FLOW CELLS
20240418630 ยท 2024-12-19
Inventors
- Sahngki Hong (San Diego, CA, US)
- M. Shane Bowen (Encinitas, CA, US)
- Lewis J. Kraft (San Diego, CA, US)
Cpc classification
B01L2300/0636
PERFORMING OPERATIONS; TRANSPORTING
B01L2300/0893
PERFORMING OPERATIONS; TRANSPORTING
B01L3/502707
PERFORMING OPERATIONS; TRANSPORTING
G03F7/0002
PHYSICS
B01L2300/0864
PERFORMING OPERATIONS; TRANSPORTING
H01L31/08
ELECTRICITY
B01L2300/0816
PERFORMING OPERATIONS; TRANSPORTING
International classification
G03F7/00
PHYSICS
G03F7/09
PHYSICS
H01L21/02
ELECTRICITY
H01L21/311
ELECTRICITY
Abstract
One example of a flow cell includes a base support and a multi-layer stack positioned over the base support. The multi-layer stack includes a resin layer positioned over the base support; and a hydrophobic layer positioned over the resin layer. A depression is defined in the multi-layer stack through the hydrophobic material and through a portion of the resin.
Claims
1. A flow cell, comprising: a base support; a multi-layer stack positioned over the base support, the multi-layer stack including: a resin layer positioned over the base support; and a hydrophobic layer positioned over the resin layer; and a depression defined in the multi-layer stack through the hydrophobic material and through a portion of the resin.
2. The flow cell as defined in claim 1, further comprising a polymeric hydrogel positioned in the depression.
3. The flow cell as defined in claim 2, further comprising primers attached to the polymeric hydrogel.
4. The flow cell as defined in claim 1, wherein: a first region of the depression includes: a first polymeric hydrogel; and a first primer set attached to the first polymeric hydrogel; and a second region of the depression includes: a second polymeric hydrogel; and a second primer set attached to the second polymeric hydrogel, wherein the first primer set is different than the second primer set.
5. The flow cell as defined in claim 1, wherein the resin layer includes a resin selected from the group consisting of a polyhedral oligomeric silsesquioxane-based resin, an epoxy resin, a poly (ethylene glycol) resin, a polyether resin, an acrylic resin, an acrylate resin, a methacrylate resin, and combinations thereof.
6. The flow cell as defined in claim 1, wherein the hydrophobic layer includes a fluorinated polymer, a perfluorinated polymer, a silicon polymer, or a mixture thereof.
7. A method, comprising: defining a depression in a multi-layer stack including a hydrophobic layer over a resin layer by: i) etching through a depth of the hydrophobic layer; or ii) imprinting and etching the hydrophobic layer through a depth of the hydrophobic layer; or iii) imprinting through a depth of the hydrophobic layer and through a portion of a depth of the resin layer; and applying a functionalized layer in at least one region of the depression.
8. The method as defined in claim 7, wherein defining the depression involves ii) imprinting and etching the hydrophobic layer through the depth of the hydrophobic layer, and wherein the imprinting and etching of the hydrophobic layer involves: imprinting through a portion of the depth of the hydrophobic layer; and etching a remaining portion of the depth of the hydrophobic layer, whereby the resin layer acts as an etch stop.
9. The method as defined in claim 7, wherein defining the depression involves i) etching through the depth of the hydrophobic layer, and wherein prior to etching through the depth of the hydrophobic layer, the method further comprises: applying a lift-off resist and an additional resin layer over the hydrophobic layer; imprinting the additional resin layer to form a concave region therein; and extending the concave region to a surface of the hydrophobic layer by selectively etching portions of the additional resin layer and the lift-off resist, whereby other portions of the additional resin layer and the lift-off resist that are adjacent to the concave region remain intact.
10. The method as defined in claim 9, wherein after the functionalized layer is applied, the method further comprises lifting off the other portions of the lift-off resist.
11. The method as defined in claim 7, wherein the resin layer includes a resin selected from the group consisting of a polyhedral oligomeric silsesquioxane-based resin, an epoxy resin, a poly (ethylene glycol) resin, a polyether resin, an acrylic resin, an acrylate resin, a methacrylate resin, and combinations thereof.
12. The method as defined in claim 7, wherein the hydrophobic layer includes a fluorinated polymer, a perfluorinated polymer, a silicon polymer, or a mixture thereof.
13. A method, comprising: applying a sacrificial layer over a first portion of a depression defined in a substrate, whereby a second portion of the depression remains exposed; applying a first functionalized layer over the sacrificial layer and over the second portion of the depression; removing the sacrificial layer and the first functionalized layer applied thereon, thereby exposing the first portion of the depression; applying a second functionalized layer over the second portion of the depression; and attaching respective primers sets to the first and second functionalized layers.
14. The method as defined in claim 13, wherein: the substrate includes a resin layer over a base support; and the depression is defined through a portion of the resin layer.
15. The method as defined in claim 13, wherein prior to applying the sacrificial layer over the first portion, the method further comprises forming the depression in the resin layer using nanoimprint lithography.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0036] Features of examples of the present disclosure will become apparent by reference to the following detailed description and drawings, in which like reference numerals correspond to similar, though perhaps not identical, components. For the sake of brevity, reference numerals or features having a previously described function may or may not be described in connection with other drawings in which they appear.
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
DETAILED DESCRIPTION
[0055] Examples of the flow cells disclosed herein may be used for nucleic acid sequencing.
[0056] Some of the flow cells include different primer sets attached to different regions of the flow cell substrate. In these examples, the primer sets may be controlled so that the cleaving (linearization) chemistry is orthogonal in the different regions. Orthogonal cleaving chemistry may be realized through identical cleavage sites that are attached to different primers in the different sets, or through different cleavage sites that are attached to different primers in the different sets. This enables a cluster of forward strands to be generated in one region of the substrate and a cluster of reverse strands to be generated in another region of the substrate. In an example, the regions are directly adjacent to one another. In another example, any space between the regions is small enough that clustering can span the two regions. With some of the flow cell configurations disclosed herein, the forward and reverse strands are spatially separate, which separates the fluorescence signals from both reads while allowing for simultaneous base calling of each read. As such, some examples of the flow cells disclosed herein enable simultaneous paired-end reads to be obtained. Several example methods are described to generate these flow cells.
[0057] Other of the flow cells include the same primer set attached to different regions of the flow cell substrate. In these examples, the primer sets include two different primers in each region. This provides at least the benefits of i) a cluster of forward strands to be generated in each region of the substrate, sequenced, and removed; and ii) a cluster of reverse strands to be generated in each region of the substrate, sequenced, and removed. As such, other examples of the flow cells disclosed herein enable sequential paired-end reads to be obtained. Several example methods are described to generate these flow cells.
DEFINITIONS
[0058] It is to be understood that terms used herein will take on their ordinary meaning in the relevant art unless specified otherwise. Several terms used herein and their meanings are set forth below.
[0059] The singular forms a, an, and the include plural referents unless the context clearly dictates otherwise.
[0060] The terms comprising, including, containing and various forms of these terms are synonymous with each other and are meant to be equally broad.
[0061] The terms top, bottom, lower, upper, on, etc. are used herein to describe the flow cell and/or the various components of the flow cell. It is to be understood that these directional terms are not meant to imply a specific orientation, but are used to designate relative orientation between components. The use of directional terms should not be interpreted to limit the examples disclosed herein to any specific orientation(s).
[0062] The terms first, second, etc. also are not meant to imply a specific orientation or order, but rather are used to distinguish one component from another.
[0063] It is to be understood that the ranges provided herein include the stated range and any value or sub-range within the stated range, as if such values or sub-ranges were explicitly recited. For example, a range of about 400 nm to about 1 m (1000 nm), should be interpreted to include not only the explicitly recited limits of about 400 nm to about 1 m, but also to include individual values, such as about 708 nm, about 945.5 nm, etc., and sub-ranges, such as from about 425 nm to about 825 nm, from about 550 nm to about 940 nm, etc. Furthermore, when about and/or substantially are/is utilized to describe a value, they are meant to encompass minor variations (up to +/10%) from the stated value.
[0064] An acrylamide monomer is a monomer with the structure
##STR00001##
or a monomer including an acrylamide group. Examples of the monomer including an acrylamide group include azido acetamido pentyl acrylamide:
##STR00002##
and N-isopropylacrylamide:
##STR00003##
Other acrylamide monomers may be used.
[0065] An aldehyde, as used herein, is an organic compound containing a functional group with the structure CHO, which includes a carbonyl center (i.e., a carbon double-bonded to oxygen) with the carbon atom also bonded to hydrogen and an R group, such as an alkyl or other side chain. The general structure of an aldehyde is:
##STR00004##
[0066] As used herein, alkyl refers to a straight or branched hydrocarbon chain that is fully saturated (i.e., contains no double or triple bonds). The alkyl group may have 1 to 20 carbon atoms. Example alkyl groups include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tertiary butyl, pentyl, hexyl, and the like. As an example, the designation C1-4 alkyl indicates that there are one to four carbon atoms in the alkyl chain, i.e., the alkyl chain is selected from the group consisting of methyl, ethyl, propyl, iso-propyl, n-butyl, isobutyl, sec-butyl, and t-butyl.
[0067] As used herein, alkenyl refers to a straight or branched hydrocarbon chain containing one or more double bonds. The alkenyl group may have 2 to 20carbon atoms. Example alkenyl groups include ethenyl, propenyl, butenyl, pentenyl, hexenyl, and the like.
[0068] As used herein, alkyne or alkynyl refers to a straight or branched hydrocarbon chain containing one or more triple bonds. The alkynyl group may have 2 to 20 carbon atoms.
[0069] As used herein, aryl refers to an aromatic ring or ring system (i.e., two or more fused rings that share two adjacent carbon atoms) containing only carbon in the ring backbone. When the aryl is a ring system, every ring in the system is aromatic. The aryl group may have 6 to 18 carbon atoms. Examples of aryl groups include phenyl, naphthyl, azulenyl, and anthracenyl.
[0070] An amino functional group refers to an NR.sub.aR.sub.b group, where R.sub.a and R.sub.b are each independently selected from hydrogen
##STR00005##
C1-6 alkyl, C2-6alkenyl, C2-6 alkynyl, C3-7 carbocycle, C6-10 aryl, 5-10 membered heteroaryl, and 5-10 membered heterocycle, as defined herein.
[0071] As used herein, the term attached refers to the state of two things being joined, fastened, adhered, connected or bound to each other, either directly or indirectly. For example, a nucleic acid can be attached to a functionalized polymer by a covalent or non-covalent bond. A covalent bond is characterized by the sharing of pairs of electrons between atoms. A non-covalent bond is a physical bond that does not involve the sharing of pairs of electrons and can include, for example, hydrogen bonds, ionic bonds, van der Waals forces, hydrophilic interactions and hydrophobic interactions.
[0072] An azide or azido functional group refers to N.sub.3.
[0073] As used herein, a bonding region refers to an area of a substrate that is to be bonded to another material, which may be, as examples, a spacer layer, a lid, another substrate, etc., or combinations thereof (e.g., a spacer layer and a lid, or a spacer layer and another substrate). The bond that is formed at the bonding region may be a chemical bond (as described above), or a mechanical bond (e.g., using a fastener, etc.).
[0074] As used herein, carbocycle means a non-aromatic cyclic ring or ring system containing only carbon atoms in the ring system backbone. When the carbocycle is a ring system, two or more rings may be joined together in a fused, bridged or spiro-connected fashion. Carbocycles may have any degree of saturation, provided that at least one ring in a ring system is not aromatic. Thus, carbocycles include cycloalkyls, cycloalkenyls, and cycloalkynyls. The carbocycle group may have 3 to 20 carbon atoms. Examples of carbocycle rings include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclohexenyl, 2,3-dihydro-indene, bicyclo [2.2.2] octanyl, adamantyl, and spiro [4.4] nonanyl.
