Genetically engineered bacteria, its construction method and its application in producing NAD.SUP.+ method
12173338 ยท 2024-12-24
Assignee
Inventors
- Wei Wang (Anhui, CN)
- Kanglin Wang (Anhui, CN)
- Minjie Fu (Anhui, CN)
- Yonghong Jin (Anhui, CN)
- Feng Tian (Anhui, CN)
- Heping Jia (Anhui, CN)
- Zhihao Hu (Anhui, CN)
Cpc classification
C12Y204/02012
CHEMISTRY; METALLURGY
C12N9/78
CHEMISTRY; METALLURGY
C12P19/36
CHEMISTRY; METALLURGY
C12Y603/05001
CHEMISTRY; METALLURGY
International classification
C12N9/78
CHEMISTRY; METALLURGY
C12N9/00
CHEMISTRY; METALLURGY
C12N9/12
CHEMISTRY; METALLURGY
Abstract
The invention discloses a genetically engineered bacterium in which the gene encoding adenine deaminase on the genome of the bacterium is knocked out or/and the gene encoding the enzyme in the NAD.sup.+ anabolic pathway is integrated on the genome of the bacterium. The invention also discloses a construction method of the above-mentioned genetically engineered bacteria. The gene encoding adenine deaminase on the genome of the host strain is knocked out to obtain a strain with high NAD.sup.+ yield. Or the expression cassettes of the gene encoding the enzyme in the NAD.sup.+ synthesis pathway are constructed separately, and then the enzyme encoding The gene expression cassette is integrated into the genome of the host strain whose gene encoding adenine deaminase is knocked out to construct a strain with high NAD.sup.+ production. The application of the above genetically engineered bacteria is disclosed. A method of producing NAD.sup.+ is disclosed.
Claims
1. A method for producing a NAD.sup.+ comprising using nicotinamide or/and adenine as a substrate, and using a genetically engineered microorganism strain to produce the NAD.sup.+, wherein encoding genes of an adenine deaminase in a genome of the genetically engineered microorganism strain are double knocked out, and encoding genes of enzymes in a NAD.sup.+ synthesis process are incorporated and overexpressed in the genome of the genetically engineered microorganism strain, wherein the enzymes in the NAD.sup.+ synthesis process are Nicotinate phosphoribosyl transferase NPT1 and Nicotinic acid mononucleotide adenylyl transferase NMA1, the strain is diploid Saccharomyces cerevisiae, and the encoding genes of the adenine deaminase are two AAH1 alleles in the diploid Saccharomyces cerevisiae.
2. The method for producing the NAD.sup.+ of claim 1, wherein the genetically engineered microorganism whose deposit number is CGMCC No. 19048.
3. The method for producing the NAD.sup.+ of claim 1, wherein the method comprises constructing the genetically engineered strain, comprising constructing an expression cassette of the encoding genes of the enzyme in NAD.sup.+ synthesis process respectively, and integrating and overexpressing the expression cassette into the genome of a host strain, wherein the encoding genes of the adenine deaminase in the genome have been double knocked out.
4. The method for producing the NAD.sup.+ of claim 3, wherein the integrating is through a -site integration method.
5. The method for producing the NAD.sup.+ of claim 4, wherein the -site integration method is a way of gene integration based on a homology of sequence, the sequence comprises a 1 fragment and a 2 fragment, and a first nucleotide sequence of the 1 fragment is shown in SEQ ID No. 1, and a second nucleotide sequence of the 2 fragment is shown in SEQ ID No. 2.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
DESCRIPTION OF PREFERRED EMBODIMENTS
(6) The detailed implementation of the invention is further described as follows. The following embodiments are used to illustrate the invention, but not to limit the scope of the invention.
(7) Except for special instructions, the experimental methods used in the following embodiments are all conventional methods. Except for special instructions, the materials and reagents etc. used in the inventation can be obtained from commercial sources.
(8) In the following embodiments, NPT1, NMA1, and AAH1 all represent genes, and NPT1, NMA1, and AAH1 all represent enzymes.
