerogenes 333 Proteobacteria; c_Gammaproteobacteria; o_Enterobacteriales; f_Enterobacteriaceae; g_Enterobacter; s_Enterobacter cancerogenus 334 Proteobacteria; c_Gammaproteobacteria; o_Enterobacteriales; f_Enterobacteriaceae; g_Enterobacter; s_Enterobacter cloacae complex 335 Proteobacteria; c_Gammaproteobacteria; o_Enterobacteriales; f_Enterobacteriaceae; g_Enterobacter; s_NOT_LABELED 336 Proteobacteria; c_Gammaproteobacteria; o_Enterobacteriales; f_Enterobacteriaceae; g_Erwinia; s_Erwinia amylovora 337 Proteobacteria; c_Gammaproteobacteria; o_Enterobacteriales; f_Enterobacteriaceae; g_Escherichia; s_Escherichia coli 338 Proteobacteria; c_Gammaproteobacteria; o_Enterobacteriales; f_Enterobacteriaceae; g_Klebsiella; s_Klebsiella pneumoniae 339 Proteobacteria; c_Gammaproteobacteria; o_Enterobacteriales; f_Enterobacteriaceae; g_Klebsiella; s_Klebsiella variicola 340 Proteobacteria; c_Gammaproteobacteria; o_Enterobacteriales; f_Enterobacteriaceae; g_Klebsiella; s_NOT_LABELED 341 Proteobacteria; c_Gammaproteobacteria; o_Enterobacteriales; f_Enterobacteriaceae; g_NOT_LABELED; s_NOT_LABELED 342 Proteobacteria; c_Gammaproteobacteria; o_Enterobacteriales; f_Enterobacteriaceae; g_Pantoea; s_Pantoea vagans 343 Proteobacteria; c_Gammaproteobacteria; o_Enterobacteriales; f_Enterobacteriaceae; g_Salmonella; s_Salmonella enterica 344 Proteobacteria; c_Gammaproteobacteria; o_Enterobacteriales; f_Enterobacteriaceae; g_Serratia; s_Serratia marcescens 345 Proteobacteria; c_Gammaproteobacteria; o_Enterobacteriales; f_Enterobacteriaceae; g_Shigella; s_Shigella flexneri 346 Proteobacteria; c_Gammaproteobacteria; o_NOT_LABELED; f_NOT_LABELED; g_NOT_LABELED; s_NOT_LABELED 347 roteobacteria; c_Gammaproteobacteria; o_Oceanospirillales; f_Halomonadaceae; g_Halomonas; s_NOT_LABELED 348 Proteobacteria; c_Gammaproteobacteria; o_Pasteurellales; f_Pasteurellaceae; g_Actinobacillus; s_Actinobacillus pleuropneumoniae 349 Proteobacteria; c_Gammaproteobacteria; o_Pasteurellales; f_Pasteurellaceae; g_Aggregatibacter; s_Aggregatibacter aphrophilus 350 Proteobacteria; c_Gammaproteobacteria; o_Pasteurellales; f_Pasteurellaceae; g_Gallibacterium; s_Gallibacterium anatis 351 Proteobacteria; c_Gammaproteobacteria; o_Pasteurellales; f_Pasteurellaceae; g_Haemophilus; s_Haemophilus influenzae 352 Proteobacteria; c_Gammaproteobacteria; o_Pasteurellales; f_Pasteurellaceae; g_Haemophilus; s_Haemophilus parainfluenzae 353 Proteobacteria; c_Gammaproteobacteria; o_Pasteurellales; f_Pasteurellaceae; g_Haemophilus; s_Haemophilus parasuis 354 Proteobacteria; c_Gammaproteobacteria; o_Pasteurellales; f_Pasteurellaceae; g_Pasteurella; s_Pasteurella multocida 355 Proteobacteria; c_Gammaproteobacteria; o_P seudomonadales; f_Moraxellaceae; g_Acinetobacter; s_Acinetobacter bereziniae 356 Proteobacteria; c_Gammaproteobacteria; o_Pseudomonadales; f_Pseudomonadaceae; g_Pseudomonas; s_NOT_LABELED 357 Proteobacteria; c_Gammaproteobacteria; o_Pseudomonadales; f_Pseudomonadaceae; g_Pseudomonas; s_Pseudomonas aeruginosa 358 Proteobacteria; c_Gammaproteobacteria; o_Pseudomonadales; f_Pseudomonadaceae; g_Pseudomonas; s_Pseudomonas aeruginosa group 359 Proteobacteria; c_Gammaproteobacteria; o_Pseudomonadales; f_Pseudomonadaceae; g_Pseudomonas; s_Pseudomonas fluorescens group 360 Proteobacteria; c_Gammaproteobacteria; o_Pseudomonadales; f_Pseudomonadaceae; g_Pseudomonas; s_Pseudomonas mendocina 361 Proteobacteria; c_Gammaproteobacteria; o_Thiotrichales; f_Thiotrichaceae; g_Thiothrix; s_NOT_LABELED 362 Proteobacteria; c_Gammaproteobacteria; o_Xanthomonadales; f_Xanthomonadaceae; g_Stenotrophomonas; s_Stenotrophomonas maltophilia 363 Proteobacteria; c_NOT_LABELED; o_NOT_LABELED; f_NOT_LABELED; g_NOT_LABELED; s_NOT_LABELED 364 Spirochaetes; c_Spirochaetia; o_Spirochaetales; f_Spirochaetaceae; g_Spirochaeta; s_Spirochaeta thermophila 365 Spirochaetes; c_Spirochaetia; o_Spirochaetales; f_Spirochaetaceae; g_Treponema; s_NOT_LABELED 366 Synergistetes; c_Synergistia; o_Synergistales; f_Synergistaceae; g_Aminobacterium; s_Aminobacterium colombiense 367 Synergistetes; c_Synergistia; o_Synergistales; f_Synergistaceae; g_Thermanaerovibrio; s_Thermanaerovibrio acidaminovorans 368 Tenericutes; c_Mollicutes; o_Acholeplasmatales; f_Acholeplasmataceae; g_Acholeplasma; s_NOT_LABELED 369 Tenericutes; c_Mollicutes; o_Acholeplasmatales; f_Acholeplasmataceae; g_Candidatus Phytoplasma; s_NOT_LABELED 370 Tenericutes; c_Mollicutes; o_Entomoplasmatales; f_Entomoplasmataceae; g_Entomoplasma; s_NOT_LABELED 371 Tenericutes; c_Mollicutes; o_Entomoplasmatales; f_Spiroplasmataceae; g_Spiroplasma; s_NOT_LABELED 372 Tenericutes; c_Mollicutes; o_Mycoplasmatales; f_Mycoplasmataceae; g_Mycoplasma; s_NOT_LABELED 373 Tenericutes; c_Mollicutes; o_Mycoplasmatales; f_Mycoplasmataceae; g_Ureaplasma; s_Ureaplasma urealyticum 374 Thermodesulfobacteria; c_Thermodesulfobacteria; o_Thermodesulfobacteriales; f_Thermodesulfobacteriaceae; g_Thermodesulfatator; s_Thermodesulfatator indicus 375 Thermodesulfobacteria; c_Thermodesulfobacteria; o_Thermodesulfobacteriales; f_Thermodesulfobacteriaceae; g_Thermodesulfobacterium; s_NOT_LABELED 376 Thermotogae; c_Thermotogae; o_Thermotogales; f_Thermotogaceae; g_Kosmotoga; s_Kosmotoga olearia 377 Verrucomicrobia; c_Opitutae; o_Puniceicoccales; f_Puniceicoccaceae; g_Coraliomargarita; s_Coraliomargarita akajimensis 378 Verrucomicrobia; c_Verrucomicrobiae; o_Verrucomicrobiales; f_Verrucomicrobiaceae; g_Akkermansia; s_Akkermansia muciniphila Taxon ID CM Atm+/+ Small Intestine RM Atm+/+ Small Intestine 1 5.2E03 2.2E03 8.9E03 2.6E03 5.0E03 1.0E03 2 0.0E+00 2.6E07 0.0E+00 4.6E07 1.0E06 0.0E+00 3 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 4 0.0E+00 9.3E06 0.0E+00 1.1E04 2.0E05 6.2E06 5 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 6 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 7 2.9E05 2.0E05 0.0E+00 4.2E06 1.0E05 2.1E06 8 3.8E06 2.4E06 5.3E05 0.0E+00 0.0E+00 0.0E+00 9 0.0E+00 2.6E07 0.0E+00 0.0E+00 0.0E+00 2.9E07 10 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.5E06 11 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 12 0.0E+00 8.5E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 13 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 14 0.0E+00 0.0E+00 0.0E+00 4.6E07 0.0E+00 0.0E+00 15 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 16 1.9E06 0.0E+00 8.7E06 0.0E+00 0.0E+00 0.0E+00 17 0.0E+00 2.6E07 6.0E06 0.0E+00 2.0E06 0.0E+00 18 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 19 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 20 0.0E+00 2.6E07 2.2E06 0.0E+00 0.0E+00 0.0E+00 21 4.7E06 1.8E05 2.4E04 0.0E+00 0.0E+00 0.0E+00 22 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 5.9E07 23 3.3E06 0.0E+00 0.0E+00 1.4E06 0.0E+00 0.0E+00 24 0.0E+00 9.5E06 2.2E06 0.0E+00 2.5E06 0.0E+00 25 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 26 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 27 0.0E+00 0.0E+00 5.4E07 0.0E+00 0.0E+00 0.0E+00 28 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 29 0.0E+00 0.0E+00 2.2E06 0.0E+00 0.0E+00 0.0E+00 30 0.0E+00 0.0E+00 0.0E+00 0.0E+00 5.1E07 0.0E+00 31 0.0E+00 5.3E07 5.4E07 0.0E+00 2.0E06 0.0E+00 32 1.9E05 2.1E05 0.0E+00 1.5E05 1.4E04 0.0E+00 33 3.8E06 4.2E06 1.3E04 1.2E05 3.1E06 2.9E07 34 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 35 0.0E+00 0.0E+00 2.7E06 0.0E+00 0.0E+00 0.0E+00 36 0.0E+00 0.0E+00 0.0E+00 0.0E+00 7.6E06 0.0E+00 37 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 38 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 39 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 40 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.0E06 0.0E+00 41 0.0E+00 0.0E+00 1.1E04 0.0E+00 0.0E+00 2.3E05 42 0.0E+00 0.0E+00 2.5E05 0.0E+00 0.0E+00 0.0E+00 43 0.0E+00 0.0E+00 6.2E05 9.2E07 0.0E+00 8.5E06 44 1.9E06 0.0E+00 1.2E05 0.0E+00 0.0E+00 0.0E+00 45 0.0E+00 4.2E05 0.0E+00 1.8E05 2.0E06 0.0E+00 46 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 47 0.0E+00 2.6E07 1.6E06 0.0E+00 0.0E+00 0.0E+00 48 0.0E+00 1.7E04 0.0E+00 0.0E+00 0.0E+00 0.0E+00 49 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 4.1E06 50 0.0E+00 1.9E05 2.1E04 3.7E05 2.4E05 5.9E06 51 0.0E+00 0.0E+00 0.0E+00 6.3E05 6.8E05 0.0E+00 52 0.0E+00 2.6E06 0.0E+00 4.6E07 0.0E+00 0.0E+00 53 0.0E+00 4.2E06 0.0E+00 5.5E06 7.6E06 0.0E+00 54 0.0E+00 1.3E06 1.0E05 0.0E+00 4.1E06 0.0E+00 55 4.7E05 1.9E06 1.7E05 0.0E+00 0.0E+00 0.0E+00 56 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 57 0.0E+00 0.0E+00 0.0E+00 4.6E07 5.1E07 0.0E+00 58 6.7E04 8.0E04 1.5E02 9.6E05 1.3E03 8.7E05 59 1.1E03 3.1E03 5.1E03 9.2E07 1.0E02 2.1E06 60 4.5E04 9.3E03 1.3E02 1.8E05 7.7E03 6.7E06 61 1.9E05 3.3E05 2.8E04 0.0E+00 0.0E+00 0.0E+00 62 1.1E04 2.2E03 2.1E03 1.3E05 4.4E04 1.2E05 63 1.5E05 1.5E05 5.5E05 7.9E05 1.2E04 1.9E05 64 5.9E05 1.6E04 3.5E03 9.2E07 1.4E04 2.9E07 65 2.7E03 6.3E03 4.8E04 4.6E06 4.6E06 2.3E06 66 5.8E04 5.1E04 2.8E03 0.0E+00 2.7E04 0.0E+00 67 3.0E04 7.4E04 1.6E02 9.2E07 3.1E06 8.8E07 68 0.0E+00 0.0E+00 0.0E+00 0.0E+00 3.1E06 0.0E+00 69 2.7E04 4.8E06 2.5E03 7.0E04 3.3E03 1.6E03 70 9.4E07 5.3E07 5.4E06 7.8E06 1.8E05 2.1E06 71 1.4E05 6.6E06 1.9E05 4.6E05 8.4E05 5.0E06 72 0.0E+00 0.0E+00 5.4E07 0.0E+00 2.0E06 2.9E07 73 0.0E+00 0.0E+00 0.0E+00 4.6E07 5.1E07 2.9E07 74 4.7E07 2.6E07 7.0E06 2.3E06 3.1E06 1.2E06 75 0.0E+00 8.2E06 3.3E05 0.0E+00 0.0E+00 0.0E+00 76 4.0E04 4.6E04 1.6E03 4.6E07 2.3E05 1.4E04 77 1.7E05 2.9E06 2.7E05 3.7E06 4.2E05 1.5E06 78 0.0E+00 0.0E+00 4.9E06 1.8E06 2.0E06 0.0E+00 79 1.7E05 4.3E03 5.5E03 3.2E06 6.6E06 2.9E06 80 2.4E05 1.0E05 0.0E+00 4.6E07 1.5E05 5.6E06 81 0.0E+00 0.0E+00 7.6E06 0.0E+00 0.0E+00 0.0E+00 82 1.9E03 4.0E02 1.2E01 4.7E02 4.1E02 1.9E02 83 2.6E04 2.9E04 1.8E03 1.0E03 1.5E02 4.7E03 84 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.5E06 0.0E+00 85 3.7E04 3.1E03 5.4E03 5.1E02 4.3E02 1.7E02 86 4.3E02 2.2E02 9.9E02 2.8E01 4.5E01 5.8E02 87 1.4E06 2.6E07 2.7E06 1.0E05 1.4E05 8.8E07 88 0.0E+00 5.3E07 5.4E07 0.0E+00 0.0E+00 5.9E07 89 4.2E05 0.0E+00 1.3E04 1.3E05 0.0E+00 2.1E06 90 4.7E07 0.0E+00 3.8E06 0.0E+00 0.0E+00 0.0E+00 91 1.5E05 0.0E+00 5.4E07 0.0E+00 5.1E07 0.0E+00 92 0.0E+00 2.6E07 0.0E+00 1.5E05 0.0E+00 0.0E+00 93 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 94 4.2E03 1.0E02 2.2E02 2.5E04 4.4E04 6.1E05 95 0.0E+00 0.0E+00 5.4E07 0.0E+00 0.0E+00 0.0E+00 96 1.3E04 2.9E04 2.1E03 3.2E06 9.0E05 2.9E04 97 4.2E06 5.3E07 0.0E+00 9.2E07 0.0E+00 5.9E07 98 1.9E06 7.1E06 2.3E05 0.0E+00 0.0E+00 0.0E+00 99 0.0E+00 0.0E+00 5.0E05 0.0E+00 0.0E+00 0.0E+00 100 0.0E+00 0.0E+00 0.0E+00 0.0E+00 2.4E05 0.0E+00 101 9.4E07 0.0E+00 5.4E07 4.8E05 3.8E05 2.3E06 102 9.4E07 0.0E+00 0.0E+00 0.0E+00 0.0E+00 2.9E07 103 0.0E+00 0.0E+00 5.4E07 0.0E+00 0.0E+00 0.0E+00 104 0.0E+00 2.1E05 0.0E+00 0.0E+00 0.0E+00 0.0E+00 105 0.0E+00 2.1E05 1.1E03 4.6E07 1.5E06 2.9E07 106 0.0E+00 2.6E07 2.2E06 0.0E+00 2.0E06 2.9E07 107 1.9E05 2.3E05 8.1E06 6.9E06 1.5E05 2.1E06 108 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 109 0.0E+00 2.6E07 5.4E07 0.0E+00 0.0E+00 0.0E+00 110 9.4E05 0.0E+00 1.9E04 0.0E+00 0.0E+00 0.0E+00 111 0.0E+00 5.3E07 0.0E+00 1.8E06 0.0E+00 0.0E+00 112 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 113 4.7E07 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 114 2.9E05 4.5E06 1.9E05 0.0E+00 3.6E06 0.0E+00 115 7.3E04 5.8E05 1.0E04 7.6E05 1.2E03 5.1E05 116 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 117 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 118 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 119 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 120 3.8E06 3.9E05 1.1E04 1.4E06 0.0E+00 0.0E+00 121 0.0E+00 0.0E+00 1.1E05 0.0E+00 1.0E06 0.0E+00 122 0.0E+00 1.6E06 1.6E06 0.0E+00 4.1E06 0.0E+00 123 1.4E06 2.6E07 1.1E05 0.0E+00 0.0E+00 0.0E+00 124 1.4E06 2.6E06 1.1E06 0.0E+00 0.0E+00 3.8E06 125 3.3E06 7.9E07 4.3E06 0.0E+00 1.3E04 5.3E06 126 1.9E06 0.0E+00 1.1E06 0.0E+00 0.0E+00 0.0E+00 127 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 128 3.8E06 8.9E05 1.7E03 6.0E05 2.4E03 3.4E05 129 4.3E05 0.0E+00 0.0E+00 0.0E+00 5.1E07 0.0E+00 130 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 131 0.0E+00 0.0E+00 0.0E+00 0.0E+00 2.5E06 9.7E06 132 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 133 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 134 1.0E04 1.0E05 1.3E03 4.6E07 4.5E04 2.9E07 135 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 136 0.0E+00 0.0E+00 0.0E+00 0.0E+00 8.1E05 2.6E06 137 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 138 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 139 0.0E+00 2.9E06 9.8E05 6.0E06 4.8E05 5.0E06 140 3.6E05 8.5E06 6.7E04 2.9E05 1.2E03 2.8E05 141 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 142 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 2.9E07 143 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 144 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 145 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 146 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 2.9E07 147 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 148 1.6E04 3.4E06 7.1E04 2.2E05 6.7E04 3.0E05 149 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 150 1.4E05 9.9E05 3.2E06 4.0E04 4.5E05 2.7E04 151 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 152 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 153 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 154 3.1E02 3.4E06 9.0E02 2.0E05 1.0E04 1.3E05 155 6.1E06 1.1E06 4.0E05 2.8E06 0.0E+00 8.8E07 156 0.0E+00 3.3E05 0.0E+00 1.4E05 9.2E06 0.0E+00 157 2.9E05 0.0E+00 8.9E05 0.0E+00 0.0E+00 0.0E+00 158 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 159 5.2E04 8.9E05 4.6E04 0.0E+00 2.1E04 1.6E05 160 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.1E05 0.0E+00 161 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.5E06 162 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 2.3E06 163 1.3E03 7.9E07 0.0E+00 0.0E+00 0.0E+00 0.0E+00 164 0.0E+00 5.0E06 7.0E05 1.2E05 2.4E04 4.7E06 165 0.0E+00 3.4E05 0.0E+00 0.0E+00 0.0E+00 0.0E+00 166 0.0E+00 0.0E+00 1.6E06 0.0E+00 0.0E+00 0.0E+00 167 2.2E02 1.6E02 7.3E02 1.5E02 1.7E02 6.9E03 168 0.0E+00 0.0E+00 6.5E06 0.0E+00 0.0E+00 2.9E07 169 0.0E+00 2.6E07 5.4E07 4.6E07 0.0E+00 8.8E07 170 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 171 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 172 6.2E04 2.7E02 1.0E02 1.0E01 3.7E02 7.1E02 173 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 174 2.5E02 9.7E03 1.1E02 4.6E06 1.1E05 3.8E06 175 9.4E07 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 176 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 177 0.0E+00 0.0E+00 5.4E07 0.0E+00 0.0E+00 0.0E+00 178 0.0E+00 2.6E07 0.0E+00 4.6E06 4.1E05 5.9E07 179 6.6E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 180 1.0E05 0.0E+00 2.8E05 0.0E+00 0.0E+00 2.9E07 181 0.0E+00 7.9E07 5.4E06 0.0E+00 0.0E+00 0.0E+00 182 0.0E+00 0.0E+00 0.0E+00 0.0E+00 2.4E05 2.9E06 183 0.0E+00 0.0E+00 4.3E06 0.0E+00 0.0E+00 0.0E+00 184 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.2E05 1.3E05 185 2.8E04 0.0E+00 4.2E04 3.2E06 3.8E04 6.2E06 186 0.0E+00 0.0E+00 1.7E04 0.0E+00 3.1E06 2.1E06 187 6.9E05 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 188 4.7E07 0.0E+00 0.0E+00 0.0E+00 0.0E+00 2.9E07 189 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 190 5.1E04 2.2E04 2.8E03 5.5E06 1.5E05 9.9E05 191 4.7E07 0.0E+00 4.2E04 3.3E05 6.5E04 8.5E06 192 0.0E+00 0.0E+00 8.7E06 0.0E+00 1.0E06 2.3E06 193 5.0E05 0.0E+00 1.5E04 0.0E+00 5.1E07 0.0E+00 194 3.3E04 0.0E+00 6.0E05 2.8E06 3.0E05 5.7E05 195 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 196 0.0E+00 0.0E+00 0.0E+00 4.6E07 0.0E+00 0.0E+00 197 0.0E+00 7.9E07 0.0E+00 0.0E+00 0.0E+00 0.0E+00 198 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 199 1.7E03 4.7E04 1.2E05 1.1E04 4.9E02 5.1E05 200 0.0E+00 0.0E+00 0.0E+00 0.0E+00 3.1E06 0.0E+00 201 0.0E+00 4.0E06 1.7E05 0.0E+00 0.0E+00 0.0E+00 202 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 203 0.0E+00 5.3E07 0.0E+00 4.1E05 4.4E04 8.8E07 204 0.0E+00 0.0E+00 1.6E06 0.0E+00 0.0E+00 0.0E+00 205 0.0E+00 0.0E+00 0.0E+00 4.6E07 0.0E+00 0.0E+00 206 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 207 2.8E06 6.9E05 2.1E04 7.2E05 5.8E04 1.3E05 208 1.3E03 1.5E04 6.5E03 3.5E04 1.0E02 3.0E04 209 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 210 2.2E04 1.9E04 1.0E03 1.2E05 3.6E04 1.3E05 211 0.0E+00 0.0E+00 0.0E+00 9.2E07 0.0E+00 3.5E06 212 4.7E07 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.5E05 213 0.0E+00 1.3E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 214 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 215 1.9E06 0.0E+00 3.2E06 0.0E+00 0.0E+00 0.0E+00 216 8.0E05 5.2E05 3.8E05 1.5E05 6.7E04 2.2E05 217 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 218 1.0E04 5.0E05 2.0E04 6.5E06 3.7E04 1.5E05 219 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 220 3.1E04 3.0E04 2.3E04 1.1E05 3.6E04 2.1E06 221 0.0E+00 0.0E+00 5.4E07 0.0E+00 0.0E+00 0.0E+00 222 0.0E+00 2.6E07 3.2E06 0.0E+00 0.0E+00 0.0E+00 223 0.0E+00 0.0E+00 0.0E+00 3.7E05 0.0E+00 0.0E+00 224 0.0E+00 5.3E07 0.0E+00 0.0E+00 0.0E+00 0.0E+00 225 3.5E05 0.0E+00 4.7E04 6.0E06 3.9E04 2.9E05 226 0.0E+00 5.3E07 0.0E+00 0.0E+00 0.0E+00 0.0E+00 227 0.0E+00 5.3E07 0.0E+00 0.0E+00 3.6E06 0.0E+00 228 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 229 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 230 0.0E+00 0.0E+00 8.1E06 0.0E+00 1.1E05 0.0E+00 231 1.4E06 0.0E+00 6.5E06 0.0E+00 5.4E05 0.0E+00 232 8.5E03 3.7E02 1.3E01 3.6E05 2.3E04 2.1E05 233 9.4E07 2.6E07 1.2E05 0.0E+00 3.1E06 0.0E+00 234 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 235 4.5E05 1.9E05 5.3E05 6.5E06 2.9E04 9.7E06 236 1.3E04 3.2E05 1.1E03 2.4E05 5.1E04 1.7E05 237 0.0E+00 0.0E+00 6.4E05 1.4E06 2.0E05 2.3E06 238 0.0E+00 0.0E+00 9.5E04 0.0E+00 1.0E06 0.0E+00 239 0.0E+00 0.0E+00 3.6E05 0.0E+00 0.0E+00 0.0E+00 240 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 241 0.0E+00 2.9E06 1.5E05 0.0E+00 0.0E+00 0.0E+00 242 0.0E+00 7.9E07 2.2E06 0.0E+00 0.0E+00 0.0E+00 243 6.5E05 8.7E06 5.4E04 1.1E05 4.3E04 9.7E06 244 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 2.9E07 245 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 246 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 247 0.0E+00 0.0E+00 1.1E06 0.0E+00 0.0E+00 0.0E+00 248 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 249 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 250 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 251 9.9E04 9.6E05 2.1E03 7.1E05 3.5E03 5.1E05 252 3.3E01 7.4E01 1.0E01 4.9E01 1.4E01 8.0E01 253 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 2.9E07 254 2.0E04 9.8E05 3.9E04 6.9E05 1.1E04 5.2E05 255 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 256 0.0E+00 7.9E07 4.2E03 9.2E07 1.5E06 0.0E+00 257 0.0E+00 0.0E+00 0.0E+00 0.0E+00 5.4E05 0.0E+00 258 2.4E04 2.2E02 5.2E03 1.4E06 8.9E05 2.6E06 259 2.1E05 0.0E+00 4.0E04 0.0E+00 5.1E07 7.3E06 260 9.9E06 4.5E05 9.7E04 9.1E05 2.0E02 3.6E04 261 5.7E05 7.8E03 7.0E04 1.8E05 9.7E02 1.2E02 262 3.3E05 2.4E06 5.4E07 1.1E05 1.7E04 2.8E05 263 0.0E+00 1.0E04 1.2E04 0.0E+00 5.1E07 0.0E+00 264 7.3E04 2.8E04 1.1E02 1.2E04 3.2E03 1.5E04 265 2.1E05 1.8E05 6.1E05 2.8E06 5.1E07 0.0E+00 266 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 267 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.1E05 268 9.4E06 7.1E06 6.8E05 1.8E06 5.4E05 2.1E06 269 4.7E07 4.5E06 1.5E05 4.3E05 1.6E05 1.4E05 270 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 271 2.5E03 1.6E03 3.5E02 2.5E03 2.3E02 5.5E03 272 1.1E05 5.8E06 3.5E05 0.0E+00 2.0E06 0.0E+00 273 0.0E+00 0.0E+00 0.0E+00 8.9E05 0.0E+00 0.0E+00 274 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 275 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 276 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 277 1.9E05 0.0E+00 2.2E06 9.2E07 1.5E06 2.9E07 278 9.4E07 1.1E06 5.4E07 9.2E07 2.0E06 0.0E+00 279 0.0E+00 2.6E07 0.0E+00 0.0E+00 1.0E06 5.9E07 280 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 281 0.0E+00 0.0E+00 5.4E07 1.4E06 0.0E+00 5.9E07 282 0.0E+00 5.3E07 5.4E07 0.0E+00 0.0E+00 0.0E+00 283 0.0E+00 0.0E+00 0.0E+00 6.9E06 0.0E+00 0.0E+00 284 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 285 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 286 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 287 0.0E+00 0.0E+00 0.0E+00 1.3E05 0.0E+00 0.0E+00 288 0.0E+00 0.0E+00 0.0E+00 0.0E+00 5.1E07 0.0E+00 289 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 290 1.8E05 0.0E+00 2.0E05 0.0E+00 4.1E06 4.7E06 291 0.0E+00 0.0E+00 2.2E06 0.0E+00 0.0E+00 0.0E+00 292 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 293 2.4E06 9.8E06 2.6E05 9.2E07 1.0E05 2.9E07 294 0.0E+00 0.0E+00 0.0E+00 9.7E06 0.0E+00 0.0E+00 295 6.4E03 4.6E03 2.0E02 5.6E04 3.2E03 9.6E04 296 1.5E05 5.6E06 3.6E05 8.8E06 9.2E06 2.9E07 297 0.0E+00 0.0E+00 2.7E06 0.0E+00 0.0E+00 0.0E+00 298 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 299 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.0E06 0.0E+00 300 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 301 0.0E+00 2.6E07 1.6E06 4.6E07 3.6E06 0.0E+00 302 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 303 3.4E05 0.0E+00 0.0E+00 0.0E+00 1.2E05 0.0E+00 304 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 305 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 306 4.2E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 307 0.0E+00 0.0E+00 5.4E07 0.0E+00 0.0E+00 0.0E+00 308 0.0E+00 0.0E+00 1.6E06 0.0E+00 0.0E+00 0.0E+00 309 2.8E06 0.0E+00 0.0E+00 0.0E+00 6.1E06 5.9E07 310 9.4E07 0.0E+00 1.5E05 0.0E+00 0.0E+00 0.0E+00 311 0.0E+00 2.6E07 0.0E+00 0.0E+00 5.1E07 0.0E+00 312 3.2E04 6.7E04 2.2E04 4.6E07 1.0E06 0.0E+00 313 3.2E05 3.9E05 0.0E+00 0.0E+00 0.0E+00 0.0E+00 314 4.0E04 9.0E05 5.0E03 2.3E06 0.0E+00 0.0E+00 315 1.8E03 9.7E03 1.1E02 8.8E06 1.5E05 2.9E06 316 3.8E05 6.8E05 1.4E04 0.0E+00 0.0E+00 0.0E+00 317 3.3E06 0.0E+00 9.2E06 0.0E+00 0.0E+00 0.0E+00 318 0.0E+00 2.6E07 5.4E07 0.0E+00 0.0E+00 0.0E+00 319 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 320 1.9E06 5.3E07 8.1E06 6.9E05 2.5E05 1.0E05 321 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 322 0.0E+00 0.0E+00 5.4E07 9.2E07 0.0E+00 0.0E+00 323 2.8E06 1.1E06 5.1E05 0.0E+00 0.0E+00 0.0E+00 324 0.0E+00 0.0E+00 4.3E06 0.0E+00 0.0E+00 0.0E+00 325 4.4E04 2.4E04 7.3E03 1.2E05 6.1E06 1.4E05 326 2.5E04 2.3E04 1.2E02 9.2E07 2.5E06 8.8E07 327 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 328 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 329 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 330 0.0E+00 0.0E+00 1.6E06 0.0E+00 0.0E+00 0.0E+00 331 5.6E06 7.0E05 4.1E04 4.2E06 5.5E05 1.9E05 332 2.1E04 6.6E06 2.7E04 1.0E04 6.8E05 7.2E05 333 0.0E+00 0.0E+00 3.8E06 0.0E+00 0.0E+00 0.0E+00 334 2.7E04 1.5E04 8.5E04 3.5E05 2.2E04 5.9E05 335 3.2E05 5.8E06 1.9E04 2.3E06 