[0075] As used herein, the term carboxylic acid or carboxyl as used herein refers to COOH.
[0076] As used herein, cycloalkylene means a fully saturated carbocycle ring or ring system that is attached to the rest of the molecule via two points of attachment.
[0077] As used herein, cycloalkenyl or cycloalkene means a carbocycle ring or ring system having at least one double bond, wherein no ring in the ring system is aromatic. Examples include cyclohexenyl or cyclohexene and norbornenyl or norbornene. Also as used herein, heterocycloalkenyl or heterocycloalkene means a carbocycle ring or ring system with at least one heteroatom in ring backbone, having at least one double bond, wherein no ring in the ring system is aromatic.
[0078] As used herein, cycloalkynyl or cycloalkyne means a carbocycle ring or ring system having at least one triple bond, wherein no ring in the ring system is aromatic. An example is cyclooctyne. Another example is bicyclononyne. Also as used herein, heterocycloalkynyl or heterocycloalkyne means a carbocycle ring or ring system with at least one heteroatom in ring backbone, having at least one triple bond, wherein no ring in the ring system is aromatic.
[0079] The term depositing, as used herein, refers to any suitable application technique, which may be manual or automated, and, in some instances, results in modification of the surface properties. Generally, depositing may be performed using vapor deposition techniques, coating techniques, grafting techniques, or the like. Some specific examples include chemical vapor deposition (CVD), spray coating (e.g., ultrasonic spray coating), spin coating, dunk or dip coating, doctor blade coating, puddle dispensing, flow through coating, aerosol printing, screen printing, microcontact printing, inkjet printing, or the like.
[0080] As used herein, the term depression refers to a discrete concave feature in a substrate having a surface opening that is at least partially surrounded by interstitial region(s) of the substrate. Depressions can have any of a variety of shapes at their opening in a surface including, as examples, round, elliptical, square, polygonal, star shaped (with any number of vertices), etc. The cross-section of a depression taken orthogonally with the surface can be curved, square, polygonal, hyperbolic, conical, angular, etc. As examples, the depression can be a well or two interconnected wells. The depression may also have more complex architectures, such as ridges, step features, etc.
[0081] The term each, when used in reference to a collection of items, is intended to identify an individual item in the collection, but does not necessarily refer to every item in the collection. Exceptions can occur if explicit disclosure or context clearly dictates otherwise.
[0082] The term epoxy (also referred to as a glycidyl or oxirane group) as used herein refers to
##STR00006##
[0083] As used herein, the term flow cell is intended to mean a vessel having a flow channel where a reaction can be carried out, an inlet for delivering reagent(s) to the flow channel, and an outlet for removing reagent(s) from the flow channel. In some examples, the flow cell accommodates the detection of the reaction that occurs in the flow cell. For example, the flow cell can include one or more transparent surfaces allowing for the optical detection of arrays, optically labeled molecules, or the like.
[0084] As used herein, a flow channel may be an area defined between two bonded components, which can selectively receive a liquid sample. In some examples, the flow channel may be defined between a patterned resin of a substrate and a lid, and thus may be in fluid communication with one or more depressions defined in the patterned resin. In other examples, the flow channel may be defined between two substrates (each of which has sequencing chemistry thereon).
[0085] As used herein, heteroaryl refers to an aromatic ring or ring system (i.e., two or more fused rings that share two adjacent atoms) that contain(s) one or more heteroatoms, that is, an element other than carbon, including but not limited to, nitrogen, oxygen and sulfur, in the ring backbone. When the heteroaryl is a ring system, every ring in the system is aromatic. The heteroaryl group may have 5-18 ring members.
[0086] As used herein, heterocycle means a non-aromatic cyclic ring or ring system containing at least one heteroatom in the ring backbone. Heterocycles may be joined together in a fused, bridged or spiro-connected fashion. Heterocycles may have any degree of saturation provided that at least one ring in the ring system is not aromatic. In the ring system, the heteroatom(s) may be present in either a non-aromatic or aromatic ring. The heterocycle group may have 3 to 20 ring members (i.e., the number of atoms making up the ring backbone, including carbon atoms and heteroatoms). In some examples, the heteroatom(s) are O, N, or S.
[0087] The term hydrazine or hydrazinyl as used herein refers to a NHNH.sub.2 group. As used herein, the term hydrazone or hydrazonyl as used herein refers to a
##STR00007##
group in which R.sub.a and R.sub.b are each independently selected from hydrogen, C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3-7 carbocycle, C6-10 aryl, 5-10 membered heteroaryl, and 5-10 membered heterocycle, as defined herein.
[0088] As used herein, hydroxy or hydroxyl refers to an OH group.
[0089] As used herein, the term interstitial region refers to an area, e.g., of a substrate, patterned resin, or other support that separates depressions or protrusions. For example, an interstitial region can separate one depression of an array from another depression of the array. The two depressions or protrusions that are separated from each other can be discrete, i.e., lacking physical contact with each other. In many examples, the interstitial region is continuous whereas the depressions or protrusions are discrete, for example, as is the case for a plurality of depressions or protrusions defined in an otherwise continuous surface. In other examples, the interstitial regions and the features are discrete, for example, as is the case for a plurality of depressions in the shape of trenches, which are separated by respective interstitial regions. The separation provided by an interstitial region can be partial or full separation. Interstitial regions may have a surface material that differs from the surface material of the depressions or the protrusions. For example, depressions can have a polymer and a first primer set therein, and the interstitial regions can have a polymer and a second primer set thereon. For another example, depressions of an array can have beads therein while the interstitial regions do not have beads thereon.
[0090] As used herein, a negative photoresist refers to a light-sensitive material in which a portion that is exposed to light of particular wavelength(s) becomes insoluble to a developer. In these examples, the insoluble negative photoresist has less than 5% solubility in the developer. With the negative photoresist, the light exposure changes the chemical structure so that the exposed portions of the material becomes less soluble (than non-exposed portions) in the developer. While not soluble in the developer, the insoluble negative photoresist may be at least 95% soluble in a remover that is different from the developer. The remover may be a solvent or solvent mixture used, e.g., in a lift-off process.
[0091] In contrast to the insoluble negative photoresist, any portion of the negative photoresist that is not exposed to light is at least 95% soluble in the developer. In some examples, the portion of the negative photoresist not exposed to light is at least 98%, e.g., 99%, 99.5%, 100%, soluble in the developer.
[0092] Nitrile oxide, as used herein, means a R.sub.aCN+O group in which R.sub.a is defined herein. Examples of preparing nitrile oxide include in situ generation from aldoximes by treatment with chloramide-T or through action of base on imidoyl chlorides [RC(CI)=NOH] or from the reaction between hydroxylamine and an aldehyde.
[0093] Nitrone, as used herein, means a
##STR00008##
group in which R.sub.1, R.sub.2, and R.sub.3 may be any of the Ra and Rb groups defined herein.
[0094] As used herein, a nucleotide includes a nitrogen containing heterocyclic base, a sugar, and one or more phosphate groups. Nucleotides are monomeric units of a nucleic acid sequence. In RNA, the sugar is a ribose, and in DNA, the sugar is a deoxyribose, i.e. a sugar lacking a hydroxyl group that is present at the 2 position in ribose. The nitrogen containing heterocyclic base (i.e., nucleobase) can be a purine base or a pyrimidine base. Purine bases include adenine (A) and guanine (G), and modified derivatives or analogs thereof. Pyrimidine bases include cytosine (C), thymine (T), and uracil (U), and modified derivatives or analogs thereof. The C-1 atom of deoxyribose is bonded to N-1 of a pyrimidine or N-9 of a purine. A nucleic acid analog may have any of the phosphate backbone, the sugar, or the nucleobase altered. Examples of nucleic acid analogs include, for example, universal bases or phosphate-sugar backbone analogs, such as peptide nucleic acid (PNA).
[0095] In some examples, the term over may mean that one component or material is positioned directly on another component or material. When one is directly on another, the two are in contact with each other. In
[0096] In other examples, the term over may mean that one component or material is positioned indirectly on another component or material. By indirectly on, it is meant that a gap or an additional component or material may be positioned between the two components or materials. In
[0097] A patterned resin refers to any polymer that can have depressions and/or protrusions defined therein. Specific examples of resins and techniques for patterning the resins will be described further below.
[0098] As used herein, a positive photoresist refers to a light-sensitive material in which a portion that is exposed to light of particular wavelength(s) becomes soluble to a developer. In these examples, any portion of the positive photoresist exposed to light is at least 95% soluble in the developer. In some examples, the portion of the positive photoresist exposed to light is at least 98%, e.g., 99%, 99.5%, 100%, soluble in the developer. With the positive photoresist, the light exposure changes the chemical structure so that the exposed portions of the material become more soluble (than non-exposed portions) in the developer.
[0099] In contrast to the soluble positive photoresist, any portion of the positive photoresist not exposed to light is insoluble (less than 5% soluble) in the developer. While not soluble in the developer, the insoluble positive photoresist may be at least 95% soluble in a remover that is different from the developer. In some examples, insoluble positive photoresist is at least 98%, e.g., 99%, 99.5%, 100%, soluble in the remover. The remover may be a solvent or solvent mixture used in a lift-off process.
[0100] As used herein, the primer is defined as a single stranded nucleic acid sequence (e.g., single strand DNA or single strand RNA). Some primers, referred to herein as amplification primers, serve as a starting point for template amplification and cluster generation. Other primers, referred to herein as sequencing primers, serve as a starting point for DNA or RNA synthesis. The 5 terminus of the primer may be modified to allow a coupling reaction with a functional group of a polymer. The primer length can be any number of bases long and can include a variety of non-natural nucleotides. In an example, the sequencing primer is a short strand, ranging from 10 to 60 bases, or from 20 to 40 bases.
[0101] A spacer layer, as used herein refers to a material that bonds two components together. In some examples, the spacer layer can be a radiation-absorbing material that aids in bonding, or can be put into contact with a radiation-absorbing material that aids in bonding.
[0102] The term substrate refers to a structure upon which various components of the flow cell (e.g., a polymer, primer(s), etc.) may be added. The substrate may be a wafer, a panel, a rectangular sheet, a die, or any other suitable configuration. The substrate is generally rigid and is insoluble in an aqueous liquid. The substrate may be inert to a chemistry that is used to modify the depressions or that is present in the depressions. For example, a substrate can be inert to chemistry used to form the polymer, to attach the primer(s), etc. The substrate may be a single layer structure (e.g., a base support), or a multi-layered structure (e.g., including a base support and one or more layers over the base support). Examples of suitable substrates will be described further below.
[0103] A thiol functional group refers to SH.
[0104] As used herein, the terms tetrazine and tetrazinyl refer to six-membered heteroaryl group comprising four nitrogen atoms. Tetrazine can be optionally substituted.
[0105] Tetrazole, as used herein, refer to five-membered heterocyclic group including four nitrogen atoms. Tetrazole can be optionally substituted.
