PROBE AND METHOD FOR STR-GENOTYPING

Abstract

The disclosure relates to the field of DNA-fingerprinting, e.g., in a forensic setting. More specifically, the disclosure discloses a method to genotype polymorphisms such as short tandem repeats, relying on the fluorescein-quenching properties of guanine. As such, the degree of complementary between an amplified DNA sample and a specifically designed probe, can be assessed by measuring fluorescence intensity of the fluorophore attached to the probe upon hybridization or melting. The probes and method of the disclosure are well-suited to be used in a portable, less-expensive DNA analysis device and can be applied in other fields than forensics, like food fraud, diagnostics and many others.

Claims

1. A plurality of probes representing the allelic variability of a certain short tandem repeat locus within a population consisting, wherein each probe consists, from 5′ to 3′ or from 3′ to 5′, of: 1) a first flanking region, which comprises nucleotides and which anneals with a region directly next to a specific DNA sequence of interest and which contains more nucleotides than a second flanking region, 2) the specific DNA sequence of interest, which comprises at least 1 short one short tandem repeat and which anneals with the short tandem repeat region within the sample, and 3) the second flanking region, which comprises at leastone nucleotide and which contains at least one fluorophore and wherein the fluorophore is attached to a residue of the second flanking region in the position directly complementary to a specific nucleotide capable of quenching the fluorophore in an efficient way of the sample, or linked to a nucleotide adjacent —either upstream or downstream- to the position or linked to a nucleotide two positions away — either upstream or downstream- of the position so that it is brought into close proximity of one or more specific nucleotides capable of quenching the fluorophore in an efficient way of the sample upon hybridization of the second flanking region within the sample.

2. The plurality of probes according to claim 1, wherein the fluorophore is attached to a cytosine residue of the second flanking region and wherein the specific nucleotide capable of quenching the sfluorophore in an efficient way is guanosine.

3. The plurality of probes according to claim 1 wherein the nucleotides are nucleic acid analogues.

4. The plurality of probes according to claim 1 wherein the fluorophore is selected from the group consisting of fluorescein (FAM), hexachlorofluorescein (HEX), tetrachloro-6-carboxyfluorescein (TET), 2,7-dimethoxy-4,5-dichloro-6-carboxyfluorescein (JOE) and 6-carboxytetramethylrhodamine (TAMRA).

5. The plurality of probes according to claim 1 which is immobilized on a support.

6. A method of using the plurality of probes of claim 1 to genotype short tandem repeats within a sample, the method comprising the steps of: providing a sample comprising DNA, amplifying DNA within said sample, which comprises a specific DNA sequence of interest in order to obtain amplified DNA sequences, adding the plurality of probes to the amplified DNA sequences to obtain duplexes of single stranded DNA sequences annealed to the probe, and denaturing the duplexes followed by slowly cooling the denatured duplexes while continually measuring fluorescence of the fluorophore of the probe, or, slowly heating the duplexes while continually measuring fluorescence of the fluorophore of the probe, wherein the decrease of fluorescence intensity or the increase in fluorescence intensity, respectively, provides information on whether or not a specific, completely complementary short tandem repeat is present in the sample.

7. The method according to claim 6, wherein the amplifying DNA within the sample is undertaken by an asymmetric PCR in order to obtain amplified, single stranded DNA sequences.

8. The method according to claim 7, wherein the amplifying DNA within the sample is undertaken by a symmetric PCR using biotin-labeled primers or a subsequent lambda exonuclease digestion in order to obtain amplified, single stranded DNA sequences.

9. The method according to claim 7, wherein the plurality of probes is added in solution or immobilized on a support.

10. A plurality of probes representing allelic variability of a certain short tandem repeat (STR) locus within a population, wherein each probe, from 5′ to 3′ or from 3′ to 5′, consists of: a first flanking region comprising nucleotides, which first flanking region anneals with a region directly next to a specific DNA sequence of interest, wherein the specific DNA sequence of interest comprises at least one STR, and wherein the specific DNA sequence of interest anneals with the certain STR locus within a sample, and a second flanking region comprising at least one nucleotide, wherein the second flanking region contains fewer nucleotides than the first flanking region, and wherein the second flanking region contains at least one fluorophore attached to a residue of the second flanking region, whereby, upon hybridization of the second flanking region within the sample, the at least one fluorophore is brought into close proximity of a specific nucleotide able to quench the fluorophore.

