MART-1(27-35) EPITOPE-SPECIFIC T CELL RECEPTOR

20220340638 · 2022-10-27

    Inventors

    Cpc classification

    International classification

    Abstract

    Provided is a MART-1 (27-35) epitope-specific T cell receptor, comprising an α chain and a β chain. The α chain comprises three complementary determining regions, respective sequences thereof being positions 61-66, positions 84-89, and positions 124-136 of SEQ ID No. 3. The β chain comprises three complementary determining regions, respective amino acid sequences thereof being positions 46-50, positions 68-73, and positions 112-125 of SEQ ID No. 4. A T cell expressing the TCR can effectively recognize a MART-1 (27-35) epitope polypeptide supported on a T2 cell and secrete IFN-γ, thereby demonstrating the functionality of the receptor. Use of the TCR with a relevant drug target allows for effective drug development.

    Claims

    1. A MART-1 (27-35) epitope-specific T cell receptor, comprising an α chain and a β chain; the α chain comprises three complementary determining regions, respective amino acid sequences thereof being positions 61-66, positions 84-89, and positions 124-136 of SEQ ID No. 3; or variants of the sequences with up to 3, 2, or 1 amino acid changes; the β chain comprises three complementary determining regions, respective amino acid sequences thereof being positions 46-50, positions 68-73, and positions 112-125 of SEQ ID No. 4; or variants of the sequences with up to 3, 2, or 1 amino acid changes.

    2. The T cell receptor as defined in claim 1, wherein: the amino acid sequence of a variable region of the α chain is positions 35-136 of SEQ ID No. 3; or variants of the sequences with up to 3, 2, or 1 amino acid changes; the amino acid sequence of a variable region of the β chain is positions 20-125 of SEQ ID No. 4; or variants of the sequences with up to 3, 2, or 1 amino acid changes.

    3. The T cell receptor as defined in claim 1, wherein: the amino acid sequence of a constant region of the α chain is positions 148-288 of SEQ ID No. 3; and the amino acid sequence of a constant region of the β chain is positions 136-314 of SEQ ID No. 4.

    4. The T cell receptor as defined in claim 1, wherein: the amino acid sequence of the α chain is SEQ ID No. 3; and the amino acid sequence of the β chain is SEQ ID No. 4.

    5. A nucleic acid molecule encoding the T cell receptor as defined in claim 1.

    6. The nucleic acid molecule as defined in claim 5, wherein: the nucleic acid molecule encoding the T cell receptor comprises a nucleic acid molecule encoding the α chain of the T cell receptor and the nucleic acid molecule encoding the β chain of the T cell receptor; the sequences of nucleic acid molecules encoding the three complementary determining regions in the α chain of the T cell receptor are respectively positions 181-198, positions 250-267 and positions 370-408 of SEQ ID No. 1; or sequences having at least 99%, at least 95%, at least 90%, at least 85% or at least 80% identity with the sequences and encoding the same amino acid residues; the sequences of nucleic acid molecules encoding the three complementary determining regions in the β chain of the T cell receptor are respectively positions 136-150, positions 202-219 and positions 334-375 of SEQ ID No. 2; or sequences having at least 99%, at least 95%, at least 90%, at least 85% or at least 80% identity with the sequences and encoding the same amino acid residues.

    7. The nucleic acid molecule as defined in claim 5, wherein: the sequence of the nucleic acid molecule encoding the variable region of the α chain is positions 103-408 of SEQ ID No. 1; or sequences having at least 99%, at least 95%, at least 90%, at least 85% or at least 80% identity with the sequences and encoding the same amino acid residues; the sequence of the nucleic acid molecule encoding the variable region of the β chain is positions 58-375 of SEQ ID No. 2; or sequences having at least 99%, at least 95%, at least 90%, at least 85% or at least 80% identity with the sequences and encoding the same amino acid residues.

    8. The nucleic acid molecule as defined in claim 5, wherein: the sequence of the nucleic acid molecule encoding the α chain is SEQ ID No. 1; and the sequence of the nucleic acid molecule encoding the β chain is SEQ ID No. 2.