[0106] The term transparent, when referencing a base support or layer, refers to a material, e.g., in the form of a substrate or layer, that is transparent to a particular wavelength or range of wavelengths. For example, the material may be transparent to wavelength(s) that are used to chemically change a positive or negative photoresist. Transparency may be quantified using transmittance, i.e., the ratio of light energy falling on a body to that transmitted through the body. The transmittance of a transparent base support or a transparent layer will depend upon the thickness of the base support or layer and the wavelength of light. In the examples disclosed herein, the transmittance of the transparent base support or the transparent layer may range from 0.25 (25%) to 1 (100%). The material of the base support or layer may be a pure material, a material with some impurities, or a mixture of materials, as long as the resulting base support or layer is capable of the desired transmittance. Additionally, depending upon the transmittance of the base support or layer, the time for light exposure and/or the output power of the light source may be increased or decreased to deliver a suitable dose of light energy through the transparent base support and/or layer to achieve the desired effect (e.g., generating a soluble or insoluble photoresist).
Methods and Flow Cells for Sequential Paired-End Sequencing
[0107] An example of the flow cell for sequential paired-end sequencing generally includes a substrate; a functionalized layer over at least a portion of the substrate; and a primer set attached to the functionalized layer. The configuration of the various components of the flow cell may vary, depending in part upon the method used to generate the flow cell. Several example methods will now be described.
[0108]
[0109] In the example shown in
[0110] In an example, the base support 22 may have a diameter ranging from about 2 mm to about 300 mm, or a rectangular sheet or panel having its largest dimension up to about 10 feet ( 3 meters). In an example, the base support 22 is a wafer having a diameter ranging from about 200 mm to about 300 mm. In another example, the substrate is a die having a width ranging from about 0.1 mm to about 10 mm. While example dimensions have been provided, it is to be understood that a base support 22 with any suitable dimensions may be used. For another example, a panel may be used that is a rectangular support, which has a greater surface area than a 300 mm round wafer.
[0111] The resin layer 18 may be deposited over the base support 22 using any suitable deposition technique, including the examples disclosed herein, and cured using conditions suitable for the resin. Some examples of suitable resins are selected from the group consisting of a polyhedral oligomeric silsesquioxane resin (POSS)-based resin, an epoxy resin, a poly (ethylene glycol) resin, a polyether resin, an acrylic resin, an acrylate resin, a methacrylate resin, and combinations thereof. While several examples have been provided, it is believed that any resin that can be cured may be used.
[0112] As used herein, the term polyhedral oligomeric silsesquioxane (commercially available as POSS from Hybrid Plastics) refers to a chemical composition that is a hybrid intermediate (e.g., RSiO.sub.1.5) between that of silica (SiO.sub.2) and silicone (R.sub.2SiO). An example of polyhedral oligomeric silsesquioxane can be that described in Kehagias et al., Microelectronic Engineering 86 (2009), pp. 776-778, which is incorporated by reference in its entirety. In an example, the composition is an organosilicon compound with the chemical formula [RSiO.sub.3/2].sub.n, where the R groups can be the same or different. Example R groups for polyhedral oligomeric silsesquioxane include epoxy, azide/azido, a thiol, a poly (ethylene glycol), a norbornene, a tetrazine, acrylates, and/or methacrylates, or further, for example, alkyl, aryl, alkoxy, and/or haloalkyl groups. The resin composition disclosed herein may comprise one or more different cage or core structures as monomeric units. The polyhedral structure may be a T.sub.8 structure, such as:
##STR00009##
and represented by:
##STR00010##
This monomeric unit typically has eight arms of functional groups R.sub.1 through R.sub.8.
[0113] The monomeric unit may have a cage structure with 10 silicon atoms and 10 R groups, referred to as T.sub.10, such as:
##STR00011##
or may have a cage structure with 12 silicon atoms and 12 R groups, referred to as T.sub.12, such as:
##STR00012##
The polyhedral oligomeric silsesquioxane-based material may alternatively include T.sub.6, T.sub.14, or T.sub.16 cage structures. The average cage content can be adjusted during the synthesis, and/or controlled by purification methods, and a distribution of cage sizes of the monomeric unit(s) may be used in the examples disclosed herein.
[0114] In some of the examples disclosed herein, at least one of R.sub.1 through R.sub.8 or R.sub.10 or R.sub.12 comprises an epoxy. R.sub.1 through R.sub.8 or R.sub.10 or R.sub.12 may or may not be the same, and in some examples at least one of R.sub.1 through R.sub.8 or R.sub.10 or R.sub.12 comprises epoxy and at least one other of R.sub.1 through R.sub.8 or R.sub.10 or R.sub.12 is a non-epoxy functional group. The non-epoxy functional group may be (a) a reactive group that is orthogonally reactive to an epoxy group (i.e., reacts under different conditions than an epoxy group), that serves as a handle for coupling the resin to an amplification primer, a polymer, or a polymerization agent; or (b) a group that adjusts the mechanical or functional properties of the resin, e.g., surface energy adjustments. In some examples, the non-epoxy functional group is selected from the group consisting of an azide/azido, a thiol, a poly (ethylene glycol), a norbornene, a tetrazine, an amino, a hydroxyl, an alkynyl, a ketone, an aldehyde, an ester group, an alkyl, an aryl, an alkoxy, and a haloalkyl.
[0115] Depending upon the resin layer 18 that is used, the resin layer 18 may be activated using silanization or plasma ashing to generate surface groups that can react with the functionalized layer 20 subsequently deposited thereon (see
[0116] Silanization may be accomplished using any silane or silane derivative. The selection of the silane or silane derivative may depend, in part, upon the functionalized layer 20 that is to be formed, as it may be desirable to form a covalent bond between the silane or silane derivative and the functionalized layer 20. Some example silane derivatives include a cycloalkene unsaturated moiety, such as norbornene, a norbornene derivative (e.g., a (hetero) norbornene including an oxygen or nitrogen in place of one of the carbon atoms), transcyclooctene, transcyclooctene derivatives, transcyclopentene, transcycloheptene, trans-cyclononene, bicyclo [3.3.1]non-1-ene, bicyclo [4.3.1]dec-1 (9)-ene, bicyclo [4.2.1]non-1(8)-ene, and bicyclo[4.2.1]non-1-ene. Any of these cycloalkenes can be substituted, for example, with an R group, such as hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, aryl, heteroaryl, heteroalicycle, aralkyl, or (heteroalicycle) alkyl. An example of the norbornene derivative includes [(5-bicyclo[2.2.1]hept-2-enyl) ethyl]trimethoxysilane. Other example silane derivatives include a cycloalkyne unsaturated moiety, such as cyclooctyne, a cyclooctyne derivative, or bicyclononynes (e.g., bicyclo[6.1.0]non-4-yne or derivatives thereof, bicyclo[6.1.0]non-2-yne, or bicyclo[6.1.0]non-3-yne). These cycloalkynes can be substituted with any of the R groups described herein.
[0117] The method used to attach the silane or silane derivative may vary depending upon the silane or silane derivative that is being used. Examples of suitable silanization methods include vapor deposition (e.g., a YES method), spin coating, or other deposition methods.
[0118] In other examples, plasma ashing rather than silanization may be used to activate the resin layer 18. Plasma ashing may generate surface-activating agent(s) (e.g., hydroxyl (COH or SiOH) and/or carboxyl groups) that can adhere the subsequently deposited functionalized layer 20 to the exposed resin layer 18 in the depressions 12. In these examples, the functionalized layer 20 is selected so that it reacts with the surface groups generated by plasma ashing.
[0119] The hydrophobic layer 16 may be deposited over the resin layer 18 using any suitable deposition technique, including the examples disclosed herein.
[0120] Examples of the hydrophobic layer 16 may be selected from the group consisting of a fluorinated polymer, a perfluorinated polymer, a silicon polymer, and a mixture thereof. As examples, the hydrophobic layer 16 may include an amorphous fluoropolymer (commercially available examples of which include those in the CYTOP series from AGC Chemicals, which have one of the following terminal functional groups: A type: COOH, M type: CONHSi(OR).sub.n or S type: CF.sub.3), a polytetrafluoroethylene (a commercially available example of which is TEFLON from Chemours), parylen, a fluorinated hydrocarbon, a fluoroacrylic copolymer (a commercially available example of which includes as FLUOROPEL from Cytonix).
[0121] The hydrophobic layer 16 is then imprinted (
[0122] In this example method, imprinting is performed through a portion of the depth of the hydrophobic layer 16; and etching removes a remaining portion of the depth of the hydrophobic layer 16, where the resin layer 18 acts as an etch stop.
[0123] The hydrophobic layer 16 may be imprinted using nanoimprint lithography. A nanoimprint lithography mold or working stamp 24 (
[0124] After curing, the working stamp 24 is released. This creates topographic features in the hydrophobic layer 16. In this example method, the working stamp 24 does not extend through the entire depth of the hydrophobic layer 16, and thus a partial depression 12 is formed after the imprinting process. As shown in
[0125] The hydrophobic layer 16 may then be etched to remove the remaining hydrophobic layer portion 16 from the partial depression 12. Any exposed areas of the hydrophobic layer 16 may be etched during this process, as indicated by the downward arrows in
[0126] While
[0127] Many different layouts for an array of depressions 12 may be envisaged, including regular, repeating, and non-regular patterns. In an example, the depressions 12 are disposed in a hexagonal grid for close packing and improved density. Other layouts may include, for example, rectilinear (rectangular) layouts, triangular layouts, and so forth. In some examples, the layout or pattern can be an x-y format of depressions 12 that are in rows and columns. In some other examples, the layout or pattern can be a repeating arrangement of depressions 12 and/or interstitial regions 26. In still other examples, the layout or pattern can be a random arrangement of depressions 12 and/or interstitial regions 26. The pattern may include spots, stripes, swirls, lines, triangles, rectangles, circles, arcs, checks, plaids, diagonals, arrows, squares, and/or cross-hatches.
[0128] The layout or pattern of the depressions 12 may be characterized with respect to the density of the depressions 12 (number of depressions 12) in a defined area. For example, the depressions 12 may be present at a density of approximately 2 million per mm.sup.2. The density may be tuned to different densities including, for example, a density of about 100 per mm.sup.2, about 1,000 per mm.sup.2, about 0.1 million per mm.sup.2, about 1 million per mm.sup.2, about 2 million per mm.sup.2, about 5 million per mm.sup.2, about 10 million per mm.sup.2, about 50 million per mm.sup.2, or more, or less. It is to be further understood that the density of depressions 12 in the hydrophobic layer 16 (or in other layers described herein) can be between one of the lower values and one of the upper values selected from the ranges above. As examples, a high density array may be characterized as having depressions 12 separated by less than about 100 nm, a medium density array may be characterized as having depressions 12 separated by about 400 nm to about 1 m, and a low density array may be characterized as having depressions 12 separated by greater than about 1 m. While example densities have been provided, it is to be understood that any suitable densities may be used. The density of the depressions 12 may depend, in part, on the depth of the depressions 12. In some instances, it may be desirable for the spacing between depressions 12 to be even greater than the examples listed herein.
[0129] The layout or pattern of the depressions 12 may also or alternatively be characterized in terms of the average pitch, or the spacing from the center of the depression 12 to the center of an adjacent depression 12 (center-to-center spacing) or from the left edge of one depression 12 to the right edge of an adjacent depression 12 (edge-to-edge spacing). The pattern can be regular, such that the coefficient of variation around the average pitch is small, or the pattern can be non-regular in which case the coefficient of variation can be relatively large. In either case, the average pitch can be, for example, about 50 nm, about 0.1 m, about 0.5 m, about 1 m, about 5 m, about 10 m, about 100 m, or more or less. The average pitch for a particular pattern of depressions 12 can be between one of the lower values and one of the upper values selected from the ranges above. In an example, the depressions 12 have a pitch (center-to-center spacing) of about 1.5 m. While example average pitch values have been provided, it is to be understood that other average pitch values may be used.
[0130] The size of each depression 12 may be characterized by its volume, opening area, depth, and/or diameter.