(9) The source information of the preferred embodiments, reagents and plasmids used in the examples are as follows: Agarose gel DNA recovery kit (upgraded spin column type) (Shanghai Generay Bioengineering Co., Ltd., catalog number GK2043-200); GB clonart seamless cloning reagent Kit (Suzhou Shenzhou Gene Co., Ltd., Item No. GB2001-48); Yeast Genomic DNA Extraction Kit (Beijing Kangwei Century Biotechnology Co., Ltd., Item No. CW0569); Plasmid pUC57 (Wuhan Miaoling Biotechnology Co., Ltd., Item No. P0087); pUG6 plasmid (Wuhan Miaoling Biotechnology Co., Ltd., item number P0104); pSH65 plasmid (Wuhan Miaoling Biotechnology Co., Ltd., item number P1352); SmaI, SdaI and other restriction endonucleases (Thermo Fisher Technology (China) Co., Ltd. Company).
Example 1
(10) The construction of integrated expression plasmid in Saccharomyces cerevisiae is presented as the follows:
(11) 1 the Construction of Integrated Plasmid Containing Delta Sequence
(12) 1.1 Using the Saccharomyces cerevisiae genome as a template, amplify PCR to get 235 bp fragment I and 21 bp fragment II by the primers listed in Table 1 respectively. And the fragment I contains a 154 bp 1 fragment whose sequence is shown in SEQ ID No. 1. The fragment II contains a a 180 bp 2 fragment whose sequence is shown in SEQ ID No.2.
(13) 1.2 Using plasmid pUC57 as a template, amplify PCR to get the fragment pUC57 of 2682 bp by the primers listed in Table 1.
(14) 1.3 The fragment pUC57, fragment I and fragment II are gel recovery disposed by using agarose gel DNA recovery kit, and then which was seamlessly cloned by GBclonart seamless cloning kit to construct the plasmid pND04.
(15) TABLE-US-00001 TABLE1 Sequencesofprimersusedinsteps1.1and1.2 Primer Fragment name Primersequence(5-3) pUC57 pUC-F GTTCCATCCCAATACGCGTCAATTCACTG fragment pUC-R GTTCCATCCCAATGGCGCGCCGAG FragmentI delta-F1 GAATTGACGCGTATTGGGATGGAACGCGGCCGCGT TTAAACTGTTGGAATAGAAATCAACTATC delta-R1 TCATCATTTTATATGTTTATATTCACCCGGGCCTGC AGGTTGATCCTATTACATTATCAATCC FragmentII delta-F2 AGGATTGATAATGTAATAGGATCAACCTGCAGGCC CGGGTGAATATAAACATATAAAATGATG delta-R2 GCTCGGCGCGCCATTGGGATGGAACGCGGCCGCGT TTAAACTGAGAAATATGTGAATGTTGAG
2. The Construction of Integrated Plasmid Containing Dual Promoters
(16) Plasmid pNL01, the nucleotide sequence of which is shown in SEQ ID No. 3. And plasmid pNL01 contains GPD promoter and TEF1 promoter.
(17) Using the plasmid pNL01 as a template, amplify PCR to get 1811 bp dual promoter fragment by primers pND05-F1 and pND05-R1. The dual promoter fragment is gel recovery disposed by using agarose gel DNA recovery kit, and then which was seamlessly cloned together with plasmid pND04 recovered by digestion with SmaI (using GB clonart seamless cloning kit) to construct the plasmid pND05.
(18) TABLE-US-00002 TABLE2 SequencesofprimerspND05-F1andpND05-R1 Primer name Sequence(5-3) pND05-F1 TGTAATAGGATCAACCTGCAGGCCCGTTAGCATATCTAC AATTGGGTGAAATG pND05-R1 TCATTTTATATGTTTATATTCACCCCCATGGGTTGGCCG ATTCATTAATGCAG
3. The Construction of Integrated Plasmid Containing Yeast Selection Markers
(19) Using the pUG6 plasmid as a template, amplify PCR to get KanMX fragment of 1654 bp by primers pND06-F1 and pND06-R1. The KanMX fragment is gel recovery disposed by using agarose gel DNA recovery kit, and then which was seamlessly cloned together with plasmid pND05 recovered by digestion with SdaI (using GBclonart seamless cloning kit) to construct the plasmid pND06.