2.2E05 9.7E06 336 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.0E06 0.0E+00 337 4.3E01 2.4E04 9.7E04 9.7E05 3.6E04 8.1E05 338 1.4E04 1.4E04 6.6E04 1.2E05 6.7E05 2.5E05 339 1.4E06 5.3E07 0.0E+00 0.0E+00 0.0E+00 0.0E+00 340 9.0E05 1.2E05 7.7E05 2.3E06 1.3E05 4.7E06 341 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 342 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 343 1.4E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 344 2.4E06 0.0E+00 0.0E+00 0.0E+00 4.6E06 0.0E+00 345 2.8E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 346 0.0E+00 0.0E+00 5.4E07 0.0E+00 0.0E+00 0.0E+00 347 1.4E04 7.9E06 1.0E04 1.2E05 3.1E06 6.2E06 348 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 349 6.4E04 1.1E06 8.9E04 9.2E07 5.1E07 5.9E07 350 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 351 2.5E03 7.7E06 7.4E03 0.0E+00 5.1E07 5.9E07 352 0.0E+00 0.0E+00 0.0E+00 9.2E06 0.0E+00 4.7E06 353 9.4E07 0.0E+00 3.2E05 0.0E+00 0.0E+00 0.0E+00 354 1.6E02 2.6E07 6.6E03 1.4E06 0.0E+00 0.0E+00 355 0.0E+00 0.0E+00 0.0E+00 4.8E05 0.0E+00 0.0E+00 356 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 357 2.1E02 5.3E07 2.7E06 4.6E07 2.5E06 8.8E07 358 4.1E05 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 359 8.9E06 0.0E+00 2.7E06 1.8E06 0.0E+00 2.9E07 360 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 361 1.5E04 8.7E06 8.4E04 0.0E+00 0.0E+00 0.0E+00 362 9.8E05 3.1E05 8.1E05 2.3E06 3.2E05 1.8E06 363 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 364 0.0E+00 0.0E+00 0.0E+00 0.0E+00 2.5E06 0.0E+00 365 0.0E+00 0.0E+00 0.0E+00 7.8E06 3.7E04 8.8E07 366 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 367 0.0E+00 5.3E07 0.0E+00 0.0E+00 0.0E+00 0.0E+00 368 2.8E06 9.1E05 4.3E06 0.0E+00 1.5E06 0.0E+00 369 3.3E06 4.5E06 1.1E06 5.5E06 2.0E06 1.6E05 370 0.0E+00 2.4E05 0.0E+00 0.0E+00 0.0E+00 0.0E+00 371 5.2E06 8.5E06 1.6E06 0.0E+00 5.9E04 0.0E+00 372 1.9E06 5.6E06 3.2E06 0.0E+00 0.0E+00 0.0E+00 373 2.4E02 1.2E02 9.8E02 1.8E05 1.5E05 2.0E05 374 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 375 1.4E06 2.4E06 5.4E07 5.1E06 1.0E06 2.6E06 376 1.4E06 5.3E07 0.0E+00 9.2E07 5.1E07 1.5E06 377 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.0E06 0.0E+00 378 2.3E04 1.3E04 1.0E03 2.4E05 1.8E04 3.0E05 Taxon ID CM Atm+/+ Colon RM Atm+/+ Colon 1 1.5E03 1.2E03 1.3E03 2.4E03 1.8E03 1.3E03 2 0.0E+00 0.0E+00 7.6E07 2.2E06 1.2E06 0.0E+00 3 9.2E07 1.3E06 7.6E07 0.0E+00 0.0E+00 0.0E+00 4 4.0E05 5.0E05 8.4E06 7.1E05 2.1E05 1.5E05 5 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 6 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 7 0.0E+00 0.0E+00 8.4E06 1.7E06 0.0E+00 0.0E+00 8 1.5E05 4.6E06 1.5E05 5.6E07 4.1E07 0.0E+00 9 0.0E+00 6.6E07 3.1E06 0.0E+00 0.0E+00 0.0E+00 10 0.0E+00 1.3E06 0.0E+00 1.1E05 0.0E+00 0.0E+00 11 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 12 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 13 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 14 4.6E07 5.3E06 2.3E06 2.2E06 0.0E+00 0.0E+00 15 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 16 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 17 1.8E06 1.3E06 0.0E+00 5.6E06 1.2E06 5.5E06 18 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 19 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 20 6.9E06 5.3E06 5.3E06 0.0E+00 0.0E+00 0.0E+00 21 1.8E04 2.8E04 2.2E04 5.6E07 0.0E+00 0.0E+00 22 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 23 0.0E+00 6.6E07 0.0E+00 3.3E06 0.0E+00 0.0E+00 24 1.4E06 4.6E06 3.8E06 1.7E06 2.4E06 1.5E06 25 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 26 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 27 4.6E07 1.3E06 1.5E06 0.0E+00 0.0E+00 0.0E+00 28 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 29 0.0E+00 0.0E+00 1.5E06 0.0E+00 0.0E+00 0.0E+00 30 9.2E07 0.0E+00 0.0E+00 0.0E+00 0.0E+00 5.0E07 31 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 32 3.7E06 1.3E05 7.6E07 8.2E05 3.1E05 6.5E05 33 5.5E06 1.2E05 2.2E05 5.1E05 9.7E06 9.9E07 34 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 35 5.1E06 2.0E06 4.6E06 0.0E+00 0.0E+00 0.0E+00 36 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 37 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 38 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 39 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 40 0.0E+00 1.3E06 3.8E06 0.0E+00 0.0E+00 0.0E+00 41 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 42 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 43 0.0E+00 6.6E07 0.0E+00 0.0E+00 0.0E+00 0.0E+00 44 1.4E06 0.0E+00 7.6E07 0.0E+00 0.0E+00 0.0E+00 45 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 3.5E06 46 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 47 4.6E07 2.0E06 3.1E06 0.0E+00 0.0E+00 0.0E+00 48 4.6E07 8.6E06 7.6E07 0.0E+00 0.0E+00 0.0E+00 49 0.0E+00 0.0E+00 1.9E05 0.0E+00 0.0E+00 0.0E+00 50 2.1E05 3.9E05 1.4E04 3.7E05 2.6E05 7.4E05 51 2.8E06 0.0E+00 0.0E+00 5.1E05 2.6E05 6.5E05 52 0.0E+00 0.0E+00 0.0E+00 3.9E06 0.0E+00 0.0E+00 53 0.0E+00 0.0E+00 0.0E+00 9.5E06 5.3E06 2.5E06 54 1.2E05 8.6E06 2.3E06 0.0E+00 8.1E07 2.5E06 55 1.0E04 8.4E05 1.0E04 0.0E+00 0.0E+00 0.0E+00 56 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 57 0.0E+00 0.0E+00 0.0E+00 1.7E06 8.1E07 9.9E07 58 6.5E03 1.6E02 2.1E02 4.4E03 8.2E04 9.6E04 59 3.4E03 6.1E03 6.4E03 1.7E05 5.7E03 2.0E06 60 2.2E03 2.1E02 1.6E02 9.5E05 4.4E03 1.1E05 61 1.2E04 4.3E04 3.0E04 0.0E+00 0.0E+00 0.0E+00 62 1.3E03 6.9E03 2.3E03 1.0E03 1.4E04 2.8E04 63 8.0E05 3.7E05 6.7E05 1.5E04 1.7E04 7.8E05 64 4.4E04 6.0E03 4.9E03 1.5E04 8.6E05 3.7E05 65 2.0E02 1.8E02 6.0E04 6.1E06 6.5E06 5.0E06 66 3.3E03 1.6E03 2.5E03 5.6E07 1.2E04 5.0E07 67 3.7E03 1.4E02 2.0E02 2.8E06 1.2E06 9.9E07 68 0.0E+00 0.0E+00 0.0E+00 0.0E+00 4.1E07 0.0E+00 69 1.4E03 1.1E05 2.2E03 3.8E03 3.6E03 5.2E03 70 6.5E06 1.3E06 9.2E06 1.3E05 1.8E05 5.5E06 71 1.0E04 1.4E05 4.5E05 1.1E04 1.2E04 6.2E05 72 0.0E+00 0.0E+00 0.0E+00 5.6E07 8.1E07 9.9E07 73 4.6E07 0.0E+00 7.6E07 2.2E06 8.1E07 5.0E07 74 7.8E06 6.6E07 6.1E06 1.0E05 5.7E06 5.5E06 75 4.6E06 1.2E04 1.7E05 0.0E+00 0.0E+00 0.0E+00 76 2.6E03 1.2E03 1.6E03 1.1E06 2.3E05 9.9E05 77 2.1E04 5.0E05 5.3E05 5.0E05 6.3E05 7.4E05 78 1.4E06 2.0E06 4.6E06 0.0E+00 8.1E07 0.0E+00 79 2.8E06 8.8E03 6.6E03 3.3E06 3.6E06 6.5E06 80 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 2.5E05 81 9.7E06 2.8E05 3.1E05 0.0E+00 0.0E+00 0.0E+00 82 9.2E03 1.1E01 1.6E01 9.3E02 3.2E02 2.4E02 83 1.4E03 2.8E03 2.2E03 1.6E03 1.2E02 9.0E03 84 0.0E+00 0.0E+00 0.0E+00 0.0E+00 4.9E06 5.0E07 85 2.1E03 1.1E02 5.5E03 9.5E02 3.9E02 1.8E02 86 3.9E01 1.0E01 2.5E01 5.9E01 7.5E01 5.9E01 87 1.8E05 3.3E06 9.9E06 1.4E05 1.5E05 8.9E06 88 0.0E+00 1.3E05 0.0E+00 0.0E+00 0.0E+00 5.0E07 89 0.0E+00 0.0E+00 3.1E06 1.1E06 0.0E+00 9.9E07 90 4.0E05 1.1E04 3.4E05 0.0E+00 0.0E+00 0.0E+00 91 9.2E07 0.0E+00 0.0E+00 1.1E06 8.1E07 9.9E07 92 0.0E+00 0.0E+00 0.0E+00 3.1E05 4.1E07 0.0E+00 93 0.0E+00 0.0E+00 0.0E+00 1.9E04 0.0E+00 0.0E+00 94 3.8E02 4.8E02 3.7E02 5.0E04 6.5E04 4.2E04 95 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 96 1.6E03 4.5E03 3.2E03 8.9E06 5.5E05 2.5E04 97 1.4E06 4.0E05 7.6E07 1.7E06 4.1E07 0.0E+00 98 2.0E04 1.6E04 1.1E04 0.0E+00 0.0E+00 0.0E+00 99 0.0E+00 6.6E06 1.5E06 0.0E+00 0.0E+00 0.0E+00 100 0.0E+00 0.0E+00 0.0E+00 1.9E05 4.9E06 3.0E05 101 3.2E06 1.6E05 7.6E07 4.4E05 2.4E05 4.1E05 102 4.6E07 0.0E+00 0.0E+00 4.0E05 0.0E+00 1.4E04 103 0.0E+00 2.0E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 104 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 105 1.8E04 3.0E03 9.9E04 1.7E06 1.6E06 9.9E07 106 1.4E06 4.0E06 7.6E07 0.0E+00 0.0E+00 9.9E07 107 4.0E05 3.2E05 6.9E06 2.6E05 2.3E05 8.0E06 108 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 109 4.6E06 2.6E06 3.1E06 0.0E+00 0.0E+00 0.0E+00 110 7.4E05 6.1E05 6.3E05 0.0E+00 0.0E+00 0.0E+00 111 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 112 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 113 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 114 0.0E+00 0.0E+00 6.1E06 0.0E+00 1.2E06 0.0E+00 115 1.5E03 6.9E04 8.1E05 5.7E03 1.2E03 8.5E03 116 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 117 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 118 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 119 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 120 1.2E04 9.4E05 2.3E04 2.2E06 3.2E06 4.0E06 121 6.5E06 2.6E06 7.6E06 1.6E05 5.3E06 0.0E+00 122 3.7E06 3.6E05 3.8E06 0.0E+00 0.0E+00 5.0E07 123 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 124 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.5E06 125 1.3E04 1.1E05 8.6E05 1.2E04 2.2E04 3.0E04 126 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 127 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 128 1.1E04 2.6E03 1.5E03 2.8E03 9.5E04 3.2E03 129 4.6E07 3.3E06 7.6E07 0.0E+00 8.1E07 9.9E07 130 0.0E+00 6.6E07 0.0E+00 0.0E+00 0.0E+00 0.0E+00 131 0.0E+00 0.0E+00 0.0E+00 5.6E07 4.1E07 1.5E06 132 0.0E+00 0.0E+00 7.6E07 0.0E+00 0.0E+00 0.0E+00 133 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 134 1.8E05 3.1E04 1.2E03 5.6E06 1.7E04 0.0E+00 135 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 136 2.8E05 1.1E04 9.2E06 4.7E05 7.5E05 8.5E05 137 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 138 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 139 2.3E05 8.8E05 3.6E04 4.5E04 1.6E04 1.1E03 140 3.2E04 8.0E05 6.0E04 1.9E03 5.2E04 2.1E03 141 9.2E07 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 142 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 143 0.0E+00 0.0E+00 0.0E+00 1.1E06 0.0E+00 0.0E+00 144 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 145 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 146 4.6E07 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 147 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 148 1.4E04 3.1E05 3.7E04 1.0E03 5.0E04 1.6E03 149 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 150 1.1E05 3.2E05 5.3E06 1.0E04 5.6E05 3.4E05 151 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 152 0.0E+00 1.1E05 0.0E+00 0.0E+00 0.0E+00 0.0E+00 153 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 154 1.6E04 2.6E06 3.9E04 2.8E06 0.0E+00 2.5E06 155 5.1E06 0.0E+00 6.1E06 3.3E06 1.6E06 1.5E05 156 5.5E06 2.0E05 3.8E05 1.6E05 0.0E+00 2.9E05 157 4.6E07 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 158 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 159 0.0E+00 9.9E06 2.7E05 3.4E05 7.7E06 4.0E05 160 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.7E05 161 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 162 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 163 6.5E05 6.6E07 6.9E06 2.8E06 4.1E07 5.0E07 164 6.0E06 1.0E04 4.6E05 1.1E03 3.4E04 1.5E03 165 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 166 0.0E+00 0.0E+00 0.0E+00 5.6E06 0.0E+00 1.5E06 167 3.3E03 3.8E03 1.2E02 1.9E02 1.4E03 6.0E03 168 0.0E+00 0.0E+00 7.6E07 0.0E+00 0.0E+00 0.0E+00 169 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 170 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 171 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 172 7.4E05 2.7E03 3.7E04 2.5E02 2.4E02 2.3E02 173 0.0E+00 0.0E+00 0.0E+00 0.0E+00 8.1E07 5.0E07 174 1.6E04 1.9E03 3.4E04 2.7E04 7.7E06 1.4E05 175 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 176 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 177 0.0E+00 2.0E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 178 0.0E+00 0.0E+00 0.0E+00 5.0E06 7.3E06 5.0E07 179 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 180 0.0E+00 6.6E07 1.5E06 0.0E+00 0.0E+00 0.0E+00 181 3.7E06 3.3E06 6.9E06 0.0E+00 0.0E+00 0.0E+00 182 9.2E07 0.0E+00 5.3E06 0.0E+00 0.0E+00 2.0E05 183 0.0E+00 0.0E+00 2.3E06 0.0E+00 0.0E+00 0.0E+00 184 0.0E+00 4.6E06 3.1E06 0.0E+00 0.0E+00 0.0E+00 185 2.1E03 2.8E05 3.3E04 4.5E04 3.8E04 6.7E04 186 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.1E05 1.0E04 187 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 188 0.0E+00 6.6E07 0.0E+00 5.6E07 0.0E+00 9.9E07 189 0.0E+00 0.0E+00 0.0E+00 0.0E+00 8.1E07 1.4E05 190 2.8E06 4.3E05 8.1E05 8.4E06 4.5E06 4.3E05 191 2.8E06 9.2E06 6.3E04 4.2E04 2.9E04 4.4E04 192 2.3E05 2.7E05 2.1E05 1.0E05 2.4E06 5.5E06 193 0.0E+00 2.6E06 0.0E+00 5.6E07 0.0E+00 0.0E+00 194 0.0E+00 1.3E06 3.8E06 0.0E+00 5.7E06 2.0E06 195 0.0E+00 0.0E+00 0.0E+00 6.1E06 0.0E+00 0.0E+00 196 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 197 0.0E+00 2.1E05 0.0E+00 0.0E+00 0.0E+00 0.0E+00 198 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 199 7.4E06 3.6E05 6.2E05 4.7E04 7.1E05 1.1E04 200 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.5E06 201 3.7E06 3.0E05 2.3E05 2.2E06 0.0E+00 1.5E06 202 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 203 0.0E+00 0.0E+00 9.0E05 1.4E03 1.5E04 3.1E05 204 0.0E+00 2.6E06 7.6E07 0.0E+00 4.1E07 5.0E07 205 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 206 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 207 4.6E07 2.2E03 5.3E05 4.2E04 1.7E04 6.5E04 208 1.0E02 3.2E03 6.5E03 2.2E02 6.9E03 2.8E02 209 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 210 1.6E03 5.5E03 1.6E03 7.2E04 3.3E04 1.2E03 211 0.0E+00 0.0E+00 0.0E+00 1.1E06 8.1E07 0.0E+00 212 0.0E+00 1.1E05 2.3E05 1.1E06 8.1E07 0.0E+00 213 0.0E+00 0.0E+00 0.0E+00 7.2E06 0.0E+00 0.0E+00 214 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 215 0.0E+00 1.3E06 3.8E06 0.0E+00 0.0E+00 0.0E+00 216 2.0E04 3.9E04 1.7E05 4.4E04 3.4E04 1.2E03 217 0.0E+00 1.9E05 0.0E+00 0.0E+00 0.0E+00 0.0E+00 218 2.5E04 4.3E04 8.9E05 6.3E04 2.4E04 1.3E03 219 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 220 2.6E05 3.8E04 3.5E04 2.5E04 1.9E04 4.1E05 221 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 222 0.0E+00 3.7E05 9.9E06 0.0E+00 0.0E+00 0.0E+00 223 0.0E+00 1.8E05 0.0E+00 1.6E05 0.0E+00 4.5E05 224 3.7E06 3.3E06 7.6E07 0.0E+00 0.0E+00 0.0E+00 225 1.3E03 1.1E03 1.1E03 6.9E04 4.5E04 2.6E03 226 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 227 2.3E06 2.0E05 4.6E06 0.0E+00 4.1E07 0.0E+00 228 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 229 4.2E06 2.6E06 7.6E07 0.0E+00 4.1E07 0.0E+00 230 0.0E+00 1.3E06 1.5E06 1.7E05 7.3E06 2.0E05 231 1.4E06 2.9E05 2.3E06 0.0E+00 2.2E05 3.9E05 232 3.4E01 2.9E01 2.9E01 4.7E05 1.2E04 3.3E05 233 6.0E06 7.2E06 7.6E07 3.7E05 4.9E06 8.4E06 234 0.0E+00 0.0E+00 3.5E05 0.0E+00 0.0E+00 0.0E+00 235 3.5E04 9.6E04 9.7E05 5.7E04 2.8E04 1.4E03 236 8.5E04 1.0E03 1.9E03 1.2E03 5.6E04 2.0E03 237 1.8E06 1.3E06 3.1E05 3.8E05 2.3E05 6.8E05 238 0.0E+00 0.0E+00 3.0E05 0.0E+00 0.0E+00 5.0E07 239 4.4E05 1.3E04 6.5E05 0.0E+00 0.0E+00 0.0E+00 240 9.2E07 2.0E06 2.3E06 0.0E+00 0.0E+00 0.0E+00 241 2.8E06 1.1E05 1.5E06 0.0E+00 0.0E+00 0.0E+00 242 1.8E06 2.6E06 1.5E06 0.0E+00 0.0E+00 0.0E+00 243 3.4E04 3.4E04 4.1E04 5.9E04 2.9E04 1.0E03 244 0.0E+00 0.0E+00 0.0E+00 1.3E05 0.0E+00 0.0E+00 245 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 246 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 247 1.4E06 4.0E06 2.3E06 0.0E+00 0.0E+00 0.0E+00 248 4.6E07 6.6E07 2.0E04 0.0E+00 0.0E+00 0.0E+00 249 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 250 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 251 1.7E03 1.0E03 1.6E03 4.3E03 1.7E03 4.3E03 252 2.2E02 7.2E02 4.5E03 8.6E02 3.0E02 1.8E01 253 0.0E+00 0.0E+00 0.0E+00 0.0E+00 4.1E07 0.0E+00 254 8.9E05 2.9E04 2.1E04 8.0E04 4.5E05 7.4E04 255 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 256 0.0E+00 1.5E05 3.7E03 5.6E07 0.0E+00 0.0E+00 257 0.0E+00 0.0E+00 0.0E+00 3.0E05 0.0E+00 0.0E+00 258 3.0E04 2.1E02 5.5E03 2.2E06 2.6E05 1.5E04 259 7.3E05 2.9E04 1.7E04 5.6E07 9.7E06 4.2E05 260 2.1E04 2.4E05 5.4E04 5.3E03 2.5E03 6.6E03 261 3.5E04 6.9E03 2.2E05 1.5E04 5.6E02 2.9E02 262 7.0E05 4.0E06 3.1E06 5.2E05 2.8E05 1.1E04 263 1.9E04 1.5E03 1.7E04 0.0E+00 0.0E+00 0.0E+00 264 5.6E03 1.0E02 7.4E03 7.8E03 3.1E03 1.3E02 265 4.4E05 4.3E04 6.9E06 5.2E05 0.0E+00 8.5E05 266 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 267 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 268 9.2E05 1.6E04 6.5E05 4.1E05 4.2E05 1.0E04 269 0.0E+00 3.4E05 1.6E05 2.4E05 1.3E05 0.0E+00 270 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 271 9.9E03 1.5E02 2.5E02 1.7E02 1.3E02 2.4E02 272 2.8E05 2.8E05 2.1E05 0.0E+00 8.1E07 5.0E07 273 0.0E+00 0.0E+00 0.0E+00 5.3E05 0.0E+00 0.0E+00 274 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 275 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 276 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 277 6.3E05 4.6E06 4.0E05 8.6E05 3.8E05 0.0E+00 278 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 279 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 280 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 281 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 2.0E06 282 0.0E+00 6.6E07 0.0E+00 0.0E+00 0.0E+00 0.0E+00 283 0.0E+00 0.0E+00 0.0E+00 4.5E06 0.0E+00 0.0E+00 284 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 285 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 286 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 287 0.0E+00 0.0E+00 0.0E+00 5.6E06 0.0E+00 0.0E+00 288 0.0E+00 0.0E+00 0.0E+00 0.0E+00 4.1E07 0.0E+00 289 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 290 0.0E+00 2.0E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 291 3.7E06 5.9E06 1.5E05 0.0E+00 0.0E+00 0.0E+00 292 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 293 2.2E05 8.3E05 6.9E05 1.6E05 5.3E06 2.0E06 294 0.0E+00 0.0E+00 0.0E+00 1.0E05 0.0E+00 0.0E+00 295 2.8E04 4.4E04 4.7E04 3.1E04 1.9E04 9.4E04 296 1.4E06 1.3E06 7.6E07 1.7E05 2.4E06 0.0E+00 297 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 298 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 299 1.4E06 6.6E07 0.0E+00 0.0E+00 4.1E07 5.0E07 300 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 301 4.6E06 7.9E06 3.1E06 1.7E06 4.1E07 2.5E06 302 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 303 0.0E+00 6.6E07 0.0E+00 0.0E+00 0.0E+00 0.0E+00 304 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 305 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 306 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 5.0E07 307 0.0E+00 6.6E07 0.0E+00 0.0E+00 0.0E+00 0.0E+00 308 2.6E05 2.4E05 1.2E05 5.6E07 4.1E07 0.0E+00 309 0.0E+00 0.0E+00 0.0E+00 3.9E06 0.0E+00 0.0E+00 310 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 5.0E07 311 2.8E06 3.3E06 7.6E07 1.1E06 4.1E07 5.0E07 312 1.7E03 9.3E04 1.4E04 2.8E06 0.0E+00 0.0E+00 313 0.0E+00 7.9E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 314 1.9E03 2.8E03 3.8E03 1.7E06 4.1E07 5.0E07 315 3.4E03 6.5E02 1.4E02 2.3E05 1.9E05 9.9E06 316 5.6E05 6.1E04 5.2E04 0.0E+00 4.1E07 0.0E+00 317 2.7E05 6.6E07 1.1E05 0.0E+00 0.0E+00 0.0E+00 318 1.4E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 319 9.2E07 2.0E06 3.1E06 0.0E+00 0.0E+00 0.0E+00 320 8.4E05 3.4E05 3.4E05 4.6E05 3.3E05 6.0E06 321 0.0E+00 0.0E+00 7.6E07 0.0E+00 0.0E+00 0.0E+00 322 2.8E06 1.3E06 3.8E06 5.6E07 0.0E+00 0.0E+00 323 6.4E05 3.8E05 4.9E05 0.0E+00 0.0E+00 0.0E+00 324 9.2E07 0.0E+00 7.6E07 0.0E+00 0.0E+00 0.0E+00 325 6.5E02 7.4E02 3.9E02 7.2E06 7.7E06 9.4E06 326 4.9E03 2.0E02 2.5E02 2.2E06 2.0E06 2.0E06 327 2.8E06 1.1E05 1.5E06 0.0E+00 0.0E+00 5.0E07 328 1.8E06 2.0E06 1.5E06 0.0E+00 0.0E+00 0.0E+00 329 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 330 0.0E+00 6.6E07 0.0E+00 0.0E+00 0.0E+00 0.0E+00 331 1.4E06 6.6E06 1.5E06 3.9E06 4.9E06 7.0E06 332 5.0E05 6.6E07 0.0E+00 3.6E05 1.7E05 2.4E05 333 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 334 2.8E05 3.9E05 1.5E05 1.4E05 1.9E05 9.2E05 335 2.3E06 7.2E06 3.1E06 5.6E07 8.1E07 3.0E06 336 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 337 2.1E02 1.1E04 1.3E04 1.0E04 6.9E05 7.2E05 338 2.8E06 7.2E06 1.6E05 9.5E06 7.7E06 2.5E05 339 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.2E06 0.0E+00 340 9.2E07 3.3E06 3.1E06 0.0E+00 5.3E06 0.0E+00 341 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 342 0.0E+00 0.0E+00 0.0E+00 0.0E+00 4.1E07 0.0E+00 343 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 344 0.0E+00 6.6E07 0.0E+00 0.0E+00 0.0E+00 1.5E06 345 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 346 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 347 4.2E06 5.9E06 1.2E05 5.6E07 3.6E06 2.5E06 348 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 349 3.2E06 0.0E+00 0.0E+00 3.3E05 4.1E07 5.0E07 350 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 351 6.9E06 4.6E06 4.6E06 1.2E05 4.1E07 2.0E06 352 0.0E+00 0.0E+00 4.6E06 0.0E+00 0.0E+00 5.0E07 353 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 354 9.2E07 0.0E+00 7.6E07 3.3E06 8.1E07 1.5E06 355 0.0E+00 0.0E+00 0.0E+00 3.0E05 0.0E+00 0.0E+00 356 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 357 1.8E04 2.0E06 0.0E+00 5.6E07 8.1E07 5.0E07 358 1.4E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 359 0.0E+00 1.3E06 0.0E+00 1.4E04 0.0E+00 0.0E+00 360 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 361 3.2E04 1.7E04 5.4E04 0.0E+00 0.0E+00 0.0E+00 362 0.0E+00 3.3E06 0.0E+00 7.0E05 0.0E+00 2.0E06 363 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 364 0.0E+00 0.0E+00 0.0E+00 1.1E06 4.1E07 1.5E06 365 9.2E07 0.0E+00 0.0E+00 2.9E04 5.2E05 2.5E04 366 0.0E+00 0.0E+00 0.0E+00 1.1E06 8.1E07 3.5E06 367 0.0E+00 3.3E06 0.0E+00 2.2E06 0.0E+00 5.0E07 368 1.8E05 6.0E05 1.2E05 3.3E06 0.0E+00 3.5E06 369 0.0E+00 6.6E07 0.0E+00 5.0E06 8.1E07 2.5E06 370 0.0E+00 7.8E04 0.0E+00 0.0E+00 0.0E+00 0.0E+00 371 0.0E+00 1.3E06 7.6E06 4.0E05 1.9E04 0.0E+00 372 5.1E05 1.5E04 1.8E05 0.0E+00 0.0E+00 0.0E+00 373 3.9E04 8.1E04 7.2E04 8.9E06 1.0E05 1.2E05 374 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 375 9.2E07 0.0E+00 0.0E+00 2.2E06 0.0E+00 0.0E+00 376 4.6E07 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 377 0.0E+00 6.6E07 0.0E+00 5.6E07 8.1E07 9.9E07 378 1.2E05 2.4E05 3.7E05 6.7E06 1.1E05 4.7E05 Taxon ID CM Atm/ Small Intestine 1 1.0E03 9.4E03 9.2E04 9.1E05 5.8E03 6.3E03 4.9E03 2 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 3 3.1E07 2.2E06 0.0E+00 0.0E+00 6.8E07 0.0E+00 4.3E07 4 0.0E+00 0.0E+00 1.9E05 2.6E07 3.5E05 4.0E05 1.3E06 5 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 6 0.0E+00 0.0E+00 9.6E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 7 2.8E06 9.0E05 7.3E06 5.2E07 1.6E04 2.8E05 0.0E+00 8 1.6E06 3.5E05 1.9E06 0.0E+00 6.8E07 1.6E05 0.0E+00 9 6.3E07 0.0E+00 0.0E+00 0.0E+00 3.1E05 3.4E05 0.0E+00 10 1.9E06 0.0E+00 3.8E06 0.0E+00 2.3E05 4.1E05 3.8E06 11 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 2.4E05 0.0E+00 12 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 13 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 14 0.0E+00 2.3E05 3.8E07 2.6E07 0.0E+00 1.2E05 0.0E+00 15 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 8.2E06 0.0E+00 16 4.8E05 0.0E+00 3.8E07 0.0E+00 6.1E06 0.0E+00 3.8E06 17 0.0E+00 0.0E+00 1.5E06 0.0E+00 3.4E06 1.9E06 8.1E06 18 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 19 