COMPOSITIONS AND METHODS FOR SUPPRESSING AND/OR TREATING METABOLIC DISEASES AND/OR A CLINICAL CONDITION THEREOF
20240425457 ยท 2024-12-26
Assignee
Inventors
Cpc classification
C07D309/38
CHEMISTRY; METALLURGY
G01N2800/042
PHYSICS
C07D209/40
CHEMISTRY; METALLURGY
G01N2800/085
PHYSICS
C07C237/48
CHEMISTRY; METALLURGY
C07D311/30
CHEMISTRY; METALLURGY
C07D487/22
CHEMISTRY; METALLURGY
C07D207/44
CHEMISTRY; METALLURGY
G01N2800/044
PHYSICS
International classification
C07C229/36
CHEMISTRY; METALLURGY
C07C237/48
CHEMISTRY; METALLURGY
C07D207/44
CHEMISTRY; METALLURGY
C07D209/40
CHEMISTRY; METALLURGY
C07D309/38
CHEMISTRY; METALLURGY
C07D311/30
CHEMISTRY; METALLURGY
C07D487/22
CHEMISTRY; METALLURGY
Abstract
Therapeutic compositions comprising one or more agents that inhibit CXXC5-DVL interface, and methods of administering those therapeutic compositions to model, treat, reduce resistance to treatment, prevent, and diagnose a condition/disease associated with a metabolic disease or a related clinical condition thereof, are disclosed.
Claims
1. A method of treating a metabolic disease, comprising: administering to a subject at least one therapeutically effective dose of at least one compound or a pharmaceutically acceptable hydrate salt thereof, wherein the compound is: ##STR00050##
2. The method according to claim 1, further comprising: detecting upregulated expression of CXXC5 in the subject.
3. The method according to claim 1, further comprising: identifying the subject as at risk for a metabolic disease.
4. The method according to claim 1, wherein the subject exhibits abnormal lipid profile and/or blood glucose levels.
5. The method according to claim 1, wherein the subject is diagnosed with obesity, diabetes, non-alcoholic fatty liver disease (NAFLD), and/or non-alcoholic steatohepatitis (NASH).
6. The method according to claim 1, wherein the at least one compound that reduces and/or inhibits the CXXC5-DVL.
7. The method according to claim 1, wherein the subject is a human or an animal.
8. The method according to claim 1, wherein the at least one compound is administered orally or intravenously.
9. A method of suppressing the activity of CXXC5, comprising: providing a subject at least one therapeutically effective dose of at least one compound or a pharmaceutically acceptable salt thereof, wherein the compound is: ##STR00051##
10. The method according to claim 9, wherein the subject is a human, an animal, a cell, and/or a tissue.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0091] The following drawings form part of the present specification and are included to further demonstrate certain embodiments. Some embodiments may be better understood by reference to one or more of these drawings alone or in combination with the detailed description of specific embodiments presented.
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
[0107]
[0108]
[0109]
[0110]
[0111]
[0112]
[0113]
[0114]
[0115]
[0116]
[0117]
[0118]
[0119]
[0120]
[0121]
[0122]
[0123]
[0124]
[0125]
[0126]
[0127]
[0128]
[0129]
[0130]
[0131]
[0132]
[0133]
[0134]
[0135]
[0136]
[0137]
[0138]
[0139]
[0140]
[0141]
[0142]
[0143]
[0144]
[0145]
[0146]
[0147]
[0148]
[0149]
[0150]
[0151]
[0152]
[0153]
[0154]
[0155]
[0156]
[0157]
[0158]
[0159]
[0160]
[0161]
[0162]
[0163]
[0164]
[0165]
[0166]
[0167]
[0168]
[0169]
[0170]
[0171]
[0172]
[0173]
[0174]
[0175]
[0176]
[0177]
[0178]
[0179]
[0180]
[0181]
[0182]
[0183]
[0184]
[0185]
[0186]
[0187]
[0188]
[0189]
[0190]
[0191]
[0192]
[0193]
[0194]
[0195]
[0196]
[0197]
[0198]
[0199]
[0200]
[0201]
[0202]
[0203]
[0204]
[0205]
[0206]
[0207]
[0208]
[0209]
[0210]
[0211]
[0212]
[0213]
[0214]
[0215]
[0216]
[0217]
[0218]
[0219]
[0220]
[0221]
[0222]
[0223]
[0224]
[0225]
[0226]
[0227]
[0228]
[0229]
[0230]
[0231]
[0232]
[0233]
[0234]
[0235]
[0236]
[0237]
[0238]
[0239]
[0240]
[0241]
[0242]
[0243]
[0244]
[0245]
[0246]
[0247]
[0248]
[0249]
[0250]
[0251]
[0252]
[0253]
[0254]
[0255]
[0256]
[0257]
[0258]
[0259]
[0260]
[0261]
[0262]
[0263]
[0264]
[0265]
[0266]
[0267]
[0268]
[0269]
[0270]
[0271]
[0272]
[0273]
[0274]
[0275]
[0276]
[0277]
[0278]
[0279]
[0280]
[0281]
[0282]
[0283]
[0284]
[0285]
[0286]
[0287]
[0288]
[0289]
[0290]
[0291]
[0292]
[0293]
[0294]
[0295]
[0296]
[0297]
[0298]
[0299]
[0300]
[0301]
[0302]
[0303]
[0304]
[0305]
[0306]
[0307]
[0308]
[0309]
TABLE-US-00001 BRIEFDESCRIPTIONOFSEQUENCES SEQIDNO.1. CAAGAAGAAGCGGAAACGCTGC SEQIDNO.2. TCTCCAGAGCAGCGGAAGGCTT SEQIDNO.3. CAACCCAGCCAAGAAGAAGA SEQIDNO.4. AGATCTGGTGTCCCGTTTTG SEQIDNO.5. TGTGTACCCAATCACGACAGGAG SEQIDNO.6. GATTCCGGTCGTGTGCAGAG SEQIDNO.7. TGGAGAGTGAGCGGCAGAGC SEQIDNO.8. TGGAGACGAGCGGGCAGA SEQIDNO.9. CCTTCCATCCAAATGTTGC SEQIDNO.10. GTGACTGACCATAGACTCTGTGC SEQIDNO.11. ATCGCCCGAGGTACGCAATAGG SEQIDNO.12. CAGCCCACCGTGCCATCAATG SEQIDNO.13. AACCGGAGGAAGGAACTGAC SEQIDNO.14. AACCGGAGGAAGGAACTGAC SEQIDNO.15. TGTGGGGATAAAGCATCAGGC SEQIDNO.16. CCGGCAGTTAAGATCACACCTAT SEQIDNO.17. GGTGGACAAGAACAGCAACGA SEQIDNO.18. TGTCCAGTTCACGGCTCAGCT SEQIDNO.19. GGAGCCATGGATTGCACATT SEQIDNO.20. GGCCCGGGAAGTCACTGT SEQIDNO.21. GCGATGAAGAGCATGGTTTAG SEQIDNO.22. GGCTCAAGGGTTCCATGTT SEQIDNO.23. CTGTACGGGATCATACTGGTTC SEQIDNO.24. GCCGTGCCTTGTAAGTTCTG SEQIDNO.25. CCTCCGTCAGCTCAGATACA SEQIDNO.26. TTTACTAGGTGCAAGCCAGACA SEQIDNO.27. CGGAGTCCGGGCAGGT SEQIDNO.28. GCTGGGTAGAGAATGGATCA SEQIDNO.29. TGACGTCACTGGAGTTGTACGG SEQIDNO.30. GGTTCATGTCATGGATGGTGC SEQIDNO.31. TCAAGTGGCATAGATGTGGAAGAA SEQIDNO.32. TGGCTCTGCAGGATTTTCATG SEQIDNO.33. CTTTGGCTATGGGCTTCCAGTC SEQIDNO.34. GCAAGGAGGACAGAGTTTATCGTG SEQIDNO.35. ACTGAAGCCAGCTCTCTCTTCCTC SEQIDNO.36. TTCCTTCTTGGGGTCAGCACAGAC SEQIDNO.37. CTCCAAGCCAAAGTCCTTAGAG SEQIDNO.38. GGAGCTGTCATTAGGGACATCA SEQIDNO.39. CAGGTCTGGCAATTCTTCTGAA SEQIDNO.40. GTCTTGCTCATGTGTGTAAGTGA SEQIDNO.41. CCAATCCAGCTAACTATCCCTCC SEQIDNO.42. ACCCAGTAGCAGTCATCCCA SEQIDNO.43. TTGTCGGTGTGATTGGCTTC SEQIDNO.44. AAAAGGCAGCACACAGTTGC SEQIDNO.45. GCTATGCTGCCTGCTCTTACT SEQIDNO.46. CCTGCTGATCCTCATGCCA SEQIDNO.47. GGACTTGAGCTATGACACGGG SEQIDNO.48. GCCAATCAGGTTCTTTGTCTGAC SEQIDNO.49. GTCGTGGCTGGAGTCTTG SEQIDNO.50. CGGAGGCTGGCATTGTAG SEQIDNO.51. ATCTCCTTTGGAAGCGGATATG SEQIDNO.52. CGCAACGCAAAGCATTTCTT SEQIDNO.53. GGTATTGAACTGACAGACTC SEQIDNO.54. CCAGTTGTTGACCAAAGG SEQIDNO.55. GTAACATCTACAGCCTTAATGAG SEQIDNO.56. CCAGAGTGCGGTGAATATC SEQIDNO.57. AGGCTTCCAGTACCATTAGGT SEQIDNO.58. CTGAGTGAGGCAAAGCTGATTT SEQIDNO.59. TTGGCACCGATCCTCGAAC SEQIDNO.60. CCCAGCTCCAGTCAGAACTAT SEQIDNO.61. CAGTGTGGTGCACGTCTCCAATC SEQIDNO.62. TGAACCAAAGTTGACCACCAG SEQIDNO.63. AGCCGTGACCACTGACAACGAG SEQIDNO.64. GCTGCATGGTTCTGAGTGCTAAG SEQIDNO.65. GCTGGAGGTGGCTTTGGT SEQIDNO.66. GCTTGGCGGATGTGGTTC SEQIDNO.67. GGATAAACAGAATAAGCACACCA SEQIDNO.68. GAAGGAACAAAGCGGATGAG SEQIDNO.69. CCGACCGAATGCAGAAGGA SEQIDNO.70. ACAGAGTATTTGCGCTCCGAA SEQIDNO.71. AAGGTATTGCTGGACAGCGT SEQIDNO.72. TGTTTGCCAGGTTCACCAGA SEQIDNO.73. AACATCTGGCACTCCACACC SEQIDNO.74. GCAGAAGTTCTTTGGCCTGC
DEFINITIONS
[0310] About refers to a range of values plus or minus 10 percent, e.g. about 1.0 encompasses values from 0.9 to 1.1.
[0311] CXXC5-DVL interface refers to an interaction and/or association between CXXC5 (CXXC finger protein 5) and DVL (dishevelled), which can induce biological activities known in the art. The interactions and/or associations can be physical or chemical interactions that would activate a CXXC5-DVL pathway within a subject. CXXC5-DVL interface can be present in a form of a complex.
[0312] Inhibitor of CXXC5-DVL interface refers to an agent that alters the function and/or activity of the CXXC5-DVL interface or induces conformational changes in the CXXC5-DVL interface. Examples of inhibitors of CXXC5-DVL interface include, but are not limited to, agents that alter association/dissociation between CXXC5 and DVL and/or agents that inhibit CXXC5-DVL complex assembly/function.
[0313] Metabolic disease or a similar condition can include, but is not limited to, metabolic disorder, metabolic syndrome, obesity, high blood pressure, high blood sugar, high serum triglycerides, hyperuricemia, fatty liver, polycystic ovarian syndrome, erectile dysfunction, acanthosis nigricans, type 2 diabetes mellitus, hypoadiponectinemia, cirrhosis, portal hypertension, cardiovascular diseases, coronary artery disease, lipodystrophy, dyslipidemia, hepatic steatosis, non-alcoholic fatty liver disease (NAFLD), and/or non-alcoholic steatohepatitis (NASH).
[0314] Pharmaceutically acceptable refers to approved or approvable by a regulatory agency of a government, such as the U.S. FDA or the EMA, or listed in the U.S. Pharmacopoeia or other generally recognized pharmacopoeia for use in mammals and/or animals, and more particularly in humans.
[0315] Pharmaceutically acceptable vehicle or pharmaceutically acceptable carrier, unless stated or implied otherwise, is used herein to describe any ingredient other than the active component(s) that can be included in a formulation. The choice of carrier will to a large extent depend on factors such as the mode of administration, the effect of the carrier on solubility and stability, and the nature of the dosage form.
[0316] Pharmaceutical composition refers to a therapeutically active inhibitor of CXXC5-DVL interface or a therapeutically active inhibitor of GSK , and at least one pharmaceutically acceptable vehicle/carrier, with which the inhibitor of CXXC5-DVL interface and/or inhibitor of GSK is administered to a subject.
[0317] Subject refers to a human (adult and/or child), an animal, a livestock, a cell, and/or a tissue.
[0318] Therapeutically effective amount refers to the amount of an inhibitor of CXXC5-DVL interface or inhibitor of GSK that, when administered to a subject for treating a disease, or at least one of the clinical symptoms of a disease, is sufficient to affect such treatment of the disease or symptom thereof. The therapeutically effective amount can vary depending, for example, on the inhibitor of CXXC5-DVL interface, inhibitor of GSK, the disease and/or symptoms of the disease, severity of the disease and/or symptoms of the disease or disorder, the age, weight, and/or health of the subject to be treated, and the judgment of the prescribing physician.