(20) TABLE-US-00003 TABLE3 SequencesofprimerspND06-F1andpND06-R1 Primer name Sequence(5-3) pND06-F1 TAATGTAATAGGATCAACCTGCAGGTTAATTAACTGCA GGTCGACAACCCTTAATATAAC pND06-R1 TTGTAGATATGCTAACGGGCCTGCAATTTAAATCACTA GTGGATCTGATATCACCTAATAAC
4. The Construction of Integrated Plasmid Containing the Target Gene.
(21) 4.1 Using the plasmid pND06 as a template, amplify PCR to get the vector fragment 1 of 6391 bp by primers pEZTEF1-F1 and pEZTEF1-R1.
(22) 4.2 Using the Saccharomyces cerevisiae genome as a template, amplify PCR to get the NPT1 fragment of 1347 bp by primers NPT1-F1 and NPT1-R1.
(23) 4.3 The vector fragment 1, fragment NPT1 are gel recovery disposed by using agarose gel DNA recovery kit, and then which was seamlessly cloned by GBclonart seamless cloning kit to construct the plasmid pND07.
(24) 4.4 Using the plasmid pND07 as a template, amplify PCR to get the vector fragment 2 of 7678 bp by primers pEZGPD-F1 and pEZGPD-R1.
(25) 4.5 Using the Saccharomyces cerevisiae genome as a template, amplify PCR to get the NMA1 fragment by primers NMA1-F1 and NMA1-R1.
(26) 4.6 The vector fragment 2, fragment NMA1 are gel recovery disposed by using agarose gel DNA recovery kit, and then which was seamlessly cloned by GBclonart seamless cloning kit to construct the plasmid pND08 of which nucleotide sequence is shown in SEQ ID No.4.
(27) 4.7 The plasmid pND08 was verified by restriction digestion, and the results are shown in
(28) TABLE-US-00004 TABLE4 Sequencesofprimersusedin4.1,4.2,4.4and4.5 Primer name Primersequence(5.fwdarw.3) pEZTEF1-F1 GAATTCTGCAGATATCCATCACACTG pEZTEF1-R1 TTTGTAATTAAAACTTAGATTAGATTGCTATGC NPT1-F1 ATCTAATCTAAGTTTTAATTACAAAGGATCCATGTCAGAACCAGTGAT AAAGTCTC NPT1-R1 AGTGTGATGGATATCTGCAGAATTCTTAGGTCCATCTGTGCGCTTC pEZGPD-F1 ACCCGGGGCGAATTTCTTATG pEZGPD-R1 TTTGTTTGTTTATGTGTGTTTATTCGAAACTAAG NMA1-F1 GAATAAACACACATAAACAAACAAAATGGATCCCACAAGAGCTCC NMAl-R1 AAATCATAAGAAATTCGCCCCGGGTTCATTCTTTGTTTCCAAGAACTT GCTTAAC
Example 2
(29) Knockout of AAH1 Gene in Saccharomyces cerevisiae (Diploid):
(30) The adenine deaminase expressed by the AAH1 gene can degrade adenine into less soluble hypoxanthine, which affects the subsequent purification work and causes the waste of adenine. Therefore, knockout of AAH1 gene can reduce both the amount of adenine and the amount of hypoxanthine, a by-product to achieve the purpose of reducing costs.
(31) There are two AAH1 alleles in diploid yeast, and it is too inefficient to replace only one of them, so the two alleles need to be knocked out separately. When two alleles are knocked out separately, homologous arms used for two knockouts should be designed to avoid the occurrence of two knockouts at the same location. The specific operation is as follows:
(32) 1. Knockout of the First AAH1 Gene
(33) 1.1 Using the plasmid pUG6 as a template, PCR amplification was performed with primers AAH1-F1 and AAH1-R1, and then gel recovery was performed with agarose gel DNA recovery kit to obtain 1588 bp AAH1 knockout fragment I.