[0131] Each depression 12 can have any volume that is capable of confining a fluid. The minimum or maximum volume can be selected, for example, to accommodate the throughput (e.g., multiplexity), resolution, labeled nucleotides, or analyte reactivity expected for downstream uses of the flow cell 10A. For example, the volume can be at least about 110.sup.3 m.sup.3, at least about 1.sup.102 m.sup.3, at least about 0.1 m.sup.3, at least about 1 m.sup.3, at least about 10 m.sup.3, at least about 100 m.sup.3, or more. Alternatively or additionally, the volume can be at most about 110.sup.4 m.sup.3, at most about 110.sup.3 m.sup.3, at most about 100 m.sup.3, at most about 10 m.sup.3, at most about 1 m.sup.3, at most about 0.1 m.sup.3, or less.
[0132] The area occupied by each depression opening can be selected based upon similar criteria as those set forth above for the volume. For example, the area for each depression opening can be at least about 110.sup.3 m.sup.2, at least about 110.sup.2 m.sup.2, at least about 0.1 m.sup.2, at least about 1 m.sup.2, at least about 10 m.sup.2, at least about 100 m.sup.2, or more. Alternatively or additionally, the area can be at most about 110.sup.3 m.sup.2, at most about 100 m.sup.2, at most about 10 m.sup.2, at most about 1 m.sup.2, at most about 0.1 m.sup.2, at most about 110.sup.2 m.sup.2, or less. The area occupied by each depression opening can be greater than, less than or between the values specified above.
[0133] The depth of each depression 12 can large enough to house some of the functionalized layer 20. In an example, the depth may be at least about 0.1 m, at least about 0.5 m, at least about 1 m, at least about 10 m, at least about 100 m, or more. Alternatively or additionally, the depth can be at most about 110.sup.3 m, at most about 100 m, at most about 10 m, or less. In some examples, the depth is about 0.4 m. The depth of each depression 12 can be greater than, less than or between the values specified above.
[0134] In some instances, the diameter or length and width of each depression 12 can be at least about 50 nm, at least about 0.1 m, at least about 0.5 m, at least about 1 m, at least about 10 m, at least about 100 m, or more. Alternatively or additionally, the diameter or length and width can be at most about 110.sup.3 m, at most about 100 m, at most about 10 m, at most about 1 m, at most about 0.5 m, at most about 0.1 m, or less (e.g., about 50 nm). In some examples, the diameter is, or each of the length and width is about 0.4 m. The diameter or length and width of each depression 12 can be greater than, less than or between the values specified above.
[0135] Referring back to
[0136] The functionalized layer 20 may be any gel material that can swell when liquid is taken up and can contract when liquid is removed, e.g., by drying. In an example, the gel material is a polymeric hydrogel. In an example, the polymeric hydrogel includes an acrylamide copolymer, such as poly (N-(5-azidoacetamidylpentyl) acrylamide-co-acrylamide, PAZAM. PAZAM and some other forms of the acrylamide copolymer are represented by the following structure (I):
wherein:
##STR00013##
[0137] R.sup.A is selected from the group consisting of azido, optionally substituted amino, optionally substituted alkenyl, optionally substituted alkyne, halogen, optionally substituted hydrazone, optionally substituted hydrazine, carboxyl, hydroxy, optionally substituted tetrazole, optionally substituted tetrazine, nitrile oxide, nitrone, sulfate, and thiol;
[0138] R.sup.B is H or optionally substituted alkyl;
[0139] R.sup.C, R.sup.D, and R.sup.E are each independently selected from the group consisting of H and optionally substituted alkyl;
[0140] each of the (CH.sub.2).sub.p- can be optionally substituted;
[0141] p is an integer in the range of 1 to 50 ;
[0142] n is an integer in the range of 1 to 50,000; and
[0143] m is an integer in the range of 1 to 100,000.
[0144] One of ordinary skill in the art will recognize that the arrangement of the recurring n and m features in structure (I) are representative, and the monomeric subunits may be present in any order in the polymer structure (e.g., random, block, patterned, or a combination thereof).
[0145] The molecular weight of PAZAM and other forms of the acrylamide copolymer may range from about 5 kDa to about 1500 kDa or from about 10 kDa to about 1000 kDa, or may be, in a specific example, about 312 kDa.
[0146] In some examples, PAZAM and other forms of the acrylamide copolymer are linear polymers. In some other examples, PAZAM and other forms of the acrylamide copolymer are a lightly cross-linked polymers.
[0147] In other examples, the initial polymeric hydrogel may be a variation of the structure (I). In one example, the acrylamide unit may be replaced with N,N-dimethylacrylamide
##STR00014##
In this example, the acrylamide unit in structure (I) may be replaced with
##STR00015##
where R.sup.D, R.sup.E, and R.sup.F are each H or a C1-C6 alkyl, and R.sup.G and R.sup.H are each a C1-C6 alkyl (instead of H as is the case with the acrylamide). In this example, q may be an integer in the range of 1 to 100,000. In another example, the N,N-dimethylacrylamide may be used in addition to the acrylamide unit. In this example, structure (I) may include
##STR00016##
in addition to the recurring n and m features, where R.sup.D, R.sup.E, and R.sup.F are each H or a C1-C6 alkyl, and R.sup.G and R.sup.H are each a C1-C6 alkyl. In this example, q may be an integer in the range of 1 to 100,000.
[0148] As another example of the polymeric hydrogel, the recurring n feature in structure (I) may be replaced with a monomer including a heterocyclic azido group having structure (II):
##STR00017##
wherein R.sup.1 is H or a C1-C6 alkyl; R.sub.2 is H or a C1-C6 alkyl; L is a linker including a linear chain with 2 to 20 atoms selected from the group consisting of carbon, oxygen, and nitrogen and 10 optional substituents on the carbon and any nitrogen atoms in the chain; E is a linear chain including 1 to 4 atoms selected from the group consisting of carbon, oxygen and nitrogen, and optional substituents on the carbon and any nitrogen atoms in the chain; A is an N substituted amide with an H or a C1-C4 alkyl attached to the N; and Z is a nitrogen containing heterocycle. Examples of Z include 5 to 10 carbon-containing ring members present as a single cyclic structure or a fused structure. Some specific examples of Z include pyrrolidinyl, pyridinyl, or pyrimidinyl.
[0149] As still another example, the initial polymeric hydrogel may include a recurring unit of each of structure (III) and (IV):
##STR00018##
wherein each of R.sup.1a, R.sup.2a, R.sup.1b and R.sup.2b is independently selected from hydrogen, an optionally substituted alkyl or optionally substituted phenyl; each of R.sup.3a and R.sup.3b is independently selected from hydrogen, an optionally substituted alkyl, an optionally substituted phenyl, or an optionally substituted C7-C14 aralkyl; and each L.sup.1 and L.sup.2 is independently selected from an optionally substituted alkylene linker or an optionally substituted heteroalkylene linker.
[0150] It is to be understood that other molecules may be used to form the functionalized layer 20, as long as they are functionalized to graft oligonucleotide primers thereto. Other examples of suitable functionalized layers include those having a colloidal structure, such as agarose; or a polymer mesh structure, such as gelatin; or a cross-linked polymer structure, such as polyacrylamide polymers and copolymers, silane free acrylamide (SFA), or an azidolyzed version of SFA. Examples of suitable polyacrylamide polymers may be synthesized from acrylamide and an acrylic acid or an acrylic acid containing a vinyl group, or from monomers that form [2+2] photo-cycloaddition reactions. Still other examples of suitable initial polymeric hydrogels include mixed copolymers of acrylamides and acrylates. A variety of polymer architectures containing acrylic monomers (e.g., acrylamides, acrylates etc.) may be utilized in the examples disclosed herein, such as branched polymers, including star polymers, star-shaped or star-block polymers, dendrimers, and the like. For example, the monomers (e.g., acrylamide, acrylamide containing the catalyst, etc.) may be incorporated, either randomly or in block, into the branches (arms) of a star-shaped polymer.
[0151] The gel material of the functionalized layer 20 may be formed using any suitable copolymerization process. The functionalized layer 20 may also be deposited using any of the methods disclosed herein.
[0152] The attachment of the functionalized layer 20 to the activated (e.g., silanized or plasma ashed) surfaces of the resin layer 18 may be through covalent bonding. Covalent linking is helpful for maintaining the primer set 30 (
[0153] In the example flow cell 10A, the primer set 30 is grafted to the functionalized layer 20 in each of the depressions 12. This example primer set 30 includes two different primers 32, 34. It is desirable for the primers 32, 34 to be immobilized to the functionalized layer 20. In some examples, immobilization may be by single point covalent attachment to the functionalized layer 20 at the 5 end of the respective primers 32, 34. Any suitable covalent attachment means known in the art may be used. In some examples, immobilization may be by strong non-covalent attachment.
[0154] Examples of terminated primers that may be used include an alkyne terminated primer, a tetrazine terminated primer, an azido terminated primer, an amino terminated primer, an epoxy or glycidyl terminated primer, a thiophosphate terminated primer, a thiol terminated primer, an aldehyde terminated primer, a hydrazine terminated primer, a phosphoramidite terminated primer, a triazolinedione terminated primer, and a biotin-terminated primer. In some specific examples, a succinimidyl (NHS) ester terminated primer may be reacted with an amine at a surface of the functionalized layer 20, an aldehyde terminated primer may be reacted with a hydrazine at a surface of the functionalized layer 20, or an alkyne terminated primer may be reacted with an azide at a surface of the functionalized layer 20, or an azide terminated primer may be reacted with an alkyne or DBCO (dibenzocyclooctyne) at a surface of the functionalized layer 20, or an amino terminated primer may be reacted with an activated carboxylate group or NHS ester at a surface of the functionalized layer 20, or a thiol terminated primer may be reacted with an alkylating reactant (e.g., iodoacetamine or maleimide) at a surface of the functionalized layer 20, a phosphoramidite terminated primer may be reacted with a thioether at a surface of the functionalized layer 20, or a biotin-modified primer may be reacted with streptavidin at a surface of the functionalized layer 20.
[0155] Each of the primers 32, 34 has a universal sequence for capture and/or amplification purposes. Examples of the primers 32, 34 include P5 and P7 primers, examples of which are used on the surface of commercial flow cells sold by Illumina Inc. for sequencing, for example, on HISEQ, HISEQX, MISEQ, MISEQDX, MINISEQ, NEXTSEQ, NEXTSEQDX, NOVASEQ, ISEQ, GENOME ANALYZER, and other instrument platforms. In an example, the P5 and P7 primers include the following:
TABLE-US-00001 P5:5.fwdarw.3 (SEQ.ID.NO.1) AATGATACGGCGACCACCGA P7:5.fwdarw.3 (SEQ.ID.NO.2) CAAGCAGAAGACGGCATACGA
[0156] For sequential paired end sequencing, each of these primers 32, 34 may also include a cleavage site. The cleavage sites of the primers 32, 34 may be different from each other so that cleavage of the primers 32, 34 does not take place at the same time. Examples of suitable cleavage sites include enzymatically cleavable nucleobases or chemically cleavable nucleobases, modified nucleobases, or linkers (e.g., between nucleobases). The enzymatically cleavable nucleobase may be susceptible to cleavage by reaction with a glycosylase and an endonuclease, or with an exonuclease. One specific example of the cleavable nucleobase is deoxyuracil (dU), which can be targeted by the USER enzyme. In an example, the uracil base may be incorporated at the 7.sup.th base position from the 3 end of the P5 primer (P5U) or of the P7 primer (P7U). Other abasic sites may also be used. Examples of the chemically cleavable nucleobases, modified nucleobases, or linkers include 8-oxoguanine, a vicinal diol, a disulfide, a silane, an azobenzene, a photocleavable group, allyl T (a thymine nucleotide analog having an allyl functionality), allyl ethers, or an azido functional ether.
