NUCLEIC ACID APTAMER SPECIFICALLY RECOGNIZING B-LACTOGLOBULIN AND USE THEREOF
20220340905 · 2022-10-27
Inventors
Cpc classification
G01N33/5308
PHYSICS
C12N15/115
CHEMISTRY; METALLURGY
International classification
C12N15/115
CHEMISTRY; METALLURGY
Abstract
The present invention provides a nucleic acid aptamer specifically recognizing 3-lactoglobulin and use thereof. The nucleic acid aptamer has a sequence as shown in SEQ ID NO:1, a sequence having 60% or higher homology to the sequence as shown in SEQ ID NO:1 and specifically recognizing β-lactoglobulin, or a sequence derived from the sequence as shown in SEQ ID NO:1 and specifically recognizing β-lactoglobulin. The nucleic acid aptamer specifically binds to the allergen β-lactoglobulin in cow milk and dairy products, thereby providing a new tool for the high-sensitivity and low-cost detection of the allergen β-lactoglobulin.
Claims
1. A nucleic acid aptamer specifically recognizing β-lactoglobulin, having a sequence as shown in SEQ ID NO:1, a sequence having 60% or higher homology to the sequence as shown in SEQ ID NO:1 and specifically recognizing β-lactoglobulin, or a sequence derived from the sequence as shown in SEQ ID NO:1 and specifically recognizing β-lactoglobulin.
2. The nucleic acid aptamer specifically recognizing β-lactoglobulin according to claim 1, wherein the nucleotide sequence of the nucleic acid aptamer is modified by any one or more of phosphorylation, methylation, amination, sulfhydrylation, phosphorothioate modification, and side chain modification of glycosyl ring.
3. The nucleic acid aptamer specifically recognizing β-lactoglobulin according to claim 1, wherein the nucleotide sequence of the nucleic acid aptamer is linked with any one or more of a fluorescent marker, a radioactive material, a therapeutic material, biotin, digoxin, a nano-luminescent material, a small peptide, siRNA and an enzyme marker.
4. The nucleic acid aptamer specifically recognizing β-lactoglobulin according to claim 1, wherein the sequence as shown in SEQ ID NO:1 has an intermolecular interaction with β-lactoglobulin, where hydrogen bonding is formed between C-45/T-46 and ARG-40, G-56 and SER-36, C-57 and ASN-63, G-58 and ASN-63/TRP-61, and G-76 and SER-30.
5. A kit, comprising the nucleic acid aptamer according to claim 1.
6. Use of the nucleic acid aptamer according to claim 1 in the detection of β-lactoglobulin, wherein a standard curve for the detection of β-lactoglobulin by the nucleic acid aptamer is plotted by a method comprising: (1) construction of a recognition probe, comprising: uniformly mixing the nucleic acid aptamer and a complementary short chain thereof at a molar ratio of 1:1, and then denaturing; (2) construction of a beacon hairpin molecule, comprising: dissolving a beacon hairpin molecule in a binding buffer and then denaturing; (3) enzymatic digestion and cyclic amplification, comprising: mixing the recognition probe, the beacon hairpin molecule and exonuclease III uniformly, co-incubating with various concentrations of standard β-lactoglobulin solutions for 2-3 h, and determining the fluorescence intensity by a fluorescence spectrometer at an excitation wavelength of 575 nm and an emission wavelength of 606 nm; and (4) plotting of a standard detection curve, comprising: according to the changes in the intensity of the fluorescence signal at various concentrations of β-lactoglobulin, plotting a standard curve for detecting β-lactoglobulin by the nucleic acid aptamer with the logarithm of the concentration of β-lactoglobulin as a horizontal ordinate and the fluorescence intensity as a vertical ordinate.
7. The use according to claim 6, wherein in the step (2), the beacon hairpin molecule is denatured at 95° C. for 10 min, and then gradually cooled to 37° C. for 3 h.
8. The use according to claim 6, wherein in the step (3), the incubation time is 2 h, and the volume of the incubation system is 400 μL; the concentration of the beacon hairpin molecule is 400 nM, and the enzyme activity of the exonuclease III is 0.25 U/μL.
9. The use according to claim 6, wherein in the step (3), the molar ratio of the recognition probe to the beacon hairpin molecule is 1:2.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0036] Hereinafter, the embodiments of the present invention will be described in detail by way of examples. However, it should be understood by those skilled in the art that the following examples are for illustrative purposes and not intended to limit the scope of the invention in any way.
[0037] Where no specific conditions are given in the examples, conventional conditions or conditions recommended by the manufacturer are followed. The reagents or instruments for which no manufacturers are noted are all common products commercially available from the market.