    9. A cell containing the nucleic acid molecule as defined in claim 5.

    10. (canceled)

    11. The cell as defined in claim 9, wherein: the cell is a T cell.

    12. A pharmaceutical composition containing the cell as defined in claim 9.

    13-14. (canceled)

    15. A method for preventing or treating melanoma, comprising the following steps: using the T cell receptor as defined in claim 1 to prevent or treat melanoma.

    16. An expression cassette containing the nucleic acid molecule as defined in claim 5.

    17. A vector containing the nucleic acid molecule as defined in claim 5.

    18. The vector as defined in claim 17, wherein: the vector is obtained by linking the nucleic acid molecule encoding the α chain and the nucleic acid molecule encoding the β chain with a coding sequence of a linker peptide and then inserting between BamHI and SalI of a lentiviral vector pRRLSIN.cPPT.PGK-GFP.WPRE.

    19. A pharmaceutical composition containing the vector as defined in claim 17.

    20. A method for preventing or treating melanoma, comprising the following steps: using the nucleic acid molecule as defined in claim 5 to prevent or treat melanoma.

    21. A method for preventing or treating melanoma, comprising the following steps: using the cell as defined in claim 9 to prevent or treat melanoma.

    22. A method for preventing or treating melanoma, comprising the following steps: using the vector as defined in claim 17 to prevent or treat melanoma.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0023] FIG. 1 shows the flow cytometry detection results after the first round stimulation by MART-1 (27-35) epitope polypeptide. The left plot is an unstimulated cell population of CD8-T; and the right plot is a flow cytometry cell population via tetramer detection after stimulation by MART-1 antigen.

    [0024] FIG. 2 shows the flow cytometry detection results after the second round stimulation by MART-1 (27-35) epitope polypeptide. The left plot is an unstimulated cell population of CD8-T; and the right plot is a flow cytometry cell population via tetramer detection after stimulation by MART-1 antigen.

    [0025] FIG. 3 shows the Elispot detection results of MART-1 (27-35) epitope polypeptide-specific T cell. 7 holes, from left to right, sequentially represent T+T2+an effective polypeptide, T+T2+an unrelated polypeptide, T+T2, T+an effective peptide, T+an unrelated peptide, T, and T+OKT3.

    [0026] FIG. 4 is an amplification electropherogram of a single cell TCR. The bands marked by a frame are subjected to enzyme digestion and gel recovery.

    [0027] FIG. 5 is an electrophoretogram of products obtained after colony PCR of a TA clone. 1-1 represents TA cloning performed by one clone, 1-2 represents TA cloning performed by another clone, and 1-6 represents TA cloning performed by yet another clone.

    [0028] FIG. 6 is a schematic diagram of part of the structure of a recombinant viral vector.

    [0029] FIG. 7 shows the Elispot detection results of MART-1 (27-35) epitope polypeptide-specific T cell corresponding to clone #4 sequence.

    DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT

    [0030] The following examples facilitate a better understanding of the disclosure, but do not limit the disclosure. The experimental methods in the following examples are all conventional methods, unless otherwise specified. The test materials used in the following examples, unless otherwise specified, were purchased from general biochemical reagent stores. For the quantitative tests in the following examples, triplicates were set, and the results were averaged.

    [0031] Experimental reagents and articles used in the following examples were as follows:

    [0032] Experimental articles: blood collection tubes (including ACD anticoagulant), syringes, centrifuge tubes, 0.2 μm filtration membranes, MS separation columns, magnetic stands, and six-well plates with low adsorption; 0.2 μm filtration membranes, Dayou freezing kits and PCR tubes.

    [0033] Experimental reagents: sterile saline solution (DPBS), RPMI1640 medium, Ficoll, AIM-V medium, sterile ultrapure water (filtered through 0.1 um filtration membrane), MACS running buffer; AIM-V medium, GM-CSF, IL-4, IFN-γ, LPS and IL-7. Antigen-presenting beads, AIM-V medium, IL-21, IL-2 and IL-15. Sterile saline solution (PBS), Human IFN-γ ELISpot kits (MABTECH), tetramer (MART-1 antigen).