[0157] The primer set 30 may be pre-grafted to the gel material (of the functionalized layer 20), and thus may be present in the depressions 12 once the functionalized layer 20 is applied.
[0158] In other examples, the primers 32, 34 are not pre-grafted to the functionalized layer 20. In these examples, the primers 32, 34 may be grafted after the functionalized layer 20 is applied. Grafting may be accomplished by flow through deposition (e.g., using a temporarily bound lid), dunk coating, spray coating, puddle dispensing, or by another suitable method that will attach the primer(s) 32, 34 to the functionalized layer 20. Each of these example techniques may utilize a primer solution or mixture, which may include the primer(s) 32, 34 water, a buffer, and a catalyst. With any of the grafting methods, the primers 32, 34 attach to the reactive groups of the functionalized layer 20, and have no affinity for the hydrophobic layer 16.
[0159] Referring now to
[0160] In the example shown in
[0161] The resin layer 18 may be deposited over the base support 22 using any suitable deposition technique, including the examples disclosed herein. Unlike the example in
[0162] The hydrophobic layer 16 and the resin layer 18 are then imprinted to form the depression 12, as shown in
[0163] The hydrophobic and resin layers 16, 18 may then be cured with the working stamp 24 in place. Curing may be performed as described herein using suitable conditions for both the hydrophobic and resin layers 16, 18.
[0164] After curing, the working stamp 24 is released. This creates topographic features in the hydrophobic and resin layers 16, 18. More specifically, in this example, the depression 12 is defined in the hydrophobic layer 16 and in a portion of the resin layer 18. As shown in
[0165] In this example method, the exposed resin layer 18 may then be activated using silanization or plasma ashing. It is desirable for the subsequently applied functionalized layer 20 to attach to the exposed resin layer 18 and not to the hydrophobic layer 16. As such, any plasma ashing used in this example method should activate the exposed resin layer 18 and not the hydrophobic layer 16.
[0166] The functionalized layer 20 and primer set 30 may then be applied using any of the examples described herein.
[0167] Referring now to
[0168] Any example of the base support 22, the resin layer 18, and the hydrophobic layer 16 described herein may be used in the example shown in
[0169] In this example, the resin layer 18 may be deposited over the base support 22, cured, and activated (e.g., via silanization or plasma ashing) as described herein. The hydrophobic layer 16 may then be deposited over the resin layer 18 and cured.
[0170] The lift-off resist 36 may then be applied to the hydrophobic layer 16. Examples of suitable lift-off resists 36 include those that are commercially available from Kayaku Advanced Materials, Inc. (formerly MicroChem), which are based on a polymethylglutarimide platform. The lift-off resist 36 may be spun on or otherwise deposited, cured, and subsequently removed at a desirable time in the process (see
[0171] The additional resin layer 38 may then be applied to the lift-off resist 36. The additional resin layer 38 may be any example set forth herein for the resin layer 18. The additional resin layer 38 may also be deposited using any suitable deposition technique.
[0172] The additional resin layer 38 is then imprinted to form a concave region 40 in the additional resin layer 38. As shown in
[0173] After curing, the working stamp 24 is released. This creates topographic features in the additional resin layer 38. In this example method, the working stamp 24 does not extend through the entire depth (or thickness) of the additional resin layer 38, and thus a portion 38 of the additional resin layer 38 forms the bottom of the concave region 40.
[0174] The concave region 40 is then extended down to a surface of the resin layer 18 by selectively etching the additional resin layer portion 38, a portion of the lift-off resist 36, and a portion of the hydrophobic layer 16. Each of these layers 38 and 36 is selected to have a different etching rate, and thus one layer can act as an etch stop when etching the layer applied directly thereon (e.g., lift-off resist 36 acts as an etch stop when etching the additional resin layer 38). The layers 36 and 16 may have the same etching rate and this may be etched using the same technique. The underlying resin layer 18 may act as an etch stop to the technique used to etch layer 36 and 16.
[0175] For the additional resin layer 38, etching may be performed with an anisotropic oxygen plasma or with a 90% CF.sub.4 and 10% O.sub.2. Any exposed areas of the additional resin layer 38 may be etched during this process, as indicated by the downward arrows in
[0176] For the portion of the lift-off resist 36 adjacent the concave region 40, 100% O.sub.2 plasma etching may be used. Any areas of the lift-off resist 36 that are exposed in the concave region may be etched during this process, as indicated by the downward arrows in
[0177] As depicted in
[0178] The functionalized layer 20 may then be applied using any of the examples described herein, as shown in
[0179] Lift-off of the remaining lift-off resin 36 may then be performed. As shown in
[0180] While not shown in
[0181] While
[0182] Referring now to
[0183] Any example of the base support 22 and the resin layer 18 described herein may be used in the example shown in
[0184] In this example, the resin layer 18 may be deposited over the base support 22, cured, and activated (e.g., via silanization or plasma ashing) as described herein.
[0185] The poly (methyl methacrylate) lift-off layer 42 may then be deposited over the resin layer 18 using any suitable technique, and cured using heat. The poly (methyl methacrylate) lift-off layer 42 is layer of poly (methyl methacrylate). While this example method is described with a poly (methyl methacrylate) lift-off layer 42, it is to be understood that this layer may be another type of lift-off resist. Any of the example lift-off resists for layer 36 may be used instead of the poly (methyl methacrylate) lift-off layer 42.
[0186] The additional resin layer 38 may then be applied to the poly (methyl methacrylate) lift-off layer 42. The additional resin layer 38 may be any example set forth herein for the resin layer 18. The additional resin layer 38 may also be deposited using any suitable deposition technique.
[0187] The additional resin layer 38 is then imprinted to form a concave region 40 in the additional resin layer 38. As shown in
[0188] After curing, the working stamp 24 is released. This creates topographic features in the additional resin layer 38. In this example method, the working stamp 24 does not extend through the entire depth (or thickness) of the additional resin layer 38, and thus a portion 38 of the additional resin layer 38 forms the bottom of the concave region 40.
[0189] The concave region 40 is then extended down to a surface of the resin layer 18 by selectively etching the additional resin layer portion 38 and a portion of the poly (methyl methacrylate) lift-off layer 42. Each of these layers 38 and 42 is selected to have a different etching rate, and thus the poly (methyl methacrylate) lift-off layer 42 acts as an etch stop when etching the additional resin layer 38.
[0190] For the additional resin layer 38, etching may be performed with an anisotropic oxygen plasma. Any exposed areas of the additional resin layer 38 may be etched during this process, as indicated by the downward arrows in
[0191] For the portion of the poly (methyl methacrylate) lift-off layer 42 adjacent the concave region 40, reactive ion etching (e.g., in O.sub.2 or O.sub.2/CHF.sub.3) or CF.sub.4/O.sub.2 plasma etching or 100% O.sub.2 plasma etching may be used. Any areas of the poly (methyl methacrylate) lift-off layer 42 that are exposed in the concave region 40 may be etched during this process, as indicated by the downward arrows in
[0192] As depicted in
[0193] This example method then involves simultaneously etching the additional resin layer 38, and the resin layer 18 that is exposed in the concave region 40. As such, in this example, the additional resin layer 38 and the resin layer 18 may be the same material or different materials that have the same etch rate. The layers 38, 18 may be etched until the additional resin layer 38 is removed, as shown in
[0194] In an alternate method, the additional resin layer 38 and the resin layer 18 may have different etch rates. In this example, the additional resin layer 38 may be etched to expose the underlying poly (methyl methacrylate) lift-off layer 42, and then the resin layer 18 may be etched to form the depression 12.
[0195] The functionalized layer 20 may then be applied using any of the examples described herein, as shown in
[0196] Lift-off of the remaining poly (methyl methacrylate) lift-off layer 42 may then be performed. As shown in
[0197] While not shown in
[0198] While
[0199] Referring now to
[0200] Any example of the base support 22 and the resin layer 18 described herein may be used in the example shown in
[0201] In this example, the resin layer 18 may be deposited over the base support 22, cured, and activated (e.g., via silanization or plasma ashing) as described herein.
[0202] The functionalized layer 20 may then be applied using any of the examples described herein, as shown in
[0203] The lift-off resist 36 may then be applied to the functionalized layer 20. Any of the lift-off resists disclosed herein may be used. The lift-off resist 36 may, for example, be spun on and cured.
[0204] The additional resin layer 38 may then be applied to the lift-off resist 36. The additional resin layer 38 may be any example set forth herein for the resin layer 18. The additional resin layer 38 may also be deposited using any suitable deposition technique.
[0205] As shown in
[0206] After curing, the working stamp 24 is released. This creates topographic features in the additional resin layer 38. In this example method, the working stamp 24 does not extend through the entire depth (or thickness) of the additional resin layer 38, and thus a portion 38 of the additional resin layer 38 remains adjacent to the convex region 44.
[0207] Sequential etching processes are then performed to expose portions of the resin layer 18 that underlie the portion 38 of the additional resin layer 38. The arrows in
[0208] A first of the etching processes removes the portion 38 and some of the additional resin layer 38 in the convex region 44 (e.g., at the top surface of the convex region 44). The underlying lift-off resist 36 acts as an etch stop (e.g., when the portion 38 is removed), as its etch rate is different from the etch rate of the additional resin layer 38. Etching of the additional resin layer 38 may involve an anisotropic oxygen plasma.
[0209] The convex region 44 is then extended down to a surface of the resin layer 18 by selectively etching the lift-off resist 36 and the functionalized layer 20. The selective etching process removes portions of the lift-off resist 36 and the functionalized layer 20 that are not underlying the convex region 44.
[0210] For the portion of the lift-off resist 36 and the functionalized layer 20 that are removed, 100% O.sub.2 plasma etching may be used. Any areas of the lift-off resist 36 and the functionalized layer 20 that are exposed, e.g., adjacent to the convex region 44 may be etched during this process. In this example, the resin layer 18 acts as an etch stop for the lift-off resist etching process. This leaves a portion of the functionalized layer 20 intact beneath the convex region 44 (
[0211] Lift-off of the remaining lift-off resist 36 may then be performed. As shown in
[0212] This example of the flow cell 10E does not include depressions 12. Rather, the functionalized layer 20 forms patches or pads 46 that are isolated by the adjacent interstitial regions 26.
[0213] While not shown in
[0214] While
[0215] Two other examples of the method for forming examples of the flow cell 10F (
[0216] Any example of the base support 22 and the resin layer 18 described herein may be used in the example shown in
[0217] The sacrificial layer 48 may then be applied. Examples of suitable materials for the sacrificial layer 48 include semi-metals, such as silicon, or metals, such as aluminum, copper, titanium, gold, silver, etc., or negative or positive photoresists. In some examples, the semi-metal or metal may be at least substantially pure (<99% pure). In other examples, molecules or compounds of the listed elements may be used, as they provide the desired etch stop or other function in a particular method. For example, oxides of any of the listed semi-metals (e.g., silicon dioxide) or metals (e.g., aluminum oxide) may be used, alone or in combination with the listed semi-metal or metal. These materials may be deposited using any suitable technique disclosed herein.
[0218] The additional resin layer 38 may then be applied to the sacrificial layer 48. The additional resin layer 38 may be any example set forth herein for the resin layer 18. The additional resin layer 38 may also be deposited using any suitable deposition technique.
[0219] As shown in
[0220] After curing, the working stamp 24 is released. This creates topographic features in the additional resin layer 38. In this example method, the working stamp 24 does not extend through the entire depth (or thickness) of the additional resin layer 38, and thus a portion 38 of the additional resin layer 38 remains adjacent to the convex region 44.