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 20 0.0E+00 1.3E06 0.0E+00 0.0E+00 6.1E06 1.3E06 2.1E06 21 6.3E06 2.4E05 1.5E05 0.0E+00 6.5E05 3.2E05 1.7E04 22 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 23 0.0E+00 2.8E05 7.7E07 0.0E+00 0.0E+00 0.0E+00 0.0E+00 24 0.0E+00 3.1E06 0.0E+00 0.0E+00 3.4E06 0.0E+00 2.6E06 25 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.8E05 0.0E+00 26 0.0E+00 0.0E+00 5.8E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 27 0.0E+00 0.0E+00 3.8E07 0.0E+00 0.0E+00 6.3E07 8.5E07 28 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 29 0.0E+00 4.0E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 30 0.0E+00 0.0E+00 0.0E+00 0.0E+00 2.7E06 1.9E06 0.0E+00 31 0.0E+00 0.0E+00 3.8E07 0.0E+00 1.4E06 0.0E+00 9.0E06 32 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 33 6.3E06 1.2E05 4.6E06 5.2E07 1.8E05 5.0E05 6.8E06 34 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 35 0.0E+00 8.9E06 3.1E06 0.0E+00 4.8E06 1.8E05 1.3E06 36 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 37 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 38 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 39 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 40 0.0E+00 0.0E+00 0.0E+00 2.6E07 8.5E05 8.2E06 0.0E+00 41 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 42 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 43 0.0E+00 0.0E+00 7.7E07 0.0E+00 0.0E+00 0.0E+00 0.0E+00 44 0.0E+00 0.0E+00 2.3E06 0.0E+00 2.7E06 2.5E06 0.0E+00 45 9.1E06 0.0E+00 0.0E+00 0.0E+00 3.4E06 0.0E+00 3.0E06 46 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 47 0.0E+00 1.3E06 0.0E+00 0.0E+00 6.8E07 0.0E+00 2.6E06 48 3.1E07 4.4E07 3.8E07 0.0E+00 0.0E+00 6.3E07 1.7E06 49 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 50 6.9E06 1.9E04 1.5E05 0.0E+00 5.7E05 8.3E05 6.7E05 51 0.0E+00 0.0E+00 5.0E06 0.0E+00 0.0E+00 0.0E+00 2.1E06 52 0.0E+00 0.0E+00 3.1E06 0.0E+00 3.1E04 3.8E06 4.3E06 53 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 8.3E05 0.0E+00 54 0.0E+00 4.7E05 0.0E+00 0.0E+00 6.8E06 3.1E06 3.4E06 55 9.4E07 1.3E04 6.5E06 0.0E+00 5.6E05 3.1E06 4.8E05 56 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 9.4E06 0.0E+00 57 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 58 1.7E04 2.6E03 6.7E04 1.2E05 3.3E03 2.4E03 9.4E03 59 1.3E06 4.7E04 1.4E03 0.0E+00 1.1E02 1.3E02 1.2E02 60 9.7E06 1.6E04 2.1E03 5.2E06 1.3E02 4.0E02 5.1E03 61 9.4E07 2.4E05 5.0E06 0.0E+00 2.3E04 3.4E05 1.1E04 62 5.7E05 1.2E03 5.3E04 3.1E06 5.4E04 1.3E04 6.6E04 63 0.0E+00 8.9E06 1.5E06 0.0E+00 6.6E05 9.2E05 1.1E04 64 5.3E05 5.5E05 1.6E04 1.0E05 5.0E03 3.0E04 1.9E03 65 6.3E06 7.1E04 1.4E04 7.8E07 6.7E02 2.4E05 3.9E02 66 1.6E06 4.4E04 2.3E04 0.0E+00 2.2E03 2.7E03 2.0E03 67 6.2E05 5.8E04 2.4E04 6.5E06 4.4E03 8.5E04 3.0E03 68 0.0E+00 0.0E+00 1.2E06 0.0E+00 1.4E06 6.3E07 0.0E+00 69 0.0E+00 3.6E06 7.7E04 2.6E07 9.6E06 1.1E05 8.5E06 70 0.0E+00 4.4E07 7.7E07 0.0E+00 2.2E05 7.5E06 3.4E06 71 3.1E07 2.2E06 3.8E07 0.0E+00 4.5E05 2.9E05 6.0E05 72 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 6.3E07 8.5E07 73 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.4E06 6.3E07 0.0E+00 74 0.0E+00 4.4E07 1.9E06 0.0E+00 2.0E06 6.3E07 4.3E06 75 1.3E06 0.0E+00 1.2E06 0.0E+00 6.4E05 4.4E06 6.8E06 76 1.6E06 2.8E04 1.9E04 7.8E07 2.1E03 1.1E03 1.2E03 77 0.0E+00 6.2E06 1.2E06 0.0E+00 2.3E05 1.9E05 3.1E05 78 0.0E+00 4.4E07 3.8E07 0.0E+00 4.8E06 9.4E06 8.5E07 79 1.3E06 3.6E06 7.5E04 2.3E06 3.5E03 2.1E02 4.4E04 80 1.6E05 5.1E05 0.0E+00 0.0E+00 0.0E+00 3.1E06 0.0E+00 81 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.4E06 1.3E06 9.4E06 82 1.3E05 2.0E02 2.1E02 6.7E06 2.5E02 2.2E01 5.5E02 83 1.7E05 1.9E04 2.3E04 6.0E06 4.6E03 4.0E04 1.0E03 84 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 85 1.5E05 1.2E04 1.9E03 3.4E06 8.2E03 3.4E02 2.9E03 86 1.4E04 1.8E02 1.9E03 6.6E05 2.0E01 1.9E01 2.4E01 87 0.0E+00 8.9E07 0.0E+00 0.0E+00 9.6E06 6.9E06 1.5E05 88 3.1E07 7.0E04 7.0E05 0.0E+00 6.8E07 6.3E07 4.3E07 89 1.9E06 5.3E06 1.2E05 0.0E+00 5.0E05 7.5E05 4.3E07 90 5.6E06 0.0E+00 3.8E07 0.0E+00 9.8E05 6.3E07 2.3E05 91 7.5E06 2.7E04 3.8E07 0.0E+00 6.0E05 0.0E+00 9.8E06 92 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 6.3E07 0.0E+00 93 0.0E+00 0.0E+00 0.0E+00 2.6E07 0.0E+00 0.0E+00 0.0E+00 94 9.1E06 1.3E03 2.0E03 5.7E06 2.7E02 3.0E02 2.2E02 95 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.4E06 0.0E+00 8.5E07 96 6.3E07 1.3E05 1.4E04 1.0E06 1.0E03 5.6E04 1.5E03 97 1.6E06 4.3E03 8.4E04 2.6E07 0.0E+00 2.4E05 6.5E03 98 5.3E06 4.7E05 2.0E05 0.0E+00 2.9E05 1.0E05 3.5E05 99 0.0E+00 0.0E+00 7.7E07 0.0E+00 0.0E+00 5.0E06 3.4E06 100 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 101 0.0E+00 9.3E05 0.0E+00 0.0E+00 5.5E05 1.2E05 7.7E05 102 0.0E+00 0.0E+00 7.7E07 0.0E+00 0.0E+00 0.0E+00 0.0E+00 103 0.0E+00 1.3E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 104 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 105 4.8E05 9.4E04 3.0E05 7.8E07 3.6E04 5.7E05 2.9E04 106 0.0E+00 8.9E07 0.0E+00 0.0E+00 3.4E06 0.0E+00 0.0E+00 107 0.0E+00 0.0E+00 4.2E06 0.0E+00 1.3E05 8.8E06 1.1E05 108 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 109 0.0E+00 2.7E06 0.0E+00 0.0E+00 2.0E06 0.0E+00 1.7E06 110 0.0E+00 0.0E+00 5.8E06 0.0E+00 2.7E05 0.0E+00 0.0E+00 111 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 112 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 113 1.3E06 1.8E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 4.3E07 114 2.8E06 0.0E+00 6.5E06 0.0E+00 9.6E06 5.0E06 0.0E+00 115 9.1E06 3.0E05 1.1E04 0.0E+00 4.8E06 1.1E04 7.4E04 116 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 117 0.0E+00 0.0E+00 6.1E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 118 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 119 0.0E+00 0.0E+00 5.0E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 120 4.7E06 1.0E04 4.6E06 0.0E+00 5.3E04 1.3E05 6.4E06 121 0.0E+00 8.9E07 3.8E06 0.0E+00 0.0E+00 0.0E+00 8.5E07 122 0.0E+00 5.8E06 0.0E+00 0.0E+00 5.5E06 6.9E05 4.3E04 123 1.7E05 3.6E05 0.0E+00 0.0E+00 3.1E05 6.3E07 2.1E05 124 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 125 0.0E+00 9.8E06 3.8E07 0.0E+00 0.0E+00 0.0E+00 1.5E04 126 3.4E06 0.0E+00 1.2E05 0.0E+00 0.0E+00 0.0E+00 0.0E+00 127 0.0E+00 0.0E+00 1.0E05 0.0E+00 0.0E+00 4.5E05 0.0E+00 128 1.2E04 2.0E04 1.6E04 7.8E07 2.9E05 9.4E05 5.8E05 129 3.1E07 1.8E06 0.0E+00 0.0E+00 6.8E07 0.0E+00 1.7E06 130 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 131 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 132 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.9E05 0.0E+00 0.0E+00 133 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 134 6.1E03 1.6E02 2.9E03 2.6E07 4.1E03 1.1E04 6.0E03 135 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 136 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 4.4E06 0.0E+00 137 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 138 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 139 0.0E+00 2.7E06 1.4E05 2.6E07 6.8E06 0.0E+00 3.1E05 140 2.4E05 3.5E04 5.0E06 0.0E+00 1.5E05 1.6E04 3.1E04 141 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 142 0.0E+00 0.0E+00 0.0E+00 0.0E+00 2.5E04 0.0E+00 0.0E+00 143 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.5E05 0.0E+00 0.0E+00 144 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 145 0.0E+00 2.2E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 146 0.0E+00 0.0E+00 3.8E07 5.2E07 0.0E+00 0.0E+00 0.0E+00 147 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 148 5.6E06 4.2E04 3.4E05 4.4E06 1.8E04 2.3E04 9.9E04 149 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 150 0.0E+00 8.9E07 7.7E07 2.6E07 1.4E06 3.1E05 1.4E05 151 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 6.6E05 152 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 153 3.1E07 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 154 1.3E06 4.4E07 2.1E05 5.2E07 6.8E07 4.9E03 1.6E04 155 4.4E06 0.0E+00 6.1E06 0.0E+00 5.6E05 1.6E05 1.2E05 156 2.2E06 2.2E05 1.8E05 5.2E07 6.1E04 9.7E05 0.0E+00 157 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 6.9E06 4.3E07 158 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 159 3.6E05 4.5E04 3.7E05 5.2E07 1.4E03 7.0E04 0.0E+00 160 6.3E06 0.0E+00 0.0E+00 0.0E+00 4.1E05 0.0E+00 0.0E+00 161 2.2E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.3E06 0.0E+00 162 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.6E05 6.3E07 0.0E+00 163 1.0E02 3.6E06 5.1E04 1.4E03 8.2E06 5.5E05 2.5E04 164 0.0E+00 4.4E05 1.5E06 0.0E+00 1.6E04 8.2E05 7.7E06 165 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 166 0.0E+00 0.0E+00 8.4E06 0.0E+00 0.0E+00 0.0E+00 4.3E07 167 1.3E02 7.5E02 1.2E01 2.2E04 3.0E02 3.0E02 3.4E02 168 2.5E06 0.0E+00 8.9E05 0.0E+00 0.0E+00 1.3E06 2.6E06 169 0.0E+00 4.4E07 3.8E07 0.0E+00 0.0E+00 0.0E+00 0.0E+00 170 3.1E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 171 4.1E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 172 4.6E03 1.5E03 1.7E01 1.1E05 2.3E03 1.8E02 2.3E02 173 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 174 5.7E02 8.0E02 1.9E01 2.5E05 4.8E03 4.9E02 1.9E02 175 0.0E+00 5.8E06 3.8E07 0.0E+00 0.0E+00 6.3E07 2.1E06 176 0.0E+00 7.5E05 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 177 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 6.3E07 0.0E+00 178 0.0E+00 2.7E06 7.7E07 0.0E+00 2.7E06 0.0E+00 0.0E+00 179 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 180 2.7E04 5.6E05 1.0E05 0.0E+00 6.8E06 1.9E06 2.1E05 181 0.0E+00 6.7E06 0.0E+00 0.0E+00 2.7E06 0.0E+00 3.4E06 182 0.0E+00 0.0E+00 1.2E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 183 0.0E+00 2.7E06 0.0E+00 0.0E+00 0.0E+00 6.3E07 0.0E+00 184 0.0E+00 0.0E+00 6.9E06 0.0E+00 7.5E06 0.0E+00 0.0E+00 185 2.8E06 1.3E03 4.1E05 0.0E+00 5.9E05 2.2E04 2.1E04 186 8.4E06 0.0E+00 3.5E06 0.0E+00 9.8E05 6.3E06 3.5E05 187 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 188 6.3E07 4.4E07 0.0E+00 0.0E+00 4.8E06 0.0E+00 0.0E+00 189 0.0E+00 0.0E+00 1.9E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 190 1.4E02 6.1E03 6.6E04 2.6E07 1.8E03 6.5E04 5.8E04 191 1.6E06 9.3E06 1.9E06 0.0E+00 4.8E06 5.0E05 1.5E04 192 5.3E06 4.9E06 2.7E06 0.0E+00 0.0E+00 1.9E06 8.5E07 193 1.4E03 3.8E04 9.4E05 0.0E+00 4.0E05 0.0E+00 1.1E04 194 2.0E05 2.3E05 3.1E06 0.0E+00 2.8E05 2.4E04 1.3E05 195 2.2E06 5.4E05 1.5E06 0.0E+00 3.7E05 0.0E+00 0.0E+00 196 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 5.6E06 197 0.0E+00 0.0E+00 7.7E07 5.2E07 0.0E+00 0.0E+00 0.0E+00 198 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 3.5E05 0.0E+00 199 2.1E03 1.7E04 2.6E01 3.6E06 2.6E05 2.5E04 6.1E04 200 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 201 3.1E07 1.4E05 6.5E06 0.0E+00 1.8E05 0.0E+00 2.6E06 202 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 203 3.1E07 8.9E07 2.4E05 0.0E+00 0.0E+00 0.0E+00 4.3E07 204 0.0E+00 1.3E06 8.8E06 0.0E+00 6.8E07 0.0E+00 0.0E+00 205 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 206 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 207 0.0E+00 5.8E05 1.2E05 0.0E+00 1.3E04 2.8E04 3.3E04 208 1.2E04 5.2E03 4.7E04 1.4E05 9.4E04 2.1E04 3.7E03 209 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 210 3.6E05 8.5E04 2.4E04 0.0E+00 7.6E05 1.6E04 6.0E04 211 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 2.6E04 212 0.0E+00 0.0E+00 1.5E06 0.0E+00 2.9E05 4.8E05 0.0E+00 213 0.0E+00 0.0E+00 0.0E+00 0.0E+00 3.1E05 0.0E+00 3.8E06 214 0.0E+00 0.0E+00 1.6E05 0.0E+00 0.0E+00 0.0E+00 0.0E+00 215 0.0E+00 0.0E+00 0.0E+00 0.0E+00 3.3E05 0.0E+00 6.0E06 216 2.3E05 3.6E04 1.3E05 7.8E07 8.0E04 2.1E05 2.2E04 217 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 218 2.1E05 4.3E04 1.9E05 0.0E+00 8.4E05 9.7E05 3.2E04 219 0.0E+00 0.0E+00 1.5E05 0.0E+00 0.0E+00 0.0E+00 2.5E04 220 1.2E04 9.6E04 1.9E04 2.6E07 1.1E04 1.6E04 7.8E05 221 2.5E06 0.0E+00 3.8E07 0.0E+00 0.0E+00 0.0E+00 0.0E+00 222 0.0E+00 8.0E06 0.0E+00 0.0E+00 1.4E06 0.0E+00 0.0E+00 223 0.0E+00 0.0E+00 0.0E+00 0.0E+00 3.0E05 0.0E+00 0.0E+00 224 0.0E+00 2.2E06 0.0E+00 0.0E+00 6.8E07 0.0E+00 1.7E06 225 4.3E05 2.1E04 6.2E05 0.0E+00 5.0E05 2.1E05 6.7E05 226 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.0E05 0.0E+00 0.0E+00 227 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 6.3E07 1.2E05 228 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 229 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.4E06 0.0E+00 0.0E+00 230 0.0E+00 2.7E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 231 0.0E+00 0.0E+00 0.0E+00 0.0E+00 3.4E06 2.5E06 5.6E06 232 3.3E03 2.8E01 3.4E03 8.6E06 2.5E01 3.5E02 1.7E01 233 0.0E+00 6.3E05 0.0E+00 0.0E+00 4.8E06 6.3E07 4.7E06 234 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 5.2E05 0.0E+00 235 5.3E06 2.7E05 1.6E05 0.0E+00 9.9E05 2.4E05 7.9E05 236 4.6E05 2.0E04 4.0E05 5.2E07 8.1E05 9.3E05 2.8E04 237 3.1E07 0.0E+00 7.7E07 0.0E+00 0.0E+00 0.0E+00 0.0E+00 238 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.9E04 239 1.3E05 0.0E+00 4.2E06 0.0E+00 0.0E+00 4.4E05 1.7E04 240 0.0E+00 0.0E+00 3.8E07 0.0E+00 0.0E+00 6.3E07 4.3E07 241 3.1E07 5.8E06 7.7E07 0.0E+00 0.0E+00 3.6E05 0.0E+00 242 0.0E+00 2.7E06 0.0E+00 0.0E+00 2.7E06 0.0E+00 1.7E06 243 1.4E04 5.7E04 5.3E05 5.2E07 1.1E04 7.1E05 1.4E04 244 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 2.5E06 0.0E+00 245 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 8.2E06 0.0E+00 246 0.0E+00 0.0E+00 1.2E05 0.0E+00 0.0E+00 0.0E+00 0.0E+00 247 0.0E+00 1.8E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 8.5E07 248 3.1E07 3.1E06 0.0E+00 0.0E+00 0.0E+00 2.5E06 2.1E06 249 0.0E+00 0.0E+00 1.5E06 0.0E+00 0.0E+00 0.0E+00 4.3E07 250 1.8E05 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 251 6.3E05 3.2E03 3.1E05 2.6E07 2.2E04 7.8E04 2.4E03 252 1.5E04 2.8E02 3.8E05 2.2E05 2.2E04 1.6E01 8.2E02 253 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 254 2.1E05 8.6E05 5.8E06 2.1E06 4.3E04 6.8E05 8.5E05 255 0.0E+00 0.0E+00 5.0E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 256 0.0E+00 5.5E03 2.3E05 2.6E07 3.7E04 2.8E04 3.2E05 257 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 258 0.0E+00 7.2E04 8.3E04 2.6E07 1.1E02 2.3E02 6.3E03 259 1.3E06 4.2E04 0.0E+00 0.0E+00 9.7E04 2.5E06 8.5E07 260 1.3E05 9.9E05 1.7E05 4.4E06 1.8E05 9.8E05 1.9E03 261 1.0E05 1.6E05 9.4E05 7.0E06 1.8E05 4.0E02 1.7E05 262 4.7E06 4.4E06 7.7E07 7.8E07 3.4E06 1.9E05 8.5E07 263 3.0E05 6.9E04 7.3E05 0.0E+00 2.0E04 2.4E05 3.0E06 264 2.1E04 4.2E03 5.7E04 1.8E06 9.5E04 1.2E03 3.2E03 265 8.8E06 1.8E06 3.5E05 0.0E+00 8.6E05 6.3E07 8.9E05 266 0.0E+00 1.9E04 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 267 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 268 6.3E07 4.4E06 0.0E+00 0.0E+00 1.8E05 2.3E05 4.9E05 269 6.3E07 4.4E06 8.6E05 0.0E+00 1.1E05 2.9E05 3.0E06 270 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 271 6.9E03 3.8E03 1.7E01 2.5E05 9.6E03 1.4E02 1.1E02 272 1.3E06 2.8E05 4.6E06 0.0E+00 1.8E05 4.4E06 1.7E05 273 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 274 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.3E06 0.0E+00 275 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 276 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 277 9.4E07 2.1E05 1.2E06 0.0E+00 4.1E06 6.3E06 3.0E05 278 6.3E07 0.0E+00 0.0E+00 0.0E+00 6.8E07 0.0E+00 0.0E+00 279 1.6E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 280 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 281 3.1E07 0.0E+00 7.7E07 0.0E+00 0.0E+00 0.0E+00 0.0E+00 282 3.1E07 0.0E+00 3.8E07 0.0E+00 2.0E06 0.0E+00 4.3E07 283 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 284 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.7E05 0.0E+00 285 0.0E+00 0.0E+00 0.0E+00 0.0E+00 7.5E06 0.0E+00 0.0E+00 286 2.1E05 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 287 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 288 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 289 0.0E+00 1.4E05 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 290 6.3E07 1.1E05 0.0E+00 0.0E+00 1.6E05 4.4E06 2.1E06 291 3.1E07 0.0E+00 0.0E+00 0.0E+00 1.4E06 0.0E+00 2.1E06 292 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.6E05 0.0E+00 0.0E+00 293 0.0E+00 1.6E05 6.1E06 0.0E+00 4.2E05 8.3E05 3.5E05 294 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 295 8.7E04 1.6E02 4.6E04 2.4E05 4.7E03 5.3E03 6.3E03 296 2.2E06 5.6E05 1.9E06 0.0E+00 2.1E05 1.1E05 1.5E05 297 0.0E+00 0.0E+00 0.0E+00 0.0E+00 3.4E06 6.3E06 8.5E07 298 0.0E+00 2.5E05 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 299 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 300 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 301 0.0E+00 4.0E06 3.8E07 0.0E+00 2.0E06 6.3E07 6.0E06 302 0.0E+00 4.4E07 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 303 0.0E+00 0.0E+00 1.2E06 0.0E+00 2.7E05 1.7E05 0.0E+00 304 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 305 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 306 0.0E+00 0.0E+00 0.0E+00 0.0E+00 3.4E06 2.3E05 0.0E+00 307 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.7E06 308 0.0E+00 8.9E07 0.0E+00 0.0E+00 2.7E06 1.9E06 5.6E06 309 0.0E+00 1.8E06 1.5E06 0.0E+00 1.3E05 6.9E06 0.0E+00 310 1.9E06 1.3E06 0.0E+00 0.0E+00 2.2E05 4.4E06 0.0E+00 311 6.3E07 1.3E06 0.0E+00 0.0E+00 2.7E06 0.0E+00 1.7E06 312 2.5E06 2.8E04 3.0E04 0.0E+00 5.8E03 1.5E03 3.5E04 313 1.0E05 0.0E+00 1.5E05 0.0E+00 0.0E+00 5.6E05 0.0E+00 314 1.6E04 3.2E04 6.8E05 9.6E06 7.5E04 8.9E05 3.9E03 315 6.4E04 5.6E02 6.2E03 3.1E05 1.4E01 2.7E02 5.6E02 316 0.0E+00 7.2E05 6.1E05 1.0E06 1.5E04 1.6E04 6.7E04 317 3.1E07 0.0E+00 7.7E07 0.0E+00 0.0E+00 0.0E+00 2.6E06 318 0.0E+00 0.0E+00 0.0E+00 0.0E+00 6.8E07 6.3E07 0.0E+00 319 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 320 0.0E+00 3.1E06 1.2E05 0.0E+00 1.7E05 1.0E05 8.1E06 321 3.1E07 0.0E+00 3.8E07 0.0E+00 0.0E+00 0.0E+00 0.0E+00 322 0.0E+00 4.4E07 0.0E+00 0.0E+00 6.8E07 0.0E+00 1.3E06 323 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.2E05 3.1E06 5.1E06 324 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 325 2.9E04 4.3E03 4.6E04 7.0E06 2.6E03 4.5E03 1.1E02 326 5.0E04 1.6E03 1.6E04 1.8E06 2.8E03 2.3E03 4.3E05 327 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 328 0.0E+00 4.4E07 0.0E+00 0.0E+00 1.0E05 1.3E06 3.8E06 329 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 330 1.3E06 8.9E07 0.0E+00 0.0E+00 0.0E+00 6.3E07 4.3E07 331 1.9E05 3.8E04 4.2E06 1.0E06 1.1E04 1.3E05 8.7E05 332 0.0E+00 2.7E04 3.8E07 1.6E06 4.2E04 9.9E05 1.3E04 333 0.0E+00 8.9E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.7E06 334 4.5E05 1.2E03 2.4E05 1.8E06 4.3E04 3.9E04 2.8E04 335 8.1E06 5.4E05 7.7E07 2.6E07 4.0E05 3.5E05 4.6E05 336 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 337 5.6E01 6.2E04 5.1E04 1.0E+00 3.7E03 5.5E04 1.8E03 338 4.1E05 1.4E04 1.0E05 1.3E06 1.7E04 9.3E05 2.7E04 339 1.6E06 8.9E07 0.0E+00 0.0E+00 0.0E+00 3.8E06 0.0E+00 340 5.6E06 0.0E+00 0.0E+00 1.0E06 6.4E05 0.0E+00 0.0E+00 341 0.0E+00 1.1E05 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 342 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 343 2.8E06 0.0E+00 0.0E+00 6.0E06 0.0E+00 0.0E+00 0.0E+00 344 0.0E+00 6.2E06 0.0E+00 0.0E+00 1.6E05 0.0E+00 4.7E06 345 1.3E06 0.0E+00 0.0E+00 1.6E06 0.0E+00 6.3E07 0.0E+00 346 0.0E+00 0.0E+00 0.0E+00 0.0E+00 3.4E06 0.0E+00 0.0E+00 347 1.5E05 8.3E05 2.7E05 0.0E+00 2.5E05 6.3E05 7.7E05 348 3.1E07 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 349 6.9E03 1.6E02 2.4E02 1.0E06 9.4E04 3.5E05 9.0E03 350 0.0E+00 8.9E07 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 351 1.7E02 9.4E03 1.4E02 5.2E07 2.5E03 1.8E04 5.4E03 352 6.6E06 0.0E+00 0.0E+00 0.0E+00 2.6E04 0.0E+00 0.0E+00 353 0.0E+00 1.6E05 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.3E06 354 4.5E03 5.5E02 6.3E04 0.0E+00 8.6E04 6.3E07 1.7E03 355 0.0E+00 4.0E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 356 0.0E+00 4.4E06 3.8E07 0.0E+00 0.0E+00 0.0E+00 8.5E07 357 3.1E07 8.9E07 1.9E06 2.6E07 1.4E06 1.9E06 1.6E05 358 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 359 1.9E06 0.0E+00 0.0E+00 2.6E07 0.0E+00 0.0E+00 5.6E06 360 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 361 1.1E05 1.3E05 1.0E05 0.0E+00 2.2E04 4.6E05 4.9E04 362 4.1E06 1.1E04 1.5E06 0.0E+00 2.5E05 6.3E07 4.3E05 363 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 364 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 365 0.0E+00 2.5E05 3.8E07 0.0E+00 0.0E+00 0.0E+00 2.1E05 366 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 367 0.0E+00 1.9E04 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 368 9.4E07 2.6E05 1.2E06 0.0E+00 1.3E05 2.5E05 1.2E05 369 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.4E05 0.0E+00 370 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 5.1E06 371 0.0E+00 7.1E06 0.0E+00 0.0E+00 0.0E+00 1.9E06 4.3E06 372 1.9E05 1.3E05 0.0E+00 0.0E+00 5.3E05 2.5E06 4.7E05 373 2.9E01 2.6E01 6.2E04 5.3E05 1.2E01 1.8E02 1.1E01 374 0.0E+00 0.0E+00 8.8E06 0.0E+00 1.2E04 0.0E+00 0.0E+00 375 0.0E+00 4.4E07 0.0E+00 0.0E+00 0.0E+00 0.0E+00 8.5E07 376 0.0E+00 4.4E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 4.3E07 377 0.0E+00 1.3E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 378 2.3E05 7.3E04 1.3E05 3.1E06 2.4E04 3.2E04 2.6E04 Taxon ID RM Atm/ Small Intestine 1 4.2E02 2.5E03 6.3E04 8.7E04 2 0.0E+00 0.0E+00 0.0E+00 0.0E+00 3 0.0E+00 0.0E+00 0.0E+00 0.0E+00 4 7.1E04 2.6E04 5.2E05 1.9E05 5 0.0E+00 0.0E+00 0.0E+00 0.0E+00 6 1.6E04 7.8E06 0.0E+00 6.5E07 7 1.7E04 2.0E05 0.0E+00 9.1E06 8 1.9E06 0.0E+00 0.0E+00 0.0E+00 9 1.5E04 1.0E06 0.0E+00 1.6E06 10 3.3E04 0.0E+00 0.0E+00 1.9E06 11 1.8E04 0.0E+00 0.0E+00 0.0E+00 12 0.0E+00 0.0E+00 0.0E+00 0.0E+00 13 9.3E06 0.0E+00 0.0E+00 0.0E+00 14 0.0E+00 0.0E+00 0.0E+00 0.0E+00 15 0.0E+00 0.0E+00 0.0E+00 0.0E+00 16 0.0E+00 0.0E+00 0.0E+00 0.0E+00 17 1.3E05 0.0E+00 1.6E06 0.0E+00 18 0.0E+00 0.0E+00 0.0E+00 0.0E+00 19 8.3E04 0.0E+00 0.0E+00 0.0E+00 20 0.0E+00 0.0E+00 0.0E+00 0.0E+00 21 0.0E+00 0.0E+00 3.1E07 0.0E+00 22 2.7E04 0.0E+00 0.0E+00 0.0E+00 23 0.0E+00 3.4E06 0.0E+00 3.2E07 24 3.7E06 3.4E07 0.0E+00 0.0E+00 25 0.0E+00 0.0E+00 0.0E+00 0.0E+00 26 1.2E05 0.0E+00 0.0E+00 0.0E+00 27 0.0E+00 0.0E+00 0.0E+00 0.0E+00 28 9.6E05 0.0E+00 0.0E+00 0.0E+00 29 0.0E+00 0.0E+00 0.0E+00 0.0E+00 30 2.9E04 0.0E+00 0.0E+00 0.0E+00 31 3.1E06 0.0E+00 0.0E+00 0.0E+00 32 1.3E03 0.0E+00 1.6E06 3.2E07 33 2.4E03 9.4E05 9.4E07 1.3E06 34 8.8E05 0.0E+00 0.0E+00 0.0E+00 35 0.0E+00 0.0E+00 0.0E+00 0.0E+00 36 0.0E+00 0.0E+00 0.0E+00 0.0E+00 37 1.9E04 0.0E+00 0.0E+00 0.0E+00 38 1.1E04 0.0E+00 0.0E+00 0.0E+00 39 0.0E+00 0.0E+00 0.0E+00 0.0E+00 40 1.5E05 0.0E+00 0.0E+00 0.0E+00 41 0.0E+00 0.0E+00 0.0E+00 0.0E+00 42 0.0E+00 0.0E+00 0.0E+00 0.0E+00 43 5.1E05 0.0E+00 0.0E+00 0.0E+00 44 1.2E06 0.0E+00 0.0E+00 0.0E+00 45 0.0E+00 0.0E+00 0.0E+00 1.6E06 46 4.2E04 0.0E+00 0.0E+00 0.0E+00 47 0.0E+00 0.0E+00 0.0E+00 0.0E+00 48 0.0E+00 0.0E+00 0.0E+00 0.0E+00 49 0.0E+00 0.0E+00 0.0E+00 6.5E07 50 0.0E+00 3.8E05 8.1E05 