11. The plurality of probes of claim 10, wherein the fluorophore is attached to a cytosine residue of the second flanking region and wherein the specific nucleotide able to quench the fluorophore in an efficient way is guanosine.

12. The plurality of probes of claim 10, wherein the nucleotides are nucleic acid analogues.

13. The plurality of probes of claim 10, wherein the fluorophore is selected from the group consisting of fluorescein (FAM), hexachlorofluorescein (HEX), tetrachloro-6-carboxyfluorescein (TET), 2,7-dimethoxy-4,5-dichloro-6- carboxyfluorescein (JOE), and 6-carboxytetramethylrhodamine (TAMRA).

14. The plurality of probes of claim 10, wherein the plurality of probes is immobilized on a support.

15. A method of using the plurality of probes of claim 10 to genotype short tandem repeats (STRs) within a sample, the method comprising: amplifying DNA within a sample comprising a specific DNA sequence of interest in order to obtain amplified DNA sequences; adding the plurality of probes to the amplified DNA sequences in order to obtain duplexes of single stranded DNA sequences annealed to a probe; and denaturing the duplexes, followed by slowly cooling the denatured duplexes while continually measuring fluorescence of the fluorophore of the probe, or slowly heating the duplexes while continually measuring fluorescence of the fluorophore of the probe, wherein the decrease or increase of fluorescence intensity, respectively, identifies whether a specific, completely complementary STR is present in the sample.

16. The method according to claim 15, wherein amplifying DNA within the sample utilizes an asymmetric PCR in order to obtain amplified, single stranded DNA sequences.

17. The method according to claim 15, wherein the amplifying DNA within the sample is undertaken by a symmetric PCR using biotin-labeled primers or a subsequent lambda exonuclease digestion in order to obtain amplified, single stranded DNA sequences.

18. The method according to claim 15, wherein the plurality of probes is added in solution or is immobilized on a support.

19. The method according to claim 16, wherein the plurality of probes is added in solution or is immobilized on a support.

20. The method according to claim 17, wherein the plurality of probes is added in solution or is immobilized on a support.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0031] FIG. 1: STR genotyping example for the D16S539 locus. Three duplexes of probe (upper) and STR-amplicon (lower) are shown. Each amplicon contains twelve STR repeats, while the depicted probes contain eleven (SEQ ID NO: 5), twelve (SEQ ID NO: 6) or thirteen repeats (SEQ ID NO: 7) along with a complementary strand with the general sequence in SEQ ID NO: 27. The probes consist, from 5′ to 3′, of a FL1 region (black), a specific number of repeats (dark grey) and the F12 region containing one or more fluorophores (light grey). When the amplicon contains the exact equal number of repeats as the probe, the FL2 region will occur in a hybridized state, resulting in quenching of the fluorophore(s).

[0032] FIG. 2: Typical example of a melting experiment. Before melting, fluorescence decreases in a linear fashion, and probes are hybridized to an amplicon, with quenching of the fluorophore as a consequence. Upon melting, a sudden increase of fluorescence is observed due to the loss of the quenching effect of guanine. After melting, fluorescence again decreases in a linear fashion, and probes are single stranded.

[0033] FIG. 3: Melting curves of mismatch probes for the D8S1179 locus.

[0034] FIG. 4: Temperature profile for the D165539 experiment.

[0035] FIG. 5: Melting peaks of the probes designed for the D165539 locus after hybridization with a heterozygous sample (9:12).

[0036] FIG. 6: Melting peaks of the probes designed for the D16S539 locus after hybridization with a homozygous sample (9:9).

[0037] FIG. 7: Melting peaks of the probes designed for the D16S539 locus after hybridization with a heterozygous sample (11:13).

[0038] FIG. 8: Melting peaks of the probes designed for the TH01 locus after hybridization with a heterozygous sample (9.3:10).

[0039] FIG. 9: Melting peaks of the probes designed for the TH01 locus after hybridization with a homozygous sample (9.3:9.3).

[0040] FIG. 10: Melting peaks of the probes designed for the D8S1179 locus after hybridization with a heterozygous sample (13:13′).

[0041] FIG. 11: Melting peaks of the probes designed for the D8S1179 locus after hybridization with a heterozygous sample (14:15).