[0221] Sequential etching processes are then performed to expose portions of the resin layer 18 that underlie the portion 38 of the additional resin layer 38. The arrows in
[0222] A first of the etching processes removes the portion 38 and some of the additional resin layer 38 in the convex region 44 (e.g., at the top surface of the convex region 44). The underlying sacrificial layer 48 acts as an etch stop (e.g., when the portion 38 is removed), as its etch rate is different from the etch rate of the additional resin layer 38. Etching of the additional resin layer 38 may involve an anisotropic oxygen plasma.
[0223] The convex region 44 is then extended down to a surface of the resin layer 18 by selectively etching the exposed portions of the sacrificial layer 48. As examples, an aluminum sacrificial layer 48 can be removed in acidic or basic conditions, a copper sacrificial layer 48 can be removed using FeCl.sub.3, a photoresist sacrificial layer 48 can be removed using organic solvents, such as acetone, or in basic (pH) conditions; and a silicon sacrificial layer 48 can be removed in basic (pH) conditions. In this example, the resin layer 18 acts as an etch stop for the sacrificial layer etching process.
[0224] One example of the method proceeds from
[0225] In some examples, the additional resin layer 38 and the resin layer 18 may be the same material or different materials that have the same etch rate. The resin layers 38, 18 may be etched simultaneously with an anisotropic oxygen plasma or with a 90% CF.sub.4 and 10% O.sub.2. The layers 38, 18 may be etched until the additional resin layer 38 is removed, as shown in
[0226] In an alternate method, the additional resin layer 38 and the resin layer 18 may have different etch rates. In this example, the additional resin layer 38 may be etched to expose the underlying sacrificial layer 48, and then the resin layer 18 may be etched to extend the convex region 44 down into a portion of the resin layer 18 and so that other portions 18 of the resin layer 18 are exposed.
[0227] A photoresist 50 may then be applied over the remaining portion of the sacrificial layer 48 and the exposed portions 18 of the resin layer 18. The photoresist 50 may be patterned so that insoluble regions 50 remain over the portions 18 of the resin layer 18, as shown in
[0228] In the example shown in
[0229] The functionalized layer 20 may then be applied using any of the examples described herein, as shown in
[0230] Lift-off of the insoluble portions 50 of the photoresist 50 may then be performed. As shown in
[0231] In this flow cell 10F, the functionalized layer 20 remains intact on a protrusion 51 (e.g., portion of the convex region 44 defined in the resin layer 18). In an array, it is to be understood that each protrusion 51 is isolated from each other protrusion 51 by interstitial regions 26. The interstitial regions 26 are also defined in the resin layer 18, but have a smaller height than the protrusion(s) 51.
[0232] While not shown in
[0233] Another example of the method proceeds from
[0234] In the example shown in
[0235] In the example shown in
[0236] The functionalized layer 20 may then be applied using any of the examples described herein, as shown in
[0237] Lift-off of the insoluble portions 50 of the photoresist 50 may then be performed. As shown in
[0238] In this flow cell 10G, the functionalized layer 20 remains intact, and forms patches or pads 46 that are isolated by the adjacent interstitial regions 26. In an array, it is to be understood that each patch or pad 46 is isolated from each other patch or pad 46 by interstitial regions 26.
[0239] While not shown in
Methods and Flow Cells for Simultaneous Paired-End Sequencing
[0240] An example of the flow cell for simultaneous paired-end sequencing generally includes a substrate; two functionalized layers over at least a portion of the substrate; and different primer sets attached to the two functionalized layers.
[0241] In an example, the first primer set includes an un-cleavable first primer and a cleavable second primer; and the second primer set including a cleavable first primer and an un-cleavable second primer.
[0242] Each of the first primer sets 52A, 52B, 52C, and 52D includes an un- cleavable first primer 54 or 54 and a cleavable second primer 56 or 56; and each of the second primer sets 52A, 52B, 52C, and 52D includes a cleavable first primer 58 or 58 and an un-cleavable second primer 60 or 60.
[0243] The un-cleavable first primer 54 or 54 and the cleavable second primer 56 or 56 are oligo pairs, e.g., where the un-cleavable first primer 54 or 54 is a forward amplification primer and the cleavable second primer 56 or 56 is a reverse amplification primer or where the cleavable second primer 56 or 56 is the forward amplification primer and the un-cleavable first primer 54 or 54 is the reverse amplification primer. In each example of the first primer set 52A, 52B, 52C, and 52D, the cleavable second primer 56 or 56 includes a cleavage site 62, while the un-cleavable first primer 54 or 54 does not include a cleavage site 62.
[0244] The cleavable first primer 58 or 58 and the un-cleavable second primer 60 or 60 are also oligo pairs, e.g., where the cleavable first primer 58 or 58 is a forward amplification primer and un-cleavable second primer 60 or 60 is a reverse amplification primer or where the un-cleavable second primer 60 or 60 is the forward amplification primer and the cleavable first primer 58 or 58 is the reverse amplification primer. In each example of the second primer set 52A, 52B, 52C, and 52D, the cleavable first primer 58 or 58 includes a cleavage site 62 or 64, while the un-cleavable second primer 60 or 60 does not include a cleavage site 62 or 64.
[0245] It is to be understood that the un-cleavable first primer 54 or 54 of the first primer set 52A, 52B, 52C, 52D and the cleavable first primer 58 or 58 of the second primer set 52A, 52B, 52C, and 52D have the same nucleotide sequence (e.g., both are forward amplification primers), except that the cleavable first primer 58 or 58 includes the cleavage site 62 or 64 integrated into the nucleotide sequence or into a linker 66 attached to the nucleotide sequence. Similarly, the cleavable second primer 56 or 56 of the first primer set 52A, 52B, 52C, 52D and the un-cleavable second primer 60 or 60 of the second primer set 52A, 52B, 52C, and 52D have the same nucleotide sequence (e.g., both are reverse amplification primers), except that the cleavable second primer 56 or 56 includes the cleavage site 62 integrated into the nucleotide sequence or into a linker 66 attached to the nucleotide sequence.
[0246] It is to be understood that when the first primers 54 and 58 or 54 and 58 are forward amplification primers, the second primers 56 and 60 or 56 and 60 are reverse primers, and vice versa.
[0247] Examples of un-cleavable primers 54, 60 or 54, 60 include the P5and P7 primers as described herein. In some examples, the P5 and P7 primers are un-cleavable primers 54, 60 or 54, 60 because they do not include a cleavage site 62, 62, 64. It is to be understood that any suitable universal sequence can be used as the un-cleavable primers 54, 60 or 54, 60.
[0248] Examples of cleavable primers 56, 58 or 56, 58 include the P5 and P7 (or other universal sequence) primers with the respective cleavage sites 62, 62, 64 incorporated into the respective nucleic acid sequences (e.g.,
[0249] Each primer set 52A and 52A or 52B and 52B or 52C and 52C or 52D and 52D is attached to a respective functionalized layer 20A, 20B over the substrate. In some examples, the functionalized layer 20A, 20B have the same surface chemistry, and any of the techniques set forth herein may be used to graft one set of primers 54, 56 or 54, 56 on the functionalized layer 20A, and another set of primers 58, 60 or 58, 60 on the functionalized layer 20B. In other examples, the functionalized layers 20A, 20B include different surface chemistries (e.g., functional groups) that can selectively react with the respective primers 54, 56 or 54, 56 or 58, 60 or 58, 60. In these other examples, the functionalized layer 20A has a first functional group, and the functionalized layer 20B has a second functional group that is different than the first functional group.
[0250] As mentioned,
[0251] In the example shown in
[0252] In this example, immobilization may be by single point covalent attachment to the respective functionalized layer 20A, 20B at the 5 end of the respective primers 54 and 56 or 58 and 60. Any suitable covalent attachment means known in the art may be used, examples of which are set forth herein for the primers 32, 34.
[0253] Also in the example shown in
[0254] In the example shown in
##STR00019##
[0255] In the example shown in
[0256] The example shown in
[0257] The example shown in
[0258] In any of the examples shown in
[0259] The functionalized layers 20A, 20B represent different areas of the substrate that have different primer sets 52A, 52A, or 52B, 52B, or 52C, 52C, or 52D, 52D attached thereto. The functionalized layers 20A, 20B may include materials with different functional groups. In some instances the different functional groups are surface functional groups of the substrate or functional groups that have been introduced to a surface of the substrate, or may be functional groups of another component (e.g., a polymer layer, a bead, etc.) that is deposited over the substrate.
[0260] In some examples, the functionalized layers 20A, 20B are chemically the same, and any technique disclosed herein may be used to sequentially attach the primers 54, 56 and 58, 60 or 54, 56 and 58, 60 of the respective sets 52A and 52A, or 52B and 52B, or 52C and 52C, or 52D and 52D to the functionalized layers 20A, 20B.
[0261] In still another example, the materials applied to form the functionalized layers 20A, 20B may have the respective primers 54, 56 or 58, 60 pre-grafted thereto, and thus the immobilization chemistries may be the same or different.
[0262] The configuration of the various components of the flow cell may vary, depending in part upon the method used to generate the flow cell. Several example methods will now be described.
[0263] The example of the method shown in
[0264] A depression 12 is defined in the single layer substrate 68 or in the resin layer 18. While a single depression 12 is shown, it is to be understood that a flow cell 10H (
[0265] The depression 12 may be formed in the single layer substrate 68 using any suitable technique, such as photolithography, nanoimprint lithography (NIL), stamping techniques, laser-assisted direct imprinting (LADI) embossing techniques, molding techniques, microetching techniques, etc. The technique used will depend, in part, upon the type of material used. For example, the depression 12 may be microetched into a glass single layer substrate.
[0266] The depression 12 may be formed in the resin layer 18 of the multi-layer substrate using any suitable technique, such as nanoimprint lithography (NIL) or photolithography, etc. The technique used will depend, in part, upon the type of material used.
[0267] One example of forming the depression 12 in the resin layer 18 is depicted in
[0268] Another example of forming the depression 12 in the resin layer 18 utilizes a photoresist 50. In this example the photoresist 50 is applied over the resin layer 18 and is developed (through light exposure and a developer solution as described herein) to define a depression pattern where (developer) soluble photoresist is removed and an interstitial pattern where (developer) insoluble photoresist regions 50 remain over the resin layer 18.
[0269] The resin layer 18 is then etched (indicated by the arrow in
[0270] Depending upon the single layer substrate 68 or resin layer 18 that is used, activation of the exposed surfaces using silanization or plasma ashing may be performed to generate surface groups that can react with the functionalized layers 20A, 20B subsequently deposited over the single layer substrate 68 or resin layer 18 (see, e.g.,
[0271] With the depression 12 formed in the single layer substrate 68 or resin layer 18, this example method continues with the application of a sacrificial layer 48 over a portion of the depression 12. This is depicted in
[0272] The applied sacrificial layer 48 defines a pattern for one of the functionalized layers 20B that is to be subsequently applied to the covered portion of the depression 12. As such, the sacrificial layer 48 may be applied so that it covers a portion of the depression 12, including some of the sidewalls and some of the bottom, while leaving another portion 74 of the depression 12 exposed. The sacrificial layer 48 may also be applied over the interstitial region(s) 26 that is/are adjacent to the sidewall(s) being coated. Coating the interstitial regions 26 may be desirable to ensure that the top most portion of the depression sidewall will be available for subsequent deposition of the functionalized layer 20B.