    Example 1. Acquisition of Sequence of MART-1(27-35) Epitope-Specific T Cell Receptor with High Affinity

    [0034] I. Stimulation of MART-1 (27-35) Epitope-Specific T Cells

    [0035] 1. Isolation of PBMCs from Peripheral Blood of Healthy People

    [0036] 50 ml of blood samples were collected and centrifuged at room temperature at 100 g for 15 min; the plasma in the upper layer and the blood cells in the lower layer were collected, respectively. The plasma in the upper layer was centrifuged at room temperature at 1100 g for 20 min and the precipitate is discarded; after being inactivated at 56° C. (30 min), same was placed in a freezing layer of −20° C. and kept standing for 15 min. Centrifugation was performed at room temperature at 3800 rpm for 20 min. After centrifugation, the supernatant was human serum, which was taken for later use. The blood cells in the lower layer were made up to 50 ml with DPBS, and mixed upside down; 20 mL was pipetted to a 50 mL centrifuge tube; and 25 mL of blood sample after mixing homogeneously was carefully added on Ficoll and centrifuged at room temperature. After centrifugation, the liquid was divided into four layers, which, from top to bottom, were respectively a plasma layer, a buffy coat, a Ficoll layer and a blood cell layer; the buffy coat was carefully sucked out with a Pasteur dropper and transferred to a sterile centrifuge tube; 3 times the volume of 1640 medium was added therein to wash the sucked buffy coat, and the buffy coat was gently pipetted for several times, centrifuged at room temperature at 500 g for 10 min. The supernatant was carefully sucked out, and the precipitate is PBMC. DNAase was added therein to digest the agglomerate cells, and when the cells were judged to be a single cell suspension by eyes, 5-6 ml of MACS running buffer at 4° C. was added to terminate digestion. After termination, the single cell suspension was added onto a 70 μm cell sieve, and the tube and sieve were washed three times with 1-2 ml of MACS running buffer; and the single cell suspension was centrifuged at room temperature at 300 g for 10 min, and counted after resuspension.

    [0037] 2. Sorting of CD8.sup.+ T Cell

    [0038] After counting, PBMCs were added into MACS running buffer at 80 μl buffer/10.sup.7 cells for resuspension, and 20 μl of CD8 beads/10.sup.7 cells were added, mixed homogeneously, and incubated at 4° C. for 15 min; after incubation, 1-2 mL of buffer/10.sup.7 cells were added for washing; the supernatant was completely sucked out, and the PBMCs were dispersed and 500 μl of buffer (0-10.sup.8 total cells) was added for resuspension; and a separation column was placed on a magnetic stand and MACS running buffer was added to equilibrate the separation column. Cell suspension was added into (MS: 500 μl, LS: 3 mL), and the tube and separation column were washed with MACS running buffer for three times with the volume for each time being the same as above; after the column was removed, 1 ml of MACS running buffer was added, and then the plunger on the column was pushed vigorously, and the liquid that was pushed out is CD8.sup.+ T cell, the cells were counted, and then cryopreserved at 10.sup.7/ml; and CD8.sup.− T cells (negative cells) were adherent and DC cells (1.5-2 h or overnight) were obtained.

    [0039] 3. DC Loaded with MART-1 Polypeptide

    [0040] Negative cells were resuspended in 5% human serum AIM-V, and plated; the petri dish was shaken to make the non-adherent cells resuspended in the supernatant. The supernatant was sucked out, and then AIM-V medium was added for drip washing; and the adherent cells were added into DC medium, after 48 h, half volume of 5% human serum AIM-V medium was supplemented; after 24 hours, the cells were purged with cold DPBS (the original culture medium and the cell fluid purged by subsequent addition of DPBS were separated in different tubes), and the cells were plated in a 12 well plate with 5×10.sup.5 cells, with 1 ml of medium per well (the medium being 5% human serum AIM-V), and a cytokine was added therein to induce the maturation of DC cells. At the same time, the DC cells were loaded with the polypeptide (MART-1 (27-35) epitope peptide, SEQ ID No. 5) by adding the polypeptide into the cultured DC cells, and the cells were incubated at 37° C. for 16 h.