DETAILED DESCRIPTION

[0042] An aspect of this disclosure relates to probes whose functioning relies on the naturally occurring quenching properties of specific nucleotides on certain fluorophores. The most common example is the fluorescein-quenching effect of guanine [17, 18]. Another example is the quenching of pyrenebutyrate by thymidine nucleotides.

[0043] A probe is herein defined as a synthetically manufactured oligonucleotide wherein some nucleotides might be modified. Examples of modifications are e.g., the presence of a fluorescent moiety, molecules for attachment purposes, etc. Probes are generally designed in such a way that they will interact with the investigated molecule, and the response of the probe upon this interaction will be observed and used in order to obtain information of the investigated molecule.

[0044] STR genotyping probes described in this disclosure consist of three different regions, as shown in FIG. 1: flanking region 1 (FL1), the specific STR-region, and flanking region 2 (FL2). [0045] FL1 is the region directly next to the specific DNA sequence and acts as an anchor, ensuring proper annealing of the sample and the probe, preventing slippage. This implicates that FL1 should be significantly longer than FL2, a requirement that is also discussed in literature on other STR-genotyping probes [13]. If FL1 would be as long as or even shorter than FL2, FL1 would be single stranded in the case of mismatch, and FL2 would hybridize with the sample, thereby resulting in a signal comparable to the signal generated by a matching duplex. An extra functionality can be added at the terminus of FL1 for attachment purposes. [0046] The STR-region is the polymorphous part that differs between probes for a certain locus. A probe is designed for every possible allele of the examined locus. [0047] FL2 is substantially shorter than FL1 and is terminally labeled with a fluorophore, e.g., FAM. This labeling can be either 5′ or 3′ terminal. FL2 acts as a sensor, and gives an indication on the degree of complementarity between the probe and the sample.

[0048] The probe is designed in such a way that, upon hybridization with a complementary amplicon, the fluorophore is brought into proximity of one or more nucleotides capable of quenching the fluorophore. In a more specific embodiment of this disclosure, the fluorophore is FAM, which is quenched by the presence of guanine residues. These guanine residues also exert a quenching effect on other fluorophores, like HEX, TET, JOE and TAMRA [19]. Those skilled in the art will recognize that this is a non-limitative list. It should be noted that other combinations of fluorophores and nucleotides are also applicable for this purpose. In order to achieve efficient quenching of the FAM fluorophore, the fluorophore is linked to a nucleotide (mostly cytosine) in the position directly complementary to the guanine residue, or linked to a nucleotide adjacent to the position (either upstream or downstream) or linked to a nucleotide 2 positions away from the position (either upstream or downstream).

[0049] In the herein described method, an array of probes is designed, representing all possible alleles of a certain STR-locus. The difference between full complementarity and partial complementarity of an amplified sample and the probe can be assessed by measuring the fluorescence intensity of the fluorophore attached to the probe upon hybridization or melting. Resulting fluorescence graphs as a function of time can be divided in 3 parts (see FIG. 2): a linear part, during which the fluorescence decreases (temperature-dependent phenomenon) and (most of) the probes are hybridized to an amplicon, with quenching of the fluorophore as a consequence, the melting part during which the fluorescence increases, and a second linear phase where the probes are single stranded. Calculating the first derivative of these graphs as a function of temperature provides melting peaks used for interpretation of the data. After amplification, probe and amplicons are denatured by heating and thereafter cooled down slowly in a controlled fashion, ensuring correct hybridization by avoiding slippage of the probe. The probe-amplicon duplexes are thereafter melted, while fluorescence is measured constantly. Upon melting, the distance between the fluorophore and the quenching guanine residue will increase and the fluorescence intensity will increase. This increase in fluorescence intensity occurs at a higher temperature and is more pronounced when the probe and the amplicon present in the PCR product share the same repeat number, as compared to a mismatch combination of probe and amplicon. Still some dequenching can be observed upon melting in the event of a mismatch situation, due to the formation of hetero-duplexes. These duplexes contain a mismatch in the repeat region, resulting in the formation of a bulged loop. However, the melting temperature of these duplexes is lower as compared to full complementarity, and the hybridization efficiency is pronouncedly lower: for most probes, the sensor region will remain single stranded.