(34) 1.2 Preparation of Saccharomyces cerevisiae competent cells of Saccharomyces cerevisiae KH01 (This is a strain for host which is Saccharomyces cerevisiae purchased from Yantai Marley Yeast Co., Ltd., and its batch number is YT201902260569. This strain is renamed Saccharomyces cerevisiae KH01). A ring of bacterial liquid was taken from the glycerol cryopreserved tube, and it was marked and activated on YPD plate (the composition of YPD medium was: yeast powder 10 g/L, peptone 20 g/L, and glucose 20 g/L). It was placed in an incubator at 30 C. for 3 days. And then pick a single colony from the YPD plate and inoculate it into a 4 mL YPD test tube, and incubate it at 30 C. and 250 rpm for 16 hours. And then transfer the test tube bacterial solution to a 30 mL YPD shake flask at a 2% inoculum amount, and incubate it at 30 C. and 250 RPM under culture to the OD.sub.600=0.8-1.2. By collecting bacteria, with cold aseptic water washing twice, reoccupying cold 1 M sorbitol after washing twice, bacteria with 1 M sorbitol finally hanging weight to 300 uL, we get Saccharomyces cerevisiae competent cells which are divided into three equal parts by 100 L per and place them in ice for later use.
(35) 1.3 Electro transformation: Take 1 g of AAH1 knock-out fragment I and add it to 100 L of Saccharomyces cerevisiae competent cells, then place them in ice for a while, and transfer them to a 2 mm electric rotor cup in an ice bath. After 1.5 KV electric shock, resuspend in 1 mL YPD medium and transfer to EP tube and incubate at 30 C. in a shaker for 1-3 h to obtain the transformation solution. Take 200 L and 300 L of the transformation solution respectively to replace them on YPD plates containing 500 mg/L G418 antibiotics, and place them in a 30 C. incubator for 3-5 days to obtain transformants, cultivate in a 30 C. incubator for 3-5 days to obtain transformants, pick the transformants and streak for purification, extract the genome with the yeast genome extraction kit, perform PCR with primers on AAH1-500F/AAH1-500R to verify that the knockout is correct, this transformant strain was named Saccharomyces cerevisiae KH07SG (containing G418 resistance).
(36) TABLE-US-00005 TABLE5 PrimersusedforknockoutofthefirstAAH1gene rimername Sequence(5.fwdarw.3) AH1-F1 CGACATCTTTTGCAAATGAATAATTGACAAGCAGGCCTGTGT ATTTATAGCTGCAGGTCGACAACCCTTAATATAAC AHl-R1 ATCGAAAAAGACTTTCAACAAAAATATTATACAATGTCTTGC AAATGGTACACTAGTGGATCTGATATCACCTAATAAC AH1-500F GATGACTTTAACTGTGCACAC AH1-500R GACTCGCCTTCAGAAAATG
(37) 2 KH07SG Strain Elimination
(38) According to the method 1.2 in Example 2, prepare competent cells of Saccharomyces cerevisiae KH07SG strain. According to the method 1.3 in Example 2, transform 500 ng of pSH65 plasmid into competent cells of Saccharomyces cerevisiae KH07SG strain to obtain a transformation solution. Coat the transformation solution on YPD with 30 mg/L zeo or YPD with 15 mg/L Phleo. After culturing in a 30 C. incubator for 3 days, pick the transformants and inoculate YPG (with 20 g/L galactose instead of 20 g/L glucose, the others are the same as YPD medium) test tube, culture for 2-3 h at 30 C., 250 rpm. After the bacterial solution is diluted, take 100 L each of the bacterial solution of different dilutions and spread on the YPD plate and culture in an incubator at 30 C. for 3 days. A single colony YPD plate and YPD plate containing 500 mg/L G418 antibiotic were selected respectively. The resistant strain is screened out (the strain grows on the YPD plate and does not grow on the YPD plate containing 500 mg/L G418 antibiotic), and the strain is named Saccharomyces cerevisiae KH07S.
(39) 3. Knockout of the Second AAH1 Gene (Knockout of the Second AAH1 Gene in S. cerevisiae KH07S)
(40) 3.1 Using the plasmid pNL01 as a template, amplify PCR with primers AAH1-F2 and AAH1-R2. Then use agarose gel DNA recovery kit for gel recovery to obtain 1589 bp AAH1 knockout fragment II.