[0319] Therapeutically effective dose refers to a dose that provides effective treatment of a disease or disorder in a subject. A therapeutically effective dose can vary from compound to compound, and from subject to subject, and can depend upon factors such as the condition of the subject and the route of delivery.
[0320] Therapeutic regime(s) and/or therapeutic regimen(s) include, but are not limited to, surgery, weight loss, healthy eating, physical activity, insulin therapy, and/or a medication/drug therapy. In some embodiments, the medication/drug therapy includes one or more treatments with at least one agent including, but is not limited to, orlistat, lorcaserin, phentermine-topiramate, naltrexone-bupropion, liraglutide, benzphetanine, diethylpropion, sulfonylureas, meglitinides, thiazolidinediones, DPP-4 inhibitors, insulin analog, alpha glucosidase inhibitor, SGL T2 inhibitors, sitagliptin, metformin, rosiglitazone, ocaliva, selonsertib, elafibranol, cenicriviroc, MGL-3196, GR-MD-02, and/or aramchol.
[0321] Treat, treating or treatment of any disease or condition refers to reversing, alleviating, arresting, or ameliorating a disease or at least one of the clinical symptoms of a disease, reducing the risk of acquiring a disease or at least one of the clinical symptoms of a disease, inhibiting the progress of a disease or at least one of the clinical symptoms of the disease or reducing the risk of developing a disease or at least one of the clinical symptoms of a disease. In some embodiments, treat, treating or treatment also refers to inhibiting the disease, either physically, (e.g., stabilization of a discernible symptom), physiologically, (e.g., stabilization of a physical parameter), or both, and to inhibiting at least one physical parameter that can or cannot be discernible to the subject. In certain embodiments, treat, treating or treatment refers to delaying the onset of the disease or condition or at least one or more symptoms thereof in a subject which can be exposed to or predisposed to a disease or condition even though that subject does not yet experience or display symptoms of the disease.
DETAILED DESCRIPTION
[0322] For the purposes of promoting an understanding of the principles of the novel technology, reference will now be made to the preferred embodiments thereof, and specific language will be used to describe the same. It will nevertheless be understood that no limitation of the scope of the novel technology is thereby intended, such alterations, modifications, and further applications of the principles of the novel technology being contemplated as would normally occur to one skilled in the art to which the novel technology relates are within the scope of this disclosure and the claims.
[0323] Metabolic diseases possess multiplex pathological status associated with obesity, atherogenic dyslipidemia, insulin resistance, and increased risk of developing type 2 diabetes mellitus (T2DM). Metabolic diseases have long been considered as incurable, chronic conditions that require glycemic control in peripheral insulin target tissues. Although weight reduction by restricting the consumption of calories has been considered as an underlying direction to reverse metabolic diseases, an effective medication that improves the overall condition of metabolic diseases by targeting the systemic pathological process is not currently available.
[0324] Nonalcoholic steatohepatitis (NASH) can be characterized as inflammation and damage in liver caused by accumulation of fat in the liver. Many affected patients exhibit obesity, type 2 diabetes mellitus, glucose intolerance, dyslipidemia, and/or metabolic disease. Although incidences of NASH have been increasing worldwide with increase in obesity, its pathological mechanism(s) is not well understood.
[0325] In recent years, accumulating evidence from basic and clinical studies indicate that Wnt/-catenin signaling target genes are involved in inducing inflammation, lipogenesis, fatty acid oxidation, glucose oxidation, mitochondria biogenesis, insulin resistance, glucose tolerance, and/or free fatty acid production. For example, the following Wnt/-catenin pathway target genes are found to be involved in obesity, type II diabetes, and NASH: 1) Obesity: TCF7L2, Wnt10b, PPAR, C/EBP, Cttnb1, Axin2, Lef1, Myc, Wisp1, Wisp2 and Tle3) Type II diabetes: Wnt5b, PPAR, TCF7L2 (TCF4), PPAR, c-Myc, cyclin D1, and CDK4, AMPK, PGC-1, and 3) NAS1-1: PPAR, COL4, COL3, -SMA, and Fibronectin.
[0326] CXXC finger protein 5 (CXXC5) is a negative regulator of Wnt/-catenin signaling, functioning via interaction with PDZ domain of dishevelled (DVL) in the cytosol. Inhibition of the CXXC5-DVL interaction improved several pathophysiological phenotypes involving Wnt/-catenin signaling including osteoporosis, longitudinal bone growth, cutaneous wounds, and hair loss through activation of the Wnt/-catenin signaling.
[0327] As disclosed herein, CXXC5 expression were progressively increased in the white adipocytes and the liver tissues of patients diagnosed with NASH and diabetes. Further, Wnt/-catenin pathway target genes such as TCF7L2, and FOSL1 were found to be suppressed in patients diagnosed with NASH and/or Type II diabetes. Cxxc5.sup./ mice did not develop any phenotypes of metabolic diseases including obesity, diabetes, and/or NASH. The results disclosed herein suggest that CXXC5 contributes to the development of metabolic diseases. Thus, the instant disclosure provides a novel function of CXXC5-DVL interface that may lead to the treatment of metabolic diseases including, but are not limited to, obesity, diabetes, and/or NASH.
[0328] The present disclosure provides, inter alia, a discovery platform for developing therapeutic inhibitors of a CXXC5-DVL interface that negatively affects the Wnt/-catenin pathway, for example, in liver of a subject having or suspected of having metabolic diseases. For example, small molecules that activate the Wnt/-catenin pathway by inhibiting the CXXC5-DVL interface were obtained by use of an in vitro screening system monitoring fluorescent intensity that reveals binding of the PTD-DBNMP (protein transduction domain fused DVL binding motif peptide), which contains sequence of CXXC5 binding to DVL and is conjugated to FITC, onto PZD domain of DVL. See e.g., Kim H Y, et al (2016), Small molecule inhibitors of the Dishevelled-CXXC5 interaction are new drug candidates for bone anabolic osteoporosis therapy. EMBO Mol Med 8: 375-387. Interestingly, several GSK3 inhibitors, including 6-bromoindirubine-3-oxime (BIO) and indirubin 3-oxyme (I3O), were identified as initial hits. Further, the instant disclosure provides that a functionally improved, and newly synthesized, indirubin derivatives, e.g., A3334 and A3051, effectively inhibited interaction between CXXC5 and DVL. Moreover, A3334 and A3051 markedly reduced and/or inhibited the development of high fat diet (HFD)-induced and methionine-choline deficient diet (MCD)-induced phenotypes such as obesity, diabetes, and/or NASH. By identifying this CXXC5-DVL induced mechanism of developing metabolic diseases, the present disclosure provides a platform for screening compound libraries for inhibitors of the specific interaction of CXXC5 and DVL by binding to the CXXC5-DVL interface that involves the DVL binding motif.
[0329] Embodiments disclosed herein relate to compositions and methods for treating a condition and/or disease associated with metabolic disease and/or a related clinical condition in a subject. In certain embodiments, compositions and methods disclosed herein concern suppression of a side effect of a therapeutic regime. Other embodiments relate to compositions and methods for treating a subject diagnosed with a metabolic disease or having a condition contributed to fatty liver disease, nonalcoholic fatty liver disease (NAFLD), nonalcoholic steatohepatitis (NASH), obesity, diabetes, hyperlipidemia, chronic liver disease, cirrhosis, coronary artery disease, portal hypertension, lipodystrophy, rheumatic disease, psoriasis, and/or psoriatic arthritis.
[0330] Methods disclosed herein include a method of treating a clinical condition, comprising administering to a subject at least one therapeutically effective dose of any one of the compounds and/or compositions disclosed herein. The subject can be diagnosed with a clinical condition selected from and/or comprising a metabolic disease or a similar condition thereof. In certain embodiments, the methods disclosed herein further comprise administering to the subject at plurality of therapeutically effective doses of any one of the compounds and/or compositions disclosed herein.
[0331] In some embodiments, compositions disclosed herein comprise at least one agent that inhibits CXXC5-DVL interface in a subject. Consistent with these embodiments, the at least one agent that inhibits CXXC5-DVL interface comprises at least one compound disclosed herein. In some embodiments, the at least one agent that inhibits CXXC5-DVL interface can disrupt conformation of the CXXC5-DVL interface physically and/or chemically.
Pharmaceutical Compositions
[0332] Pharmaceutical compositions provided by the present disclosure can comprise a therapeutically effective amount of one or more compositions disclosed herein, together with a suitable amount of one or more pharmaceutically acceptable vehicles to provide a composition for proper administration to a subject. Suitable pharmaceutical vehicles are described in the art.
[0333] Pharmaceutical compositions of the present disclosure suitable for oral administration can be presented as discrete units, such as a capsule, cachet, tablet, or lozenge, each containing a predetermined amount of the active ingredient; as a powder or granules; as a solution or a suspension in an aqueous liquid or non-aqueous liquid such as a syrup, elixir or a draught, or as an oil-in-water liquid emulsion or a water-in-oil liquid emulsion. The composition can also be presented as a bolus, electuary, or paste. A tablet can be made by compressing or moulding the active ingredient with the pharmaceutically acceptable carrier. Compressed tablets can be prepared by compressing in a suitable machine the active ingredient in a free-flowing form, such as a powder or granules, in admixture with, for example, a binding agent, an inert diluent, a lubricating agent, a disintegrating and/or a surface-active agent. Moulded tablets can be prepared by moulding in a suitable machine a mixture of the powdered active ingredient moistened with an inert liquid diluent. The tablets can optionally be coated or scored and can be formulated to provide slow or controlled release of the active ingredient.
[0334] Pharmaceutical compositions of the present disclosure suitable for parenteral administration include aqueous and non-aqueous sterile injection solutions, and can also include an antioxidant, buffer, a bacteriostat and a solution which renders the composition isotonic with the blood of the recipient, and aqueous and non-aqueous sterile suspensions which can contain, for example, a suspending agent and a thickening agent. The formulations can be presented in a single unit-dose or multi-dose containers and can be stored in a lyophilized condition requiring the addition of a sterile liquid carrier prior to use.
[0335] Pharmaceutically acceptable salts include salts of compounds provided by the present disclosure that are safe and effective for use in mammals and that possess a desired therapeutic activity. Pharmaceutically acceptable salts include salts of acidic or basic groups present in compounds provided by the present disclosure. Pharmaceutically acceptable acid addition salts include, but are not limited to, hydrochloride, hydrobromide, hydroiodide, nitrate, sulfate, bisulfate, phosphate, acid phosphate, isonicotinate, acetate, lactate, salicylate, citrate, tartrate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucaronate, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzensulfonate, p-toluenesulfonate and pamoate (i.e., 1,1-methylene-bis-(2-hydroxy-3-naphthoate)) salts. Certain disclosed compounds may form pharmaceutically acceptable salts with various amino acids. Suitable base salts include, but are not limited to, aluminum, calcium, lithium, magnesium, potassium, sodium, zinc, and diethanolamine salts. For additional information on some pharmaceutically acceptable salts that can be used to practice the methods described herein please review articles such as Berge, et al., 66 J. PHARM. SCI. 1-19 (1977), Haynes, et al, J. Pharma. Sci., Vol. 94, No. 10, October 2005, pgs. 2111-2120, and the like.
[0336] In some embodiments, the composition can contain pharmaceutically acceptable lubricant(s). The pharmaceutically acceptable lubricant(s) prevent the components of the pharmaceutical composition from clumping together and from sticking to the pellet press that generates the disclosed compositions. The lubricant(s) also ensure that the formation of the pellet, as well as its ejection from the pellet press, occurs with low friction between the composition and the wall of the die press. In some embodiments, the lubricant(s) are added to a pharmaceutical composition to improve processing characteristics, for example to help increase the flexibility of the compositions, thereby reducing breakage.
[0337] The type of lubricant that can be used in the disclosed pharmaceutical compositions can vary. In some embodiments, the pharmaceutically acceptable lubricant is selected from talc, silica, vegetable stearin, magnesium stearate, stearic acid, calcium stearate, glyceryl behenate, glyceryl monostearate, glyceryl palmitostearate, mineral oil, polyethylene glycol, sodium stearyl fumarate, sodium lauryl sulfate, vegetable oil, zinc stearate, and combinations thereof. In some embodiments, the pharmaceutically acceptable lubricant is stearic acid.
[0338] The type of vehicles that can be used in the disclosed pharmaceutical compositions can vary. In some embodiments, the pharmaceutically acceptable vehicles are selected from binders, fillers and combinations thereof. In some embodiments, the pharmaceutically acceptable vehicle is selected from ascorbic acid, polyvinylpyrrolidone, polyvinylpyrrolidone K-30 (povidone K-30), glyceryl monostearate (GMS) or glyceryl monostearate salts, glyceryl behenate, glyceryl palmitostearate, hydroxypropyl cellulose, hydroxypropyl methylcellulose, methylcellulose, hydroxyethyl cellulose, sugars, dextran, cornstarch, dibasic calcium phosphate, dibasic calcium phosphate dihydrate, calcium sulfate, dicalcium phosphate, tricalcium phosphate, lactose, cellulose including microcrystalline cellulose, mannitol, sodium chloride, dry starch, pregelatinized starch, compressible sugar, mannitol, lactose monohydrate, starch, dibasic calcium phosphate dihydrate, calcium sulfate, dicalcium phosphate, tricalcium phosphate, powdered cellulose, microcrystalline cellulose, lactose, glucose, fructose, sucrose, mannose, dextrose, galactose, the corresponding sugar alcohols and other sugar alcohols, such as mannitol, sorbitol, xylitol, and combinations of any of the foregoing. In some embodiments, the pharmaceutically acceptable vehicle is polyvinylpyrrolidone K-30, also known as povidone K-30. In some embodiments, the pharmaceutically acceptable vehicle is polyvinylpyrrolidone K-30, also known as povidone K-30, having an average molecular weight of MW of 40,000 (CAS 9003-39-8). In some embodiments, the pharmaceutically acceptable vehicle is selected from glyceryl monostearate (GMS) or glyceryl monostearate salts, glyceryl behenate and glyceryl palmitostearate. In some embodiments, the pharmaceutically acceptable vehicle is glyceryl monostearate (GMS) or glyceryl monostearate salts. In some embodiments, the pharmaceutically acceptable vehicle is glyceryl behenate. In some embodiments, the pharmaceutically acceptable vehicle is glyceryl palmitostearate.