[0050] The herein described probes provide information on the degree of complementarity between probe and sample. Besides deducing whether or not probe and sample have the same number of repeats, information on the number of repeats differing between sample and probe can be obtained in the case of a mismatch. The bigger the difference in repeat number, the lower the obtained signal will be. An example is given in FIG. 4, for the D8S1179 locus. The melting curves of 4 probes are displayed, after incubation with reference sample 2800, which has alleles 14 and 15. All the shown melting curves originate from mismatch probes. It can clearly be seen that probe 13 shows the most intense signal, and probe 10 the less intense. Intensity of the signal can in this example be defined by the height of the melting peak and the melting temperature.

[0051] A unique feature of this disclosure is the considerable amount of information that can be retrieved from multiple parameters of these melting curves (Tm, peak shape, . . . ). Melting curves result in an indication of the degree of complementarity, whereas most systems solely give a binary answer (match or mismatch). The latter systems only look at one parameter, e.g., the melting temperature or the fluorescence intensity. The unique positioning of the fluorophore, in combination with the other structural elements of the probes, makes these STR-probes highly informative. The fluorophore is positioned in the second flanking region, thereby acting as a sensor: when the probe matches the sample, FL2 will hybridize to the sample. Whereas, when the probe does not match the sample, FL2 mainly remains single stranded, or melts at a lower temperature, and dequenching upon melting will occur less sudden. The bigger the distance between the fluorophore and the amplicon with quenching moieties, the less intense the signal will be. Therefore, the STR genotyping probe discussed herein is the most elementary and informative STR genotyping probe described yet, as both the melting temperature and the fluorescence intensity are informative.

[0052] This obtained information can eventually be analyzed in an automated way by means of artificial intelligence. Similar algorithms for high resolution melting analysis have already been described. A custom algorithm for allele calling could be developed in the future, based on a high amount of data. For this purpose, the algorithm should be trained for calling the correct alleles, based on the curves of samples with known alleles.

[0053] An important aspect for hybridization-based genotyping methods is the requirement of an excess of the amplicon complementary to the probe. If this requirement would not be met, both amplicon strands would hybridize preferentially to each other, leaving the probe single stranded. An excess of one amplicon strand can be obtained by adapting the amplification step. After sample preparation, an amplification step should be performed in order to amplify the STR-loci. This is typically done by means of the polymerase chain reaction (PCR), a technique well known to those skilled in the art. The region(s) being amplified are determined by the primers used. These are short oligonucleotides complementary to a sequence in the genome of the examined species. The DNA polymerase will initiate amplification at the 3′ terminus of the primer.

[0054] In symmetric PCR, both primers are added in equal concentrations, resulting in double stranded amplicons. When asymmetric PCR is performed, one primer is added in excess. In the first cycli, both primers are present and PCR occurs symmetric. At a certain point, one primer will be depleted, resulting in the amplification of only 1 of the 2 strands. From this point on, amplification will not occur exponentially but linear.

[0055] Asymmetric PCR is not the only way to obtain an excess of one specific strand. After performing symmetric PCR where one of both primers is labelled with biotin, the strands in which this primer is incorporated can be captured by means of streptavidin beads. Another option is the use of the lambda exonuclease enzyme, which selectively degrades phosphorylated DNA-strands. This modification can be introduced in 1 of the 2 primers. [20]

[0056] The probe, as described above, can also contain nucleic acid analogues, e.g., LNAs. The former are non-naturally occurring components that resemble structurally to the naturally occurring nucleic acids. Among many other examples are nucleic acids with a modified base, or a modification in the sugar component.

EXAMPLES

1. Example 1: STR—Genotyping Buccal Swabs (D16S539 Locus)

[0057] Three buccal swabs were immersed in a volume of 200 μL sterile HPLC-water. After a vortex-step of 30,” the swab was removed and the water was used as input for PCR. Singleplex asymmetric PCR was performed with 30 μL of input sample. Primer concentrations were 0.1 μM forward primer and 1.5 μM reverse primer. The volume of the PCR mixture was 50 μL containing MgC1.sup.2+ at a concentration of 0.5 mM, dNTPs at 200μM each, 1x Qiagen PCR buffer and 1.3U HotStarTaq enzyme. Activation of the polymerase was done by heating the PCR mix at 95° C. for 15 minutes followed by 60 cycles of 95° C. for 1 minute, 59° C. for 1 minute and 72°C. for 80 seconds. Primer sequences can be found in table 1.