(41) 3.2 Prepare competent cells of KH07S strain according to the step 1.2 in Example 2.
(42) 3.3 Transform the AAH1 knock-out fragment II into KH07S strain cells to obtain the transformant according to the step 1.3 in Example 2. Take the transformant for streak purification and extract the genome, use primers to perform PCR on AAH1-500F/AAH1-500R to verify that the knockout is correct, and name the transformant strain Saccharomyces cerevisiae KH07G (containing G418 resistance).
(43) TABLE-US-00006 TABLE6 SequencesofprimerAAH1-F2andAAH1-R2 Primer name Sequence(5.fwdarw.3) AH1-F2 TTATTTTGAAATAATAACTACCATTAGAACTAACAAAAGAA AAGAAAAAAAAAATAATGGTTTCTGTGGAGCTGCAGGTCGA CAACCCTTAATATAAC AH1-R2 CTAATGCGAATATTTAGTGACTACTTCGTCCACTCTACTTA ACAAACCGTTCTTTCTTTTATCGTCACACCACTAGTGGATC TGATATCACCTAATAAC
(44) 4. According to the step 2 in Example 2, the strain of Saccharomyces cerevisiae KH07G was eliminated to obtain the correctly eliminated strain which was named Saccharomyces cerevisiae KH07. The primer pair AAH1-500F/AAH1-500R in Table 5 was used to perform PCR confirmation of the Saccharomyces cerevisiae KH07 strain. The results are shown in
(45) 5. Testing
(46) 5.1 Take the Saccharomyces cerevisiae strains KH01, KH07S and KH07 and use the same shake flask fermentation method to produce NAD.sup.+ to verify the effect of gene knockout.
(47) The method of producing NAD.sup.+ by shaking flask fermentation is to pick a ring of bacteria liquid from the glycerol cryopreservation tube of Saccharomyces cerevisiae to streak YPD plate, place it in a 30 C. incubator, and cultivate it for 2-3 days, use an inoculating loop to pick the activated single clone of Saccharomyces cerevisiae into a 500 mL shake flask containing 50 mL fermentation medium (Fermentation medium formula: glucose 50 g/L, casein extract 15 g/L, yeast extract 15 g/L, NaCl 5 g/L, KH.sub.2PO.sub.4 1 g/L, K.sub.2HPO.sub.4 1 g/L, MgSO.sub.4.7H.sub.2O 0.3 g/L, pH 5.4). After 72 hours of culture at 30 C. and 250 rpm, adenine and nicotinamide were added to make the final concentration of adenine 3 g/L and the final concentration of nicotinamide 6 g/L. The culture was continued at 30 C. and 250 RPM for 72 hours, and the fermentation was stopped to obtain the fermentation broth.
(48) Fermentation extract: 20 mL of the above fermentation liquid was centrifuged in a 50 mL centrifuge tube to collect the bacteria, and 5 mL 0.2% formic water was added into the bacteria, which was mixed in vortex. The bacteria were then stirred at 1000 RPM for 5 min and quickly transferred to an ice bath at 95 C. The mixture was then stirred at 1000 RPM for 5-10 min and centrifuged at 7500 RPM for 5 min.
(49) Detection: The contents of adenine, hypoxanthine and NAD.sup.+ in the fermented extract were detected by HPLC. The detection method was as follows: 1 mL of NAD.sup.+ extract was absorbed and filtered by a 0.22 m filter membrane for sampling detection.