2.0E05 51 0.0E+00 1.4E04 2.6E05 1.7E05 52 0.0E+00 0.0E+00 5.7E06 0.0E+00 53 0.0E+00 1.2E05 3.5E06 7.1E06 54 1.3E04 6.8E07 0.0E+00 0.0E+00 55 4.3E05 0.0E+00 0.0E+00 0.0E+00 56 0.0E+00 0.0E+00 0.0E+00 0.0E+00 57 1.9E06 6.8E07 9.4E07 0.0E+00 58 2.2E05 1.8E04 2.2E04 6.8E05 59 1.2E06 2.4E06 9.4E07 9.7E07 60 2.3E05 1.8E05 1.4E05 2.6E05 61 0.0E+00 0.0E+00 0.0E+00 0.0E+00 62 3.6E05 3.4E05 3.4E05 5.5E06 63 1.4E05 8.1E05 6.3E05 8.0E05 64 6.2E07 5.4E06 2.5E06 6.5E07 65 1.9E06 3.4E06 3.1E06 2.6E06 66 0.0E+00 1.4E06 6.3E07 3.2E07 67 6.2E07 1.4E06 9.4E07 1.3E06 68 0.0E+00 0.0E+00 0.0E+00 0.0E+00 69 2.2E04 5.1E03 5.4E03 1.2E02 70 4.3E06 6.1E06 7.2E06 7.5E06 71 5.6E06 4.8E05 3.6E05 5.5E05 72 0.0E+00 6.8E07 6.3E07 3.2E07 73 0.0E+00 0.0E+00 0.0E+00 0.0E+00 74 0.0E+00 3.4E06 2.2E06 3.9E06 75 0.0E+00 0.0E+00 0.0E+00 0.0E+00 76 8.6E06 1.0E06 6.3E04 2.8E04 77 4.1E05 5.4E06 7.9E06 6.8E06 78 0.0E+00 1.4E06 6.3E07 1.3E06 79 8.6E06 4.1E06 3.8E06 5.2E06 80 5.0E04 8.4E05 1.9E06 3.9E06 81 0.0E+00 0.0E+00 0.0E+00 0.0E+00 82 8.8E03 5.2E02 4.8E02 4.8E02 83 4.5E03 1.2E03 5.6E02 2.7E02 84 5.6E06 0.0E+00 0.0E+00 0.0E+00 85 8.6E06 2.5E02 4.8E02 4.7E02 86 4.5E02 2.9E01 2.6E01 3.5E01 87 6.2E07 5.8E06 3.1E06 6.8E06 88 1.9E06 0.0E+00 6.3E07 0.0E+00 89 6.2E07 6.8E07 2.2E06 0.0E+00 90 0.0E+00 0.0E+00 0.0E+00 0.0E+00 91 6.8E06 1.4E06 0.0E+00 0.0E+00 92 6.2E07 0.0E+00 0.0E+00 0.0E+00 93 0.0E+00 0.0E+00 0.0E+00 0.0E+00 94 5.1E05 2.9E04 2.2E04 3.0E04 95 0.0E+00 0.0E+00 0.0E+00 0.0E+00 96 6.2E07 3.7E06 1.4E03 7.0E04 97 0.0E+00 1.0E06 3.1E07 6.5E07 98 0.0E+00 0.0E+00 0.0E+00 0.0E+00 99 0.0E+00 0.0E+00 0.0E+00 0.0E+00 100 6.1E05 6.8E07 3.1E07 0.0E+00 101 1.7E03 8.8E05 3.0E05 2.1E05 102 2.0E05 3.4E06 0.0E+00 0.0E+00 103 0.0E+00 0.0E+00 0.0E+00 0.0E+00 104 0.0E+00 0.0E+00 0.0E+00 0.0E+00 105 1.9E06 1.7E06 3.1E07 2.6E06 106 1.2E06 0.0E+00 0.0E+00 0.0E+00 107 2.5E06 1.0E05 6.3E06 8.4E06 108 0.0E+00 0.0E+00 0.0E+00 0.0E+00 109 0.0E+00 0.0E+00 0.0E+00 0.0E+00 110 0.0E+00 0.0E+00 0.0E+00 0.0E+00 111 0.0E+00 1.4E06 0.0E+00 0.0E+00 112 0.0E+00 1.3E05 0.0E+00 0.0E+00 113 0.0E+00 0.0E+00 0.0E+00 0.0E+00 114 1.4E04 0.0E+00 0.0E+00 1.3E06 115 2.1E03 2.0E04 8.8E05 6.8E06 116 0.0E+00 0.0E+00 0.0E+00 0.0E+00 117 0.0E+00 0.0E+00 0.0E+00 0.0E+00 118 6.2E04 0.0E+00 0.0E+00 0.0E+00 119 0.0E+00 0.0E+00 0.0E+00 0.0E+00 120 0.0E+00 0.0E+00 3.1E07 0.0E+00 121 0.0E+00 0.0E+00 3.1E07 0.0E+00 122 6.4E05 0.0E+00 0.0E+00 0.0E+00 123 0.0E+00 0.0E+00 0.0E+00 0.0E+00 124 0.0E+00 0.0E+00 0.0E+00 3.2E07 125 1.5E04 2.0E05 3.1E07 0.0E+00 126 2.5E06 0.0E+00 0.0E+00 0.0E+00 127 0.0E+00 0.0E+00 0.0E+00 0.0E+00 128 1.8E03 4.7E04 7.1E05 1.1E05 129 9.9E06 0.0E+00 0.0E+00 0.0E+00 130 0.0E+00 0.0E+00 0.0E+00 0.0E+00 131 7.4E06 3.4E07 0.0E+00 0.0E+00 132 0.0E+00 0.0E+00 0.0E+00 0.0E+00 133 0.0E+00 0.0E+00 0.0E+00 0.0E+00 134 1.0E03 1.0E06 6.0E06 3.2E07 135 0.0E+00 0.0E+00 0.0E+00 0.0E+00 136 0.0E+00 3.1E06 3.1E06 3.2E07 137 1.0E03 6.8E07 0.0E+00 0.0E+00 138 0.0E+00 0.0E+00 0.0E+00 0.0E+00 139 4.9E05 4.5E05 6.3E07 9.7E07 140 2.8E03 7.6E05 7.8E05 3.1E05 141 0.0E+00 0.0E+00 0.0E+00 0.0E+00 142 0.0E+00 0.0E+00 0.0E+00 6.5E07 143 0.0E+00 0.0E+00 0.0E+00 0.0E+00 144 0.0E+00 0.0E+00 0.0E+00 0.0E+00 145 0.0E+00 0.0E+00 0.0E+00 0.0E+00 146 6.8E03 0.0E+00 0.0E+00 0.0E+00 147 0.0E+00 0.0E+00 0.0E+00 0.0E+00 148 5.2E03 6.2E05 1.6E05 6.8E06 149 0.0E+00 0.0E+00 0.0E+00 0.0E+00 150 6.2E07 5.0E05 3.6E04 2.3E04 151 0.0E+00 0.0E+00 0.0E+00 0.0E+00 152 0.0E+00 0.0E+00 0.0E+00 0.0E+00 153 0.0E+00 0.0E+00 0.0E+00 0.0E+00 154 4.7E02 6.1E06 2.5E06 5.5E06 155 0.0E+00 1.0E05 0.0E+00 3.2E07 156 2.0E03 1.9E05 2.2E06 1.1E05 157 4.5E05 0.0E+00 0.0E+00 0.0E+00 158 0.0E+00 0.0E+00 0.0E+00 0.0E+00 159 2.9E03 1.3E04 4.4E06 2.7E05 160 0.0E+00 2.0E05 0.0E+00 0.0E+00 161 0.0E+00 2.0E06 0.0E+00 0.0E+00 162 4.3E04 1.4E05 0.0E+00 0.0E+00 163 1.9E06 6.8E07 9.4E07 0.0E+00 164 7.8E05 7.5E06 2.5E06 1.9E06 165 0.0E+00 0.0E+00 0.0E+00 0.0E+00 166 8.0E06 0.0E+00 0.0E+00 0.0E+00 167 4.6E01 1.7E01 1.0E03 2.7E03 168 0.0E+00 3.4E07 0.0E+00 0.0E+00 169 1.2E06 1.0E06 2.2E06 0.0E+00 170 0.0E+00 0.0E+00 0.0E+00 0.0E+00 171 0.0E+00 0.0E+00 0.0E+00 0.0E+00 172 2.4E02 2.8E01 2.2E01 6.5E02 173 0.0E+00 0.0E+00 0.0E+00 0.0E+00 174 1.5E05 9.9E06 1.1E05 1.1E05 175 0.0E+00 0.0E+00 0.0E+00 0.0E+00 176 0.0E+00 0.0E+00 0.0E+00 0.0E+00 177 0.0E+00 0.0E+00 0.0E+00 0.0E+00 178 1.2E05 6.1E06 1.6E06 0.0E+00 179 0.0E+00 0.0E+00 0.0E+00 0.0E+00 180 0.0E+00 0.0E+00 0.0E+00 0.0E+00 181 0.0E+00 0.0E+00 0.0E+00 0.0E+00 182 0.0E+00 3.4E07 6.3E07 6.5E07 183 0.0E+00 0.0E+00 0.0E+00 0.0E+00 184 0.0E+00 0.0E+00 0.0E+00 6.5E07 185 6.5E04 2.5E04 0.0E+00 2.3E06 186 2.5E06 1.7E06 0.0E+00 0.0E+00 187 0.0E+00 0.0E+00 0.0E+00 0.0E+00 188 6.8E06 1.0E06 0.0E+00 0.0E+00 189 0.0E+00 2.1E05 0.0E+00 0.0E+00 190 1.3E03 6.0E05 3.5E06 1.0E05 191 1.0E03 1.3E04 6.3E05 2.6E06 192 3.1E04 4.4E06 0.0E+00 0.0E+00 193 0.0E+00 0.0E+00 0.0E+00 3.2E07 194 2.4E03 1.2E05 0.0E+00 0.0E+00 195 0.0E+00 1.1E05 0.0E+00 1.3E06 196 0.0E+00 0.0E+00 0.0E+00 0.0E+00 197 0.0E+00 0.0E+00 0.0E+00 0.0E+00 198 0.0E+00 0.0E+00 0.0E+00 0.0E+00 199 1.2E03 8.5E04 6.5E02 2.2E05 200 0.0E+00 1.0E06 0.0E+00 0.0E+00 201 1.2E06 6.8E07 6.3E07 0.0E+00 202 0.0E+00 0.0E+00 0.0E+00 0.0E+00 203 0.0E+00 2.9E04 8.5E06 0.0E+00 204 1.2E06 3.7E06 1.6E06 0.0E+00 205 1.9E06 1.0E06 0.0E+00 0.0E+00 206 0.0E+00 1.4E06 1.3E06 0.0E+00 207 1.1E02 9.9E05 2.6E05 1.2E05 208 3.2E02 1.6E03 3.3E04 8.4E05 209 0.0E+00 0.0E+00 0.0E+00 5.2E06 210 2.7E03 6.5E05 1.4E05 3.6E06 211 0.0E+00 0.0E+00 0.0E+00 6.5E07 212 0.0E+00 0.0E+00 0.0E+00 0.0E+00 213 1.2E05 0.0E+00 0.0E+00 5.2E06 214 0.0E+00 0.0E+00 0.0E+00 0.0E+00 215 1.5E04 5.4E06 0.0E+00 0.0E+00 216 2.7E03 5.3E05 4.3E05 1.5E05 217 0.0E+00 0.0E+00 0.0E+00 0.0E+00 218 4.9E04 4.8E05 9.4E07 1.9E06 219 0.0E+00 0.0E+00 0.0E+00 0.0E+00 220 1.1E03 4.6E05 1.9E06 0.0E+00 221 1.2E06 3.4E07 6.3E07 0.0E+00 222 0.0E+00 0.0E+00 0.0E+00 0.0E+00 223 0.0E+00 3.4E07 0.0E+00 0.0E+00 224 0.0E+00 0.0E+00 0.0E+00 0.0E+00 225 9.3E04 2.0E05 2.5E05 3.6E06 226 0.0E+00 0.0E+00 0.0E+00 0.0E+00 227 0.0E+00 0.0E+00 0.0E+00 0.0E+00 228 0.0E+00 0.0E+00 0.0E+00 0.0E+00 229 0.0E+00 0.0E+00 0.0E+00 0.0E+00 230 0.0E+00 0.0E+00 0.0E+00 0.0E+00 231 0.0E+00 1.7E06 0.0E+00 0.0E+00 232 3.1E04 3.5E05 3.6E05 2.3E05 233 0.0E+00 1.7E06 0.0E+00 0.0E+00 234 0.0E+00 0.0E+00 0.0E+00 0.0E+00 235 0.0E+00 5.4E06 2.5E06 3.2E07 236 1.2E03 7.7E05 3.3E05 1.6E06 237 1.2E04 6.5E06 4.4E06 0.0E+00 238 0.0E+00 0.0E+00 0.0E+00 0.0E+00 239 0.0E+00 0.0E+00 0.0E+00 0.0E+00 240 1.2E06 0.0E+00 0.0E+00 0.0E+00 241 0.0E+00 0.0E+00 0.0E+00 0.0E+00 242 0.0E+00 0.0E+00 0.0E+00 0.0E+00 243 2.7E03 8.5E05 4.4E06 3.2E07 244 4.8E05 0.0E+00 0.0E+00 0.0E+00 245 0.0E+00 0.0E+00 0.0E+00 0.0E+00 246 0.0E+00 0.0E+00 0.0E+00 0.0E+00 247 0.0E+00 0.0E+00 0.0E+00 0.0E+00 248 0.0E+00 3.4E07 0.0E+00 0.0E+00 249 0.0E+00 0.0E+00 0.0E+00 0.0E+00 250 0.0E+00 0.0E+00 0.0E+00 0.0E+00 251 7.0E03 3.2E04 6.8E05 9.7E06 252 6.3E02 1.5E01 2.4E01 1.5E01 253 0.0E+00 0.0E+00 3.1E07 1.9E06 254 2.0E03 1.6E04 2.9E05 5.8E05 255 0.0E+00 0.0E+00 0.0E+00 0.0E+00 256 0.0E+00 0.0E+00 6.3E07 0.0E+00 257 0.0E+00 0.0E+00 0.0E+00 0.0E+00 258 2.0E03 3.4E07 2.2E06 6.5E07 259 7.8E04 8.3E04 3.9E03 1.4E03 260 1.8E03 1.8E04 3.2E04 3.1E05 261 3.1E05 1.9E05 1.5E02 2.6E01 262 1.3E04 2.5E03 1.3E02 4.9E03 263 0.0E+00 2.2E05 0.0E+00 0.0E+00 264 1.1E02 6.7E04 2.2E04 1.1E05 265 3.7E04 3.4E07 0.0E+00 0.0E+00 266 0.0E+00 0.0E+00 3.1E07 0.0E+00 267 0.0E+00 0.0E+00 0.0E+00 0.0E+00 268 0.0E+00 2.4E06 6.3E07 6.5E07 269 7.7E05 8.8E05 3.0E04 3.3E05 270 0.0E+00 8.8E06 0.0E+00 0.0E+00 271 3.3E02 1.7E02 1.5E02 3.0E02 272 1.2E05 0.0E+00 0.0E+00 0.0E+00 273 0.0E+00 0.0E+00 0.0E+00 0.0E+00 274 1.8E04 0.0E+00 0.0E+00 0.0E+00 275 5.2E05 0.0E+00 0.0E+00 0.0E+00 276 6.1E05 0.0E+00 0.0E+00 0.0E+00 277 3.7E05 6.5E06 0.0E+00 0.0E+00 278 6.7E05 1.0E06 0.0E+00 0.0E+00 279 0.0E+00 0.0E+00 0.0E+00 0.0E+00 280 3.5E05 0.0E+00 0.0E+00 0.0E+00 281 0.0E+00 1.4E06 1.6E06 6.5E07 282 0.0E+00 0.0E+00 0.0E+00 0.0E+00 283 0.0E+00 0.0E+00 0.0E+00 0.0E+00 284 1.3E04 0.0E+00 0.0E+00 0.0E+00 285 0.0E+00 0.0E+00 0.0E+00 0.0E+00 286 0.0E+00 0.0E+00 0.0E+00 0.0E+00 287 0.0E+00 0.0E+00 0.0E+00 0.0E+00 288 1.2E06 0.0E+00 0.0E+00 0.0E+00 289 0.0E+00 0.0E+00 0.0E+00 0.0E+00 290 2.1E05 0.0E+00 0.0E+00 0.0E+00 291 0.0E+00 0.0E+00 0.0E+00 0.0E+00 292 0.0E+00 0.0E+00 0.0E+00 0.0E+00 293 0.0E+00 1.4E06 1.6E06 1.9E06 294 1.2E06 0.0E+00 0.0E+00 0.0E+00 295 1.1E01 1.5E03 7.5E05 1.7E04 296 2.4E04 3.4E06 0.0E+00 0.0E+00 297 1.3E05 0.0E+00 0.0E+00 0.0E+00 298 0.0E+00 0.0E+00 0.0E+00 0.0E+00 299 5.4E05 0.0E+00 0.0E+00 0.0E+00 300 4.8E05 0.0E+00 0.0E+00 0.0E+00 301 1.2E06 3.4E07 0.0E+00 0.0E+00 302 0.0E+00 0.0E+00 0.0E+00 0.0E+00 303 6.9E04 9.2E06 0.0E+00 0.0E+00 304 0.0E+00 2.4E06 0.0E+00 0.0E+00 305 0.0E+00 0.0E+00 0.0E+00 0.0E+00 306 0.0E+00 1.7E06 3.1E07 0.0E+00 307 0.0E+00 0.0E+00 0.0E+00 0.0E+00 308 0.0E+00 3.4E07 3.1E07 0.0E+00 309 0.0E+00 2.0E06 0.0E+00 0.0E+00 310 3.7E06 5.8E06 0.0E+00 0.0E+00 311 5.6E06 3.4E07 0.0E+00 0.0E+00 312 0.0E+00 0.0E+00 0.0E+00 0.0E+00 313 0.0E+00 0.0E+00 0.0E+00 0.0E+00 314 0.0E+00 0.0E+00 1.3E06 6.5E07 315 1.7E05 9.2E06 1.1E05 1.3E05 316 0.0E+00 0.0E+00 0.0E+00 0.0E+00 317 0.0E+00 0.0E+00 0.0E+00 0.0E+00 318 0.0E+00 0.0E+00 0.0E+00 0.0E+00 319 0.0E+00 0.0E+00 0.0E+00 0.0E+00 320 0.0E+00 1.8E04 3.3E04 7.1E05 321 0.0E+00 0.0E+00 0.0E+00 0.0E+00 322 0.0E+00 0.0E+00 6.3E07 0.0E+00 323 0.0E+00 0.0E+00 0.0E+00 0.0E+00 324 0.0E+00 0.0E+00 0.0E+00 0.0E+00 325 1.1E05 6.8E06 4.7E06 4.5E06 326 1.2E06 2.0E06 3.5E06 1.6E06 327 0.0E+00 0.0E+00 0.0E+00 0.0E+00 328 0.0E+00 0.0E+00 0.0E+00 0.0E+00 329 0.0E+00 0.0E+00 0.0E+00 0.0E+00 330 0.0E+00 0.0E+00 0.0E+00 0.0E+00 331 2.3E03 7.1E06 9.4E07 0.0E+00 332 2.0E03 6.7E05 6.6E06 0.0E+00 333 0.0E+00 0.0E+00 0.0E+00 0.0E+00 334 6.7E03 1.4E04 2.2E06 7.5E06 335 2.4E04 5.4E06 6.3E07 6.5E07 336 7.0E04 0.0E+00 0.0E+00 0.0E+00 337 3.9E03 1.1E04 6.3E05 5.9E05 338 3.6E03 5.4E05 2.8E06 9.7E07 339 0.0E+00 1.0E06 6.3E07 0.0E+00 340 2.5E04 1.3E05 1.9E06 0.0E+00 341 0.0E+00 0.0E+00 0.0E+00 0.0E+00 342 2.7E03 3.4E07 0.0E+00 0.0E+00 343 0.0E+00 0.0E+00 0.0E+00 0.0E+00 344 0.0E+00 0.0E+00 0.0E+00 3.2E07 345 0.0E+00 0.0E+00 0.0E+00 0.0E+00 346 0.0E+00 0.0E+00 0.0E+00 0.0E+00 347 1.6E03 7.8E06 1.6E06 6.5E07 348 7.3E04 0.0E+00 0.0E+00 0.0E+00 349 2.5E06 2.0E06 1.3E06 0.0E+00 350 0.0E+00 0.0E+00 0.0E+00 0.0E+00 351 1.2E06 1.4E06 6.3E07 3.2E07 352 0.0E+00 0.0E+00 0.0E+00 0.0E+00 353 0.0E+00 0.0E+00 0.0E+00 0.0E+00 354 6.2E07 3.7E06 1.3E06 6.5E07 355 1.2E05 3.4E07 0.0E+00 0.0E+00 356 0.0E+00 0.0E+00 0.0E+00 0.0E+00 357 2.5E06 2.0E06 1.6E06 0.0E+00 358 0.0E+00 0.0E+00 0.0E+00 0.0E+00 359 6.2E05 1.0E06 3.1E07 3.2E07 360 2.0E05 0.0E+00 0.0E+00 0.0E+00 361 0.0E+00 0.0E+00 0.0E+00 0.0E+00 362 3.9E04 5.1E06 3.1E07 6.5E07 363 9.0E05 0.0E+00 0.0E+00 0.0E+00 364 1.2E06 0.0E+00 0.0E+00 0.0E+00 365 9.0E04 1.1E05 2.2E06 0.0E+00 366 0.0E+00 0.0E+00 0.0E+00 0.0E+00 367 8.6E06 6.8E07 0.0E+00 0.0E+00 368 0.0E+00 0.0E+00 9.4E07 3.2E07 369 1.2E06 2.0E06 2.5E06 5.5E06 370 0.0E+00 0.0E+00 0.0E+00 0.0E+00 371 1.2E04 0.0E+00 1.5E05 0.0E+00 372 0.0E+00 0.0E+00 0.0E+00 0.0E+00 373 3.3E05 1.8E05 1.1E05 9.7E06 374 0.0E+00 0.0E+00 0.0E+00 0.0E+00 375 2.5E06 6.8E07 6.3E07 1.3E06 376 0.0E+00 6.8E07 0.0E+00 3.2E07 377 0.0E+00 0.0E+00 0.0E+00 0.0E+00 378 6.3E03 3.6E05 6.0E06 4.5E06 Taxon ID CM Atm/ Colon 1 3.9E03 2.5E03 2.7E03 9.4E04 3.9E03 3.6E03 1.3E03 2 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 3 6.8E07 5.1E07 0.0E+00 0.0E+00 7.7E07 0.0E+00 4.2E06 4 1.0E04 1.8E05 4.3E05 0.0E+00 0.0E+00 2.1E05 1.8E05 5 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 6 0.0E+00 5.1E07 0.0E+00 0.0E+00 1.3E05 0.0E+00 0.0E+00 7 8.9E06 0.0E+00 0.0E+00 1.2E06 6.1E06 1.4E05 0.0E+00 8 8.2E06 9.7E06 1.1E04 0.0E+00 1.8E05 1.6E06 6.1E06 9 2.7E06 0.0E+00 0.0E+00 0.0E+00 9.9E06 5.4E07 4.7E07 10 1.0E05 0.0E+00 3.4E06 0.0E+00 1.1E05 5.4E07 2.8E06 11 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 12 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 13 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 14 0.0E+00 0.0E+00 2.3E06 0.0E+00 2.3E06 1.2E05 0.0E+00 15 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 16 7.5E06 0.0E+00 0.0E+00 3.0E07 0.0E+00 0.0E+00 0.0E+00 17 4.8E06 1.4E05 9.1E06 0.0E+00 2.3E06 4.3E06 7.0E06 18 0.0E+00 4.1E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 19 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 20 2.7E06 4.1E06 4.5E06 0.0E+00 5.4E06 5.4E07 3.8E06 21 2.0E04 1.4E04 4.1E04 7.7E05 1.6E04 2.3E04 2.7E04 22 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 23 0.0E+00 2.0E06 0.0E+00 0.0E+00 3.1E06 0.0E+00 0.0E+00 24 9.5E06 6.1E06 9.1E06 0.0E+00 0.0E+00 1.1E06 5.6E06 25 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 26 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 27 0.0E+00 1.0E06 0.0E+00 0.0E+00 0.0E+00 5.4E07 3.3E06 28 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 29 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 9.4E07 30 0.0E+00 0.0E+00 0.0E+00 0.0E+00 7.7E07 5.4E07 0.0E+00 31 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 5.4E07 0.0E+00 32 8.2E06 0.0E+00 0.0E+00 0.0E+00 9.9E06 1.0E05 0.0E+00 33 2.5E04 1.0E06 6.4E05 2.1E06 2.2E05 8.1E06 4.7E07 34 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 35 6.1E06 2.6E06 3.4E06 0.0E+00 4.6E06 2.7E06 9.4E06 36 7.5E06 0.0E+00 0.0E+00 4.5E06 0.0E+00 0.0E+00 0.0E+00 37 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 38 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 39 0.0E+00 0.0E+00 0.0E+00 1.2E06 0.0E+00 0.0E+00 0.0E+00 40 0.0E+00 0.0E+00 0.0E+00 0.0E+00 2.7E05 0.0E+00 0.0E+00 41 0.0E+00 0.0E+00 0.0E+00 1.0E05 0.0E+00 0.0E+00 0.0E+00 42 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 43 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 44 4.1E06 4.1E06 6.8E06 0.0E+00 6.1E06 1.1E06 9.4E07 45 0.0E+00 0.0E+00 0.0E+00 0.0E+00 3.1E06 0.0E+00 0.0E+00 46 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 47 3.4E06 1.0E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 2.3E06 48 2.7E06 5.1E07 0.0E+00 6.0E07 7.7E07 0.0E+00 4.7E07 49 0.0E+00 0.0E+00 0.0E+00 0.0E+00 9.9E06 0.0E+00 0.0E+00 50 2.5E04 9.7E05 4.4E05 6.0E06 1.3E04 4.6E05 5.6E05 51 6.6E05 0.0E+00 3.4E06 3.0E07 1.5E06 0.0E+00 1.3E05 52 3.1E05 0.0E+00 1.1E06 1.4E05 1.3E04 7.5E06 0.0E+00 53 8.2E06 4.1E06 0.0E+00 0.0E+00 4.4E05 1.1E06 0.0E+00 54 1.2E05 5.1E06 4.3E05 1.0E05 9.9E06 5.4E07 6.6E06 55 1.2E04 1.4E04 1.9E04 0.0E+00 2.0E04 3.5E05 1.1E04 56 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 57 0.0E+00 0.0E+00 0.0E+00 1.5E06 7.7E07 0.0E+00 0.0E+00 58 1.4E02 9.4E03 2.5E02 4.8E03 1.4E02 1.6E02 1.6E02 59 5.5E05 8.5E04 2.2E03 1.0E04 4.7E03 8.5E03 4.1E03 60 3.2E04 7.3E04 5.9E03 6.9E04 1.1E02 2.5E02 1.7E03 61 1.5E04 2.9E04 2.4E04 1.8E04 9.5E04 2.7E04 1.9E04 62 4.1E03 2.1E03 9.4E03 1.2E03 4.8E03 1.1E03 1.9E03 63 1.4E06 8.9E05 1.0E05 1.1E05 8.2E05 1.9E04 8.0E05 64 3.4E03 5.0E04 1.2E02 7.3E03 1.0E02 3.6E03 2.9E03 65 5.1E04 2.8E03 1.0E03 2.7E04 4.1E02 2.2E04 1.7E02 66 1.3E04 9.7E04 7.1E04 1.2E04 1.5E03 1.9E03 4.9E04 67 4.7E03 2.0E03 2.3E02 4.0E03 1.7E02 4.7E03 5.8E03 68 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 69 1.0E05 6.7E06 2.1E03 3.0E06 9.2E06 1.1E05 1.2E05 70 0.0E+00 7.7E06 2.3E06 3.0E07 1.1E05 8.6E06 5.2E06 71 6.8E07 3.4E05 5.7E06 4.8E06 6.3E05 7.5E05 6.6E05 72 0.0E+00 0.0E+00 1.1E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 73 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 9.4E07 74 1.4E06 1.5E06 0.0E+00 0.0E+00 3.1E06 5.4E07 3.3E06 75 3.7E05 0.0E+00 1.5E05 1.6E04 6.3E05 2.3E05 9.9E06 76 4.3E05 6.7E04 5.4E04 1.9E04 1.8E03 8.2E04 6.0E04 77 8.9E06 3.4E05 2.4E05 2.1E06 4.6E05 3.8E05 6.5E05 78 0.0E+00 4.1E06 0.0E+00 0.0E+00 2.3E06 1.1E05 9.4E07 79 8.1E05 1.3E05 2.1E03 1.5E04 3.7E03 1.3E02 1.5E04 80 1.1E05 1.1E05 0.0E+00 1.2E06 4.7E05 0.0E+00 1.5E05 81 8.2E06 3.1E06 3.4E06 1.6E05 1.5E05 1.2E05 7.5E06 82 2.3E04 4.3E02 4.5E02 6.5E04 2.2E02 9.6E02 1.5E02 83 2.0E03 8.5E04 1.2E03 1.5E03 4.2E03 1.9E03 8.9E04 84 0.0E+00 0.0E+00 1.1E06 0.0E+00 0.0E+00 0.0E+00 4.7E07 85 4.5E04 3.3E04 5.1E03 6.9E04 5.0E03 2.3E02 9.5E04 86 7.1E03 2.4E01 2.8E02 2.9E02 3.5E01 3.5E01 2.8E01 87 6.8E07 9.7E06 3.4E06 1.2E06 1.1E05 1.1E05 1.5E05 88 0.0E+00 2.8E03 4.0E03 3.0E07 0.0E+00 0.0E+00 0.0E+00 89 4.8E06 5.1E06 0.0E+00 0.0E+00 1.1E05 0.0E+00 9.4E06 90 3.7E05 2.8E05 1.0E04 3.7E04 9.9E05 1.9E05 6.3E05 91 6.8E07 0.0E+00 0.0E+00 0.0E+00 2.3E06 0.0E+00 4.7E07 92 0.0E+00 0.0E+00 0.0E+00 0.0E+00 7.7E07 0.0E+00 4.7E07 93 0.0E+00 0.0E+00 0.0E+00 3.0E07 0.0E+00 5.4E07 0.0E+00 94 5.9E04 8.4E03 1.7E02 2.9E03 3.2E02 4.5E02 2.0E02 95 0.0E+00 1.5E06 0.0E+00 0.0E+00 7.7E07 2.2E06 0.0E+00 96 1.0E04 3.7E04 1.1E03 4.1E04 2.9E03 1.4E03 1.8E03 97 6.8E07 1.5E02 3.2E02 0.0E+00 7.7E07 5.4E07 6.9E03 98 1.3E04 1.8E04 1.5E04 0.0E+00 9.9E05 3.5E05 2.3E04 99 6.1E06 0.0E+00 1.1E06 3.3E06 1.5E06 1.6E06 0.0E+00 100 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 101 8.9E05 2.4E05 2.5E05 1.7E05 2.6E05 8.6E06 1.7E05 102 0.0E+00 0.0E+00 1.6E05 0.0E+00 0.0E+00 0.0E+00 0.0E+00 103 3.4E06 0.0E+00 1.1E06 0.0E+00 0.0E+00 0.0E+00 4.7E07 104 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 105 3.7E03 1.5E03 4.9E03 6.2E05 1.0E03 3.4E04 5.4E04 106 5.4E06 1.5E06 2.3E06 0.0E+00 3.1E06 0.0E+00 1.9E06 107 2.0E06 9.7E06 1.2E05 3.6E06 1.6E05 2.9E05 1.3E05 108 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 5.6E06 109 6.8E07 2.0E06 2.3E06 0.0E+00 1.5E06 1.1E06 1.4E06 110 1.3E04 9.3E05 1.6E04 9.9E05 6.7E05 2.8E05 1.0E04 111 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 112 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 113 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 114 1.4E06 5.1E07 0.0E+00 0.0E+00 0.0E+00 7.5E06 0.0E+00 115 1.4E03 2.5E04 6.4E03 7.5E06 5.4E06 3.1E04 3.2E04 116 0.0E+00 0.0E+00 6.7E05 0.0E+00 0.0E+00 0.0E+00 0.0E+00 117 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 118 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 119 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 120 1.8E04 9.6E05 1.8E04 0.0E+00 3.6E04 4.8E05 4.7E06 121 9.5E05 3.1E05 5.7E05 1.5E06 6.1E06 1.6E06 3.8E06 122 7.0E05 2.1E05 1.8E05 1.9E05 3.1E06 3.8E05 5.2E04 123 1.4E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 124 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 125 9.7E05 5.6E05 1.2E04 2.1E06 1.8E04 4.3E06 3.0E04 126 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 127 1.0E05 0.0E+00 0.0E+00 0.0E+00 0.0E+00 8.6E06 0.0E+00 128 1.3E02 1.6E04 3.0E03 3.8E05 1.7E04 4.1E04 1.0E04 129 3.4E06 2.0E06 2.3E06 0.0E+00 3.8E06 5.4E07 3.3E06 130 0.0E+00 0.0E+00 1.1E06 0.0E+00 8.4E06 0.0E+00 0.0E+00 131 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 132 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 133 7.6E05 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 134 1.4E02 9.5E04 1.3E03 7.2E06 6.3E03 4.6E04 1.2E04 135 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 136 2.9E05 4.1E06 4.7E05 0.0E+00 9.2E06 2.2E06 8.0E06 137 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 4.7E07 138 0.0E+00 1.4E05 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 139 1.2E04 1.7E05 5.1E03 5.1E06 6.9E06 1.1E06 1.5E04 140 1.6E03 1.1E03 9.5E04 1.6E05 1.3E04 3.1E04 3.1E05 141 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 142 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 143 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 144 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 145 3.4E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 146 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 147 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.0E04 0.0E+00 148 3.4E04 8.1E04 2.4E03 1.9E05 3.7E03 7.7E04 9.5E04 149 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 5.6E06 150 0.0E+00 5.1E07 0.0E+00 0.0E+00 3.1E06 6.5E06 5.2E06 151 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 4.7E07 152 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 153 4.0E05 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 154 2.0E06 2.0E06 4.5E06 6.0E07 1.5E06 4.5E05 1.9E06 155 0.0E+00 1.5E06 0.0E+00 0.0E+00 4.6E06 0.0E+00 0.0E+00 156 6.8E07 1.3E05 3.5E05 4.5E06 3.0E04 1.8E05 0.0E+00 157 0.0E+00 0.0E+00 0.0E+00 3.0E07 0.0E+00 0.0E+00 0.0E+00 158 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 159 4.3E05 5.0E05 0.0E+00 4.2E06 2.5E04 0.0E+00 0.0E+00 160 4.4E05 0.0E+00 3.4E05 0.0E+00 0.0E+00 7.0E06 0.0E+00 161 0.0E+00 5.1E07 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 162 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.2E05 0.0E+00 163 6.6E03 1.5E06 5.4E05 1.0E02 1.5E06 2.2E06 5.3E05 164 7.5E06 9.4E05 6.4E05 2.2E05 3.1E05 1.0E04 1.3E05 165 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 166 0.0E+00 0.0E+00 4.5E06 0.0E+00 7.7E07 0.0E+00 0.0E+00 167 3.0E02 3.5E02 2.6E02 5.6E03 2.4E02 1.5E02 4.1E03 168 6.8E07 0.0E+00 6.8E06 0.0E+00 0.0E+00 1.1E06 1.9E06 169 0.0E+00 0.0E+00 1.1E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 170 6.8E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 171 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 172 5.9E03 1.4E04 1.9E02 1.4E04 7.7E04 4.3E03 6.3E03 173 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 174 4.7E02 2.7E03 3.2E02 8.7E04 8.5E04 1.5E02 2.6E03 175 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 176 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 177 2.0E06 3.1E06 4.5E06 0.0E+00 0.0E+00 0.0E+00 9.4E07 178 1.4E06 8.2E06 1.1E06 0.0E+00 7.7E07 5.4E07 1.4E05 179 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 180 2.6E04 1.0E06 0.0E+00 0.0E+00 1.5E06 5.4E07 9.4E07 181 4.1E06 6.1E06 3.4E06 0.0E+00 3.8E06 0.0E+00 8.4E06 182 0.0E+00 5.1E06 0.0E+00 0.0E+00 2.3E06 0.0E+00 4.7E07 183 0.0E+00 1.2E05 0.0E+00 0.0E+00 0.0E+00 1.1E06 0.0E+00 184 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.1E05 0.0E+00 0.0E+00 185 4.7E04 3.3E03 7.3E03 4.2E06 8.5E04 9.8E04 2.2E04 186 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 187 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 188 1.4E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 189 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 190 1.2E02 1.1E04 7.0E05 4.5E06 1.5E04 1.1E04 1.8E05 191 7.6E05 6.8E05 4.8E05 0.0E+00 9.9E06 1.7E04 8.4E05 192 3.2E05 3.8E05 1.1E04 0.0E+00 1.5E05 0.0E+00 2.0E05 193 8.4E04 1.9E05 2.3E06 3.0E07 6.9E06 0.0E+00 0.0E+00 194 2.5E05 3.1E06 1.0E05 0.0E+00 2.3E06 0.0E+00 0.0E+00 195 0.0E+00 0.0E+00 0.0E+00 0.0E+00 6.1E06 0.0E+00 7.5E06 196 6.8E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 4.0E05 197 7.5E06 4.6E06 9.9E05 7.2E06 3.6E05 8.1E06 7.5E06 198 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.4E04 5.6E06 199 2.6E03 8.1E05 1.4E03 7.2E06 1.7E05 1.4E04 3.1E05 200 1.4E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 201 2.8E05 9.7E06 1.2E04 1.8E06 1.6E05 2.2E06 1.9E06 202 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.1E05 0.0E+00 203 6.6E04 0.0E+00 5.5E04 1.2E04 0.0E+00 1.9E04 0.0E+00 204 2.7E06 3.1E06 7.9E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 