[0058] After asymmetric PCR, aliquots of 8.5 μL amplified product were divided in a 96-Well plate. To each separate well, 1.5 μL of one particular probe was added at a starting concentration of 1 μM. These mixtures were denatured for 10 minutes at 95°C., followed by slowly cooling at a ramp rate of 0.04° C./s while fluorescence was continuously measured using a LightCycler (Roche). The same was done upon slowly heating, during this process duplexes will melt. Probe sequences can be found in table 1.

TABLE-US-00001 TABLE 1 Sequence of oligonucleotides used for the D16S539 experiment, ′n′ denotes the number of repeats and varied between 9 and 13. Name Sequence SEQ ID No D16S539 5′ GGGGGTCTAAGAGCTTGTAAAAAG SEQ ID NO: 1 Forward primer D16S539 5′ GTTTGTGTGTGCATCTGTAAGCATGTATC SEQ ID NO: 2 Reverse primer D16S539 Probe 5′ GTTTTGTCTTTCAATGA(TATC).sub.nCAC/36- SEQ ID NO:3 ( n= 9), 4 FAM/ (n = 10), SEQ ID NO: 5 (n = 11), SEQ ID NO: 6 (n = 12), SEQ ID NO: 7 (n = 13)

[0059] The first derivative of the melting curve is calculated, resulting in melting peaks. Differences in melting temperature due to a difference in length of the probe can be examined in this way. All examined samples were also genotyped with conventional CE-analysis as a reference.

2. Example 2: STR—Genotyping Buccal Swabs (TH01 Locus)

[0060] In order to assess the ability of this system to detect rather subtle differences in amplicon length, caused by partial repeats, a melting curve experiment using the probes designed for the TH01 locus was carried out. A quite common allele for this locus is the 9.3 allele, which is characterized by the presence of 10 repeats (CATT), of which the 4.sup.th repeat has a T-deletion. As a consequence, alleles 9.3 and 10 only differ one nucleotide in length, which has, even for CE, proven to be a challenge. Two buccal swabs were extracted, amplified and analyzed in the same way as the experiment for the D16S539 locus. As opposed to the amplification for the latter locus, forward primer was added in a concentration of 0.1 μM and the reverse primer was added in a concentration of 1.5μM. Sequence of primers and probes used can be found in table 2. Sample A has alleles 9.3 and 10; sample B is homozygous (9.3:9.3).

TABLE-US-00002 TABLE 2 Sequence of oligonucleotides used for the THOl experiment, ′n′ denotes the number of repeats and varied between 6 and 10. Name Sequence SEQ ID No TH01 Forward 5′ GTGATTCCCATTGGCCTGTTC SEQ ID NO: 8 pri1mer TH01 Reverse 5′ GTTTGTGTGTGCATCTGTAAGCATGTATC SEQ ID NO: 9 primer TH01 Probe 5′/56-FAM/CCT(CATT).sub.n SEQ ID NO: 10 CACCATGGAGTCTGTGTTCCCTGTG (n = 6), SEQ ID NO: 11 (n = 7), SEQ ID NO: 12 (n = 8), SEQ ID NO: 13 (n = 9), SEQ ID NO: 14 (n = 10) TH01 Probe 5′/56- SEQ ID NO: 15 9.3 FAM/CCT(CATT)3CAT(CATT)6CACCATGGAGTCTGT GTTCCCTGTG

3. Example 3: STR—Genotyping Reference Samples (D8S1179 Locus)

[0061] In order to assess the ability of this system to detect iso-alleles, caused by a SNP in a repeat, a melting curve experiment using the probes designed for the D8S1179 locus was carried out. Reference sample 9947a is homozygous for locus D8S1179 (13:13), but is genotyped by means of massive parallel sequencing as 13:13′. Sequences corresponding to alleles 13 and 13′ can be found in table 3. Reference sample 2800 is heterozygous for locus D8S1179 (14:15). Both reference samples are amplified and analyzed in the same way as the experiment for the D165539 locus. As opposed to the amplification for the latter locus, forward primer was added in a concentration of 0.1 μM and the reverse primer was added in a concentration of 1.5 μM. Sequence of primers and probes used can be found in table 3.