[0339] In some embodiments, the antioxidants prevent oxidation of the other components of the disclosed compositions. Oxidation can occur, for example, during sterilization where free radicals are generated. Addition of the antioxidants, or free radical scavengers, significantly reduces oxidation and makes the composition more pharmaceutically acceptable for use in subjects.
[0340] The type of antioxidants that can be used in the disclosed pharmaceutical compositions can vary. In some embodiments, the antioxidant is selected from methyl paraben and salts thereof, propyl paraben and salts thereof, vitamin E, vitamin E TPGS, propyl gallate, sulfites, ascorbic acid (aka L-ascorbic acid, also including the L-enantiomer of ascorbic acid, vitamin C), sodium benzoate, citric acid, cyclodextrins, peroxide scavengers, benzoic acid, ethylenediaminetetraacetic acid (EDTA) and salts thereof, chain terminators (e.g., thiols and phenols), butylated hydroxytoluene (BHT), butylated hydroxyanisole (BHA), and combinations thereof.
Uses or Methods of Treatment
[0341] The methods and compositions disclosed herein can be used to treat subjects suffering from diseases, disorders, conditions, and symptoms for which inhibitors of CXXC5-DVL interface and/or GSK are known to provide or are later found to provide therapeutic benefit.
[0342] In some embodiments, methods disclosed herein include a method of treating a clinical condition, comprising administering to a subject at least one therapeutically effective dose of any of the compositions disclosed herein. The subject can be diagnosed with a clinical condition selected from and/or comprising fatty liver disease, nonalcoholic fatty liver disease (NAFLD), nonalcoholic steatohepatitis (NASH), obesity, diabetes, hyperlipidemia, chronic liver disease, cirrhosis, coronary artery disease, portal hypertension, lipodystrophy, rheumatic disease, psoriasis, and psoriatic arthritis, and/or any other conditions associated with, induced by, or that are already resistant to drug treatments, therapies and/or surgical treatments. In certain embodiments, the methods disclosed herein further comprise administering to the subject at least one additional therapeutically effective dose of any of the compositions disclosed herein. In some embodiments, the at least one therapeutically effective dose of any of the compositions disclosed herein can be administered orally, parenterally, intravenously, by inhalation and/or transdermally.
[0343] Yet other embodiments can include methods for reducing a side effect of a therapeutic regime, comprising administering to a subject at least one therapeutically effective dose of at least one agent that inhibits CXXC5-DVL interface in a subject; wherein the subject has received at least one therapeutic regime comprising drug treatments, surgery, therapy, and wherein the subject experiences at least one side effect derived from the therapeutic regime. Consistent with these embodiments, side effects can include, but are not limited to, drug-resistance and/or relapse.
Kits
[0344] In a further aspect, kits are provided by the present disclosure, such kits comprising: one or more pharmaceutical compositions, each composition sterilized within a container, means for administration of the pharmaceutical compositions to a subject, and instructions for use.
[0345] Some embodiments include kits for carrying out the methods disclosed herein. Such kits typically comprise two or more components required for treating a clinical condition. Components of the kit include, but are not limited to, one or more of agents/compositions disclosed herein, reagents, containers, equipment and/or instructions for using the kit. Accordingly, the compositions and methods described herein can be performed by utilizing pre-packaged kits disclosed herein.
Examples
[0346] The following examples illustrate various aspects of the disclosure. It will be apparent to those skilled in the art that many modifications, both to materials and methods, can be practiced without departing from the scope of the disclosure.
The Involvement of CXXC5 in Metabolic Diseases Including Obesity and Diabetes
[0347] Reports have shown that diabetes could be reversed by understanding molecular and cellular events that may control adipose tissue expansion. Understanding the molecular and cellular events can be a useful tool in identifying a therapeutic approach for the prevention and treatment of the overall features of metabolic diseases such as obesity-related insulin resistance and systemic inflammation.
[0348] The canonical Wnt/-catenin pathway regulates cellular metabolism involving nutrient sensing by affecting the expression of metabolically relevant transcription factors such as WISP1, c-MYC, CCND1, PPAR and TCF7L2. The activation of the Wnt/-catenin pathway suppresses PPAR and C/EBP, the adipogenic transcription factors, by the induction of WISP1, c-MYC, and CCND1. PPARS improves the metabolic parameters and stimulates -oxidation in metabolically active tissues including the liver and adipose tissues. The common variants of TCF7L2 are associated with an increased risk of T2DM and impaired function of the incretin hormone, and its receptor in pancreatic -cells. Moreover, the adipocyte-specific deletion of TCF7L2 promotes adipocyte hypertrophy, hepatic insulin resistance, and whole-body glucose intolerance. The role of Wnt/-catenin signaling inactivation in the pathogenesis of T2DM has been shown as elevated expression of Dickkopf-1 (DKK-1), the Wnt/-catenin signaling antagonist, in the serum of a T2DM patient. Inactivation of Wnt/-catenin signaling modifies the adipokine-secretion profile followed by obesity-induced adipose tissue inflammation, thereby, influencing the systemic insulin resistance. Overall, aberrant regulation of the direct or indirect Wnt/-catenin pathway response genes is involved in metabolic disease. However, the development of drugs targeting the Wnt/-catenin pathway is limited and has mainly focused on the level of the downstream transcription factors including PPAR. Therefore, identification of a factor influencing the whole Wnt/-catenin pathway, especially which drives metabolic diseases, is further needed for the systemic treatment of the multi-diverse metabolic diseases.
[0349] CXXC5-type zinc finger protein 5 (CXXC5) is a negative feedback regulator of the Wnt/-catenin pathway that functions via Dishevelled (Dvl) binding. CXXC5 plays various pathophysiological roles involving regenerative tissue remodeling, especially at the specific pathophysiological status. However, the role of CXXC5 in the process of adipogenesis and obesity-related metabolic diseases has not been defined yet. In the present disclosure, it was found unexpectedly that CXXC5 was highly expressed in visceral adipose tissues from obese and diabetic patients, and thereby, experiencing reduced the expression of Wnt/-catenin target genes.
[0350] As disclosed herein, HFD-fed Cxxc5.sup./ mice did not develop obesity and obesity-related insulin resistance. Further, the oral administration of at least one compound disclosed herein (e.g., 5-methoxyindirubin-3-oxime, hereinafter A3334) activated Wnt/-catenin signaling by interfering the Dvl-CXXC5 protein-protein interaction (Dvl-CXXC5 PPI) in HFD-fed mice and mimicked the results derived from HFD-fed Cxxc5.sup./ mice. It was unexpected and surprising that the administration of A3334 resulted in prolonged effectiveness for the control of fasting glucose levels in HFD-fed mice when compared to the treatment with sitagliptin and metformin, which are the drugs regularly prescribed for T2DM patients. These effects of A3334 on metabolic diseases acquired through activation of the Wnt/-catenin pathway by blocking the function of the aberrantly overexpressed Cxxc5 during HFD-induced obesity was found. Activation of the Wnt/-catenin pathway by A3334 was followed by transcriptional regulation of the direct and indirect metabolic targets genes involving inflammation, lipogenesis, adipogenesis, and mitochondria biogenesis, leading to improvement of whole-body energy metabolism.
[0351] Human visceral fat specimens. To monitor the expression patterns of -catenin and CXXC5 during the development of obesity-related diabetes, 5-mm biopsy specimens were obtained from liver or colon cancer patients who had undergone surgery. The age of the subjects ranged from 43 to 82 years, who had a body mass index (BMI) between 17 and 32 kg m.sup.2. Individuals were assigned by BMI or diabetes mellitus (DM) grade (lean, BMI<25 or DM grade=0, 1, 2) divided four cohorts. (i) lean, BMI<25, DM=0; (ii) obesity, BMI>25, DM=0 or 1; (iii) lean, BMI<25, DM=2; and (iv) obesity, BMI>25, DM=2. Experiments using patient samples were approved by the Institutional Review Board of the Clinical Research Institute of Severance Hospital and were conducted according to the Declaration of Helsinki Principles.
[0352] Animals. The generation of Cxxc5.sup./ mice has been described previously. Cxxc5 heterozygous mice were intercrossed for four generations to obtain littermate wild-type and Cxxc5.sup./ mice and were maintained on a C57BL/6 background. Six-week-old Cxxc5.sup.+/+ and Cxxc5.sup./ mice were fed HFD for 8 weeks. Wild-type male C57BL/6 mice (KOATECH, Seoul, Korea) were fed HFD consisting of 60% calories from fat (Research Diet, D12492) for 8 weeks. To validate that the insulin resistance mouse model was successfully established, fasting glucose levels were assessed with a One Touch Ultra glucometer (LifeScan). Subsequently, each HFD-fed mouse with a fasting glucose level higher than 16.7 mmol/L was orally administered A3334 (25 mg kg.sup.1), sitagliptin (50 mg kg.sup.1), or metformin (100 mg kg.sup.1) each day for 5 days at weeks 8 and 12. After the removal of the drugs, mice were maintained for 3 weeks on the HFD. To monitor pancreas regeneration, six-week-old Cxxc5.sup.+/+ and Cxxc5.sup./ mice were fed an HFD as above. After dietary treatment for 4 weeks, the mice were intraperitoneally injected with STZ (50 mg/kg/d) for 1 week and the control group were injected with saline. After 2 weeks, Cxxc5.sup.+/+ mice were administered A3334 (25 mg kg.sup.1) and sitagliptin (50 mg kg.sup.1) per day by oral gavage for 4 weeks. For GTT or ITT, mice were injected with D-glucose (1.5 g/kg body weight) after overnight starvation or human insulin (0.75 units/kg body weight) after 4 h starvation, respectively. Tail blood was drawn at 0, 15, 30, 60, 120, 180 min intervals and blood glucose level was measured with a One Touch Ultra glucometer. All mice were maintained under temperature-controlled and light-controlled (standard 12 h light/dark cycle) conditions and provided with food and water ad libitum. All protocols were reviewed and approved by the Institutional Review Board of Severance Hospital, Yonsei University College of Medicine (09-013).
[0353] Blood chemistry. Total blood of mice was collected by cardiac puncture after fasting. The blood was allowed to clot for 30 min and was then centrifuged for 10 min at 1,000g to obtain supernatant to measure metabolic parameters. ELISA assay kits were used to assess serum insulin (Millipore), serum FFA (Cayman Chemical), serum adiponectin (ABclonal). The insulin function test was evaluated by HOMA-IR and was calculated as fasting plasma glucose (m mol/l)fasting serum insulin (mU/l)/22.5. Serum chemistry variables included total cholesterol, HDL-cholesterol, glucose, TG, ALT, AST, ALP, Ca, and Mg concentration. The calibration of serum parameters was performed using the quality control card supplied with the FUJI DRI-CHEM slides whenever slides from a new lot were used.
[0354] Adipokine-related protein analysis. Adipokines and hormones in mouse serum were measured using mouse adipokine array kits (Proteome Profiler and Human Cytokine; R&D System) to simultaneously detect the relative expression levels of 38 different obesity-related proteins. The array was performed according to the manufacturer's instructions. Blots were developed with enhanced chemiluminescence using a luminescent image analyzer, LAS-3000 (Fujifilm). All data were normalized by the intensity of reference spots in each membrane following the manufacturer's instruction.
[0355] Hematoxylin and eosin (H&E) staining. Dissected tissues were fixed in 4% neutral paraformaldehyde and embedded in paraffin. The paraffin sections were cut at a thickness of 4 m and subjected to H&E staining. The adipocyte cell size was measured in 20 randomly chosen microscopic areas from 3 independent animals using a Nikon bright-field optical microscope (Nikon TE-2000U). The average adipocyte size was determined using Image J software.
[0356] Immunohistochemistry (IHC). Paraffin sections 4 m in size were deparaffinized and rehydrated. For antigen retrieval, the slides were autoclaved in 10 mM sodium citrate buffer (pH 6.0). Sections were blocked in phosphate buffered saline (PBS) containing 10% BSA at room temperature for 30 min. The sections were incubated overnight at 4 C. with the following dilution of primary antibodies: anti--catenin (1:100; BD), anti-CXXC5 (1:50; Santa Cruz Biotechnology, Inc.), anti-F4/80 (1:100; Cell Signaling Technology), and anti-CD11b (1:100; eBioscience). The slides were washed with PBS, incubated with Alexa Fluor 488- or Alexa Fluor 555-conjugated IgG secondary antibody (1:300; Molecular Probes) at room temperature for 1 h, and counterstained with DAPI (1:5,000; Boehringer Mannheim). The images were captured using a LSM700 META confocal microscope (Carl Zeiss) after excitation with 405-, 488-, or 543-nm laser lines. To block endogenous peroxidase activity before peroxidase IHC analysis, tissues were incubated with 0.345% H.sub.2O.sub.2(Samchum Chemicals) for 30 min. Before incubating sections with mouse primary antibody, mouse IgG was blocked using a M.O.M Mouse IgG blocking kit (Vector Laboratories). Sections were incubated with primary antibody overnight at 4 C. with the following dilution of primary antibodies: anti-UCP1 (1:500; Abcam). Then, sections were incubated with biotinylated anti-rabbit (1:300; Dako) secondary antibodies for 1 h at room temperature. The samples were stained with 3, 3-diaminobenzidine (DAB; Dako) for 3-7 min and counter stained with Mayer's hematoxylin (Muto). All incubations were conducted in humid chambers. Signals were analyzed using a bright field microscope (Nikon TE-2000U).