    [0041] 4. Co-Culture of DC Cells Loaded with the Polypeptide (MART-1 (27-35) Epitope Polypeptide) and CD8.sup.+ T Cells

    [0042] After 16 h, the DC cells loaded with the polypeptide (MART-1 (27-35) epitope polypeptide) were pipetted with cold DPBS and co-cultured with recovered CD8.sup.+ T; the CD8.sup.+ was purged, and the well plate was purged with AIM-V medium for at least 3 times, and centrifuged at room temperature at 400 g for 5 min; the cells were resuspended with 1 ml of AIM-V, DNAase was added to digest same into a single-cell suspension, after 0-5 min, the reaction was terminated by adding 5 ml of AIM-V, and centrifugation was carried out at room temperature at 400 g for 5 min; and T cells were resuspended with 5% human serum AIM-V, and were plated at 6.25×10.sup.5 cells/cm.sup.2. The DC cells loaded with the polypeptide (MART-1 (27-35) epitope polypeptide) were added in a proportion and IL-21 was added; 72 h after addition, medium supplement or half volume-medium exchange was carried out every 2-3 days, and the total volume of cytokines of IL 2, IL-7 and IL-15 were supplemented; and cytokines were supplemented or medium were exchanged every 2-3 days. On day 5 of culturing, antigen-presenting beads used for the second round of stimulation were prepared: on day 1, the total number of magnetic beads required was calculated, and the required volume of magnetic beads was taken out and performed adsorption with magnet to remove the supernatant. The same volume of a boric acid solution was added for washing twice, and then the same volume of the solution was added again for resuspension. CD28 and HLA-A2: Ig were added, and same was placed onto a shaker at 4° C. overnight. On day 10 of culturing, the cells were resuspended, and the cells used for detection and flow cell sorting was taken out, and the remaining cells were used for the second round of co-culture.

    [0043] II. Single-Cell TCR Sequencing for MART-1 (27-35) Epitope-Specific T Cells

    [0044] 1. Synthesis of HLA-A*02 Tetramer Loaded with MART-1 (27-35) Epitope Polypeptide

    [0045] A tetramer is formed by connecting four monomers. A complex formed by a single HLA molecular protein and a polypeptide is referred to as a monomer. The tetramer is formed by connecting the four monomers via biotin-streptavidin. Monomer substitution refers to the process of polypeptide exchange on a monomer. Due to different experimental needs, tetramers need to be constructed for different antigens. The substitution of different antigens (polypeptide sequences) is referred to as monomer substitution.

    [0046] 5 μl of 10 mM MART-1 (27-35) epitope peptide (SEQ ID No. 5) was taken, and 120 μl of PBS was added therein, and placed same on ice; 20 μl of the diluted polypeptide of interest and HLA-A*02 monomer were added to the 96-well plate with a U-shaped bottom, and mixed homogeneously; the plate is sealed with tinfoil, and the reaction solution was added to the bottom of the plate; the crosslinking was performed under UV lamp at 365 nm for 30 min, and incubated at 37° C. in the dark for 30 min; and 30 μl of MART-1 (27-35) epitope polypeptide was used to substitute HLA-A*02 monomer on anew plate, and 3.3 μl of fluorescence-conjugated streptavidin was added, and placed same on ice for 30 min; and a stop solution was prepared during the incubation on ice; after staying overnight at 4° C. or staying on ice in dark for 30 min, the stop solution was stored at 4° C. for later use.

    [0047] 2. Flow Cytometry Detection of MART-1(27-35) Epitope-Specific T Cell Receptor

    [0048] The stimulated cells in step I-4 were resuspended and counted. The cells used for flow cell sorting was taken out at 2×10.sup.5/tube, and then 1 ml of PBS was added therein for resuspension. After centrifugation at 4° C. at 500 g for 5 min, the supernatant was carefully discarded and 200 μl of PBS was added for resuspension. The tetramer (10 μl/ml) prepared in step 1 was added to the tube, mixed homogeneously and carried out a reaction at 4° C. for 30 min. After the reaction time is over, 1 ml of PBS was added for resuspension and centrifugation was carried out at 4° C. at 500 g for 5 min. The supernatant was carefully discarded, and 200 μl of PBS was added for resuspension, and it was placed on ice for flow cytometry detection. After flow cytometry loading, positive population was selected to sort single cells.

    [0049] The flow cytometry detection results after the first round stimulation by MART-1 (27-35) epitope polypeptide were as shown in FIG. 1. It can be seen therefrom that compared with the control group, of which T cells without stimulation were cultured under the same conditions, the T cells after stimulation by MART-1 (27-35) epitope polypeptide antigen can be detected 0.668% of positive tumour-specific T cells by the tetramer.