TABLE-US-00003 TABLE 3 Sequence of oligonucleotides used for the D8S1179 experiment. Name Sequence SEQ ID No D8S1179 5′ ATTGCAACTTATATGTATTTTTGTATTTCATG SEQ ID NO: 16 Forward primer D8S1179 5′ ACCAAATTGTGTTCATGAGTATAGTTTC SEQ ID NO: 17 Reverse primer D8S1179 Probe 5′ SEQ ID NO: 18 10 TTGTATTTCATGTGTACATTCGTA(TCTA)10TTCCC/ 36-FAM/ D8S1179 Probe 5′ SEQ ID NO: 19 11 TTGTATTTCATGTGTACATTCGTA(TCTA).sub.11TTCCC/ 36-FAM/ D8S1179 Probe 5′ SEQ ID NO: 20 12 TTGTATTTCATGTGTACATTCGTA(TCTA).sub.12TTCCC/ 36-FAM/ D8S1179 Probe 5′ SEQ ID NO: 21 13 TTGTATTTCATGTGTACATTCGTA(TCTA)(TCTG) (TCTA).sub.11TTCCC/36-FAM/ D8S1179 Probe 5′ SEQ ID NO: 22 13′ TTGTATTTCATGTGTACATTCGTA(TCTA).sub.13TTCCC/ 36-FAM/ D8S1179 Probe 5′ SEQ ID NO: 23 14 TTGTATTTCATGTGTACATTCGTA(TCTA)(TCTG) (TCTA).sub.12TTCCC/36-FAM/ D8S1179 Probe 5′ SEQ ID NO: 24 14′ TTGTATTTCATGTGTACATTCGTA(TCTA).sub.14TTCCC/ 36-FAM/ D8S1179 Probe 5′ SEQ ID NO: 25 15 TTGTATTTCATGTGTACATTCGTA(TCTA)(TCTG) (TCTA).sub.13TTCCC/36-FAM/ D8S1179 Probe 5′ SEQ ID NO: 26 16 TTGTATTTCATGTGTACATTCGTA(TCTA)(TCTG) (TCTA).sub.14TTCCC/36-FAM/

RESULTS

1. Example 1: STR—Genotyping Buccal Swabs (D16S5339 Locus)

[0062] The first derivative of the obtained melting curves was calculated, the resulting melting peaks are shown in FIGS. 5-7. FIG. 5 displays the melting peaks obtained from sample 7 with alleles 9 and 12, where the allele 12 probe (P12) melts at a higher temperature as compared to the allele 9 probe (P9).

[0063] As can be seen in FIG. 5, every probe shows some kind of melting peak. Nevertheless, P9 and P12 display a much higher peak height and a more narrow peak width. P11 shows the most intense melting peak of the mismatch probes, which is sequacious as this is a neighboring allele of the matching probe 12. Nevertheless, the difference of Tm between P11 and P12 is too big, indicating non-specific annealing of P11.

[0064] FIG. 6 displays the melting curves of a homozygous sample (alleles 9:9). Melting peaks of matching probes are more pronounced as compared to heterozygous samples.

[0065] FIG. 7 displays the melting curves of a heterozygous sample (alleles 11 and 13). The probe with 12 repeats is a neighboring probe of both matching probes but still a clear distinction can be made between match and mismatch.

[0066] Summarizing, sufficient information for genotyping can be deduced from hybridization or melting experiments. It should be noted that, when a melting experiment is carried out, a slow hybridization process should precede in order to guarantee specific annealing of the probes.

2. Example 2: STR—Genotyping Buccal Swabs (TH01 Locus)

[0067] It should be noted that, for most of the examined loci, matching probes display 2 peaks, whereas mismatch probes only 1. This is most probably due to the presence of another allele (heterozygous samples), stutter peaks and aspecific PCR-products. Evaluation of these melting curves is by consequence less complicated. However, for the D16S539 locus, matching alleles show only one peak, which is most probably related to the shorter FL1 of these probes.

[0068] For sample A, 2 probes display melting peaks at a higher temperature, and in addition these peaks are characterized by a so-called “shoulder,” which is in fact a second peak as discussed above. The 2 probes correspond to the correct alleles. For the homozygous sample B, only one probe shows a melting peak at a higher temperature, corresponding to allele 9.3. Although probe 10 displays a higher melting peak, it occurs at a lower temperature, and a shoulder peak is absent. Thereby, it can be concluded that allele 10 is not present in the examined sample. Besides that, one can conclude that the described probes and system is able to distinguish between allele 9.3 and 10.