[0357] Metabolic monitoring and body composition. Metabolic performance (energy intake and energy expenditure) was studied using a PHENOMASTER automated combined indirect calorimetry system (TSE system GmBH). The mice were first acclimated for 24 h in a metabolic chamber and were provided with food and water. They were then subsequently evaluated for 3 days to measure oxygen consumption (VO.sub.2), carbon dioxide production (VCO.sub.2), ambulatory counts, and respiratory exchange ratio. An LF50 body composition analyzer (Bruker) was used to determine body composition (lean body mass and total body fat) of the mice. The temperature for these studies remained at 22 C., with a 12 h light/dark cycle. Standard in-house software was used for energy expenditure.
[0358] Bioinformatics data analysis. Molecular pathway dysregulation in the human visceral adipose tissues was determined by gene set enrichment analysis, surveying the molecular pathway gene set in Molecular Signature Database (MsigDB). Cross-species comparison of transcriptomic dysregulation was performed in the space of molecular pathway gene sets from HALLMARK and KEGG databases and with statistically significant dysregulation defined as false discovery rate (FDR)<0.01 in either of the two human visceral and subcutaneous adipose tissue transcriptome datasets: normal (n=5) vs. T2DM (n=5) subjects (GSE16415), normal glucose tolerance (n=17) vs. T2DM (n=17) subjects (hgu-133a), lean (n=10) vs. obese (n=10) subjects (GSE2508), normal glucose tolerance (NGT) (n=4) vs. impaired glucose tolerance (IGT) (n=4) vs. T2DM (n=4) subjects (GSE27951), and insulin sensitive (n=5) vs. resistance (n=5) subjects (GSE15773).
[0359] Dvl-CXXC5 in vitro binding assay. For the Dvl-CXXC5 in vitro binding assay, 100 l of 5 mg/ml purified Dvl PDZ domain was added into 96-well Maxibinding Immunoplate (SPL) and incubated overnight in a 4 C. chamber. After washing with PBS, 10 M PolyR-DBM.sup.37 was added to each well and incubated for 3 h at room temperature. After washing with PBS, 100 l of 1, 5, and 10 M A3334 in PBS was added to each well and incubated for 1 h at room temperature. After washing with PBS three times, the fluorescence of each well was measured using a Fluorstar Optima microplate reader (BGM Lab Technologies). A3334 used in screening were designed and synthesized by Dr Gyoonhee Han (Yonsei University, Seoul, Korea).
[0360] Luciferase reporter assay. HEK293-TOP cells were seeded in 24-well plates. Cells were treated with A3334 at a concentration of 1, 5, and 10 M for 24 h. Total cell lysates were extracted with 35 l of 5 Reporter Lysis Buffer per well according to the manufacturer's instructions (Promega). A total of 35 l of luciferin was added and luciferase activity was measured using a Fluorstar Optima microplate reader.
[0361] Cell culture and adipocyte differentiation. 3T3-L1 cells were seeded in six-well plates at a density of 310.sup.4 cells per well. The cells were grown in Dulbecco's modified Eagle medium (DMEM) with 10% bovine calf serum (Gibco) until confluent. After confluence, cells were induced to differentiate in DMEM containing 10% fetal bovine serum (FBS; Gibco) and MDI (520 M methylisobutylxanthine (IBMX; Sigma-Aldrich), 1 M dexamethasone (Sigma-Aldrich), and 167 nM insulin (Gibco)) with or without A3334. On day 4, the medium was replaced with DMEM containing 10% FBS and 167 nM insulin with or without A3334 and changed with fresh identical medium every 2 days up to day 14 post-induction. Cells were incubated at 37 C. in a 5% CO.sub.2 environment.
[0362] Oil Red O staining. 3T3-L1 cells and liver tissues were washed with PBS and 70% isopropanol (Duksan Pure Chemicals) and stained with Oil Red O solution (Sigma-Aldrich) at room temperature overnight. Samples were washed thoroughly with distilled water. Tissues were counterstained with Mayer's hematoxylin. Images of the Oil Red O staining were visualized with a bright field microscope (Nikon TE-2000U). For the quantification of lipid contents, the Oil Red O was eluted by the addition of 500 l isopropanol containing 4% nonidet P-40 to each well and the absorbance was measured spectrophotometrically at 590 nm.
[0363] Triglyceride (TG) assay. Tissues were incubated on ice into 100 l saline solution (2 M NaCl, 2 mM EDTA, 50 mM sodium phosphate, and pH 7.4). Cells and tissues suspensions were assayed for TG content using a TG assay kit (Cayman Chemical).
[0364] Quantitative real-time polymerase chain reaction (PCR). Total RNA was extracted from ground tissue powder using TRIzol reagent (Invitrogen) according to the manufacturer's instructions. Reverse transcription was performed with M-MLV reverse transcriptase (Invitrogen) using 2 g of total RNA. Synthesized cDNA was diluted to a concentration of 100 ng/l. Quantitative PCR analyses were performed in the Rotor-gene Q real-time PCR cycler (Qiagen) using SYBR green reagent (Qiagen) with conditions of 95 C. for 10 min followed by 40 cycles at 95 C. for 5 s and 60 C. for 15 s. Relative quantification of mRNA levels was estimated using the comparative Ct method (Ct). All mRNA values were normalized with respect to GAPDH. The primer sequences are listed in Table 1.
TABLE-US-00002 TABLE1 ListofPrimers Mouse Gene Strand PrimerSequences CXXC5 F 5-CAAGAAGAAGCGGAAACGCTGC-3 SEQIDNO.1 R 5-TCTCCAGAGCAGCGGAAGGCTT-3 SEQIDNO.2 CXXC4 F 5-CAACCCAGCCAAGAAGAAGA-3 SEQIDNO.3 R 5-AGATCTGGTGTCCCGTTTTG-3 SEQIDNO.4 Tcf4 F 5-TGTGTACCCAATCACGACAGGAG-3 SEQIDNO.5 R 5-GATTCCGGTCGTGTGCAGAG-3 SEQIDNO.6 Axin2 F 5-TGGAGAGTGAGCGGCAGAGC-3 SEQIDNO.7 R 5-TGGAGACGAGCGGGCAGA-3 SEQIDNO.8 Dvl1 F 5-CCTTCCATCCAAATGTTGC-3 SEQIDNO.9 R 5-GTGACTGACCATAGACTCTGTGC-3 SEQIDNO.10 Wisp1 F 5-ATCGCCCGAGGTACGCAATAGG-3 SEQIDNO.11 R 5-CAGCCCACCGTGCCATCAATG-3 SEQIDNO.12 Fosl1 F 5-AACCGGAGGAAGGAACTGAC-3 SEQIDNO.13 R 5-AACCGGAGGAAGGAACTGAC-3 SEQIDNO.14 PPAR F 5-TGTGGGGATAAAGCATCAGGC-3 SEQIDNO.15 R 5-CCGGCAGTTAAGATCACACCTAT-3 SEQIDNO.16 C/EBP F 5-GGTGGACAAGAACAGCAACGA-3 SEQIDNO.17 R 5-TGTCCAGTTCACGGCTCAGCT-3 SEQIDNO.18 SREBP1 F 5-GGAGCCATGGATTGCACATT-3 SEQIDNO.19 R 5-GGCCCGGGAAGTCACTGT-3 SEQIDNO.20 FAS F 5-GCGATGAAGAGCATGGTTTAG-3 SEQIDNO.21 R 5GGCTCAAGGGTTCCATGTT-3 SEQIDNO.22 SCD-1 F 5-CTGTACGGGATCATACTGGTTC-3 SEQIDNO.23 R 5-GCCGTGCCTTGTAAGTTCTG-3 SEQIDNO.24 ACC F 5-CCTCCGTCAGCTCAGATACA-3 SEQIDNO.25 R 5-TTTACTAGGTGCAAGCCAGACA-3 SEQIDNO.26 Tnf F 5-CGGAGTCCGGGCAGGT-3 SEQIDNO.27 R 5-GCTGGGTAGAGAATGGATCA-3 SEQIDNO.28 Tgf1 F 5-TGACGTCACTGGAGTTGTACGG-3 SEQIDNO.29 R 5-GGTTCATGTCATGGATGGTGC-3 SEQIDNO.30 Ifn F 5-TCAAGTGGCATAGATGTGGAAGAA-3 SEQIDNO.31 R 5-TGGCTCTGCAGGATTTTCATG-3 SEQIDNO.32 F4/80 F 5-CTTTGGCTATGGGCTTCCAGTC-3 SEQIDNO.33 R 5-GCAAGGAGGACAGAGTTTATCGTG-3 SEQIDNO.34 MCP1 F 5-ACTGAAGCCAGCTCTCTCTTCCTC-3 SEQIDNO.35 R 5-TTCCTTCTTGGGGTCAGCACAGAC-3 SEQIDNO.36 Arg1 F 5-CTCCAAGCCAAAGTCCTTAGAG-3 SEQIDNO.37 R 5-GGAGCTGTCATTAGGGACATCA-3 SEQIDNO.38 Chi3l3 F 5-CAGGTCTGGCAATTCTTCTGAA-3 SEQIDNO.39 R 5-GTCTTGCTCATGTGTGTAAGTGA-3 SEQIDNO.40 Retnla F 5-CCAATCCAGCTAACTATCCCTCC-3 SEQIDNO.41 R 5-ACCCAGTAGCAGTCATCCCA-3 SEQIDNO.42 Pdcd1lg2 F 5-TTGTCGGTGTGATTGGCTTC-3 SEQIDNO.43 R 5-AAAAGGCAGCACACAGTTGC-3 SEQIDNO.44 IL-10 F 5-GCTATGCTGCCTGCTCTTACT-3 SEQIDNO.45 R 5-CCTGCTGATCCTCATGCCA-3 SEQIDNO.46 Irs1 F 5-GGACTTGAGCTATGACACGGG-3 SEQIDNO.47 R 5-GCCAATCAGGTTCTTTGTCTGAC-3 SEQIDNO.48 G6pc F 5-GTCGTGGCTGGAGTCTTG-3 SEQIDNO.49 R 5-CGGAGGCTGGCATTGTAG-3 SEQIDNO.50 PEPCK F 5-ATCTCCTTTGGAAGCGGATATG-3 SEQIDNO.51 R 5-CGCAACGCAAAGCATTTCTT-3 SEQIDNO.52 Pck1 F 5-GGTATTGAACTGACAGACTC-3 SEQIDNO.53 R 5-CCAGTTGTTGACCAAAGG-3 SEQIDNO.54 Fbp1 F 5-GTAACATCTACAGCCTTAATGAG-3 SEQIDNO.55 R 5-CCAGAGTGCGGTGAATATC-3 SEQIDNO.56 UCP1 F 5-AGGCTTCCAGTACCATTAGGT-3 SEQIDNO.57 R 5-CTGAGTGAGGCAAAGCTGATTT-3 SEQIDNO.58 SIRT1 F 5-TTGGCACCGATCCTCGAAC-3 SEQIDNO.59 R 5-CCCAGCTCCAGTCAGAACTAT-3 SEQIDNO.60 Dio2 F 5-CAGTGTGGTGCACGTCTCCAATC-3 SEQIDNO.61 R 5-TGAACCAAAGTTGACCACCAG-3 SEQIDNO.62 PGC1 F 5-AGCCGTGACCACTGACAACGAG-3 SEQIDNO.63 R 5-GCTGCATGGTTCTGAGTGCTAAG-3 SEQIDNO.64 CPT1 F 5-GCTGGAGGTGGCTTTGGT-3 SEQIDNO.65 R 5-GCTTGGCGGATGTGGTTC-3 SEQIDNO.66 CPT2 F 5-GGATAAACAGAATAAGCACACCA-3 SEQIDNO.67 R 5-GAAGGAACAAAGCGGATGAG-3 SEQIDNO.68 -SMA F 5-CCGACCGAATGCAGAAGGA-3 SEQIDNO.69 R 5-ACAGAGTATTTGCGCTCCGAA-3 SEQIDNO.70 Col1a1 F 5-AAGGTATTGCTGGACAGCGT-3 SEQIDNO.71 R 5-TGTTTGCCAGGTTCACCAGA-3 SEQIDNO.72 MMP-3 F 5-AACATCTGGCACTCCACACC-3 SEQIDNO.73 R 5-GCAGAAGTTCTTTGGCCTGC-3 SEQIDNO.74
[0365] Western blot analysis. Cells and tissues were lysed using radio-immunoprecipitation assay (RIPA) buffer (150 mM NaCl, 10 mM Tris, pH 7.2, 0.1% SDS, 1.0% Triton X-100, 1% sodium deoxycholate, and 5 mM EDTA). Samples were separated on 12% SDS polyacrylamide gels and transferred onto PROTRAN nitrocellulose membranes (Shleicher and Schuell Co.). After blocking with PBS containing 5% nonfat dry skim milk and 0.07% (vol/vol) Tween 20, the membranes were incubated with antibody specific for (-catenin (1:1,000; Santa Cruz Biotechnology, Inc.), CXXC5 (1:1,000), and Erk (1:5,000; Santa Cruz Biotechnology, Inc.) at 4 C. overnight. Samples were then incubated with horseradish peroxidase-conjugated anti-rabbit (1:1,000; Bio-Rad) or anti-mouse (1:1,000; Cell Signaling Technology) IgG secondary antibody. Protein bands were visualized with enhanced chemiluminescence (GE Healthcare) using a luminescent image analyzer, LAS-3000.