[0273] In some examples, the sacrificial layer 48 may be fabricated using photolithography process combines with either a lift-off technique or an etching technique. In other examples, selective deposition techniques, such as chemical vapor deposition (CVD) and variations thereof (e.g., low-pressure CVD or LPCVD), atomic layer deposition (ALD), and masking techniques, may be used to deposit the sacrificial layer 48 in the desirable areas. Alternatively, the sacrificial layer 48 may be applied across the single layer substrate 68 or the resin layer 18 (including over all of the depression 12), and then selectively removed (e.g., via masking and etching) from the portion 74 to define the pattern for one of the functionalized layers 20B.
[0274] As shown in
[0275] The sacrificial layer 48 is then removed to expose the portion 76 of the depression 12 that had been covered by the sacrificial layer 48. This is shown in
[0276] As shown in
[0277] In
[0278] The polishing process may be performed with a chemical slurry (including, e.g., an abrasive, a buffer, a chelating agent, a surfactant, and/or a dispersant) which can remove the functionalized layers 20A, 20B from the interstitial regions 26 without deleteriously affecting the underlying substrate 68 or resin layer 18 at those regions 26. Alternatively, polishing may be performed with a solution that does not include the abrasive particles.
[0279] The chemical slurry may be used in a chemical mechanical polishing system to polish the surface of the interstitial regions 26. The polishing head(s)/pad(s) or other polishing tool(s) is/are capable of polishing functionalized layers 20A, 20B that may be present over the interstitial regions 26 while leaving the functionalized layers 20A, 20B in the depression(s) 12 at least substantially intact. As an example, the polishing head may be a Strasbaugh ViPRR Il polishing head.
[0280] Cleaning and drying processes may be performed after polishing. The cleaning process may utilize a water bath and sonication. The water bath may be maintained at a relatively low temperature ranging from about 22 C. to about 30 C. The drying process may involve spin drying, or drying via another suitable technique.
[0281] In some examples, the primers 54, 56 or 54, 56 (not shown in
[0282] In other examples, the primers 54, 56 or 54, 56 are not pre-grafted to the functionalized layer 20A. In these examples, the primers 54, 56 or 54, 56 may be grafted after the functionalized layer 20A is applied (e.g., at
[0283] When grafting is performed during the method, grafting may be accomplished using any suitable grafting techniques, such as those disclosed herein. With any of the grafting methods, the primers 54, 56 or 54, 56 react with reactive groups of the functionalized layer 20A or the primers 58, 60 or 58, 60 react with reactive groups of the functionalized layer 20B, and have no affinity for the single layer substrate 68 or the resin layer 18.
[0284] While
[0285] The processes of the method shown in
[0286]
[0287] Generally, each of these methods includes imprinting a resin layer 18 or 38 to form a concave region 40 including a deep portion 78 and a shallow portion 80 defined by a step portion 82, wherein the resin layer 18 or 38 is positioned over a multi-layer stack 14 including at least two layers (e.g., 42 and 48, or 48 and 38, or 42, 48, and 38) having differential etching rates, which is positioned over a base support 22; selectively etching the resin layer 18 or 38 and the at least two layers to form a depression 12 adjacent to the deep portion 78; applying a first functionalized layer 20A to the depression 12; selectively etching the resin layer 18 or 38, the at least two layers, or combinations thereof to expose a region underlying the step portion 82; and applying a second functionalized layer 20B to the exposed region. Each of the methods will now be described in reference to the respective set of figures.
[0288] In
[0289] The surface of the base substrate 22 under the sacrificial layer 48 may function like an ashed support, and thus additional activation may not be performed.
[0290] The sacrificial layer 48 may be applied to the base support 22 using any suitable technique disclosed herein. Examples of suitable materials for the sacrificial layer 48 include any of those set forth herein, such as silicon, aluminum, negative or positive photoresists, copper, etc.
[0291] The poly (methyl methacrylate) lift-off layer 42 may then be deposited over the sacrificial layer 48 using any suitable technique, and cured using heat.
[0292] The resin layer 18 may then be applied to the poly (methyl methacrylate) lift-off layer 42. The resin layer 18 may be any example set forth herein, and may be deposited using any suitable deposition technique.
[0293] The resin layer 18 is then imprinted to form a concave region 40, which in this example includes a deep portion 78 and the shallow portion 80 which is defined, in part, by a step portion 82 of the resin layer 18. As shown in
[0294] After curing, the working stamp 24 is released. This creates the various topographic features in the resin layer 18. In this example method, the working stamp 24 does not extend through the entire depth (or thickness) of the resin layer 18 at the deep portion 78, and thus a portion 18 of the resin layer 18 forms the bottom of the concave region 40 at the deep portion 78, as shown in
[0295] A depression 12 (shown in
[0296] Referring to
[0297] For the resin layer 18, etching may be performed with an anisotropic oxygen plasma. Any exposed areas of the resin layer 18 may be etched during this process, as indicated by the downward arrows in
[0298] For the portion of the poly (methyl methacrylate) lift-off layer 42 that underlies the resin layer portion 18, reactive ion etching (e.g., in O.sub.2 or O.sub.2/CHF.sub.3) or CF.sub.4/O.sub.2 plasma etching or 100% O.sub.2 plasma etching may be used. Any areas of the poly (methyl methacrylate) lift-off layer 42 that are exposed in the concave region 40 may be etched during this process. The sacrificial layer 48 acts as an etch stop in the deep portion 78 of the concave region 40 when the portion of the poly (methyl methacrylate) lift-off layer 42 is removed. As depicted in
[0299] The deep portion 78 is then further extended down to a surface of the base support 22, which forms a depression 12 in the sacrificial layer 48 adjacent to the deep portion 78. This may involve selectively etching the exposed portions of the sacrificial layer 48 (which are adjacent to the deep portion 78). In this example, the base support 22 acts as an etch stop for the sacrificial layer etching process.
[0300] This example method then involves extending the shallow portion 80 of the concave region 40 down to a surface of the sacrificial layer 48 by selectively etching the step portion 82 and another portion of the poly (methyl methacrylate) lift-off layer 42 (that underlies the step portion 82).
[0301] For the resin layer 18, etching may again be performed with an anisotropic oxygen plasma. Any exposed areas of the resin layer 18 may be etched during this process, as indicated by the downward arrows in
[0302] For the portion of the poly (methyl methacrylate) lift-off layer 42 that underlies the step portion 82, reactive ion etching (e.g., in O.sub.2 or O.sub.2/CHF.sub.3) or CF.sub.4/O.sub.2 plasma etching or 100% O.sub.2 plasma etching may be used. Any areas of the poly (methyl methacrylate) lift-off layer 42 that are exposed in the concave region 40 may be etched during this process. The sacrificial layer 48 acts as an etch stop in the shallow portion 80 of the concave region 40 when the portion of the poly (methyl methacrylate) lift-off layer 42 is removed. As depicted in
[0303] As shown in
[0304] The sacrificial layer 48 adjacent to the shallow portion 80 is then removed to expose another portion of the base support 22 that is adjacent to the functionalized layer 20A over the base support 22. This is depicted in
[0305] As shown in
[0306] Lift-off of the remaining poly (methyl methacrylate) lift-off layer 42 may then be performed. As shown in
[0307] As depicted by the downward arrows in
[0308] In some examples, the primers 54, 56 or 54, 56 (not shown in
[0309] Similarly, the primers 58, 60 or 58, 60 (not shown in
[0310] In other examples, the primers 54, 56 or 54, 56 are not pre-grafted to the functionalized layer 20A. In these examples, the primers 54, 56 or 54, 56 may be grafted after the functionalized layer 20A is applied (e.g., at
[0311] When grafting is performed during the method, grafting may be accomplished using any suitable grafting techniques, such as those disclosed herein. With any of the grafting methods, the primers 54, 56 or 54, 56 react with reactive groups of the functionalized layer 20A or the primers 58, 60 or 58, 60 react with reactive groups of the functionalized layer 20B, and have no affinity for the base support 22.
[0312] In this example of the flow cell 101, the functionalized layers 20A, 20B are not confined within a depression 12 (like in flow cell 10H). Rather, the functionalized layers 20A, 20B form respective patches or pads 46A, 46B that are isolated by adjacent interstitial regions 26 of the base support 22.
[0313] While
[0314] In
[0315] Prior to forming the multi-layer stack 14 over the base support 22, the base support 22 may be activated using silanization. The surface of the resin layer 38 underlying the sacrificial layer 48 functions like an ashed surface and thus activation of this resin layer 38 is not performed.
[0316] The additional resin layer 38 may be deposited over the base support 22 using any suitable deposition technique, including the examples disclosed herein, and cured using conditions suitable for the resin.
[0317] The sacrificial layer 48 may be applied to the additional resin layer 38 using any suitable technique disclosed herein. Examples of suitable materials for the sacrificial layer 48 include silicon, aluminum, negative or positive photoresists, copper, etc.
[0318] The resin layer 18 may be deposited over the sacrificial layer 48 using any suitable deposition technique, including the examples disclosed herein. The resin layer 18 is then imprinted to form a concave region 40, which in this example includes the deep portion 78 and the shallow portion 80 which is defined, in part, by a step portion 82 of the resin layer 18. As shown in
[0319] After curing, the working stamp 24 is released. This creates the various topographic features in the resin layer 18. In this example method, the working stamp 24 does not extend through the entire depth (or thickness) of the resin layer 18 at the deep portion 78, and thus a portion 18 of the resin layer 18 forms the bottom of the concave region 40 at the deep portion 78.
[0320] A depression 12 (shown in
[0321] Referring to
[0322] The deep portion 78 is then further extended down to a surface of the additional resin layer 38, as shown in
[0323] This example method then involves simultaneously etching the resin layer 18, and the portion 38 of the additional resin layer 38 that is exposed in the concave region 40. As such, the portion 38 of the additional resin layer 38 and the resin layer 18 may be the same material or different materials that have the same etch rate. The layers 18, 38 may be etched until the portion of the sacrificial layer 48 underlying the step portion 82 is exposed, as shown in
[0324] In an alternate method, the additional resin layer 38 and the resin layer 18 may have different etch rates. In one example, the step portion 82 of the resin layer 18 may be etched to expose the underlying sacrificial layer 48 and then the additional resin layer 38 (adjacent the deep portion 78) may be removed to form the depression 12. In another example, the additional resin layer 38 (adjacent the deep portion 78) may be removed to form the depression 12, and then the step portion 82 of the resin layer 18 may be etched to expose the underlying sacrificial layer 48.
[0325] As shown in
[0326] The sacrificial layer 48 adjacent to the shallow portion 80 is then removed to expose another portion 38 of the additional resin layer 38 (see
[0327] As shown in
[0328] The remaining resin layer 18 and sacrificial layer 48 may then be etched, one at a time, using a suitable etchant for the resin layer 18 and then for the sacrificial layer 48. The removal of the remaining resin layer 18 (and any functionalized layer 20A thereon) and sacrificial layer 48 exposes any remaining portions of the additional resin layer 38; which, in this example, are interstitial regions 26. The functionalized layers 20A, 20B remain intact over the additional resin layer 38, in part because the functionalized layers 20A, 20B are covalently attached to the additional resin layer 38.
[0329] In some examples, the primers 54, 56 or 54, 56 (not shown in
[0330] In other examples, the primers 54, 56 or 54, 56 are not pre-grafted to the functionalized layer 20A. In these examples, the primers 54, 56 or 54, 56 may be grafted after the functionalized layer 20A is applied (e.g., at
[0331] When grafting is performed during the method, grafting may be accomplished using any suitable grafting techniques, such as those disclosed herein. With any of the grafting methods, the primers 54, 56 or 54, 56 react with reactive groups of the functionalized layer 20A or the primers 58, 60 or 58, 60 react with reactive groups of the functionalized layer 20B, and have no affinity for the base support 22.