205 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 206 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 207 2.5E05 8.7E05 3.4E06 7.2E06 6.1E06 1.4E03 1.6E04 208 1.3E02 8.2E03 2.6E02 9.0E04 5.2E03 8.6E04 5.8E03 209 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 2.9E05 0.0E+00 210 7.7E03 6.1E03 2.2E02 1.7E04 3.2E03 9.4E04 1.6E03 211 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 8.9E06 212 2.3E05 0.0E+00 3.4E06 1.6E05 1.5E05 2.7E05 0.0E+00 213 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 214 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 215 0.0E+00 1.5E06 0.0E+00 0.0E+00 3.1E06 0.0E+00 0.0E+00 216 3.9E03 1.1E03 9.8E05 4.3E05 2.2E03 1.0E04 2.5E04 217 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 218 2.2E03 4.0E04 9.7E04 1.1E04 7.5E05 8.5E05 8.2E05 219 0.0E+00 0.0E+00 0.0E+00 0.0E+00 2.1E05 5.4E07 0.0E+00 220 1.3E03 1.2E03 2.8E03 1.1E04 1.2E03 1.4E04 3.8E04 221 2.0E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 222 3.5E05 6.7E06 0.0E+00 0.0E+00 1.5E06 0.0E+00 0.0E+00 223 4.8E06 0.0E+00 0.0E+00 0.0E+00 5.6E05 0.0E+00 0.0E+00 224 1.4E06 2.6E06 5.7E06 1.8E06 1.5E06 5.4E07 3.8E06 225 8.1E03 1.5E03 6.4E03 5.2E05 8.8E04 4.0E04 5.1E04 226 1.7E04 0.0E+00 9.2E05 0.0E+00 0.0E+00 0.0E+00 0.0E+00 227 2.7E05 9.2E06 9.1E06 3.0E07 0.0E+00 1.1E05 3.7E05 228 6.1E06 5.1E07 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 229 0.0E+00 2.0E06 0.0E+00 0.0E+00 1.5E06 1.6E06 6.1E06 230 0.0E+00 3.1E06 0.0E+00 0.0E+00 7.7E07 2.2E06 0.0E+00 231 8.2E06 1.5E06 5.7E06 3.9E06 2.1E05 6.5E06 5.2E06 232 2.5E01 3.5E01 2.4E01 3.1E05 2.1E01 5.6E02 4.5E01 233 5.4E06 2.9E05 2.3E06 0.0E+00 1.5E06 1.1E06 4.7E06 234 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 6.2E05 0.0E+00 235 8.8E04 5.9E04 2.2E03 3.9E06 1.4E03 6.9E05 3.2E04 236 9.4E03 1.8E03 7.1E03 5.3E04 1.5E03 9.4E04 8.6E04 237 0.0E+00 0.0E+00 1.1E04 2.1E05 1.1E05 1.2E05 0.0E+00 238 2.0E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 5.4E07 1.3E04 239 4.3E04 5.6E05 7.4E05 3.6E06 4.7E05 1.9E05 3.8E05 240 1.1E05 1.0E06 4.5E06 1.2E06 2.3E06 0.0E+00 2.3E06 241 2.7E04 4.1E06 3.0E05 8.2E06 0.0E+00 1.7E04 1.4E06 242 4.1E06 3.1E06 0.0E+00 0.0E+00 7.7E07 1.1E06 6.1E06 243 3.2E02 2.0E03 2.8E03 2.1E04 1.0E03 4.0E04 2.4E04 244 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.2E05 0.0E+00 245 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 246 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 247 6.8E07 5.1E07 0.0E+00 0.0E+00 7.7E07 0.0E+00 5.2E06 248 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.1E04 9.4E07 249 0.0E+00 0.0E+00 3.7E04 0.0E+00 0.0E+00 0.0E+00 0.0E+00 250 2.2E04 5.4E05 2.7E05 0.0E+00 1.7E05 1.8E05 0.0E+00 251 1.4E02 7.6E03 4.6E03 3.5E04 1.3E03 2.8E03 3.6E03 252 1.7E04 2.2E03 2.0E04 3.4E05 2.9E04 7.7E03 2.6E03 253 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 254 3.4E06 8.2E05 7.9E05 4.3E05 9.9E05 1.5E04 5.8E05 255 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 256 6.1E06 5.7E03 5.5E04 0.0E+00 1.7E03 4.9E04 2.0E04 257 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 2.6E05 258 5.3E05 2.3E03 4.1E03 9.7E05 1.4E02 1.3E02 4.6E03 259 1.3E04 6.0E05 1.1E06 3.9E06 9.6E04 3.9E04 5.1E05 260 4.1E06 2.5E05 5.2E05 3.6E05 4.4E04 8.5E04 6.3E03 261 1.7E03 1.4E05 2.0E04 1.0E05 6.0E05 2.7E02 1.3E05 262 6.8E07 5.1E07 3.4E06 1.8E06 4.6E06 5.4E07 0.0E+00 263 9.8E04 1.4E03 3.9E03 8.2E06 1.3E03 2.3E04 1.4E04 264 2.5E02 1.9E02 5.5E02 3.6E04 1.1E02 4.1E03 7.9E03 265 1.2E03 3.1E05 3.5E03 3.3E06 1.3E04 5.9E06 6.3E05 266 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 267 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 268 4.1E05 7.9E05 4.8E05 1.3E05 1.2E04 1.5E04 1.6E04 269 6.1E06 1.1E05 2.0E05 3.0E07 9.2E06 2.3E05 1.9E06 270 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 271 2.0E02 8.4E03 4.3E02 3.7E03 1.6E02 1.5E02 9.1E03 272 2.4E05 2.3E05 4.7E05 9.1E07 2.2E05 5.4E06 3.5E05 273 0.0E+00 0.0E+00 0.0E+00 0.0E+00 2.3E06 0.0E+00 0.0E+00 274 0.0E+00 0.0E+00 0.0E+00 0.0E+00 6.9E06 0.0E+00 0.0E+00 275 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 276 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 277 6.4E04 9.4E05 4.1E04 1.5E05 1.0E04 1.6E05 8.9E05 278 2.0E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 279 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 280 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 281 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 282 0.0E+00 5.1E07 1.1E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 283 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 284 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 285 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 286 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 287 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 288 0.0E+00 0.0E+00 1.1E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 289 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 290 3.4E06 0.0E+00 0.0E+00 1.2E06 0.0E+00 1.6E06 1.4E06 291 1.2E05 0.0E+00 1.0E05 1.2E06 0.0E+00 4.3E06 1.5E05 292 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 293 3.4E06 2.8E05 4.4E05 2.1E06 3.1E05 6.9E05 3.7E05 294 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 295 2.3E03 1.2E03 6.6E04 5.0E04 1.4E03 2.6E03 5.7E04 296 4.1E06 1.5E06 1.1E06 2.4E06 6.1E06 3.2E06 1.4E06 297 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 298 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 299 0.0E+00 1.0E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 2.3E06 300 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 301 2.7E06 6.7E06 9.1E06 6.0E07 3.8E06 5.4E07 8.9E06 302 0.0E+00 4.6E06 4.5E06 0.0E+00 0.0E+00 0.0E+00 3.3E06 303 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 304 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 305 0.0E+00 0.0E+00 0.0E+00 0.0E+00 7.7E06 0.0E+00 0.0E+00 306 0.0E+00 0.0E+00 3.4E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 307 6.8E06 0.0E+00 0.0E+00 6.0E07 0.0E+00 0.0E+00 0.0E+00 308 3.4E06 1.1E05 1.0E05 0.0E+00 5.4E05 1.4E05 5.5E05 309 0.0E+00 0.0E+00 0.0E+00 1.2E06 6.9E06 0.0E+00 0.0E+00 310 2.0E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 311 6.8E07 3.1E06 1.2E05 0.0E+00 7.7E07 1.1E06 9.9E06 312 1.5E04 1.8E04 1.9E03 3.0E06 1.7E03 5.2E04 1.2E04 313 3.6E05 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 314 1.6E02 1.1E03 5.0E03 4.7E03 1.9E03 5.9E04 4.7E03 315 6.2E02 5.1E02 1.7E01 2.1E02 9.8E02 2.4E02 2.9E02 316 0.0E+00 7.4E04 2.4E03 8.5E04 2.4E04 3.8E04 8.3E04 317 1.5E04 2.6E06 5.6E05 9.1E07 2.0E05 4.8E06 9.4E07 318 6.8E07 0.0E+00 1.1E06 0.0E+00 7.7E07 5.4E07 0.0E+00 319 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 1.6E06 3.8E06 320 0.0E+00 5.3E05 1.0E05 9.7E06 4.3E05 7.6E05 6.1E05 321 1.7E05 3.6E06 1.4E05 0.0E+00 0.0E+00 0.0E+00 0.0E+00 322 6.8E07 2.0E06 1.1E06 0.0E+00 5.4E06 0.0E+00 2.8E06 323 0.0E+00 3.6E06 1.1E05 3.6E06 2.8E05 4.8E06 1.3E05 324 0.0E+00 0.0E+00 5.7E06 0.0E+00 2.3E06 0.0E+00 0.0E+00 325 2.0E02 1.3E01 5.5E02 6.9E04 3.1E02 1.8E01 7.9E02 326 4.2E02 1.8E02 5.4E03 9.0E05 1.9E02 2.0E02 7.0E04 327 6.8E07 3.1E06 3.4E06 1.8E06 3.1E06 1.1E06 6.6E06 328 0.0E+00 2.6E06 1.2E05 0.0E+00 2.3E06 0.0E+00 1.4E06 329 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 330 6.8E07 0.0E+00 0.0E+00 6.0E06 2.3E06 0.0E+00 9.4E07 331 1.4E05 2.4E05 9.1E06 1.3E05 5.0E05 8.4E05 1.0E05 332 2.2E05 5.5E05 1.2E05 5.1E06 7.0E05 5.4E06 1.5E05 333 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 334 2.2E04 5.4E05 3.5E05 2.8E05 1.1E04 1.0E04 8.5E05 335 0.0E+00 5.6E06 3.4E06 1.5E06 1.8E05 4.3E06 8.4E06 336 0.0E+00 5.1E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 337 2.7E01 1.1E04 2.3E04 8.9E01 3.9E04 1.9E04 1.8E04 338 1.0E04 5.5E05 3.0E05 9.4E06 4.7E05 1.8E04 4.5E05 339 0.0E+00 3.1E06 0.0E+00 0.0E+00 0.0E+00 7.0E06 0.0E+00 340 0.0E+00 0.0E+00 0.0E+00 7.2E06 2.3E06 2.2E06 2.8E06 341 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 342 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 343 0.0E+00 0.0E+00 0.0E+00 3.6E06 0.0E+00 0.0E+00 0.0E+00 344 0.0E+00 0.0E+00 0.0E+00 0.0E+00 3.1E06 2.4E05 0.0E+00 345 0.0E+00 0.0E+00 0.0E+00 3.3E06 0.0E+00 0.0E+00 0.0E+00 346 6.8E07 5.1E07 0.0E+00 0.0E+00 7.7E07 0.0E+00 4.7E07 347 1.9E05 2.5E05 7.9E06 3.0E07 3.4E05 5.7E05 1.4E06 348 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 349 1.2E03 3.1E05 2.4E04 1.4E05 0.0E+00 1.1E06 1.4E06 350 0.0E+00 0.0E+00 0.0E+00 2.4E06 0.0E+00 0.0E+00 0.0E+00 351 4.2E03 6.7E06 1.7E04 1.7E05 1.8E05 5.4E07 3.3E06 352 0.0E+00 1.1E05 3.4E06 2.7E06 3.1E05 0.0E+00 0.0E+00 353 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 354 1.0E03 9.2E06 4.1E05 4.8E06 2.3E06 1.1E06 4.7E06 355 1.4E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 356 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 357 6.8E07 5.1E07 6.8E06 3.0E07 0.0E+00 5.4E07 4.7E07 358 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 359 1.4E06 0.0E+00 0.0E+00 3.0E07 0.0E+00 5.4E07 4.7E07 360 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 361 1.6E03 4.9E05 4.1E04 3.1E04 2.2E04 2.2E04 1.9E04 362 1.5E05 2.6E06 5.7E06 1.8E06 6.9E06 1.6E05 1.4E06 363 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 364 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 365 1.8E05 3.6E05 0.0E+00 0.0E+00 6.9E06 0.0E+00 2.6E05 366 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 367 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 368 2.0E06 5.1E06 1.2E05 0.0E+00 1.7E05 2.2E05 1.4E05 369 0.0E+00 5.1E07 0.0E+00 0.0E+00 0.0E+00 7.5E05 0.0E+00 370 0.0E+00 1.0E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 371 1.2E05 2.5E04 0.0E+00 0.0E+00 1.5E06 0.0E+00 0.0E+00 372 1.1E04 9.5E05 0.0E+00 6.2E05 2.0E04 3.5E05 4.6E05 373 1.2E03 7.9E04 6.9E05 7.4E04 1.9E03 4.3E04 2.7E04 374 0.0E+00 0.0E+00 1.8E04 3.1E05 1.5E04 1.1E05 0.0E+00 375 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 376 0.0E+00 1.0E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 0.0E+00 377 0.0E+00 2.6E06 4.5E06 0.0E+00 0.0E+00 0.0E+00 0.0E+00 378 1.0E04 4.6E05 3.9E05 9.4E06 6.9E05 4.2E04 1.7E05 Taxon ID RM Atm/ Colon 1 2.3E03 3.1E03 2.6E03 1.7E03 2 3.8E07 0.0E+00 0.0E+00 0.0E+00 3 0.0E+00 0.0E+00 0.0E+00 0.0E+00 4 1.1E04 2.0E05 5.1E05 3.4E05 5 3.0E05 0.0E+00 0.0E+00 0.0E+00 6 0.0E+00 8.8E06 0.0E+00 0.0E+00 7 1.1E05 2.3E06 2.9E06 2.6E06 8 7.5E07 0.0E+00 5.7E07 8.5E07 9 3.8E07 0.0E+00 0.0E+00 0.0E+00 10 4.1E06 1.4E06 5.7E07 0.0E+00 11 0.0E+00 0.0E+00 0.0E+00 0.0E+00 12 0.0E+00 0.0E+00 0.0E+00 0.0E+00 13 0.0E+00 0.0E+00 0.0E+00 0.0E+00 14 7.9E06 0.0E+00 0.0E+00 0.0E+00 15 0.0E+00 0.0E+00 0.0E+00 0.0E+00 16 0.0E+00 0.0E+00 0.0E+00 0.0E+00 17 5.3E06 5.6E06 5.7E07 2.6E06 18 3.8E07 0.0E+00 0.0E+00 4.3E07 19 0.0E+00 0.0E+00 0.0E+00 0.0E+00 20 0.0E+00 0.0E+00 0.0E+00 0.0E+00 21 0.0E+00 9.3E06 0.0E+00 0.0E+00 22 0.0E+00 0.0E+00 0.0E+00 0.0E+00 23 0.0E+00 1.9E06 0.0E+00 0.0E+00 24 5.6E06 6.0E06 1.1E06 5.1E06 25 0.0E+00 0.0E+00 0.0E+00 0.0E+00 26 4.9E06 0.0E+00 0.0E+00 0.0E+00 27 0.0E+00 0.0E+00 0.0E+00 0.0E+00 28 0.0E+00 0.0E+00 0.0E+00 0.0E+00 29 0.0E+00 0.0E+00 0.0E+00 0.0E+00 30 1.9E06 0.0E+00 5.7E07 0.0E+00 31 0.0E+00 0.0E+00 0.0E+00 0.0E+00 32 1.5E04 1.8E04 7.9E05 2.8E05 33 1.1E05 2.0E05 1.2E05 3.0E06 34 0.0E+00 0.0E+00 0.0E+00 0.0E+00 35 0.0E+00 0.0E+00 0.0E+00 0.0E+00 36 0.0E+00 1.4E06 0.0E+00 0.0E+00 37 0.0E+00 0.0E+00 0.0E+00 0.0E+00 38 0.0E+00 0.0E+00 0.0E+00 0.0E+00 39 0.0E+00 3.3E06 0.0E+00 0.0E+00 40 0.0E+00 0.0E+00 0.0E+00 0.0E+00 41 0.0E+00 0.0E+00 0.0E+00 0.0E+00 42 0.0E+00 0.0E+00 0.0E+00 0.0E+00 43 0.0E+00 9.3E07 0.0E+00 0.0E+00 44 3.8E07 0.0E+00 0.0E+00 0.0E+00 45 4.5E06 5.1E06 0.0E+00 1.7E06 46 0.0E+00 0.0E+00 0.0E+00 0.0E+00 47 0.0E+00 0.0E+00 0.0E+00 0.0E+00 48 0.0E+00 0.0E+00 0.0E+00 0.0E+00 49 0.0E+00 0.0E+00 0.0E+00 0.0E+00 50 2.5E04 1.6E04 1.1E04 5.2E05 51 6.7E05 1.1E04 5.4E05 5.9E05 52 1.1E06 0.0E+00 5.1E06 0.0E+00 53 2.3E05 0.0E+00 1.7E06 1.3E05 54 3.8E07 4.7E07 4.0E06 1.3E06 55 0.0E+00 0.0E+00 0.0E+00 0.0E+00 56 0.0E+00 0.0E+00 0.0E+00 0.0E+00 57 4.9E06 1.9E06 1.1E06 2.1E06 58 8.9E03 1.4E03 4.7E03 1.8E03 59 7.5E07 5.0E03 5.9E03 4.3E07 60 3.3E05 5.0E03 3.4E03 3.5E05 61 0.0E+00 0.0E+00 0.0E+00 0.0E+00 62 2.7E03 2.2E04 1.1E03 4.8E04 63 1.2E04 1.0E04 1.2E04 1.3E04 64 6.9E05 2.8E05 5.5E05 9.4E06 65 9.4E06 5.1E06 2.9E06 2.6E06 66 1.9E06 1.7E04 1.5E03 4.3E07 67 1.1E06 1.9E06 2.9E06 2.1E06 68 0.0E+00 0.0E+00 0.0E+00 0.0E+00 69 6.5E03 4.6E03 8.6E03 7.5E03 70 1.2E05 1.0E05 7.4E06 1.1E05 71 8.5E05 8.1E05 7.4E05 1.0E04 72 3.8E07 1.9E06 5.7E07 4.3E07 73 1.5E06 4.7E07 5.7E07 8.5E07 74 5.3E06 3.7E06 4.6E06 7.4E05 75 0.0E+00 0.0E+00 0.0E+00 0.0E+00 76 6.5E04 5.0E05 2.0E04 2.2E04 77 1.0E04 1.4E04 1.0E04 7.1E05 78 3.8E07 1.4E06 5.7E07 0.0E+00 79 7.5E06 6.0E06 8.6E06 4.7E06 80 2.1E05 6.0E06 0.0E+00 5.5E06 81 0.0E+00 0.0E+00 0.0E+00 0.0E+00 82 4.6E02 4.1E02 8.4E02 3.6E02 83 3.4E02 2.3E02 6.6E03 2.1E02 84 2.6E06 1.4E05 5.7E07 1.7E06 85 3.6E02 4.6E02 7.5E03 3.0E02 86 4.6E01 3.8E01 5.9E01 5.6E01 87 1.3E05 7.4E06 1.3E05 1.4E05 88 0.0E+00 4.7E07 0.0E+00 4.3E07 89 0.0E+00 1.8E05 0.0E+00 0.0E+00 90 0.0E+00 0.0E+00 0.0E+00 0.0E+00 91 7.5E07 0.0E+00 0.0E+00 1.3E06 92 0.0E+00 0.0E+00 0.0E+00 0.0E+00 93 0.0E+00 0.0E+00 0.0E+00 0.0E+00 94 4.7E04 3.5E04 3.8E03 4.9E04 95 0.0E+00 0.0E+00 0.0E+00 0.0E+00 96 1.3E03 1.3E04 4.1E04 5.4E04 97 7.5E07 9.3E07 0.0E+00 1.3E06 98 0.0E+00 0.0E+00 0.0E+00 0.0E+00 99 0.0E+00 0.0E+00 0.0E+00 0.0E+00 100 8.6E06 1.6E05 3.4E06 1.4E05 101 1.0E04 4.7E05 5.9E05 3.8E05 102 2.3E06 0.0E+00 7.5E05 6.6E05 103 0.0E+00 0.0E+00 0.0E+00 0.0E+00 104 0.0E+00 0.0E+00 0.0E+00 0.0E+00 105 1.9E06 2.8E06 4.0E06 4.3E07 106 3.8E07 9.3E07 1.1E06 4.3E07 107 1.2E05 1.0E05 1.9E05 8.5E06 108 0.0E+00 0.0E+00 0.0E+00 0.0E+00 109 0.0E+00 0.0E+00 0.0E+00 0.0E+00 110 0.0E+00 0.0E+00 0.0E+00 0.0E+00 111 0.0E+00 0.0E+00 0.0E+00 0.0E+00 112 0.0E+00 0.0E+00 0.0E+00 0.0E+00 113 0.0E+00 0.0E+00 0.0E+00 0.0E+00 114 7.5E07 4.7E06 0.0E+00 4.3E07 115 2.1E03 1.8E03 1.0E03 1.6E03 116 0.0E+00 0.0E+00 0.0E+00 0.0E+00 117 0.0E+00 0.0E+00 0.0E+00 0.0E+00 118 0.0E+00 0.0E+00 0.0E+00 0.0E+00 119 0.0E+00 0.0E+00 0.0E+00 0.0E+00 120 1.5E06 3.3E06 1.1E06 8.5E07 121 3.0E06 9.3E07 9.1E06 0.0E+00 122 0.0E+00 2.3E06 0.0E+00 8.5E07 123 0.0E+00 0.0E+00 0.0E+00 0.0E+00 124 3.8E07 0.0E+00 0.0E+00 0.0E+00 125 4.3E05 2.8E04 1.8E04 1.4E04 126 0.0E+00 0.0E+00 0.0E+00 0.0E+00 127 0.0E+00 0.0E+00 0.0E+00 0.0E+00 128 1.6E03 2.5E03 1.6E03 1.6E03 129 3.4E06 7.0E06 5.7E07 4.3E07 130 0.0E+00 0.0E+00 4.6E06 0.0E+00 131 0.0E+00 9.3E07 5.7E07 8.5E07 132 0.0E+00 0.0E+00 0.0E+00 0.0E+00 133 0.0E+00 0.0E+00 0.0E+00 0.0E+00 134 7.1E04 5.6E04 1.1E06 4.3E07 135 1.1E05 0.0E+00 0.0E+00 0.0E+00 136 1.5E04 2.6E04 3.3E05 3.2E04 137 0.0E+00 0.0E+00 0.0E+00 0.0E+00 138 0.0E+00 0.0E+00 0.0E+00 0.0E+00 139 6.5E05 1.9E04 1.0E04 3.8E04 140 2.3E03 1.5E03 4.2E03 3.2E03 141 0.0E+00 0.0E+00 0.0E+00 1.1E05 142 0.0E+00 0.0E+00 0.0E+00 0.0E+00 143 5.3E06 0.0E+00 0.0E+00 0.0E+00 144 9.0E06 0.0E+00 0.0E+00 0.0E+00 145 0.0E+00 0.0E+00 0.0E+00 0.0E+00 146 0.0E+00 0.0E+00 0.0E+00 0.0E+00 147 0.0E+00 0.0E+00 0.0E+00 0.0E+00 148 1.4E04 7.4E04 1.2E03 8.2E04 149 0.0E+00 0.0E+00 0.0E+00 0.0E+00 150 7.3E05 5.1E05 3.2E05 6.7E05 151 0.0E+00 0.0E+00 0.0E+00 0.0E+00 152 0.0E+00 0.0E+00 0.0E+00 0.0E+00 153 0.0E+00 0.0E+00 0.0E+00 0.0E+00 154 3.8E07 1.4E06 1.3E05 8.5E06 155 7.5E06 1.4E06 0.0E+00 0.0E+00 156 1.9E05 7.0E06 7.4E06 7.2E06 157 0.0E+00 0.0E+00 0.0E+00 0.0E+00 158 1.4E05 0.0E+00 0.0E+00 0.0E+00 159 9.7E05 4.7E05 4.0E05 1.1E05 160 8.3E06 0.0E+00 5.7E07 0.0E+00 161 1.8E05 0.0E+00 1.2E05 0.0E+00 162 0.0E+00 0.0E+00 0.0E+00 0.0E+00 163 3.8E07 0.0E+00 5.7E07 4.3E07 164 3.1E04 1.0E03 1.7E04 1.1E03 165 0.0E+00 0.0E+00 0.0E+00 0.0E+00 166 0.0E+00 0.0E+00 4.0E06 0.0E+00 167 7.4E03 5.7E03 2.7E02 2.6E03 168 0.0E+00 0.0E+00 1.8E05 0.0E+00 169 1.1E06 0.0E+00 0.0E+00 4.3E07 170 0.0E+00 0.0E+00 0.0E+00 0.0E+00 171 0.0E+00 0.0E+00 0.0E+00 0.0E+00 172 1.5E01 6.6E02 1.2E02 4.0E02 173 0.0E+00 2.3E06 0.0E+00 2.6E06 174 3.6E05 7.0E06 3.8E03 1.1E05 175 0.0E+00 0.0E+00 0.0E+00 0.0E+00 176 0.0E+00 0.0E+00 0.0E+00 0.0E+00 177 0.0E+00 0.0E+00 0.0E+00 0.0E+00 178 9.0E06 3.7E05 3.1E05 2.1E06 179 0.0E+00 0.0E+00 0.0E+00 0.0E+00 180 0.0E+00 0.0E+00 0.0E+00 0.0E+00 181 0.0E+00 0.0E+00 5.7E07 0.0E+00 182 0.0E+00 0.0E+00 1.2E05 0.0E+00 183 0.0E+00 0.0E+00 0.0E+00 0.0E+00 184 1.2E05 0.0E+00 7.4E06 1.7E06 185 7.5E07 7.5E04 7.7E04 7.9E04 186 3.8E06 4.1E05 0.0E+00 1.2E05 187 0.0E+00 0.0E+00 0.0E+00 0.0E+00 188 0.0E+00 0.0E+00 5.7E07 0.0E+00 189 0.0E+00 1.8E05 9.1E06 0.0E+00 190 9.1E05 3.0E05 3.7E05 1.1E05 191 2.2E04 1.2E03 7.5E04 2.8E04 192 6.8E06 4.7E06 2.3E05 6.8E06 193 0.0E+00 0.0E+00 0.0E+00 0.0E+00 194 0.0E+00 4.2E06 3.6E05 2.6E06 195 8.3E06 1.1E05 0.0E+00 6.4E06 196 0.0E+00 0.0E+00 0.0E+00 0.0E+00 197 0.0E+00 0.0E+00 0.0E+00 0.0E+00 198 3.8E07 0.0E+00 0.0E+00 0.0E+00 199 3.4E03 6.8E04 1.0E04 2.0E05 200 7.5E07 0.0E+00 0.0E+00 0.0E+00 201 6.4E06 2.3E06 0.0E+00 0.0E+00 202 0.0E+00 0.0E+00 0.0E+00 0.0E+00 203 4.7E04 4.7E04 1.9E03 8.1E05 204 9.8E06 6.5E06 1.1E06 4.3E07 205 3.4E06 0.0E+00 0.0E+00 0.0E+00 206 0.0E+00 9.3E07 0.0E+00 0.0E+00 207 3.0E04 5.0E04 6.4E04 3.9E04 208 1.0E02 2.0E02 5.4E02 1.9E02 209 0.0E+00 0.0E+00 0.0E+00 0.0E+00 210 1.9E03 1.9E03 1.4E03 1.4E03 211 5.3E06 1.4E06 9.7E06 0.0E+00 212 0.0E+00 1.1E05 0.0E+00 0.0E+00 213 0.0E+00 0.0E+00 1.7E06 0.0E+00 214 0.0E+00 0.0E+00 0.0E+00 0.0E+00 215 0.0E+00 0.0E+00 0.0E+00 0.0E+00 216 5.5E04 8.9E04 8.1E04 4.3E04 217 0.0E+00 0.0E+00 0.0E+00 0.0E+00 218 4.9E04 7.7E04 7.4E03 1.0E03 219 0.0E+00 0.0E+00 0.0E+00 0.0E+00 220 9.4E05 7.0E04 2.9E04 7.1E05 221 3.8E07 1.4E06 2.3E06 8.5E07 222 0.0E+00 0.0E+00 0.0E+00 0.0E+00 223 2.6E05 1.9E05 0.0E+00 3.5E05 224 0.0E+00 0.0E+00 8.6E06 0.0E+00 225 2.6E03 2.1E03 3.8E03 8.1E04 226 0.0E+00 0.0E+00 0.0E+00 0.0E+00 227 0.0E+00 1.0E05 0.0E+00 0.0E+00 228 0.0E+00 0.0E+00 0.0E+00 0.0E+00 229 0.0E+00 0.0E+00 2.3E06 4.3E07 230 0.0E+00 1.5E05 2.3E05 2.0E05 231 2.1E05 1.6E04 1.5E05 2.3E05 232 1.3E04 9.6E05 4.7E05 4.5E05 233 2.7E05 1.3E05 7.4E06 1.3E06 234 0.0E+00 0.0E+00 0.0E+00 0.0E+00 235 3.0E04 6.6E04 8.3E04 9.7E04 236 3.7E03 2.4E03 1.2E03 1.6E03 237 1.6E04 2.1E04 3.2E05 9.8E05 238 2.6E06 0.0E+00 2.9E06 4.3E07 239 0.0E+00 0.0E+00 0.0E+00 0.0E+00 240 0.0E+00 0.0E+00 0.0E+00 0.0E+00 241 0.0E+00 0.0E+00 0.0E+00 0.0E+00 242 0.0E+00 0.0E+00 0.0E+00 0.0E+00 243 5.1E04 5.9E04 6.0E04 7.6E04 244 1.2E05 2.8E06 5.7E06 0.0E+00 245 0.0E+00 0.0E+00 0.0E+00 0.0E+00 246 0.0E+00 0.0E+00 0.0E+00 0.0E+00 247 0.0E+00 0.0E+00 0.0E+00 0.0E+00 248 0.0E+00 0.0E+00 0.0E+00 0.0E+00 249 0.0E+00 0.0E+00 0.0E+00 0.0E+00 250 0.0E+00 0.0E+00 0.0E+00 0.0E+00 251 1.7E03 3.1E03 4.3E03 3.0E03 252 1.2E01 2.3E02 5.3E02 3.6E02 253 0.0E+00 4.2E06 0.0E+00 2.1E06 254 9.1E04 1.0E04 3.3E04 1.7E04 255 0.0E+00 0.0E+00 0.0E+00 0.0E+00 256 7.5E07 0.0E+00 0.0E+00 4.3E07 257 0.0E+00 0.0E+00 0.0E+00 0.0E+00 258 2.3E06 2.4E04 4.7E05 7.7E05 259 3.4E03 4.4E03 1.1E02 8.2E04 260 1.4E02 5.7E03 7.1E03 4.4E03 261 1.5E02 2.8E01 4.9E05 1.8E01 262 1.2E02 2.3E02 3.7E02 2.9E03 263 9.0E06 0.0E+00 9.1E06 0.0E+00 264 1.6E02 1.3E02 1.1E02 7.5E03 265 2.6E06 0.0E+00 2.5E04 5.1E05 266 6.8E06 0.0E+00 0.0E+00 0.0E+00 267 0.0E+00 0.0E+00 0.0E+00 0.0E+00 268 1.2E04 1.6E04 1.3E04 1.1E04 269 4.5E05 1.4E05 5.7E06 1.1E05 270 0.0E+00 0.0E+00 0.0E+00 0.0E+00 271 2.5E02 2.1E02 3.0E02 2.9E02 272 3.8E06 4.7E06 2.9E06 1.3E06 273 0.0E+00 0.0E+00 0.0E+00 0.0E+00 274 0.0E+00 0.0E+00 0.0E+00 0.0E+00 275 0.0E+00 0.0E+00 0.0E+00 0.0E+00 276 0.0E+00 0.0E+00 0.0E+00 0.0E+00 277 1.6E05 2.1E05 1.6E04 0.0E+00 278 1.1E06 9.3E07 0.0E+00 0.0E+00 279 0.0E+00 1.4E06 0.0E+00 0.0E+00 280 0.0E+00 0.0E+00 0.0E+00 0.0E+00 281 3.8E07 0.0E+00 0.0E+00 0.0E+00 282 0.0E+00 0.0E+00 0.0E+00 0.0E+00 283 0.0E+00 0.0E+00 0.0E+00 0.0E+00 284 0.0E+00 0.0E+00 0.0E+00 4.3E07 285 0.0E+00 0.0E+00 0.0E+00 0.0E+00 286 0.0E+00 0.0E+00 0.0E+00 0.0E+00 287 0.0E+00 0.0E+00 0.0E+00 0.0E+00 288 3.4E06 1.9E06 0.0E+00 0.0E+00 289 0.0E+00 0.0E+00 0.0E+00 0.0E+00 290 7.5E07 1.9E06 0.0E+00 0.0E+00 291 0.0E+00 0.0E+00 0.0E+00 0.0E+00 292 0.0E+00 0.0E+00 0.0E+00 0.0E+00 293 5.3E06 1.2E05 8.0E06 5.1E06 294 0.0E+00 0.0E+00 0.0E+00 0.0E+00 295 1.3E03 8.5E04 6.0E04 2.1E04 296 7.5E07 4.7E07 1.1E06 0.0E+00 297 0.0E+00 0.0E+00 0.0E+00 0.0E+00 298 0.0E+00 0.0E+00 0.0E+00 0.0E+00 299 3.8E07 0.0E+00 5.7E07 4.3E07 300 0.0E+00 0.0E+00 0.0E+00 0.0E+00 301 1.5E06 4.7E06 0.0E+00 2.6E06 302 0.0E+00 0.0E+00 0.0E+00 0.0E+00 303 0.0E+00 0.0E+00 0.0E+00 0.0E+00 304 0.0E+00 0.0E+00 0.0E+00 1.3E06 305 0.0E+00 0.0E+00 0.0E+00 0.0E+00 306 7.5E07 0.0E+00 0.0E+00 0.0E+00 307 0.0E+00 0.0E+00 0.0E+00 0.0E+00 308 1.5E06 7.4E06 2.3E06 2.1E06 309 4.1E06 0.0E+00 5.7E07 0.0E+00 310 0.0E+00 4.7E07 0.0E+00 0.0E+00 311 3.8E07 1.4E06 5.7E07 0.0E+00 312 0.0E+00 0.0E+00 0.0E+00 0.0E+00 313 3.8E07 0.0E+00 7.4E06 0.0E+00 314 1.1E06 4.7E07 5.7E07 4.3E07 315 1.7E05 1.2E05 2.2E05 9.4E06 316 0.0E+00 0.0E+00 0.0E+00 0.0E+00 317 0.0E+00 0.0E+00 0.0E+00 0.0E+00 318 0.0E+00 0.0E+00 0.0E+00 0.0E+00 319 0.0E+00 0.0E+00 0.0E+00 0.0E+00 320 9.8E05 3.1E05 2.1E05 3.6E05 321 0.0E+00 0.0E+00 0.0E+00 0.0E+00 322 3.8E07 0.0E+00 1.7E06 2.6E06 323 0.0E+00 0.0E+00 1.1E06 0.0E+00 324 3.8E07 0.0E+00 5.7E07 0.0E+00 325 1.4E05 8.8E06 6.3E06 8.1E06 326 2.6E06 9.3E07 1.1E06 1.7E06 327 0.0E+00 0.0E+00 5.7E07 0.0E+00 328 0.0E+00 0.0E+00 0.0E+00 0.0E+00 329 0.0E+00 2.1E05 0.0E+00 0.0E+00 330 0.0E+00 0.0E+00 0.0E+00 0.0E+00 331 1.7E05 1.1E05 1.1E06 3.4E06 332 1.6E05 1.2E05 2.3E05 6.8E06 333 0.0E+00 0.0E+00 0.0E+00 0.0E+00 334 8.3E05 6.7E05 5.4E05 1.0E05 335 5.6E06 4.7E07 2.9E06 1.7E06 336 0.0E+00 0.0E+00 0.0E+00 0.0E+00 337 1.0E04 1.1E04 1.4E04 7.7E05 338 2.1E05 1.9E05 1.7E05 8.5E07 339 0.0E+00 0.0E+00 0.0E+00 8.5E07 340 1.5E05 4.2E06 1.1E05 3.4E06 341 0.0E+00 0.0E+00 0.0E+00 0.0E+00 342 0.0E+00 0.0E+00 0.0E+00 0.0E+00 343 0.0E+00 0.0E+00 0.0E+00 0.0E+00 344 0.0E+00 0.0E+00 4.6E06 0.0E+00 345 0.0E+00 0.0E+00 0.0E+00 0.0E+00 346 0.0E+00 0.0E+00 0.0E+00 0.0E+00 347 1.1E06 1.0E05 1.0E05 8.9E06 348 0.0E+00 0.0E+00 0.0E+00 0.0E+00 349 7.5E07 4.7E07 5.7E07 4.3E07 350 0.0E+00 0.0E+00 0.0E+00 0.0E+00 351 0.0E+00 9.3E07 5.7E07 8.5E07 352 5.6E06 0.0E+00 1.1E05 1.3E06 353 0.0E+00 0.0E+00 0.0E+00 0.0E+00 354 1.9E06 9.3E07 4.0E06 2.1E06 355 0.0E+00 0.0E+00 0.0E+00 0.0E+00 356 0.0E+00 0.0E+00 0.0E+00 0.0E+00 357 1.1E06 1.4E06 0.0E+00 8.5E07 358 0.0E+00 0.0E+00 0.0E+00 0.0E+00 359 3.8E07 0.0E+00 0.0E+00 0.0E+00 360 0.0E+00 0.0E+00 0.0E+00 0.0E+00 361 0.0E+00 4.7E07 0.0E+00 0.0E+00 362 0.0E+00 1.4E06 4.0E06 0.0E+00 363 0.0E+00 0.0E+00 0.0E+00 0.0E+00 364 0.0E+00 4.7E07 0.0E+00 4.3E07 365 1.5E04 1.7E04 5.1E05 1.2E04 366 7.5E07 4.7E07 0.0E+00 0.0E+00 367 0.0E+00 0.0E+00 0.0E+00 0.0E+00 368 5.6E06 2.3E06 4.6E06 1.3E05 369 6.8E06 7.9E06 1.1E06 4.3E06 370 0.0E+00 0.0E+00 0.0E+00 0.0E+00 371 6.6E04 2.4E04 8.5E05 0.0E+00 372 0.0E+00 0.0E+00 0.0E+00 0.0E+00 373 1.4E05 1.3E05 1.3E05 1.5E05 374 0.0E+00 0.0E+00 0.0E+00 0.0E+00 375 1.5E06 0.0E+00 5.7E07 0.0E+00 376 7.5E07 0.0E+00 1.1E06 0.0E+00 377 1.1E06 3.7E06 1.1E06 4.3E07 378 4.6E05 2.3E05 1.6E05 1.7E05