[0366] Statistical analysis. Data are presented as meansstandard deviation (SD). Statistical analyses were performed using unpaired two-tailed Student's t-test. Asterisks denote statistically significant differences (*, P<0.05; **, P<0.01; ***, P<0.005).
Synthesis of 5, 6-dichloroindirubin-3-methoxime (A3051)
[0367] Synthesis of intermediate product, 5,6-dichloro-[2,3-biindolinylidene]-2,3-dione.
##STR00020##
[0368] 5,6-dichloroisatin (500 mg, 2.32 mmol) was added to a 250 mL round bottom flask and dissolved in methanol (MeOH) (92.80 mL) followed by the addition of indoxyl acetate (405.48 mg, 2.315 mmol) and sodium percarbonate (Na2CO3) (637.83 mg, 6.02 mmol), and the mixture was stirred at 65 C. for 12 hours. The reaction is terminated using TLC (Rf=0.4, ethyl acetate/hexane=1/2 (v/v)) and the product is allowed to cool down on ice until a lump of crystals is formed. After the crystals are formed, the solvent is removed by filtration. The filtrate is discarded and the product is washed several times with a solvent (ethanol/water=1/1 (v/v)). The product was filtered and dried in a vacuum pump and used in the next step without further purification.
Synthesis of A3051
##STR00021##
[0369] A 100 ml round-bottomed flask was charged with 5, 6-dichloro-[2,3-biindolinylidene]-2, 3dione (600 mg, 1.81 mmol) and it was dissolved in pyridine (151 ml), and then H.sub.2NOCH.sub.3HCl (3026.4 mg, 36.24 mmol) was added, and the mixture was stirred at 120 C. for 12 hours. The reaction is terminated using TLC (Rf=0.4, ethyl acetate/hexane=1/1 (v/v)) and the temperature of the reaction solution is lowered to room temperature. After evaporation of the pyridine solvent, the product was dissolved in water and ethylacetate for 30 minutes using ultrasonic waves. The product was extracted twice with ethyl acetate and washed with saturated NaHCO3 solution. The extracted solution is dehydrated with anhydrous magnesium sulfate, and the solvent is evaporated and recrystallized using methanol and nucleic acid. The product was dried in a vacuum pump and red solid A3051 (326 mg) can be obtained in 47.94% yield. 1H NMR (400 MHz, DMSO-d6) 11.36 (s, 2H), 8.80 (s, 1H), 8.08 (d, 1H, J=7.7 Hz), 7.46-7.41 (m, 2H), 7.07-6.99 (m, 2H), 4.38 (s, 3H).
Synthesis of 5-methoxylindirubin-3-oxim (A3334)
[0370] Synthesis of intermediate product, 5-methoxy-[2,3-biindolinylidene]-2,3-dione
##STR00022##
[0371] 5-methoxyisatin (1000 mg, 5.65 mmol) was added to a 250-mL round bottom flask and dissolved in methanol (225 mL), followed by the addition of indoxyl acetate (989 mg, 5.65 mmol) and sodium carbonate (Na.sub.2CO.sub.3) (1496 mg, 14.11 mmol), and the mixture is stirred at 65 C. for 12 hours. The reaction is terminated using TLC (Rf=0.4, ethyl acetate/hexane=1/2 (v/v)) and the product is allowed to cool down on ice until a lump of crystals is formed. After the crystals are formed and the solvent is removed by filtration, the filtrate is discarded, and the product is washed several times with a solvent (ethanol/water=1/1 (v/v)). The product was filtered and dried in a vacuum pump and used in the next step without further purification.
Synthesis of A3334
##STR00023##
[0372] 5-methoxy-[2, 3-biindolinylidene]-2, 3-dione) (670 mg, 2.29 mmol) was added to a 100-mL round bottom flask and dissolved in pyridine (27 ml), followed by addition of H.sub.2NOCH.sub.3HCl (3186 mg, 45.85 mmol) and the mixture was stirred at 120 C. for 12 hours. The reaction is terminated using TLC (Rf=0.5, ethyl acetate/hexane=1/1 (v/v)) and the temperature of the reaction solution is lowered to room temperature. After evaporation of the pyridine solvent, the product was dissolved in water and ethylacetate for 30 minutes using ultrasonic waves. The product was extracted twice with ethyl acetate and washed with saturated NaHCO.sub.3 solution. The extracted solution is dehydrated with anhydrous magnesium sulfate, the solvent is evaporated and recrystallized using methanol and nucleic acid. The product was dried in a vacuum pump and red solid A3334 can be obtained (420 mg) in 59% yield.
Indirubin-3-oxime (I3O or IO)
##STR00024##
(Z)-4-(5-((1-(4-nitrophenyl)-1H-pyrazol-4-yl)methylene)-4-oxo-2-thioxothiazolidin-3-yl) butanoic acid (A2763)
##STR00025##
Comparative Example 3. (Z)-3-(5-((5-(4-cyanophenyl)furan-2-yl)methylene)-2,4-dioxothiazolidin-3-yl) propanoic acid (A2764)
##STR00026##
5,6-dichloroindirubin-3-propyloxim (A3486)
##STR00027##
5. 6-chloroindirubin-3-benzyloxime (A3538)
##STR00028##
(Z)-5-bromo-6-nitro-[2,3-biindolinylidene]-2,3-dione (A2785)
##STR00029##
6-Nitro-5-trifuloromethoxyindirubin-3-methoxime (A2794)
##STR00030##
[0373] Screening for compounds that inhibit the CXXC5-DVL interaction. To initially identify small molecules that inhibited the CXXC5-DVL interaction, chemical libraries (2,280 compounds: 1,000 from ChemDiv and 1,280 from SigmaLOPAC) were screened by in vitro binding assay that was previously described. See e.g., Kim et al. (2015) CXXC5 is a negative-feedback regulator of the Wnt/beta-catenin pathway involved in osteoblast differentiation. C
[0374] Nineteen compounds were selected as initial hits which suppress the CXXC5-DVL (PZD-DVL-PTD-DBMP (FITC) interaction more than 90%, and their capabilities of activation of the Wnt/-catenin pathway was confirmed by using the HEK293 cells harboring the pTOFOplash reporter in its chromosome. Among these compounds, indirubin analogs including BIO and I3O were identified. A summary of the high-throughput screening results is provided in Table 2.
TABLE-US-00003 TABLE 2 Summary of high-throughput screening results Category Parameter Description Assay Type of assay In vitro binding assay Target CXXC5-DVL interaction Primary measurement Fluorescence intensity Key reagents RTC-tagged PTD-DBM peptide and DVL-PZD domain protein Assay protocol The protocol was provided in Small molecule inhibitors of the Dishevelled-CXXC5 interaction are new drug candidates Library Library size 2280 compounds assayed in 96-well plates as single compounds at 10 mM in DMSO Library composition Small molecules Source ChemDiv and Sigma LOPAC 1280 Screen Format 96-well black polystyrene plates Concentration(s) tested Constant 30 M concentration, 0.3% DMSO Plate controls DMSO-treated group Reagent/compound Reagents and compounds were dispensed dispensing system manually Detection instrument and FLUOstar OPTIMA (BMG LABTECH) software Assay validation/QC Z-factor > 0.7 Correction factors N/A Normalization The sample result was normalized to positive control and is represented as % CXXC5-DVL interaction Post-HTS analysis Hit criteria <10% inhibition Hit rate 1%
TABLE-US-00004 TABLE 3 List of top-ranked compounds screened through an in vitro CXXC5-DVL PPI inhibition assay using chemical libraries that includes 2,280 small molecules CXXC5-DVL Empirical inhibitory Compound Structure Formula activity (%) 1
[0375] Indirubin analog compounds (#8 and #12; Table 3) were repeatedly identified as CXXC5-DVL inhibitors and showed effectiveness in the activation of Wnt/-catenin pathway using reporter assay. To obtain functionally improved compound, about 60 indirubin derivatives were newly synthesized by replacing the functional groups at the R.sub.1 and R.sub.2 sites of the indirubin backbone based on the structure of indribin-3-oxim (I3O) (#12; Table 3). Newly synthesized indirubin derivatives are described in Tables 4-6 and the structures of these compounds are shown
TABLE-US-00005 TABLE 4 List of chemically synthesized compounds shown to at least partially inhibit the activity of CXXC5-DVL. R1 R2 Compound # IUPAC name 4 5 6 7 3 C Indirubin Indirubin H H H H O 1 A2735 6-Chloro-5-nitroindirubin H NO.sub.2 Cl H O 2 A2736 6-Chloro-5-nitroindirubin-3-oxime H NO.sub.2 Cl H NOH 3 A2941 5,6-dichloroindirubin H Cl Cl H O 4 A3050 5,6-dichloroindirubin-3-oxime H Cl Cl H NOH 5 A3051 5,6-dichloroindirubin-3-methoxime H Cl Cl H NOCH.sub.3 6 A3471 5,6-dichloroindirubin-3-ethyloxime H Cl Cl H NOCH.sub.2CH.sub.3 7 A3486 5,6-dichloroindirubin-3-propyloxime H Cl Cl H NOCH.sub.2CH.sub.2CH.sub.3 8 A2813 6-Chloroindirubin H H Cl H O 9 A2853 6-Chloroindirubin-3-oxime H H Cl H NOH 10 A2793 6-Chloroindirubin-3-methoxime H H Cl H NOCH.sub.3 11 A3473 6-Chloroindirubin-3-ethyloxime H H Cl H NOCH.sub.2CH.sub.3 12 A3481 6-Chloroindirubin-3-propyloxime H H Cl H NOCH.sub.2CH.sub.2CH.sub.3 13 A3538 6-Chloroidirubin-3-benzyloxime H H Cl H NOCH.sub.2Ph 14 A2851 5-Chloroindirubin H Cl H H O 15 A3439 5-Chloroindirubin-3-oxime H Cl H H NOH 16 A3440 5-Chloroindirubin-3-methoxime H Cl H H NOCH.sub.3 17 A3470 5-Chloroindirubin-3-ethyloxime H Cl H H NOCH.sub.2CH.sub.3 18 A3485 5-Chloroindirubin-3-propyloxime H Cl H H NOCH.sub.2CH.sub.2CH.sub.3 19 A3536 5-Chloroindirubin-3-benzyloxime H Cl H H NOCH.sub.2Ph 20 A3331 5-Methoxyindirubin H OCH.sub.3 H H O 21 A3334 5-Methoxyindirubin-3-oxime H OCH.sub.3 H H NOH 22 A3441 5-Methoxyindirubin-3-methoxime H OCH.sub.3 H H NOCH.sub.3 23 A3484 5-Methoxyindirubin-3-ethyloxime H OCH.sub.3 H H NOCH.sub.2CH.sub.3 24 A3483 5-Methoxyindirubin-3-proyloxime H OCH.sub.3 H H NOCH.sub.2CH.sub.2CH.sub.3 25 A3330 5-Methylindirubin H CH.sub.3 H H O 26 A3335 5-Methylindirubin-3-oxime H CH.sub.3 H H NOH 27 A3442 5-Methylindirubin-3-methoxime H CH.sub.3 H H NOCH.sub.3 28 A3533 5-Methylindirubin-3-ethyloxime H CH.sub.3 H H NOCH.sub.2CH.sub.3 29 A3534 5-Methylindirubin-3-propyloxime H CH.sub.3 H H NOCH.sub.2CH.sub.2CH.sub.3 30 A3535 5-Methylindirubin-3-benzyloxime H CH.sub.3 H H NOCH.sub.2Ph C: control
TABLE-US-00006 TABLE 5 List of chemically synthesized compounds shown to at least partially inhibit the activity of CXXC5-DVL. R1 R2 Compound # IUPAC name 4 5 6 7 3 C I3O Indirubin-3-oxime H H H H NOH 31 A3332 5-Bromoindirubin H Br H H O 32 A3390 5 -bromoindirubin-3-oxime H Br H H NOH 33 A3391 5-bromoindirubin-3-methoxime H Br H H NOCH.sub.3 34 A3472 5-bromoindirubin-3-ethyloxime H Br H H NOCH.sub.2CH.sub.3 35 A3482 5-bromoindirubin-3-propyloxime H Br H H NOCH.sub.2CH.sub.2CH.sub.3 36 A3537 5-bromoindirubin-3-benzyloxime H Br H H NOCH.sub.2Ph 37 A2784 5-Chloro-6-nitroindirubin H Cl NO.sub.2 H O 38 A2848 5-Chloro-6-nitroindirubin-3-oxime H Cl NO.sub.2 H NOH 39 A3049 5-Chloro-6-nitroindirubin-3-methoxime H Cl NO.sub.2 H NOCH.sub.3 40 A2849 5-Nitroindirubin H H NO.sub.2 H O 41 A2854 5-Nitroindirubin-3-oxime H H NO.sub.2 H NOH 42 A3333 5-Trifluoromethoxyindirubin H OCF.sub.3 H H O 43 A3392 5-Trifluoromethoxyindirubin H OCF.sub.3 H H NOH 44 A3393 5-Trifluoromethoxyindirubin-3-methoxime H OCF.sub.3 H H NOCH.sub.3 45 A2942 6-Methylindirubin H H CH.sub.3 H O 46 A2943 6-Methylindirubin-3-oxime H H CH.sub.3 H NOH 47 A2944 6-Methylindirubin-3-methoxime H H CH.sub.3 H NOCH.sub.3 48 A2852 6-Methyl-5-nitroindirubin H NO.sub.2 CH.sub.3 H O 49 A3336 6-Methyl-5-nitroindirubin-3-oxime H NO.sub.2 CH.sub.3 H NOH 50 A3337 6-Methyl-5-nitroindirubin-3-methoxime H NO.sub.2 CH.sub.3 H NOCH.sub.3 51 A2802 6-Nitro-5-Trifluoromethoxyindirubin H OCF.sub.3 NO.sub.2 H O 52 A2801 6-Nitro-5-trifluoromethoxyindirubin-3-oxime H OCF.sub.3 NO.sub.2 H NOH 53 A2794 6-Nitro-5-trifluoromethoxyindirubin-3-methoxime H OCF.sub.3 NO.sub.2 H NOCH.sub.3 54 A3307 Indirubin-7-carboxylic acid H H H COOH O 55 A3309 Indirubin-7-carboxylic acid-3-oxime H H H COOH NOH 56 A3308 7-Trifluoromethylindirubin H H H CF.sub.3 O 57 A3310 7-Trifluoromethylindirubin-3-oxime H H H CF.sub.3 NOH 58 A3311 4-Bromoindirubin Br H H H O 59 A2783 4-Bromoindirubin-3-oxime Br H H H NOH 60 A3312 4-Chloroindirubin H H H H O C: control
TABLE-US-00007 TABLE 6 List of chemically synthesized compounds shown to at least partially inhibit the activity of CXXC5-DVL No. Compound # IUPAC Name 3 moiety 1 A4664 5-Fluoroindirubin O 2 A4665 5-Fluoroindirubin-3-oxime NOH 3 A4666 6-Bromoindirubin O 4 A4667 6-Bromoindirubin-3-oxime NOH
[0376] Clinical characteristics of metabolic diseases including insulin resistance and obesity are related to complex interrelated pathological progressions. Understanding the molecular mechanism of the overall pathogenesis could provide a strategy for reversing the metabolic diseases. The Wnt/-catenin pathway plays a role in the pathological process, and its response genes can be used as therapeutic targets for the metabolic diseases. CXXC5-type zinc finger protein 5 (CXXC5), a negative regulator of the Wnt/-catenin pathway functioning via Dishevelled (Dvl) binding. As provided herein, the functional role of CXXC5 in metabolic diseases and the relationship between CXXC5 and Wnt/-catenin signaling were investigated in human adipose tissue and a mouse model. CXXC5 is highly expressed in visceral adipose tissues of obese-diabetes patient tissues. Cxxc5S mice fed a high-fat diet were abrogated hyperglycemia, inflammation, gluconeogenesis, lipogenesis, or insulin resistance. These results provided herein suggest CXXC5 as a therapeutic target for treatment of obesity-related diabetes. A small molecule inhibiting the CXXC5-Dvl interaction restored the metabolic phenotypes as observed in HFD-fed Cxxc5.sup./ mice. Administration of at least one of compounds and/or compositions described herein lowered the fasting blood glucose level of HFD-fed mice. Different from sitagliptin or metformin, the glucose controlling effect persisted for weeks. These long-lasting effects correlated with adipose tissue remodeling in adaptive energy homeostasis accompanying improvement of insulin resistance and inflammation. In addition, in a late stage of diabetes, the compounds and/or compositions described herein contributed to the regeneration of both mass and functions of pancreatic -cells. Overall, inhibition of CXXC5 activity by a small molecule-mediated interference of Dvl binding can be a potential therapeutic approach for the treatment of metabolic diseases including obesity and diabetes.