3. Example 3: STR—Genotyping Reference Samples (D8S1179 Locus)

[0069] For sample 9947a, both probe 13 and 13′ display melting peaks at a higher temperature. Besides that, both melting peaks show so-called shoulders, similar to the TH01 probes. Therefore, it can be concluded that the complementary amplicons for both probes 13 and 13′ are present in sample 9947a. For sample 2800, probe 14 and 15 show melting peaks at a higher temperature, with shoulders. Probe 14′ however does not show a shoulder, and occurs at a lower temperature. The high peak-height can be explained by the presence of both alleles 14 (which has the same length) and 15 (which is a close neighbor). It can be concluded that this method is capable of distinguishing iso-alleles, thereby being more informative than capillary electrophoresis.

REFERENCES

[0070] 1. Westen, A. A., et al., Tri-allelic SNP markers enable analysis of mixed and degraded DNA samples. Forensic Science International: Genetics, 2009. 3(4): p. 233-241.

[0071] 2. Butler, J. M., Forensic DNA typing: biology, technology, and genetics of STR markers. 2005: Elsevier.

[0072] 3. Schneider, P. M., Expansion of the Europian standard set of DNA database loci-the current situation. Profiles in DNA, 2009. 12: p. 6-7.

[0073] 4. Hares, D. R., Selection and implementation of expanded CODIS core loci in the United States. Forensic Science International: Genetics, 2015. 17: p. 33-34.

[0074] 5. Hennessy, L. K., et al., Developmental validation studies on the RapidHIT™ human DNA identification system. Forensic Science International: Genetics Supplement Series, 2013. 4(1): p. e7-e8.

[0075] 6. Bruijns, B., et al., Microfluidic devices for forensic DNA analysis: A review. Biosensors, 2016. 6(3): p. 41.

[0076] 7. French, D., et al., Fluorophore-based oligonucleotide probes with a universal element. 2016, EP3011053A2.

[0077] 8. Gale, N., et al., Rapid typing of STRs in the human genome by HyBeacon® melting. Organic & biomolecular chemistry, 2008. 6(24): p. 4553-4559.

[0078] 9. Gelfand, D. H., et al., Homogeneous assay system using the nuclease activity of a nucleic acid polymerase. 1993, U.S. Pat. No. 5,210,015.

[0079] 10. Tyagi, S. and F. R. Kramer, Nucleic acid detection probes having non-FRET fluorescence quenching and kits and assays including such probes. 2000, U.S. Pat. No. 6,150,097.

[0080] 11. Thelwell, N., et al., Mode of action and application of Scorpion primers to mutation detection. Nucleic acids research, 2000. 28(19): p. 3752-3761.

[0081] 12. Okamoto, A., ECHO probes: a concept of fluorescence control for practical nucleic acid sensing. Chemical Society Reviews, 2011. 40(12): p. 5815-5828.

[0082] 13. Halpern, M. D. and J. Ballantyne, An STR melt curve genotyping assay for forensic analysis employing an intercalating dye probe FRET. Journal of forensic sciences, 2011. 56(1): p. 36-45.

[0083] 14. Halpern, M. and P. M. Ellis, Dye probe fluorescence resonance energy transfer genotyping. 2010, U.S. Ser. No. 12/276,849.

[0084] 15. Reed, G. H., J. O. Kent, and C. T. Wittwer, High-resolution DNA melting analysis for simple and efficient molecular diagnostics. 2007.

[0085] 16. Wittwer, C. T., et al., Single-labeled oligonucleotide probes for homogeneous nucleic acid sequence analysis. 2003, Google Patents.

[0086] 17. Cooper, J. P. and P. J. Hagerman, Analysis of fluorescence energy transfer in duplex and branched DNA molecules. Biochemistry, 1990. 29(39): p. 9261-9268.

[0087] 18. Lee, S. P., et al., A fluorometric assay for DNA cleavage reactions characterized with BamHI restriction endonuclease. Analytical biochemistry, 1994. 220(2): p. 377-383.

[0088] 19. Mao, H., et al., The mechanism and regularity of quenching the effect of bases on fluorophores: the base-quenched probe method. 2018. 143(14): p. 3292-3301.

[0089] 20. Marimuthu, C., et al., Single-stranded DNA (ssDNA)production in DNA aptamer generation. Analyst, 2012. 137(6): p. 1307-1315.