    Example E. Lactobacillus Johnsonii Decreases Systemic Inflammation and Genotoxicity in Atm.SUP./ Mice

    [0393] To verify whether individual bacteria were contributing to the differential systemic genotoxicity detected in CM and RM mice, Koch's postulates experiments were performed. The high throughput sequence analysis identified numerous phylotypes exhibiting higher populations in RM than CM micea feature that makes them potentially beneficial organisms. It was attempted to culture two of the most abundant of these (FIGS. 4B and 4C), and successfully isolated and grew L. johnsonii from RM mice in pure culture.

    [0394] CM Atm.sup./ mice were orally gavaged with 109 CFU of L. johnsonii every other day for 4 weeks. Fecal qPCR targeting L. johnsonii demonstrated the deficiency of this taxon in CM Atm.sup./ mice, and that this periodic administration resulted in successful establishment and maintenance of high enteric levels L. johnsonii (FIG. 6E). After this 4-week period, L. johnsonii but not the vehicle control (PBS) resulted in reduced genotoxicity levels (FIG. 6A). This was time dependent, as no difference was observed after only 1 or 2 weeks of treatment (data not shown).

    [0395] Since systemic genotoxicity is induced by innate inflammatory mediators (Westbrook et al., 2009, Cancer Res 69:4827-4834, Westbrook et al., 2012, Mutagenesis 27:77-86), the effect of L. johnsonii administration on basal systemic inflammatory parameters in these mice was analyzed. In the liver, L. johnsonii significantly reduced the abundance of both hepatic NK and T cells (FIG. 6B, 6C). A comparable reduction of these leucocyte subsets was also observed in the splenic and blood compartments (FIGS. 7A, B; see also FIG. 13). With respect to molecular mediators, L. johnsonii treatment significantly reduced levels of the pro-inflammatory cytokines IL-1 and IFN-, and elevated the levels of the anti-inflammatory cytokines TGF- and IL-10 (FIG. 6D). Similar changes were also observed in the blood compartment (FIG. 7C; see also FIG. 13).