[0377] Elevated CXXC5 levels in visceral fat tissues from obese diabetic patients. The clinical implication of the functional roles of CXXC5 in metabolic diseases and the relationship between CXXC5 and Wnt/-catenin signaling was investigated in human adipose tissues. Referring to
[0378] Cxxc5.sup./ mice resists diet-induced obesity and metabolic diseases. Referring to
[0379] HFD-induced obesity did not occur in Cxxc5.sup./ mice (
[0380] Ablation of Cxxc5 attenuates adipocyte hypertrophy and improves hepatic glucose homeostasis in HFD-fed mice. HFD-fed Cxxc5.sup./ mice had smaller adipocytes compared to HFD-fed Cxxc5.sup.+/+ mice (
[0381] A3334, a small molecule inhibits CXXC5-Dvl interaction, inhibits HFD-induced metabolic diseases with a long-lasting glucose controlling effect. To test whether the blockade of CXXC5, especially its Dvl binding function, restored Wnt/-catenin signaling and exerted anti-diabetes properties, we used a small molecule obtained by the in vitro screening system to monitor the interaction between the PDZ domain of Dvl and the protein transduction domain-fused Dvl binding motif peptide (PTD-DBMP). The small molecules inhibiting CXXC5-Dvl protein-protein interaction (PPI) were obtained by initial screening of a small-molecule library composed of 5,000 compounds. Several of the candidates that were used in the study were obtained by selection from 60 chemically synthesized analogs of indirubin 3-oxime, a PTD-DBMP PPI inhibiting compound that was screened two times at the initial screening (see supra). Among the positive candidates, 5-methoxyindirubin-3-oxime (A3334) (
[0382] To investigate the systemic effects of the CXXC5-Dvl PPI inhibitor, A3334 (25 mg kg.sup.1), sitagliptin (50 mg kg.sup.1), or metformin (100 mg kg.sup.1) was orally administered daily for 5 days at weeks 8 and 12 on HFD mice (
[0383] A3334 reduces inflammation and increases lipolysis in the epiWAT of HFD-fed mice. Referring now to
[0384] A3334 reduces hepatic steatosis and improves glucose homeostasis. Referring now to
[0385] A3334 promotes energy expenditure through the enhancement of thermogenic activity of brown- and beige-fat tissues. Referring now to
[0386] A3334 reverses diabetes phenotypes and promotes pancreatic -cell regeneration in HFD and streptozotocin (STZ)-treated diabetic mice. Referring now to
[0387] As disclosed herein, an approach was provided for improving overall metabolic disease phenotypes by utilizing the obese-diabetes model related to inflammation, steatosis, gluconeogenesis, lipogenesis, energy metabolism, and -cell dysfunction. Illustrating the role of Cxxc5 in inhibiting the Wnt/-catenin pathway related to metabolic diseases and a small molecule-mediated interference of the Cxxc5 function, an unexpected long-lasting glucose controlling effect was identified, which might lead to improvement of metabolic diseases in general.
[0388] Diabetes is one of the major metabolic diseases and the current clinically available drugs including sulfonylureas, SGLT2 inhibitors, PPAR agonists, DPP4 inhibitors, and biguanides can control blood glucose levels by acting on peripheral insulin target tissues such as the pancreas, intestine, muscle, and liver. The glucose controlling effect of these drugs is acquired by different mechanisms and is transient; thus, patients need to be prescribed these drugs throughout their lifetimes.
[0389] One example of drug candidates, A3334, which restores the suppressed Wnt/-catenin pathway in the diet-induced obesity and diabetes models, showed an initial temporal effect similar to that of the major anti-diabetes drugs, the DPP4 inhibitor sitagliptin and the biguanide medication metformin. Sitagliptin and metformin showed an increased fasting glucose level after their second application, whereas A3334 revealed an unexpected long-lasting glucose controlling effect in HFD-fed mice. Notably, the fasting glucose level persisted for over 4 weeks after the second application. Without bound by any theory, these long-lasting effects of A3334 on glucose control could be acquired by adipose tissue remodeling, which inhibits the initial event of metabolic diseases, accompanying the suppression of inflammation, insulin resistance, and FFA and adipokine production with body weight loss of the HFD-fed mice. In accordance with the differences, the systemic immune effect or direct effect on macrophages during adipocyte hypertrophy in HFD-fed mice did not occur by administration of the peripheral tissue targeting drug, sitagliptin. The metabolic improvement effects of A3334-treated mice were acquired by the induction of metabolic genes including Tcf7l2, Wisp1, c-Myc, Ccnd1, and Ppar by the activation of Wnt/-catenin signaling via blockade of the CXXC5-Dvl interaction by the negative feedback mechanism. The pathological significance of the blockade of CXXC5-Dvl PPI was shown by the high induction of CXXC5 in obese-diabetes patients and its reverse correlation with -catenin, which controls the major metabolic genes such as TCL7L2, WISP1, c-MYC, CCND1, and PPAR. The role of CXXC5 in the suppression of Wnt/-catenin signaling and metabolic disease was correlated with high induction and its correlation with inflammation markers in the cytosol of adipocyte cells of obese-diabetes patients as well as the HFD-induced obese-diabetes mice. In the present disclosure, the role of CXXC5 as a target for metabolic diseases was confirmed by observing the suppression of HFD-induced obesity with the repression of cytosolic Cxxc5 and inflammation markers with the activation of -catenin in adipocytes. CXXC5-Dvl PPI was found to be a target for the improvement of metabolic diseases with similar phenotypes showing systemic improvement of metabolic abnormalities in both Cxxc5 and A3334-treated Cxxc5.sup.+/+ mice fed the HFD. One of the effects of restoring the suppressed Wnt/-catenin signaling by A3334 was the enhancement of energy metabolism, as shown by enhanced energy expenditure in the A3334-treated mice fed the HFD. Enhanced energy expenditure by the A3334-treated mice was also consistent with a substantial upregulation in the expression of genes that regulate thermogenesis and mitochondrial biogenesis in both scWAT and BAT. Furthermore, ectopic expression of UCP1 in scWAT from A3334-treated mice was linked to protecting diet-induced obesity by increased fatty acid oxidation of scWAT.
[0390] The instant approach of activating Wnt/-catenin signaling via the inhibition of Dvl binding function of CXXC5 could be highly advantageous owing to its potential usage in multiple metabolic diseases including obesity, diabetes, and potentially nonalcoholic steatohepatitis. The small molecules that targeted CXXC5-Dvl could be specific to the increased CXXC5 level of the diseases as proven by no observation of metabolic disease phenotypes after A3334 administration for the NCD-fed mice, which did not induce CXXC5 (
[0391] As disclosed herein, CXXC5 overexpression plays a role as a major driver in the pathogenesis of multiple obese-related metabolic diseases. An approach for restoring the suppressed Wnt/-catenin signaling via blockade of CXXC5-Dvl interaction is a therapeutic approach for the treatment of multiple metabolic diseases induced by CXXC5. Orally administered A3334, which can restore the multiple metabolic disease phenotypes, provides a novel approach for treating chronic metabolic diseases.
The Involvement of CXXC5 in Metabolic Diseases and NASH
[0392] As disclosed herein, CXXC5 expression were progressively increased in the white adipocytes and the liver tissues of patients diagnosed with NASH and diabetes. Further, Wnt/-catenin pathway target genes such as TCF7L2, and FOSL1 were found to be suppressed in patients diagnosed with NASH and/or Type II diabetes. Cxxc5.sup./ mice did not develop any phenotypes of metabolic diseases including obesity, diabetes, and/or NASH. The results disclosed herein suggest that CXXC5 contributes to the development of metabolic diseases. Thus, the instant disclosure provides a novel function of CXXC5-DVL interface that may lead to the treatment of metabolic diseases including, but are not limited to, obesity, diabetes, and/or NASH.
[0393] Gene set enrichment analysis (GSEA) and heat map gene expression analyses. The gene expression profile results were obtained by analyses of the data deposited in NCBI's Gene Expression Omnibus database (GEO) (http://www.ncbi.nlm.nih.gov/geo/), and NASH and Type II diabetes data are accessible through GEO accession numbers GSE16415 and GSE48452, respectively.
[0394] Animals and diets. Cxxc5.sup./ mice were established in a previous study. See e.g., Kim H. Y. et al. (2015), CXXC5 is a negative-feedback regulator of the Wnt/beta-catenin pathway involved in osteoblast differentiation. C
[0395] NASH study. Eight-week-old wild-type male C57BL/6N mice (KOATECH, Seoul, Korea) were fed on the methionine-choline deficient (MCD) diet for 7 weeks, followed by treatment with vehicle, A3334, A3051, or I3O of (25 mg kg.sup.1) sitagliptin (25 mg kg.sup.1) for another 3 weeks via daily oral gavage.
[0396] Obesity-induced diabetes study. Six-week-old wild-type male C57BL/6N mice were fed a HFD consisting of 60% calories (Research Diet, D12492) for 8 weeks. After then, each mouse administered on average A3334 (25 mg kg.sup.1) or sitagliptin (50 mg kg.sup.1) per day by oral gavage for 5 days on HFD. After removal of the drugs, mice were maintained on a HFD for 2 weeks. All animal protocols were approved by the Institutional Review Board of Severance Hospital, Yonsei University College of Medicine.
[0397] Immunohistochemistry. Paraffin-embedded tissue sections (4 m each) were deparaffinized and rehydrated. For antigen retrieval, the slides were autoclaved in 10 mM sodium citrate buffer (pH 6.0). Sections were blocked in PBS containing 10% BSA at room temperature for 30 min. The sections were incubated overnight at 4 C. with the following dilution of primary antibodies: anti--catenin (1:100; BD), anti-CXXC5 (1:50; Santa Cruz Biotechnology, Inc.), anti-F4/80 (1:100; Cell Signaling Technology), anti-CD11b (1:100; eBioscience), anti-PCNA (1:100; Santa Cruz Biotechnology, Inc.), anti-insulin (1:1,000; Sigma-Aldrich), and anti-glucagon (1:2,000; Sigma-Aldrich). The slides were washed with PBS, incubated with Alexa Fluor 488- or Alexa Fluor 555-conjugated IgG secondary antibody (1:300; Molecular Probes) at room temperature for 1 h, and counterstained with DAPI (1:5,000; Boehringer Mannheim).