    [0050] The flow cytometry detection results after the second round stimulation by MART-1 (27-35) epitope polypeptide were as shown in FIG. 2. It can be seen therefrom that compared with the control group, of which T cells without the first round and the second round of stimulation were cultured under the same conditions, the proportion of positive tumour-specific T cells in T cells after stimulation by MART-1 (27-35) epitope polypeptide antigen that can be detected by the tetramer increased greatly, and reached to 39.4%.

    [0051] 3. Elispot Detection of MART-1(27-35) Epitope Polypeptide-Specific T Cell

    [0052] Preparation of target cells: T2 cells were counted, and the required cells were taken out. After centrifugation at room temperature at 400 g for 5 min, the cells were resuspended in serum-free IMDM medium.

    [0053] Loading target cells with MART-1 (27-35) epitope polypeptide: a appropriate well plate and a loading volume were determined according to the number of cells taken out; the MART-1 (27-35) epitope polypeptide was prepared into 10 μg/μl, added at 1000× to the loading volume, resuspended and mixed homogeneously, and incubated in a 5% CO.sub.2 incubator at 37° C. for 4 h. At the same time, a control group loaded with an unrelated polypeptide was set up.

    [0054] Preparation of effector cells (MART-1 (27-35) epitope polypeptide-specific T cell screened out by flow cytometry after the second round of stimulation): the effector cells were counted, and the required cells were taken out, centrifuged at room temperature at 300 g for 10 min, and then resuspended with 5% of human serum AIM-V medium, and it was placed on ice.

    [0055] Washing the plate: when 45 min was left for antigen loading, the reaction well plate in the human IFN-γ ELISpot kit was taken out from the super clean bench, PBS was added therein, and the liquid in the wells was patted off after standing for 30 s. The pat action was repeated five times, and then 10% FBS RPMI1640 medium was added at 100 μl/well, and incubated in a 5% CO.sub.2 incubator at 37° C. for 30 min.

    [0056] Addition of sample: after the time for antigen loading is over, T2 cells in the well plate were purged with 5% human serum AIM-V medium, and centrifuged at room temperature at 400 g for 5 min, and resuspended with 5% human serum AIM-V medium. The effector cells were added into the reaction well plate at 50 μl/well, then the target cell suspension was added at 50 μl/well, and the reaction well plate was put into a 5% CO.sub.2 incubator at 37° C. for culturing 16-48 h. After the culture time is over, PBS was added at 150 μl/well, and the liquid in the wells was patted off after standing for 30 s. The pat action was repeated five times, and an anti-human IFN-γ detection antibody solution (7-b6-1-ALP) was prepared with PBS containing 0.5% FBS (filtered by a 0.2 μm filter membrane). After adding 200× of 7-b6-1-ALP antibody and mixing with PBS containing 0.5% FBS thoroughly, it was added into the reaction well plate at 100 μl/well. The reaction plate was put into a 5% CO.sub.2 incubator at 37° C. for reacting 2 h. After the reaction time is over, PBS was added at 150 μl/well, and the liquid in the wells was patted off after standing for 30 s. The pat action was repeated five times, and NBT/BCIP (filtered by a 0.2 μm filter membrane) was added to the reaction well at 100 μl/well in the dark. The wells were color developed in the dark for 30 s-5 min (taking the observed obvious positive control spots as the reaction end point) and then washed with a large amount of tap water, and the results were observed after drying. As shown in FIG. 3, compared with the control group (T+T2+the unrelated polypeptide, T+T2, T+the effective polypeptide, T+the unrelated polypeptide and T are five negative control groups under the same conditions, and T+OKT3 is the positive control group; wherein OKT3 is an anti-CD3 antibody, and the reaction of OKT3 with T cells can promote T cells to secrete IFN-γ and produces spots in the color development reaction, and OKT3 can be used as a positive control), the MART-1 (27-35) epitope polypeptide-specific T cells can effectively recognize the polypeptide loaded with T2 (target cells) and secrete IFN-γ, proving that such population of cells are functional.