    [0396] These findings indicate that short-term administration of the single RM-associated bacterium, L. johnsonii, recapitulated the reduction of systemic genotoxicity observed in RM mice, a host effect associated with reduced systemic inflammatory activity.

    Example F. Specifically Altering the Intestinal Microbiota, Creatine a Restricted Microbiota Colony and a Conventional Colony Causes a Change in Lifespan in Atm.SUP./ .Mice

    [0397] To confirm that the effects we found were due to a change in the intestinal microbiota, more rigorous methods to alter the microbiota were used. Mice from the sterile (SPF-S) facility were used to form two colonies: one with a restricted microbiota (RM, Table 4) and one with a conventional microbiota (CM, Table 4). To form the RM colony, mice were re-derived into an RM colony described previously (Fujiwara et al., 2008, J Immunol 180:5843-5852). Since most of the gut colonization occurs within the first few days after birth (Savage, 1977, Annu Rev Microbiol 31:107-133), re-derivation ensures that the pups incorporate the microbiome of the foster mother (bacterial rRNA gene spectrum shown in FIG. 11A, lanes 1-3). To form the CM colony, mice were treated with a cocktail of antibiotics for 4 weeks to clear the gut of native microbiota, as described previously (Rakoff-Nahoum et al., 2004; Cell 118:229-241). Then the mice were re-inoculated with fecal samples from conventional mice to create conventionalized mice (FIG. 11A, lanes 4-6). The procedure changed their fecal rRNA gene spectrum by both RISA and sequencing analyses; implying that their microbiome was altered (data not shown; e.g., see FIG. 1D).