[0398] The images were captured using a LSM700 META confocal microscope (Carl Zeiss) after excitation with 405-, 488-, or 543-nm laser lines. To block endogenous peroxidase activity before peroxidase IHC analysis, tissues were incubated with 0.345% H.sub.2O.sub.2(Samchum Chemicals) for 30 min. Before incubating sections with mouse primary antibody, mouse IgG was blocked using a M.O.M Mouse IgG blocking kit (Vector Laboratories). Sections were incubated with primary antibody overnight at 4 C. with the following dilution of primary antibodies: anti--catenin (1:100), anti-CXXC5 (1:50), anti-IRS1 (1:100; Santa Cruz Biotechnology, Inc.), anti-UCP1 (1:500; Abcam), anti-Glut4 (1:100; Cell Signaling Technology), anti-PPAR (1:100; Santa Cruz Biotechnology, Inc.), anti-fibronectin (1:100; Abam), and anti--SMA (1:100; Abcam). Then, sections were incubated with biotinylated anti-mouse (1:300; Dako) or biotinylated anti-rabbit (1:300; Dako) secondary antibodies for 1 h at room temperature. The samples were stained with 3, 3-diaminobenzidine (DAB; Dako) for 3-7 min and counter stained with Mayer's hematoxylin (Muto). All incubations were conducted in humid chambers. Signals were analyzed using a bright field microscope (Nikon TE-2000U). -Cell mass from the insulin antibody-stained and -cell mass from the glucagon antibody-stained sections were visualized using a LSM700 META confocal microscope (Carl Zeiss).
[0399] Immunoblot analysis. Cells and tissues were lysed using radio-immunoprecipitation assay (RIPA) buffer (150 mM NaCl, 10 mM Tris, pH I7.2, 0.1% SDS, 1.0% Triton X-100, 1% sodium deoxycholate, and 5 mM EDTA). Samples were separated on 6-12% SDS polyacrylamide gels and transferred onto PROTRAN nitrocellulose membranes (Shleicher and Schuell Co.). After blocking with PBS containing 5% nonfat dry skim milk and 0.07% (vol/vol) Tween 20, the membranes were incubated with antibody specific for -catenin (1:1,000; Santa Cruz Biotechnology, Inc.), CXXC5 (1:1,000), Erk (1:5,000; Santa Cruz Biotechnology, Inc.) at 4 C. overnight. Horseradish peroxidase-conjugated anti-mouse (Cell Signaling) and anti-rabbit (Bio-Rad, Hercules, CA) secondary antibodies were used at 1:3,000 dilutions for 1 hour at room temperature. Protein bands were visualized with enhanced chemiluminescence (Anersham Bioscience, Buckinghamshire, UK) using a luminescent image analyzer (LAS-3000; Fujifilm, Tokyo, Japan).
[0400] Hematoxylin and eosin (H&E) staining. Dissected tissues were fixed in 4% neutral paraformaldehyde and embedded in paraffin. The paraffin sections were cut at a thickness of 4 m and subjected to the H&E staining. Adipocyte cell size was measured in seven randomly chosen microscopic areas from three independent animals using a Nikon bright-field optical microscope (Nikon TE-2000U, Tokyo, Japan). The average adipocyte size was determined using Image J Software.
[0401] Reverse transcription and quantitative real-time PCR. Total RNA was extracted using Trizol reagent (Invitrogen) according to the manufacturer's instructions. 2 g of RNA was reverse-transcribed using 200 units of reverse transcriptase (Invitrogen) in a 40-l reaction carried out at 37 C. for 1 h. For conventional PCR analyses, the resulting cDNA (2 L) was amplified in a 20 l reaction mixture containing 10 nM dNTP (Takara, Shiga, Japan), 10 pmol of the primer set (Bioneer, Daejeon, Korea), and 1 unit of Taq DNA polymerase (Invitrogen). For quantitative real-time PCR analyses (qRT-PCR), the resulting cDNA (1 l) was amplified in 10 l reaction mixture containing iQ SYBR Green Supermix (Qiagen, Germantown, MD), 10 pmol of the primer set (Bioneer). The comparative cycle-threshold (CT) method was used, and GAPDH served as an endogenous control. The primer sets are listed in Table 1.
[0402] Blood chemistry/Enzyme-linked immunosorbent assay (ELISA). Whole blood of mice was collected by cardiac puncture. The blood was allowed to clot for 30 min and then centrifuged for 10 min at 1,000g to obtain supernatant. The supernatant was subjected to measure metabolic parameters. Plasma insulin concentration was measured with an ELISA kit (Millipore). FFA concentrations in plasma were measured with an ELISA kit (Cayman Chemical), respectively. Serum chemistry variables included total cholesterol, HDL-cholesterol, glucose, triglyceride, ALT, AST, ALP, Ca.sup.++, and Mg.sup.++ concentration. Calibration was done using the quality control (QC) card supplied with the FUJI DRI-CHEM slides whenever slides from a new lot were used.
[0403] Adipokine-related protein analysis. Adipokines and hormones in mouse serum were measured using Mouse adipokine array kits (Proteome Profiler and Human Cytokine; R&D System). These assays were used to simultaneously detect the relative expression levels of 38 different obesity-related proteins. The array analysis was performed according to the manufacture's instructions. Blots were developed with enhanced chemiluminescence using a luminescent image analyzer, LAS-3000 (Fujifilm). All of data were normalized by intensity of reference spots in each membrane, as followed by manufacture's instruction.
[0404] Glucose tolerance, insulin tolerance tests, HOMA-IR analyses. For glucose tolerance tests (GTTs) or insulin tolerance tests (ITTs), mice were injected with D-glucose (1.5 g/kg body weight) after overnight starvation or human insulin (0.75 units/kg body weight) after 4 h starvation. Tail blood was drawn at indicated time intervals, and blood glucose level was measured with a One Touch Ultra glucometer (LifeScan). Insulin function test was evaluated by HOMA-IR and was calculated as fasting plasma glucose (mmol/l)fasting serum insulin (mU/l)/22.5.
[0405] -Cell and -cell mass analyses. All of the -cell, -cell and the cross-sectional area of all pancreatic tissue were quantified. Total -cell and -cell area and total pancreas mass for each animal was calculated as the sum of the determinations from each of the 8-10 segments of pancreas. A total of 10-15 beta cells was counted for each pancreas.
[0406] ORO staining. 3T3-L1 preadipocytes were seeded in a 6-well plate at a density of 310.sup.4 cells per well. After reaching confluence, the cells were induced to differentiate as described above. At 14 days post differentiation, the plates were washed with PBS and stained with ORO overnight. In the morning each well was washed thoroughly with water and images of the ORO staining were recorded with a Nikon bright-field optical microscope (Nikon TE-2000U, Tokyo, Japan) and quantified for further statistical analysis. For quantify lipid contents, the ORO was eluted by addition of 500 l isopropanol containing 4% nonidet P-40 to each well and the absorbance was measured spectrophotometrically at 590 nm.
[0407] Collagen staining. 4 m-liver tissues sections were stained using two common collagen staining methods. For Masson's trichrome staining, slides were fixed in Bouin's solution for 1 h. After incubation in Weigert's iron hematoxylin solution for 10 min, the slides were stained with Biebrich Scarlet-Acid Fuchsin and Aniline blue for 5 min. The collagen fibers were stained blue and the nuclei were stained black. For picrosirius red staining, sections were stained with Weigert's solution for 8 min and picrosirius red for 1 h. The collagen fibers were stained red with blue nuclei.
[0408] Nineteen compounds were selected as initial hits which suppress the CXXC5-DVL (PZD-DVL-PTD-DBMP (FITC) interaction more than 90%, and their capabilities of activation of the Wnt/-catenin pathway was confirmed by using the HEK293 cells harboring the pTOFOplash reporter in its chromosome. Among these compounds, indirubin analogs including BIO and I3O were identified. A summary of the high-throughput screening results is provided in Table 2. As disclosed herein, indirubin analog compounds (#8 and #12; Table 3) were repeatedly identified as CXXC5-DVL inhibitors and showed effectiveness in the activation of Wnt/-catenin pathway using reporter assay. To obtain functionally improved compound, about 60 indirubin derivatives were newly synthesized by replacing the functional groups at the R.sub.1 and R.sub.2 sites of the indirubin backbone based on the structure of indribin-3-oxim (I3O) (#12; Table 3). Newly synthesized indirubin derivatives are described in Tables 4-6 and the structures of these compounds are shown
[0409] Wnt/-catenin signaling reporter luciferase assay. HEK293-TOP cells were seeded were seeded in 96-well plates at a density of 2.510.sup.4 cells per well. Cells were treated with individual chemicals at a concentration of 1, 5, 10 M for 24 h. Total cell lysates were extracted with 25 l of 5 Reporter Lysis Buffer per well according to the manufacturer's instruction (Promega, Madison, WI). Luciferin (25 l) was added and luciferase activity was measured using FLUOSTAR (BMG labtech, Offenburg, Germany).
[0410] In vitro screening of compounds that induce adipocyte differentiation of 3T3-L1 preadipocytes. 3T3-L1 preadipocyte cells were seeded in six-well plates at a density of 310.sup.4 cells per well. The cells were grown in Dulbecco's modified Eagle medium (DMEM) with 10% bovine calf serum (BCS; Gibco) until confluent. After confluence, cells were induced to differentiate in DMEM containing 10% fetal bovine serum (FBS; Gibco) and MDI (520 M methylisobutylxanthine (IBMX; Sigma-Aldrich), 1 M dexamethasone (Sigma-Aldrich) and 167 nM insulin (Gibco)) with or without small molecules. Each small molecule was used at a concentration of 10 M. On day 4, the medium was replaced with DMEM containing 10% FBS with or without I3O or A3334. The medium changed with fresh identical medium every 2 days to day 14 of post-induction. Cells were incubated at 37 C. in a 5% CO.sub.2 environment.
[0411] Cell viability assay. HEK293-TOP cells were seeded in 96-well plates at a density of 2.510.sup.4 cells per well and treated with the respective chemicals at a concentration of 20 M. After 24 h, 50 l Cell Titer (Promega) was added to each well and incubated for 10 min at room temperature (RT). The luciferase reporter assay was performed as described above.
[0412] In the instant disclosure, it was found that a negative feedback regulator of the Wnt/-catenin pathway, CXXC5, gradually increased with suppression of -catenin in white adipocytes and liver tissues of NASH and Type II diabetes patients (
[0413] CXXC5 overexpression as a biomarker for diagnosis of NASH and Type II diabetes patients. Referring now to
[0414] Referring now to
[0415] Phenotype of MCD-induced NASH mice and HFD-induced Type II diabetes mice. Referring now to
[0416] CXXC4, a structural and functional analog of CXXC5 that can also function as a negative regulator of Wnt/-catenin signaling, was not expressed in liver tissues of NASH and Type II patients (
[0417] To further define the role of CXXC5 in metabolic diseases, the effect of HFD in Cxxc5.sup.+/+ and Cxxc5.sup./ mice were assessed. Referring now to
[0418] Referring now to
[0419] In part due to the overexpression of CXXC5 observed in NASH patients and MCD-diet induced NASH mice (
[0420] The CXXC5-DVL Protein-Protein Interaction (PPI) as a Target for Development of 1.sup.st-In-Class Drugs for Treating NASH and/or Type II Diabetes Patients.
[0421] CXXC5 overexpression in human liver or adipocyte tissues of obesity, diabetes, and/or NASH patients, and the effect HFD in Cxxc5.sup./ mice disclosed herein provide that CXXC5 can be a target for treating metabolic diseases. As disclosed herein, inhibition of the CXXC5-DVL interface can provide selective and/or specific activation of Wnt/-catenin pathway in a subject having or diagnosed with at least one metabolic diseases including, but are not limited to, obesity, diabetes, and/or NASH. This is further supported by the fact that CXXC4, a CXXC5 analog which can also function as a negative regulator of Wnt/-catenin pathway, was not overexpressed in NASH and/or Type II diabetes patients. In addition, targeting cytosolic CXXC5, which functions via the interaction with DVL, can provide additional benefits as this approach will likely reduce any undesirable side effects that can rise from targeting nuclear CXXC5. Studies have reported that nuclear CXXC5 can activate or induce genes such as Flk-1 and/or myelin genes (Kim et al., 2014; Kim et al., 2016).
[0422] CXXC5 can function as a negative regulator of Wnt/-catenin pathway by binding to DVL. A protein transduction domain fused DVL binding motif peptide (PTD-DBMP), which interferes with the CXXC5-DVL interaction were developed (Kim et al., 2015). To identify small molecules that mimic the function of the PTD-DBMP and inhibit or reduce the activity of the CXXC5-DVL interface, 2,280 compounds were screened from chemical libraries (1,000 from ChemDiv and 1,280 from SigmaLOPAC) with an in vitro assay system that monitors the CXXC5-DVL interaction (Kim et al, 2016) (
[0423] Indirubin analog compounds (#8 and #12; Table 3) were repeatedly identified as CXXC5-DVL inhibitors and showed effectiveness in the activation of Wnt/-catenin pathway using reporter assay. To obtain functionally improved compound(s), about 60 indirubin derivatives were newly synthesized by replacing the functional groups at the R.sub.1 and R.sub.2 sites of the indirubin backbone based on the structure of indribin-3-oxim (I3O) (#12; Table 3). Newly synthesized indirubin derivatives are described in Tables 4-6 and their structures are shown
[0424] Characterization of the indirubin analogs. To select compounds that can control and/or treat metabolic diseases by the activation of the Wnt/-catenin signaling through CXXC5-DVL PPI inhibition, following tests were performed; 1) in vitro CXXC5-DVL PPI inhibition assay; 2) cell-based assays monitoring the Wnt/-catenin signaling through the pTOFPPLASH reporter system; and 3) an adipocyte differentiation assay using 3T3L1 pre-adipocyte cells.