    [0057] 4. Single-Cell TCR Sequencing

    [0058] The reagents used are as shown in Table 1.

    TABLE-US-00001 TABLE 1 Reagents required for full-length sequencing of single-cell TCR M0314L Rnase Inhibitor, Murine NEB T8787 Triton x-100 SIGMA 4030 dNTP Mixture TAKARA 18064071 SuperScript II Reverse Transcriptase Invitrogen B0300-1VL Betaine solution SIGMA 20-303 MgC12 MILLIPORE KK2602 KAPA HiFi HotStart ReadyMix KAPA BIOSYSTEMS AM9938 Nuclease-free Water AMBION B7022S Gel Loading dye, Orange NEB MD 109-2 l00bp DNA ladder TIANGEN

    [0059] The primer sequences used are as shown in Table 2.

    TABLE-US-00002 TABLE 2 Primers required for full-length sequencing of single-cell TCR of MART-1 (27-35) epitope- specific T cells α or β Primer GC chain name Sequence (5′-3′) Tm/° C. % TCRA Outer GCAGACAGACTTGTCACTGG 59.1 55 (SEO ID No. 7) Middle TGGATTTAGAGTCTCTCAGCT 66.1 48.3 GGTACACG (SEQ ID No. 8) Inner GGTACACGGCAGGGTCAGGGT 67.6 65.2 TC(SEQ ID No. 9) TCRB Outer TGGTCGGGGAAGAAGCCTGTG 63.4 65 (SEQ ID No. 10) Middle TCTGCTTCTGATGGCTCAAAC 66.3 50 ACAGC_ (SEQ ID No. 11) Inner TTCTGATGGCTCAAACACAGC 63.5 47.8 GA (SEQ ID No. 12)

    [0060] (1) Cell lysis

    [0061] A mixed solution for cell lysis was prepared according to Table 3.

    TABLE-US-00003 TABLE 3 Mixed solution for cell lysis Volume Final Mixed solution for cell lysis μl concentration RNase/DNase-free water 1.86 10 μM Oligo-dT Primer 1 2.5 μM l0 mM dNTP 1 2.5 mM 40 U/μl RNase Inhibitor 0.1 2 U/μl 10% Triton X-100 0.04 0.2% Total volume 4

    [0062] When preparing, the preparation was carried out according to 110% of the number of samples (if there were 10 cell samples, 11 tubes were prepared). The prepared lysate was pipetted, mixed homogeneously, and then subpackaged to clean PCR tubes for centrifugation at 4° C. at 14000 rpm for 30 s (droplets were centrifuged to the bottom of the tube and bubbles were removed); the PCR tubes were placed in an ice box for subsequent dividing the lysate into cells; positive population (i.e., the MART-1 (27-35) epitope-specific T cells obtained in step 7) was selected and single cells were divided into the PCR tubes containing the lysate. After sorting, the tube cap was closed for short-term centrifugation, and the PCR instrument was adjusted for single cell lysis.

    [0063] 0.2 ml PCR tubes were placed in a PCR instrument, incubated at 72° C. for 3 min (if the cells were bulk samples, increasing to 5 min), and the temperature of the hot lid was 75° C. After the lysis, the PCR tubes were immediately placed on ice for 1 min; and centrifugated at 4° C. at 10000 rpm for 30 s, and then immediately transferred to ice. After this step, all the mRNAs were released from the single cells, and Oligo-dT primers were also bound to the mRNAs.

    [0064] (2) Preparation of reverse transcription system, according to Table 4.

    TABLE-US-00004 TABLE 4 Reverse transcription system Volume Final Ingredient μl concentration 5 × SuperScript II 2 1× 5M Betaine 2 1 M l00 mM M.sub.gCl.sub.2 0.9   9 mM l00 mM DTT 0.25 2.5 mM 100 μM TSO 0.1 1 μM 40 U/ul RNAse inhibitor 0.25  1 U/μL 200 U/μl SSII 0.5 10 U/μL Total volume 6

    [0065] When preparing, the preparation was carried out according to the number of samples+0.5 (if there were 9 cell samples, 9.5 tubes were prepared). The prepared Mix was mixed thoroughly, and then sequentially added into the centrifuge tubes in the previous step;

    [0066] and (3) after pipetting, mixing homogeneously and fast centrifuging, a reverse transcription reaction (75° C. hot lid) was carried out according to the conditions as shown in Table 5.