(50) The detection conditions of HPLC were as follows: the chromatographic column was Waters C18 (4.6150 mm, 5 m), and the uv detector was used for detection, with the wavelength=260 nm, flow rate=1.0 mL/min, injection volume=5 L, column temperature=30 C., mobile phase A was methanol, mobile phase B was 10 mM ammonium acetate aqueous solution (pH=5.0), gradient elution, elution procedure is shown in Table 7. See
(51) TABLE-US-00007 TABLE 7 Time Mobile phase A Mobile phase B (min) (v/v %) (v/v %) 0.00-0.01 2 98 0.01-7.00 7 93 7.00-8.00 80 20 8.00-9.00 80 20 9.00-9.10 2 98 9.10-13.00 2 98
(52) Results: In the fermentation extract, the contents of adenine and hypoxanthine in the cells of strains KH01, KH07S and KH07 were shown in Table 8:
(53) TABLE-US-00008 TABLE 8 Saccharomyces Adenine Hypoxanthine cerevisiae strains (mg/L) (mg/L) KH01 6.11 127.23 KH07S 9.94 117.34 KH07 379.87 20.46
(54) As can be seen from Table 8, double knockout of AAH1 gene can significantly reduce the degradation of adenine to hypoxanthine, and the accumulation of hypoxanthine is reduced by at least 6 times.
Example 3
(55) Saccharomyces cerevisiae Strain KH01 Integrating the NPT1 and NMA1 Genes:
(56) The plasmid pND08 prepared in Example 1 was double-cut with MssI single enzyme, and then recovered with agarose gel DNA recovery kit to obtain 6178 bp integrated fragment.
(57) According to steps 1.2 and 1.3 in Example 2, the 6178 bp integral fragment was transformed into the cell of Saccharomyces cerevisiae KH01 to obtain the transformants. The transformants were scribed and purified, and then the transformants were screened by flask fermentation method in 5.1 of Example 2 to produce NAD.sup.+, and the dominant transformants with high yield of NAD.sup.+ were obtained. The transformants were named Saccharomyces cerevisiana KH06 after elimination in step 2 of Example 2.
(58) Testing: Saccharomyces cerevisiae KH06 was selected to produce NAD.sup.+ by flask fermentation in 5.1 of Example 3, and the results were compared with Saccharomyces cerevisiae KH01, as shown in Table 10.
(59) TABLE-US-00009 TABLE 10 different strains of the NAD.sup.+ yield Strain NAD.sup.+ (g/kg DCW) KH01 11.3 KH06 20.5
(60) As can be seen from Table 10, the NAD.sup.+ yield of Saccharomyces cerevisiae KH06, which overexpressed the genes NPT1 and NMA1, was more than 80% higher than that of Saccharomyces cerevisiae KH01.
Example 4
(61) Saccharomyces cerevisiae KH07 Integrating NPT1 and NMA1 Genes
(62) According to the steps in Example 3, the 6178 bp integration fragment was transformed into the cells of Saccharomyces cerevisiae KH07 to obtain transformants. The transformants were purified, and then the transformants were screened by flask fermentation method in 5.1 of Example 2 to produce NAD.sup.+, and the dominant transformants with high yield of NAD.sup.+ were obtained. The constriction strain was named Saccharomyces cerevisiae KH08 after eliminating resistance as described in Example 2 which was preserved in CGMCC, General Microbiology Center of China Microbial Species Preservation Management Committee, the preservation number is CGMCC No. 19048.
(63) Testing: According to the method of shake flask fermentation to produce NAD.sup.+ in 5.1 of Example 2. The single colony of Saccharomyces cerevisiae KH08 was inoculated in a 500 mL flask containing 50 mL fermentation medium, and cultured at 30 C., 250 RPM for 72 h, adenine and nicotinamide were added, and the final concentration of adenine and nicotinamide was 0.8 g/L and 6 g/L respectively. The culture was continued at 30 C. and 250 RPM for 72 h, and then the fermentation was stopped to obtain the fermentation liquid. The S. cerevisiae KH07 was used as the control, and the fermentation results were shown in Table 11.
(64) TABLE-US-00010 TABLE 11 NAD.sup.+ production of different strains Strain NAD.sup.+ (g/kg DCW) KH07 12.0 KH08 21.5
(65) As can be seen from Table 11, the NAD.sup.+ yield of Saccharomyces cerevisiae KH08 strain with NPT1 and NMA1 overexpressed was about 80% higher than that of Saccharomyces cerevisiae KH07.
(66) While embodiments of the present invention have been illustrated and described, various modifications and improvements can be made by persons skilled in the art. It is intended that the present invention is not limited to the particular forms as illustrated, and that all the modifications not departing from the spirit and scope of the present invention are Within the scope as defined in the appended claims.