[0425] Referring now to
[0426] Referring now to
[0427] Functional characterization of candidate compounds. The efficacy of representative compounds (e.g., A3334, A3051, and I3O) were investigated in the improvement of metabolic diseases including obesity, diabetes, NASH.
[0428] Anti-obesity effects of A3334, a small molecule CXXC5-DVL PPI inhibitor. Referring now to
[0429] Referring now to
[0430] No effect of A3334 on mice fed with normal diet. To evaluate whether the A3334 treatment would have any effect on normal diet fed mice, C57BL/6N mice were fed normal diet for 16 weeks with or without oral administration of 25 mpk A3334. As shown in
[0431] Anti-diabetic effects by A3334, a small molecule CXXC5-DVL PPI inhibitor. Referring now to
[0432] A3334 improved the HFD-induced major diabetes phenotypes (e.g., inflammation, insulin resistance, -cell destruction with fast fasting glucose reduction, and long-term effect). A3334 also showed advantageous effects compared to RSG including suppression of the HFD-induced ALT/AST and GTT/ITT enhancement in blood, suppression of weight gain, as well as anti-inflammatory effects. Referring now to
[0433] Referring now to
[0434] Referring now to
[0435] A3334 suppressed diabetes induced by multiple low-dose STZ-induced diabetes. Referring now to
[0436] Effects of A3334, a small molecule CXXC5-DVL PPI inhibitor, on NASH mice model. For a NASH study, eight-week-old wild-type male C57BL/6N mice were fed with the methionine-choline deficient (MCD) diet for 7 weeks, followed by treatment with vehicle, A3334, A3051, indirubin 3-oxim (I3O) of (25 mg kg.sup.1) sitagliptin (25 mg kg.sup.1) for another 3 weeks via daily oral gavage. Referring now to
[0437] Referring now to
[0438] A3334 improved metabolic disease markers induced by HFD. C57BL/6N mice were induced diabetes by HFD for 8 weeks, and then treated with A3334 (25 mpk) once per day for 5 days starting at week 9 and at week 12 under HFD condition. Animals were sacrificed at week 16. Referring now to
[0439] A3334 improved diabetic phenotypes induced by HFD. Referring now to
[0440] Referring now to
[0441] Referring now to
[0442] Referring now to
[0443] Considering the roles of the Wnt/-catenin signaling in stem cell activation and the involvement of its aberrant activation in human cancers, drugs targeting Wnt/-catenin pathway can face potential side effects including cancer. However, these side effects will likely be avoided as the instant approach provides methods of inhibiting or reducing the CXXC5-mediated negative feedback loop rather than targeting direct activation of Wnt/-catenin pathway. Potential problems of developing cancer by direct activation of Wnt/-catenin signaling may not be a critical issue when using the methods disclosed herein. This was validated by absence of any cancerous phenotype in various organs of CXXC5.sup./ mice which were grown more than 2 years. In addition, topical application of the peptide(s) interfering the CXXC5-DVL interface onto the skin of the mice did not result in any aberrant phenotypes (data not shown). Further, the addition of these peptide(s) did not have any effect on transformation or the DMBA/TPA-induced skin carcinogenesis (data not shown). The approach of targeting a negative feedback regulation in a drug discovery is also supported by the development of drugs targeting sclerostin (encoded by SOST gene), another negative feedback regulator of the Wnt/-catenin pathway that functions by binding to LGP5/6 co-receptor.
Emulsion Solution
[0444] To determine emulsion solution, solubility of A3334, for example, is measured in the several oil and surfactants. A3334 is mixed with oil or surfactants (1 ml) and vortexed for 30 min. The equilibrium state was reached by shaking for 72 hours at 37 C. with 50 rpm speed in an incubator, then centrifuged at 16,100g for 5 min. The supernatant was diluted with methanol and analyzed by LC/MS/MS (see e.g., Table 7).
[0445] Waters xevo TQ MS-ACQUITY UPLC System is used as an analyses equipment. ACQUITY UPLC BEH(C18, 1.7 m, 2.150 mm) column was used for analyses at room temperature. Mobile phase is used after filtration of deionized distilled water including 0.1% formic acid and acetonitrile including 0.1% formic acid (30:70, v/v) with 0.2 l membrane filter. The flow rate is 0.25 ml/min and it is analyzed by injection of 0.5 l sample. There are LC/MS/MS conditions for Decursin analysis; Cone 38 V, Collison 32 V. Precursor ion and daughter ion are monitored 329 and 229 m/z, respectively.
TABLE-US-00008 TABLE 7 Solubility of A3334 in various type of oil or surfactants Type Type Solubility (mg/ml) Oil Olive oil 0.83 Sunflower oil 1.35 KOLLIPHOR EL 5.4 Surfactants Tween 20 4.58 Tween 80 4.92 Co-Surfactant Transcutor P 1.15 Propylene glycol 0.25 PEG 400 3.1
[0446] As shown
Ternary Diagram Analysis
[0447] Based on solubility experiment results, KOLLIPHOR EL was selected as an oil phase for emulsions and mixture of Tween 80 and PEG 400 are selected as surfactants. To confirm area of emulsion forming range, ternary phase diagram was completed by using H.sub.2O titration method the room temperature. Surfactant mixtures were prepared by mixing surfactant Tween 80 and PEG 400 at each 1:1, 2:1 and 1:2 ratio. And, emulsion solution was made by mixing surfactant at a various ratio (0.5:9.5, 1:9. 2:8, 3:7, 4:6, 5:5, 6:4, 7:3, 8:2, 9:1, 9.5:0.5) with oil phase, KOLLIPHOR EL. While stirring above mentioned emulsion solution and loading water with a 1 ml/min rate of speed, area maintaining uniformly mixed state observed with naked eye is marked in the phase diagram and above ternary diagrams are presented
[0448]
[0449] Referring now to
[0450] Emulsion solution is manufactured with surfactant, polyethylene glycol and oil selected in various ratios, 10:30:60 or 90:3:7 (Table 7). To manufacture emulsion including active ingredient on the present disclosure, emulsion was manufactured by adding active ingredient (e.g., A3334) to make final 10% weight concentration for the total weight of entire composition and stirred overnight. (For example, if weight of total composition is 100 g, then 20 g of A3334 was mixed with above mentioned emulsion solution, 80 g)
[0451] The solubilizer Cyclodextrin can be included in the above mentioned composition. Indirubin derivative (active ingredient) (100 part by weight) with cyclodextrin (100 part by weight) was used in this experiment to increase solubilization of indirubin derivative, A3334.
TABLE-US-00009 TABLE 8 Formulations F1-F9 Emulsion solution(Kollipore Droplet Zeta- EL:Tween 80:PEG400) Solubility size potential class Part by weight (mg/ml) (nm) Viscosity (mV) F1 10:30:60 2.99 1525.7 23.33 5.14 F2 20:26:54 3.58 921.3 44.46 6.87 F3 30:23:47 3.81 624.9 59.12 7.23 F4 40:20:40 4.11 479.4 65.07 6.94 F5 50:16:34 5.67 332.3 72.72 7.99 F6 60:13:27 6.86 264.9 88.85 9.72 F7 70:10:20 7.59 183.8 91.39 10.83 F8 80:6:14 7.69 41.5 98.9 20.38 F9 90:3:7 6.88 29.3 99.52 20.99
[0452] Emulsion solution manufactured reveals as opaque red colored as seen by naked eyes. Above mentioned solubility, droplet size, viscosity, zeta potential for above mentioned emulsion solutions are analyzed and presented in Table 8.
[0453] As shown on Table 8, droplet size decreased as oil contents increased and it is identified that all of them have appropriate physical properties to use for pharmaceutical or cosmetic compositions. However, Formulation F8 exhibited the most desirable size, viscosity, zeta-potential and solubility.
Assessment for Safety Evaluation of the Formulation for the Emulsion Solution
[0454] To confirm stability of manufactured emulsion solution, F8, F10-F12 emulsion solutions were made with a composition in Table 9. Stability of above mentioned emulsion solutions are measured based on relative solubility (%) change at the low temperature (4 C.) and room temperature (25 C.). Relative solubility (%) are recorded up to 3 months and presented in
[0455]
[0456] As shown in the
Assessment of Stability of Emulsion Solution
[0457] F8 and F10-F12 emulsion formulations were manufactured with composition of above mentioned Table 9 to confirm whether activity of active ingredient of indirubin derivative, A3334, is remained stable in the emulsion formulation. Relative Wnt reporter activity (%) within 3 months from manufacture can be seen
[0458] As shown in
TABLE-US-00010 TABLE 9 Formulations F8, F10, F11, and F12. Active ingredient Indirubin Solubilizer derivative of (2-hydroxy- Class Emulsion solution embodiment 2 cyclodextrin) Aqua state DMSO Oil surfactants Polyethylene 12.5 g 12.5 g Distilled Control glycol water 100 g F8 Kollipore Tween 80 PEG400 12.5 g 12.5 g Distilled EL 80 g 6.7 g 13.3 g water 100 g F10 12.5 g 12.5 g Distilled water 100 g F11 Tween 80 12.5 g 12.5 g Distilled 100 g water 100 g F12 Kollipore 12.5 g 12.5 g Distilled EL 100 g water 100 g
[0459] Emulsions disclosed herein can include at least one agent comprising at least one compound according to any one of the first to the twenty fifth embodiments and/or at least one composition according to the twenty sixth embodiment. For the above mentioned emulsions, the mixing weight ratio of oil:surfactants:polyethylene glycol may be 0.3-30:1:2-2.5, and more preferably 10-20:1:2-2.5. The composition of the emulsion formulation can be determined by a pseudo three-phase diagram created in accordance with conventional methods for determining the composition of the emulsion system. Specifically, after thoroughly mixing in an oil phase (polyethoxylated castor oil (KolliphorEL)) and a surfactant (for example, a mixture of tween 80 and polyethylene glycol) in different weight ratios in a certain ratio range, a pseudo three-phase diagram can be created by adding water to each percentage of the oil and the surfactant mixture and marking the points corresponding to the emulsion forming regions. The emulsion region can be determined in the created pseudo three-phase diagram, and a specific composition among the compositions contained in the region can be selected to determine the composition of the emulsion formulation to dissolve the active ingredient. It is desirable that active ingredient be present in 1-20 weight % of the total weight of the composition. The active ingredient can include at least one compound according to any one of the first to the twenty fifth embodiments and/or at least one composition according to the twenty sixth embodiment.
[0460] Above mentioned surfactant is a twin-type nonionic surfactant and serves as an auxiliary solubilizer. In pharmaceuticals, it is used as an emulsifying agent or wetting agent in oral or parenteral formulations, and is also used as an additive in cosmetics and foods. It is also used as a substance for the inhibition of p-glycoprotein to increase the bioavailability of the drug. Tween series of surfactants include polyoxyethylene sorbitan monolaurate (Tween 20), polyoxyethylene sorbitan monopalmitate (Tween 40), polyoxyethylene sorbitan monostearate (Tween 60) and polyoxyethylene sorbitan oleate (Tween 80). However, the present disclosure is not limited thereto.
[0461] The polyethylene glycol is an amphoteric polymer which have hydrophilicity and hydrophobicity, and the polyethylene glycol is a liquid in the case of a low molecular weight but becomes a solid with an increase in molecular weight. The polyethylene glycol may be selected from the group consisting of PEG 150, 300, 400, 1000, 6000, 8000, 10000, 20000, 30000 and 40000. Here, the PEG 300 refers to polyethylene glycol having a molecular weight of 300, and the polyethylene glycol having a molecular weight exceeding 10,000 may be also referred to as polyethylene oxide (PEO). Of these, PEG 400 exists in the form of a liquid and is frequently used for the solubilization of various insoluble drugs.
[0462] As disclosed herein, emulsion formulations can include cyclodextrin for the higher solubilization. Cyclodextrin can be included with 100-1000 part by weight based on active ingredient 100 part by weight existing in the composition.
[0463] Above mentioned emulsion formulation is stable formulation that there is no change of Wnt activity and solubility in the distilled water at a temperature of 25 C. or 4 C. Therefore, it was confirmed that activity of the active ingredient can be maintained for a long period of time, and the absorption into the living body can be effectively improved.
[0464] Water was added to the emulsion formulation of the present disclosure and a microphotograph was taken. As a result, the emulsion of the present disclosure was completely dissolved to form an emulsion formulation (F8) in a solution state. Further, as a result of observing the stability of the emulsion of the present disclosure, it was found that the droplet was in a spherical shape, the average diameter was 20 to 1,500 nm and the preferable diameter was 30 to 50 nm to form nanosized droplets, indicating a narrow range of size distribution. Also, it is confirmed that there is no change in activity and solubility of active ingredients with maintenance of solubility for 3 months at room temperature.
[0465] While the novel technology has been illustrated and described in detail in the figures and foregoing description, the same is to be considered as illustrative and not restrictive in character, it being understood that only the preferred embodiments have been shown and described and that all changes and modifications that come within the spirit of the novel technology are desired to be protected. As well, while the novel technology was illustrated using specific examples, theoretical arguments, accounts, and illustrations, these illustrations and the accompanying discussion should by no means be interpreted as limiting the technology. All patents, patent applications, and references to texts, scientific treatises, publications, and the like referenced in this application are incorporated herein by reference in their entirety to the extent they are not inconsistent with the explicit teachings of this specification.