    TABLE-US-00005 TABLE 5 Reverse transcription reaction conditions Cycle Temperature Time  1 42° C. 90 min 10 50° C.  2 min 42° C.  2 min  1 70° C. 15 min  1  4° C. forever

    [0067] After this step, the first strand cDNAs of all mRNAs were synthesized;

    [0068] and (4) the first round of PCR Mix was prepared according to Table 6.

    TABLE-US-00006 TABLE 6 First round of PCR Mix Final Ingredient Volume μl concentration 2 × KAPAHiFi HotStart Ready Mix 12.5 1× IS PCR Primer (10 μM) 1 0.4 μM TCRA-out Primer (10 μM) 0.5 0.2 μM TCRB-out Primer (10 μM) 0.5 0.2 μM NF-water 0.5 Total volume 15

    [0069] When preparing, the preparation was carried out according to the number of samples+0.5 (if there were 9 cell samples, 9.5 tubes were prepared). The prepared Mix was mixed thoroughly, and 15 μl of the prepared Mix was sequentially added into the centrifuge tubes in the previous step. After pipetting, mixing homogeneously and fast centrifuging, pre-amplification was performed according to the conditions as shown in Table 7.

    TABLE-US-00007 TABLE 7 Pre-amplification conditions for first round of PCR Cycle Temperature Time  1 95 ° C. 3 min 25 98 ° C. 20 s 55 ° C. 15 s 72 ° C. 2 min  1 72 ° C. 5 min  1  4 ° C. forever

    [0070] (5) The second round of PCR Mix was prepared according to Table 8.

    TABLE-US-00008 TABLE 8 Second round of PCR Mix Final Ingredient Volume μl concentration 2 × KAPAHiFi HotStart Ready Mix 12.5 1× IS PCR Primer (10 μM) 1 0.4 μM TCRA-middle Primer (10 μM) 0.5 0.2 μM TCRB-middle Primer (10 μM) 0.5 0.2 μM NF-water 9.5 Total volume 24

    [0071] When preparing, the preparation was carried out according to the number of samples+0.5 (if there were 9 cell samples, 9.5 tubes were prepared). The prepared Mix was mixed thoroughly, and 24 μl of the prepared Mix was sequentially added into the centrifuge tubes in the previous step. After pipetting, mixing homogeneously and fast centrifuging, pre-amplification was performed according to the conditions as shown in Table 9.

    TABLE-US-00009 TABLE 9 Pre-amplification conditions for second round of PCR Cycle Temperature Time  1 95 ° C. 3 min 98 ° C. 20 s 25 60 ° C. 15 s 72 ° C. 2 min  1 72 ° C. 5 min  1  4 ° C. forever

    [0072] (6) The third round of PCR Mix was prepared according to Table 10.

    TABLE-US-00010 TABLE 10 Third round of PCR Mix Final Ingredient Volume μl concentration 2 × KAPAHiFi HotStart Ready Mix 12.5 1× IS PCR Primer (10 μM) 1 0.4 μM TCRA-in Primer (10 μM) 0.5 0.2 μM TCRB-in Primer (10 μM) 0.5 0.2 μM NF-water 9.5 Total volume 24

    [0073] When preparing, the preparation was carried out according to the number of samples+0.5 (if there were 9 cell samples, 9.5 tubes were prepared). The prepared Mix was mixed thoroughly, and 24 μl of the prepared Mix was sequentially added into the centrifuge tubes in the previous step. After pipetting, mixing homogeneously and fast centrifuging, pre-amplification was performed according to the conditions as shown in Table 11.

    TABLE-US-00011 TABLE 11 Pre-amplification conditions for third round of PCR Cycle Temperature Time  1 95 ° C. 3 min 35 98 ° C. 20 s 60 ° C. 15 s 72 ° C. 2 min  1 72 ° C. 5 min  1  4 ° C. forever

    [0074] (7) Electrophoresis detection: After completion of PCR, electrophoresis detection was performed, wherein 2% agarose gel was used, 15 μL of the product was taken and mixed homogeneously with 3 ul of Loading buffer, electrophoresis was performed at 130 V for 45 min, and the target band was recovered by gel cutting. The target band was then linked to a T vector, and the colony PCR identification was carried out.