[0332] In this example of the flow cell 10J, one of the functionalized layers 20A is confined within the depression 12 and the other of the functionalized layers 20B is defined over a portion of the interstitial region 26 adjacent to the depression 12.
[0333] While
[0334] In
[0335] Prior to forming the multi-layer stack 14 over the base support 22, the base support 22 may be activated using silanization. The surface of the resin layer 38 underlying the sacrificial layer 48 functions like an ashed surface and thus activation of this resin layer 38 is not performed.
[0336] The additional resin layer 38 may be deposited over the base support 22 using any suitable deposition technique, including the examples disclosed herein, and cured using conditions suitable for the resin.
[0337] The sacrificial layer 48 may be applied to the additional resin layer 38 using any suitable techniques, such as those disclosed herein. Examples of suitable materials for the sacrificial layer 48 include any of those set forth herein, such as silicon, aluminum, negative or positive photoresists, copper, etc.
[0338] The poly (methyl methacrylate) lift-off layer 42 may then be deposited over the sacrificial layer 48 using any suitable technique, and cured using heat.
[0339] The resin layer 18 may then be applied to the poly (methyl methacrylate) lift-off layer 42. The resin layer 18 may be any example set forth herein, and may be deposited using any suitable deposition technique.
[0340] The resin layer 18 is then imprinted to form a concave region 40, which in this example includes a deep portion 78 and the shallow portion 80 which is defined, in part, by a step portion 82 of the resin layer 18. As shown in
[0341] After curing, the working stamp 24 is released. This creates the various topographic features in the resin layer 18. In this example method, the working stamp 24 does not extend through the entire depth of the resin layer 18 at the deep portion 78, and thus a portion 18 of the resin layer 18 forms the bottom of the concave region 40 at the deep portion 78.
[0342] A depression 12 (shown in
[0343] Referring now to
[0344] For the resin layer 18, etching may be performed with an anisotropic oxygen plasma. Any exposed areas of the resin layer 18 may be etched during this process, as indicated by the downward arrows in
[0345] For the portion of the poly (methyl methacrylate) lift-off layer 42 that underlies the resin layer portion 18, reactive ion etching (e.g., in O.sub.2 or O.sub.2/CHF.sub.3) or CF.sub.4/O.sub.2 plasma etching or 100% O.sub.2 plasma etching may be used. Any areas of the poly (methyl methacrylate) lift-off layer 42 that are exposed in the concave region 40 may be etched during this process. The sacrificial layer 48 acts as an etch stop in the deep portion 78 of the concave region 40 when the portion of the poly (methyl methacrylate) lift-off layer 42 is removed. As depicted in
[0346] Prior to etching the sacrificial layer 48 in the deep portion 78, this example method may further include etching the resin layer 18 to remove the step portion 82 and expose a second portion of the poly (methyl methacrylate) lift-off layer 42. This is depicted in
[0347] The deep portion 78 is then further extended down to a surface of the additional resin layer 38, which forms a depression 12 in the additional resin layer 38 adjacent to the deep portion 78. This is shown in
[0348] This example method may further include etching the poly (methyl methacrylate) lift-off layer 42 in the shallow portion 80. This is depicted in
[0349] As shown in
[0350] The sacrificial layer 48 adjacent to the shallow portion 80 is then removed to expose another portion of the additional resin layer 38 that is adjacent to the functionalized layer 20A over the additional resin layer 38. This is depicted in
[0351] As shown in
[0352] Lift-off of the remaining poly (methyl methacrylate) lift-off layer 42 may then be performed. As shown in
[0353] As depicted by the downward arrows in
[0354] In some examples, the primers 54, 56 or 54, 56 (not shown in
[0355] In other examples, the primers 54, 56 or 54, 56 are not pre-grafted to the functionalized layer 20A. In these examples, the primers 54, 56 or 54, 56 may be grafted after the functionalized layer 20A is applied (e.g., at
[0356] When grafting is performed during the method, grafting may be accomplished using any suitable grafting techniques, such as those disclosed herein. With any of the grafting methods, the primers 54, 56 or 54, 56 react with reactive groups of the functionalized layer 20A or the primers 58, 60 or 58, 60 react with reactive groups of the functionalized layer 20B, and have no affinity for the additional resin layer 38.
[0357] In this example of the flow cell 10K, the functionalized layers 20A, 20B are not confined within a depression 12 (like in flow cell 10H). Rather, the functionalized layers 20A, 20B form respective patches or pads 46A, 46B that are isolated by adjacent interstitial regions 26 of the additional resin layer 38.
[0358] While
[0359] Still other example methods for making other examples of the flow cell 10L, 10M are shown in
[0360] As shown at
[0361] As shown in
[0362] In
[0363] As shown in
[0364] A timed dry etching process may then be used to remove portions of the photoresist 50 and the functionalized layer 20A from the single layer substrate 68, including from the surfaces, the shallow portion 80, and from a portion of the deep portion 78. As shown in
[0365] During the etching of the photoresist 50, the functionalized layer 20A may also be removed. A combustion reaction may be taking place, where the functionalized layer 20A is converted to carbon dioxide and water and is evacuated from the etching chamber.
[0366] As depicted by the downward arrow in
[0367] As shown in
[0368] Removal of the photoresist 50 may then be performed. As shown in
[0369] In
[0370] Referring back to
[0371] Rather, this example method then continues at
[0372] Removal of the photoresist 50 may then be performed. As shown in
[0373] In
[0374] In some examples, the primers 54, 56 or 54, 56 (not shown in
[0375] In other examples, the primers 54, 56 or 54, 56 are not pre-grafted to the functionalized layer 20A. In these examples, the primers 54, 56 or 54, 56 may be grafted after the functionalized layer 20A is applied (e.g., at
[0376] When grafting is performed during the method, grafting may be accomplished using any suitable grafting techniques, such as those disclosed herein. With any of the grafting methods, the primers 54, 56 or 54, 56 react with reactive groups of the functionalized layer 20A or the primers 58, 60 or 58, 60 react with reactive groups of the functionalized layer 20B, and have no affinity for the single layer substrate 68.
[0377] In these examples of the flow cell 10L, 10M, the functionalized regions 84, 86 are confined within a depression. In
[0378] Still another example method for making another example of the flow cell 10N is shown in
[0379] At the outset of the method shown in
[0380] As shown at
[0381] Referring to
[0382] For the resin layer 18, etching may be performed with an anisotropic oxygen plasma. Any exposed areas of the resin layer 18 may be etched during this process, as indicated by the downward arrows in
[0383] As shown in
[0384] The first functionalized layer 20A is then patterned to form a first functionalized region (region 84) covered by a photoresist 50. Any photoresist may be used. In other examples, a lift-off resist is used instead of a photoresist.
[0385] As shown in
[0386] A timed dry etching process may then be used to remove portions of the photoresist 50 and the functionalized layer 20A from the resin layer 18, including from the shallow portion 80 and from a portion of the deep portion 78. As shown in
[0387] During the etching of the photoresist 50, the functionalized layer 20A may also be removed. A combustion reaction may be taking place, where the functionalized layer 20A is converted to carbon dioxide and water and is evacuated from the etching chamber.
[0388] As depicted by the downward arrow in
[0389] As shown in
[0390] Removal of the photoresist 50 may then be performed. As shown in
[0391] In
[0392] In some examples, the primers 54, 56 or 54, 56 (not shown in
[0393] In other examples, the primers 54, 56 or 54, 56 are not pre-grafted to the functionalized layer 20A. In these examples, the primers 54, 56 or 54, 56 may be grafted after the functionalized layer 20A is applied (e.g., at
[0394] When grafting is performed during the method, grafting may be accomplished using any suitable grafting techniques, such as those disclosed herein. With any of the grafting methods, the primers 54, 56 or 54, 56 react with reactive groups of the functionalized layer 20A or the primers 58, 60 or 58, 60 react with reactive groups of the functionalized layer 20B, and have no affinity for the single layer substrate 68.
[0395] In this example of the flow cell 10N, the functionalized regions 84, 86 are confined within a depression including portions of 12A and 12B (like in flow cell 10H). In an array, respective regions 84, 86 within a depression may be isolated from respective regions 84, 86 within another depression by adjacent interstitial regions 26.
[0396] To further illustrate the present disclosure, an example is given herein. It is to be understood that this example is provided for illustrative purposes and is not to be construed as limiting the scope of the present disclosure.
NON-LIMITING WORKING EXAMPLE
[0397] An example of the method described in reference to
[0398] In this example, glass was used as the base support, and a multi-layer stack positioned over the glass. The multi-layer stack included a first layer of a nanoimprint lithography resin, an aluminum sacrificial layer, a poly (methyl methacrylate) lift-off layer, and a second layer of the nanoimprint lithography resin.
[0399] A working stamp was used to pattern the second layer of the nanoimprint lithography resin similarly to that shown in
[0400] PAZAM was then deposited. All of the depressions were coated, along with any exposed portions of layers of the multi-layer stack. P5 primers were then grafted to the PAZAM. Any unreacted azides were quenched by grafting hexynoic acid.
[0401] Selective etching (with KOH) was performed to remove the aluminum sacrificial layer at areas adjacent to the PAZAM (grafted with P5 primers) in the depressions. This exposed an area of the glass directly adjacent to the PAZAM (grafted with P5 primers) patches/pads.
[0402] PAZAM was then deposited under high ionic strength (e.g., in the presence of 10x PBS). This formed patches/pads of PAZAM adjacent to the PAZAM grafted with P5 primers in the depressions. P7 primers were then grafted to the newly PAZAM. The quenched azides on the PAZAM grafted with P5primers kept the P7 primers from grafting thereto.
[0403] The remaining poly (methyl methacrylate) lift-off layer was then lifted off using acetone. The removal of the poly (methyl methacrylate) lift-off layer also removed the PAZAM (grafted with P5 primers) positioned thereon, and exposed any remaining portions of the aluminum sacrificial layer that was adjacent to the patches/pads. The remaining aluminum sacrificial layer was removed using the KOH etching process.
[0404] Oligonucleotides complementary to each of P5 and P7 were then introduced into to the glass substrate with the pads/patches formed thereon. The complementary P5 oligos (P5) had Alexa Fluor 488 dyes (from Thermo Fisher Scientific) attached thereto and the complementary P7 oligos (P7) had Alexa Fluor 647 dyes (from Thermo Fisher Scientific) attached thereto. The respective oligos were hybridized to the respective primers. The surface was exposed to a 488 nm laser and a micrograph image was taken. This image is shown in black and white in
[0405] The grey areas in each of
[0406] The images in
Additional Notes
[0407] It should be appreciated that all combinations of the foregoing concepts and additional concepts discussed in greater detail below (provided such concepts are not mutually inconsistent) are contemplated as being part of the inventive subject matter disclosed herein. In particular, all combinations of claimed subject matter appearing at the end of this disclosure are contemplated as being part of the inventive subject matter disclosed herein. It should also be appreciated that terminology explicitly employed herein that also may appear in any disclosure incorporated by reference should be accorded a meaning most consistent with the particular concepts disclosed herein.
[0408] Reference throughout the specification to one example, another example, an example, and so forth, means that a particular element (e.g., feature, structure, and/or characteristic) described in connection with the example is included in at least one example described herein, and may or may not be present in other examples. In addition, it is to be understood that the described elements for any example may be combined in any suitable manner in the various examples unless the context clearly dictates otherwise.
[0409] While several examples have been described in detail, it is to be understood that the disclosed examples may be modified. Therefore, the foregoing description is to be considered non-limiting.