    [0398] It was found that the lifespan of conventionalized Atm.sup./ mice was significantly shorter than the lifespan of sterile-treated mice (SPF-S) (previously reported from our lab (Reliene and Schiestl, 2006a, DNA Repair (Amst) 5:852-859, p<0.05) and the RM mice (p<0.05, FIG. 11B). The median survival of conventional mice was 32 weeks versus 51 weeks in the sterile facility (SPF-S) and 80 weeks for the RF mice (FIG. 11B). The median lifespan of mice in the SPF-N colony was 44 weeks, in between the sterile (SPF-S) and CM colonies. Therefore, as microbiota restriction and sterility decrease, lifespan also decreases indicating a positive correlation with life expectancy. Thus, the intestinal microbiota may be responsible for the significant inter- and intra-laboratory differences discussed by Reliene and Schiestl (Reliene and Schiestl, 2006b, DNA Repair (Amst) 5:651-653) for Atm and possibly other cancer predisposed mice. By simply exposing isogenic mice from a sterile SPF-S facility to conventional mice, or by more rigorously altering intestinal microbiota, it was possible to affect median lifespan.

    Example G. DNA Damage is Increased in Older CM Mice Compared to RM Mice

    [0399] To determine if DNA damage was affected by altering the intestinal microbiota, DNA strand breaks and clastogenic damage in the peripheral blood of CM and RM Atm.sup./ mice was measured. It was found that DNA damage was increased in older (6 months) CM Atm.sup./ mice compared to RM mice. These differences were not seen in younger, 8 week old mice or in SPF-N Atm.sup./ mice compared to SPF-S Atm.sup./ mice (data not shown). Specifically, it was found that micronuclei and DNA strand breaks were increased in CM Atm.sup./ mice compared to RM Atm.sup./ mice (FIG. 12). Micronuclei in peripheral blood erythrocytes were almost 85% higher in CM mice compared to RM mice (FIG. 12A, p<0.05). DNA strand breaks were measured by the alkaline comet assay. Olive Tail Moments which are a ratio of % tail DNA: % comet head DNA were also higher in CM mice compared to RM mice (FIG. 12B, p<0.05). As an additional measure, % tail DNA at the 80th percentile, indicating the more damaged cells, was also assessed and were increased in CM mice compared to RM mice as well (data not shown). Therefore, DNA damage may accumulate and/or be induced to a greater extent in mice with conventional microbiota compared to those with a restricted microbiota which likely contributes to their decreased lifespan.

    Example H. Inoculating Mice with L. johnsonii Decreases Micronucleus Formation

    [0400] To determine whether inoculation with the protective bacteria, L. johnsonii, can affect carcinogenesis, levels of DNA damage were measured. It was found that at the end of a 4-week treatment with L. johnsonii, micronucleus formation was decreased by more than 40% compared to PBS-treated Atm/ mice (FIG. 14, p<0.05).

    Example I. Lactobacillus johnsonii 456 can be Transferred and Induces Beneficial Effects in Mice

    [0401] Experiments utilizing gradient analysis strategy identified one strong candidate bacterium (Lactobacillus johnsonii) that was protective (Presley et al., 2010, Appl Environ Microbiol 76(3):936-41). It has also been shown to have a positive effect on oxidative stress and inflammation in the intestines and prolongs development of diabetes in rats (Valladares et al., 2010, PLoS One 5(5):e10507). As described herein, an antibiotic treatment for 7 days followed by daily inoculations of L. johnsonii 456 (10.sup.7-10.sup.9 CFUs) for 14 days showed a trend towards increased levels of the bacteria in the intestines of the mice tested (p=0.099). It was also found that mice treated with 10.sup.7 CFUs of L. johnsonii had a trend towards lower levels of chromosomal breaks as measured by the micronucleus assay (p=0.083 not shown).

    Example J. Bacteria which are More Prevalent in RM Mice can be Differentiated from Bacteria which are More Prevalent in CM Mice and Provide Candidates to Target with Pre-, Pro-, and Antibiotics

    [0402] Illumina and ITS rRNA gene analyses have identified candidate bacteria which may have positive effects on longevity and cancer latency (Table 7, left column (A)) as well as candidate bacteria which may have negative effects (Table 7, right column (B)). These lists provide a starting point to narrow down the types and/or species of bacteria which are detrimental or beneficial to the health of people.

    TABLE-US-00007 TABLE 7 Candidate bacteria having a positive (A) or negative effect (B) on carcinogenesis and longevity. A. Bacteria more abundant in B. Bacteria more abundant in RM than CM mice (p < 0.0001) CM than RM mice (p < 0.0001) (Potentially beneficial bacteria) (Potentially detrimental bacteria) 1. Lactobacillus johnsonii 1. Dysgonomonas gadei 2. Clostridium polysaccharolyticum 2. Prevotellaceae bacterium P4P_62 3. Clostridium populeti 3. Belliella sp. MIM10 4. Eubacterium hadrum 4. Parabacteroides merdae 5. Clostridium oroticum 5. Clostridium sp. AN-AS17 6. Barnesiella intestinihominis 6. Capnocytophaga ochracea 7. Clostridium fimetarium 7. Pedobacter koreensis 8. Acetanaerobacterium elongatum 8. Eubacterium sp. BU014 9. Porphyromonadaceae 9. Riemerella anatipestifer bacterium C941 10. Helicobacter typhlonicus 10. Butyrivibrio crossotus 11. Petrimonas sulfuriphila 11. Butyricimonas synergistica 12. Caminicella sporogenes 12. Clostridium chauvoei 13. Nubsella zeaxanthinifaciens 13. Lachnospiraceae bacterium 14. Porphyromonas sp. DJF_VP30 MI10-1288x 14. Porphyromonas sp. C1075 15. Sphingobacterium sp. NBRC 15338 15. Prevotella sp. oral clone CY006 16. Proteiniphilum acetatigenes 16. Rumen bacterium NK4A66 17. Parabacteroides goldsteinii 17. Filifactor alocis 18. Bacteroidetes bacterium P073B 18. Cyanobacterium sp. MS-B-20 19. Porphyromonas catoniae 19. Clostridium tyrobutyricum 20. Bacteroides nordii. 20. Alistipes onderdonkii 21. Barnesiella viscericola

    Example K. Conventional Wildtype Mice (CM) have More Chromosomal Aberrations than Mice in Sterile Conditions (SPF-S)

    [0403] Chromosome and chromatid-type aberrations were determined in bone marrow metaphase cells from CM mice and mice housed in sterile (SFP-S) conditions as described previously Kadhim et al., 1992, Nature 355(6362):738-40; Watson et al., 2001, Int J Radiat Biol 77(4):409-17). CM mice and mice in sterile (SPF-S) conditions also have differences in microbial composition as determined by RISA (data not shown). CM mice spontaneously displayed 35% more aberrations than RM mice (p<0.05, FIG. 16). This finding provides evidence that CM mice may have a spontaneously increased risk of carcinogenesis.

    Example L. DNA Strand Breaks and Oxidative DNA Damage are Increased in CM Mice 24 Hours after Radiation Treatment but not in SPF-S Mice

    [0404] It was also found that oxidative DNA damage is increased in peripheral blood lymphocytes of CM mice compared to those housed in sterile (SPF-S) conditions 24 hours after exposure to 1 Gy rays (p<0.05, FIG. 17) as measured by the modified comet assay with hOGG1 (p<0.05), which detects both DNA strand breaks and oxidative DNA damage that can be excised by the enzyme hOGG1. No significant differences were found in sterile (SPF-S) mice using the modified comet assay or in either set of mice using the standard alkaline comet assay. This data indicates that there are differences in the CM mice, which exacerbates DNA damage caused by radiation after 24 hours.

    [0405] These findings suggest that intestinal microbiota may play a significant role in damage response to ionizing radiation and can both mitigate and enhance the damage depending on the microbial titer and composition.

    Example M. Survival of p53/ Mice Developing Lymphoma

    [0406] The first p53 knock-out mice, which were derived from UCLA with a medium life expectancy, were called the parental colony (PC). The conventional colony (CC) was established by treating a few mice of the parental colony for four weeks with an antibiotic cocktail (ampicillin: 1 g/L; vancomycin: 500 mg/L; neomycin sulphate: 1 g/L and metronidazole: 1 g/L) and subsequently inoculated them with an aqueous fecal suspension from a colony kept conventionally at the in-house animal facility. The PC and CC were housed in the same mouse room, but maintained differently (Table 1). The parental colony received sterile water and autoclaved food, the conventionalized mice tap water and normal food to sustain different microbial community. To generate the restricted colony (RC) the PC additionally was treated with antibiotics for three weeks and inoculated orally with the intestinal microbiota of a long-lived, late tumor developing, limited flora from UCLA. These mice were maintained in individually ventilated cages (IVCs) and received sterile water and food. Cages, food and water were changed once a week from animal caretakers. Pups were weaned at the age between 18 to 20 days. In this period they were earmarked with the use of an ear punch. Ear punches or tail tip biopsies were used for DNA isolation and genotyping. There was a highly significant difference in survival between the tumor free survival of the parental colony (PC) and the conventional colony (CC) which is the same as the RM and CM explained above (see FIG. 15).

    Example N. Intestinal Bacteria Modify Lymphoma Penetrance Via Inflammation-Mediated Genotoxicity

    [0407] The results described herein are believed to be the first to show a relationship between intestinal microbiota and lymphoma penetrance. In addition, the investigations described herein generated a detailed catalog of bacterial phylotypes that are differentially abundant between CM and RM mice, thereby providing candidates that may influence a wide range of traits from systemic genotoxicity (as described herein), oxidative stress (as described herein), colitis resistance (Aranda et al., 1997, J Immunol 158:3464-3473), pathogen clearance (Chang and Miller, 2006, Infect Immun 74:5261-5271) and selective reduction of marginal zone (MZ) B cells (Wei et al., 2008, Eur J Immunol 38:3411-3425), plasmacytoid dendritic cells (pDC) (Fujiwara et al., 2008, J Immunol 180:5843-5852), and invariant natural killer (iNK) T cells (Wei et al., 2010, J Immunol 184:1218-1226). Moreover, Applicants isolated L. johnsonii from RM mice and subsequently demonstrated its ability to decrease systemic inflammation and genotoxicity in Atm.sup./ mice via Koch's postulates experiments. Herein, and without being bound by theory, Applicants propose several mechanistic hypotheses of how L. johnsonii might influence these important host traits.

    [0408] First, L. johnsonii may reduce systemic genotoxicity by inhibition of basal intestinal inflammatory activity and its systemic sequelae. Applicants recent work revealed that intestinal inflammation-associated genotoxicity occurred not only locally, but also systemically. Using either a model chemical inflammatory agent, dextran sodium sulfate (DSS), or immune-mediated genetic models to induce local intestinal inflammation, Applicants found that systemic genotoxicity was elevated in peripheral lymphocytes, an effect amplified in Atm.sup./ vs. wildtype mice (Westbrook et al., 2009, Cancer Res 69:4827-4834). Moreover, such lymphocyte genotoxicity is particularly abundant in the B lymphocyte subset, the progenitor cell type for B lymphoma (the predominant cancer in A-T patients) (Westbrook et al., 2011, Int J Cancer 129:1815-1825). Genetic and interventional studies revealed that one factor is systemic dispersal of the intestinal cytokine TNF, that permits genotoxicity in TNF receptor-bearing lymphocytes remote from the intestinal compartment, in a process dependent on cell-autonomous, NFkB and AP-1 induction of reactive oxygen and nitrogen species (RONS) (Westbrook et al., 2012, Mutagenesis 27:77-86).

    [0409] The present study documents the reduction of several systemic measures of inflammatory activity after L. johnsonii restoration in Atm.sup./ CM mice. There are several known anti-inflammatory mechanisms of Lactobacillus sp. that may account for this host response, including products that directly modulate the NFkB inflammatory program of mucosal epithelial and hematopoietic cell types, or indirectly by ecologically changing the composition or functional activity of enteric microbial community (Resta-Lenert and Barrett, 2006, Gastroenterology 130:731-746; van Baarlen et al., 2011, Proc Natl Acad Sci USA 108 Suppl 1:4562-4569; McNulty et al., 2011, Sci Transl Med 3:106ra106; Jounai et al., 2012, PLoS One 7:e32588).

    [0410] The results presented herein also documented that enteric L. johnsonii resulted in a reduction in the abundance of hepatic and migratory (blood, splenic) NK and T cells, a reduction also concordant with their reduced levels in CM (Wei et al., 2008, Eur J Immunol 38:3411-3425; Fujiwara et al., 2008, J immunol 180:5843-5852). The control of NK and T cells in these compartments is complex, integrating a diversity of chemoattractant and trophic cytokines (Brady et al., 2010, J Immunol 185:6679-6688; Malamut et al., 2010, J Clin Invest 120:2131-2143; Satoh-Takayama et al., 2010, J Exp Med 207:273-280; Pachynski et al., 2012, J Exp Med 209:1427-1435). Lactobacillus sp. may both augment or reduce the production of these key cytokines by parenchymal epithelial and hematopoietic cells, due to differences in host compartment and Lactobacillus taxon (Vanderpool et al., 2008, Bowel Dis 14:1585-1596; Jounai et al., 2012, PLoS One 7:e32588). The present study suggests that enteric (dietary) administration of L. johnsonii may represent a viable strategy to reduce inflammation-induced genotoxicity.

    [0411] The ability of L. johnsonii to reduce pathogen-associated inflammation has been demonstrated in several prior in vivo investigations, including two involving H. pylori, a known cancer-promoting bacterium. In experiments examining H. pylori infection in C57BL/6 mice, oral administration of L. johnsonii over a 3-month-period reduced the amounts of lymphocytic and neutrophilic infiltration of the lamina propria as well as proinflammatory chemokines (Sgouras et al., 2005, Clin Diagn Lab Immunol 12:1378-1386). Similarly, L. johnsonii reduced both H. pylori populations and gastritis in Mongolian gerbils (Isobe et al., 2012, Biosci Biotechnol Biochem 76:850-852). A single inoculation of 1-day-old chickens with L. johnsonii inhibited the colonization and persistence of Clostridium perfringens, a poultry pathogen that causes necrotic enteritis (La Ragione et al., 2004, Lett Appl Microbiol 38:197-205). Finally, prior inoculation of gerbils with L. johnsonii prevented a persistent infection by the protozoan parasite, Giardia intestinalis (Humen et al., 2005, Infect Immun 73:1265-1269)

    [0412] Second, analysis of the literature suggests that L. johnsonii reduces immune-mediated oxidative stress and systemic genotoxicity by decreasing NF-k.sub.B activation. Linked to cancer and various inflammatory disorders, NF-k.sub.B is involved in managing responses to a wide range of potentially deleterious stimuli. Consistent with an agent that down-regulates NF-k.sub.B activation, L. johnsonii and other CM-RM associated microbiota may affect lymphoma penetrance by altering systemic genotoxicity caused by immune-mediated oxidative stress. The results described herein and others demonstrated that oral administration of L. johnsonii reduced both oxidative stress (Valladares et al., 2010, PLoS One 5:e10507; Joo et al., 2011, Int Immunopharmacol 11:1758-1765) and systemic genotoxicity (as described herein). Mechanistically, there are precedents that microbial environments modulate cancer formation in part through oxidative stress mediated by inflammatory or carcinogenic bacterial metabolites on local epithelial cells (Parsonnet, 1995, Environ Health Perspect 103 Suppl 8:263-268; Zha et al., 2008, Proc Natl Acad Sci USA 105:9302-9306). For example, inflammation that accompanies H. pylori infection, S. haematobium infection, or human inflammatory bowel disease is associated with elevated risk of stomach, bladder, or colon cancer, respectively (Parsonnet, 1995, Environ Health Perspect 103 Suppl 8:263-268; Mostafa et al., 1999, Clin Microbiol Rev 12:97-111; Pohl et al., 2000, Hepatogastroenterology 47:57-70). In an experimental system examining vaginal infection of mice with the bacterium Gardnerella vaginalis, oral administration of L. johnsonii reduced levels of proinflammatory cytokines, oxidative stress (iNOS), and activation of NF-kB (Joo et al., 2011, Immunopharmacol 11:1758-1765). An important factor linking inflammation to neoplasia is genotoxicity from inflammation-associated oxidative products, created either in trans (due to local oxidative products of inflammatory cells), and cell-autonomously (due to endogenous intra-cellular oxidative products induced by receptors to TNF and other cytokines) (Kaser et al., 2008, Cell 134:743-756; Todd et al., 2008, Nat Rev Immunol 8:663-674). In disease models, enteric colonization of H. hepaticus elicits innate immune activation, which via TNF- and iNOS induction yields host oxidative products required for neoplasia (Rao et al., 2006, Cancer Res 66:7395-7400; Erdman et al., 2009, Proc Natl Acad Sci USA 106:1027-1032).

    [0413] Genomic analysis of L. johnsonii revealed several features that may contribute to a superior colonizing ability in the mucosa, and to its ability to outcompete pathogens and other proinflammatory organisms (Pridmore et al., 2004, Proc Natl Acad Sci USA 101:2512-2517). Attachment to the host is often a key feature of mucosa-associated microbes. Putative cell-surface proteins in L. johnsonii have similarity to the mucin binding protein (MUB) from Lactobacillus reuteri (Roos and Jonsson, 2002, Microbiology 148:433-442). In addition, similarities to Fap1 and GspB from Streptococcus species suggest L. johnsonii encodes adhesive and fimbrial proteins, respectively (Bensing and Sullam, 2002, Mol Microbiol 44:1081-1094; Stephenson et al., 2002, Mol Microbiol 43:147-157). Lactobacillus johnsonii also produces a putative cell-surface protein with similarity to an IgA protease, which could enable it to avoid a key host defense mechanism. In addition, L. johnsonii may inhibit potential microbial competitors by producing the bacteriocin Lactacin F and by increasing Paneth cell numbers, which are a host cell type that produces antimicrobial compounds (Allison et al., 1994, J Bacteriol 176:2235-2241; Kingma et al., 2011, J Nutr 141:1023-1028).

    [0414] Given that intestinal microbiota is a potentially modifiable trait, experiments described herein and insights gained therefrom hold considerable promise for translational intervention of B cell lymphoma and other diseases driven by immune-mediated oxidative stress and its resulting systemic genotoxicity. The translational promise of this approach, exemplified by the studies described herein, suggest that simple interventions such as sustaining enteric levels of L. johnsonii, may favorably shift microbial composition and function to reduce basal levels of genotoxicity in a manner that may reduce cancer risk in susceptible individuals, such as those bearing the A-T genotype.

    [0415] Applicants describe herein that intestinal microbiota has a (likely direct) effect on the lifespan of Atm-deficient mice. Results indicated that isogenic mice derived from the same colony in which the microbiota had been altered have different lifespans. Restricted microbiota mice were re-derived from the mice in sterile (SPF-S) conditions into a restricted microbiota colony. Applicants' non-sterile (SPF-N) and conventional mice(CM) were also derived from the sterile (SPF-S) colony, and placed in non-sterile (SPF-N) conditions. The conventional microbiota mice, however, were treated with antibiotics followed by re-inoculation with conventional microbiota. In summary, Applicants found that changes in sterility of animal husbandry and direct changes in intestinal microbiota affects the population of microbiota in mice and correlates with a prolonged lifespan and delayed lymphoma onset. Surprisingly, Applicants also found that changes in the sterility, which affect intestinal microbiota, alter DNA deletions in Atm-deficient mice. DNA deletions are a measure of genetic instability and can result in cancer. The Atm-deficient mice were originally located at Harvard University and were housed there in non-sterile (SPF-N) conditions. Upon arriving at UCLA, mice were housed in sterile (SPF-S) conditions until they were moved to non-sterile (SPF-N) conditions as described in Example B. DNA deletions were increased in Atm-deficient mice at Harvard, compared to their wildtype littermates, however, decreased overtime in sterile (SPF-S) conditions until there was no difference between Atm-deficient mice and wildtype mice. Remarkably, once mice were moved to non-sterile (SPF-N) conditions, Atm-deficient mice again had more DNA deletions compared to their wildtype littermates.

    [0416] Using the description provided herein it is now possible to characterize which bacteria are helpful and harmful. Since each mouse represents its own endpoint with respect to longevity and onset of lymphoma, exact distribution of intestinal microbiota can then be correlated with the cancer phenotype to characterize which bacteria are beneficial and which are detrimental to our health. A similar approach was successfully used in identifying bacterial species involved in intestinal inflammation. In addition it is possible to test how changing microbiota, e.g., as described in Vrese et al. (Adv Biochem Eng Biotechnol 111 (2008) 1-66), can affect the lifespan of other cancer-prone as well as wildtype mice.

    [0417] All publications, including but not limited to patents and patent applications, cited in this specification, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference as if each individual publication were specifically and individually indicated to be incorporated by reference herein as though fully set forth.