    [0075] FIG. 4 is an amplification electropherogram of a single cell TCR. FIG. 5 is a colony PCR electrophoretogram of a TA clone. The results in the figures show that the amplified TCR fragments were successfully linked to the T vector, and the insert fragment vector constructed successfully can be effectively detected by colony PCR.

    [0076] (8) The sequenced fragments were blasted on the IMGT website, and respectively spliced with the C region of TCR α and TCR β chains to form a complete set of TCR sequences.

    [0077] III. Screening and Functional Verification of MART-1 (27-35) Epitope-Specific TCR Sequences

    [0078] The set of single-cell TCR sequences of MART-1 (27-35) epitope-specific T cells obtained in step II were in the order of abundance from high to low. The sequences with a high abundance were selected, and then the top 5% of the sequences after ordering according to the abundance from high to low were subjected to preliminary functional verification to determine the final full-length TCR sequences for treatment. Among them, a functional paired TCR α/β sequences (labeled clone #4) with abundance reaching 1.5%, after the start codon thereof was found, were spliced according to the actual sequence of the constant region (TRAC/TRBC) to form a new sequence, in which, the sequence of the complete coding gene of the α chain was SEQ ID No. 1 (encoding the α chain as shown in SEQ ID No. 3), and the sequence of the complete coding gene of the β chain was SEQ ID No. 2 (encoding the β chain as shown in SEQ ID No. 4). The positions 103-408 of SEQ ID No. 1 were the coding genes of the α chain variable region (positions 181-198, positions 250-267 and positions 370-408 were the coding genes of three CDRs, respectively), and positions 58-375 of SEQ ID No. 2 were the coding genes of the β chain variable region (positions 136-150, positions 202-219 and positions 334-375 were the coding genes of three CDRs, respectively).

    [0079] According to the schematic diagram as shown in FIG. 6, the coding genes of the α chain and β chain as shown in SEQ ID No. 1 and SEQ ID No. 2 were linked by the gene sequence of P2A peptide and then constructed into a lentiviral vector pRRLSIN.cPPT.PGK-GFP.WPR to obtain a recombinant viral vector. The structure of the recombinant viral vector was described as follows: the DNA fragment as shown in SEQ ID No. 6 was inserted into the intermediate position of BamHI and SalI double restriction endonuclease sites of pRRLSIN.cPPT.PGK-GFP.WPRE vector, and then a recombinant plasmid was obtained.

    [0080] The constructed recombinant viral vector was used to infect T cells, and then Elispot detection was carried out according to the method in step I-5 to verify the function thereof. Results were as shown in FIG. 7. Compared with the GFP control experimental group, the virus-infected T cells constructed by clone #4 sequence can effectively recognize the MART-1 (27-35) epitope polypeptide loaded by T2 and secrete IFN-γ, i.e., can effectively react with target cells.

    INDUSTRIAL APPLICATIONS

    [0081] In the present disclosure, a specific T cell population is obtained by stimulating specific T cells with MART-1 (27-35) epitope in vitro, and sets of TCR sequences of effective T lymphocytes corresponding to MART-1 (27-35) epitope is obtained by using single cell pairing TCR sequencing technology, and the sets of sequences are in the order of abundance for in vitro function verification, and finally the TCR claimed by the present disclosure is obtained. Experiments have proved that the T cell expressing the TCR provided by the present disclosure can effectively recognize MART-1 (27-35) epitope polypeptide loaded by T2 cells (target cells) and secrete IFN-γ, thereby proving that such population of T cells are functional. Effective TCR can be used for adoptive cellular immunotherapy. In addition, the sets of sequenced in combination with affinity enhancement or related drug targets can effectively used for drug development and have broad market prospects.

    SEQUENCE LISTING

    [0082] The instant application contains a Sequence Listing which is being submitted in ASCII format via EFS-WEB and is hereby incorporated by reference in its entirety.

    [0083] File name: 5_SQLv2.txt

    [0084] Creation date: Aug. 3, 2021

    [0085] Modified: Sep. 17, 2021

    [0086] Byte size: 12,354 bytes