Example 1
Design and Synthesis of Large Single-Stranded Oligonucleotide Library and Primers
[0038] A library of single-stranded oligonucleotides with a length of 80 nt having a library size of up to 10.sup.12-10.sup.24 was constructed, where the single-stranded oligonucleotide has a random sequence region of 40 nt in the middle (determining the richness of the library) and a constant sequence region of 20 nt at both ends (a sequence necessary for primer binding). Sequence: 5′-AGCAGCACAGAGGTCAGATG-40 random base -CCTATGCGTGCTACCGTGAA-3′, synthesized by Dalian TaKaRa Bio Co., Ltd.
TABLE-US-00001 Forward primer: 5′-FAM-AGCAGCACAGAGGTCAGATG-3′ Reverse primer: 5′-P-TTCACGGTAGCACGCATAGG-3′ Biotinylated complementary short chain: 5′-Biotin-AGCACGCATAGG-3′
[0039] The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0040] The single-stranded oligonucleotide library and primers were all prepared with TE buffer into 100 μM stock solutions and stored at 31 20° C. for later use.
Example 2
Screening of Aptamer Binding Allergen β-lactoglobulin Based on Capture-SELEX Technology
[0041] First, the single-stranded oligonucleotide library was hybridized with the biotinylated complementary short chain, then immobilized on streptavidin-coupled magnetic beads and co-incubated with the allergen β-lactoglobulin. Single-stranded nucleic acid fell off from the magnetic beads due to the interaction with β-lactoglobulin and were released into the solution. After incubation, the supernatant was used as a template of a secondary library for PCR amplification. The amplified product was enzymatically digested, to produce single strands, which were precipitated in ethanol to obtain the secondary library for the next round of screening. The specific steps were as follows.
[0042] Hybridization of single-stranded oligonucleotide library with biotinylated complementary short chain: The ssDNA library was mixed with the biotinylated complementary short chain at a ratio of 1:1.5 (where the amount of the single-stranded oligonucleotide library used in the first round of screening was 1 nmol, and the amount of the secondary library used in other rounds was 100 pmol), denatured at 95° C. for 10min, and then slowly cooled to 37° C. for 3 h until the two were fully hybridized.
[0043] Immobilization of single-stranded oligonucleotide library: The hybridized mixture was reacted with a certain amount of streptavidin-coupled magnetic beads (where the weight ratio of the nucleic acid library to magnetic beads was 1:400) at 37° C. and 200 rpm for 2 h to immobilize the single-stranded oligonucleotide library on the magnetic beads by the strong binding between the biotin and streptavidin.
[0044] Target incubation: The immobilized single-stranded nucleotide library was incubated with 50 μg/mL β-lactoglobulin in a 300 μL system at 37° C. and 200 rpm, and the relative fluorescence enrichment rate of each screening cycle was calculated. According to the results of fluorescence monitoring during the screening process, in the sixth and tenth rounds, a counter screening process was added. Before incubation with the target, coexisting substances (α-lactalbumin, and casein) and structural analogs (BSA, and IgG) were introduced into the system to increase the screening stress to obtain sequences with better affinity and specificity.
[0045] PCR amplification and verification: After magnetic separation, the supernatant after incubation with the target was obtained, which was used as a template for PCR amplification. Amplification system: 1 μL template, 0.5 μL Taq DNA polymerase (5U/μL), 5 μL 10× polymerase buffer (containing 20 mM MgCl.sub.2), 0.5 μL forward and reverse primers, 1 μL dNTP Mix (5 mM), and 42 μL ddH.sub.2O. Amplification procedure includes pre-denaturation at 95° C. for 5 min, 10 cycles of denaturation at 95° C. for 30 s, annealing at 58° C. for 30 s, and extension at 72° C. for 30 s, and final extension at 72° C. for 5 min, and storage at 4° C. After verification by 8% non-denaturing polyacrylamide gel electrophoresis, whether the electrophoresis band is single and bright and whether the band is at the 80 bp were observed to ensure the success of the PCR amplification of the template.
[0046] Preparation of secondary library of single-stranded oligonucleotide: After the amplified product was purified, the antisense strand of the phosphorylated PCR product was specifically digested with lambda exonuclease to prepare single strands. The digestion conditions included 350 μL PCR amplified product, 35 μL exonuclease buffer, 2 μL lambda exonuclease, and reaction at 37° C. The digestion process was determined by electrophoresis on 8% denaturing polyacrylamide gel (containing 7M urea). When the reaction was over, the reaction was terminated by inactivating the enzyme at 75° C. for 10 min. After phenol/chloroform purification and ethanol precipitation, a secondary library of single-stranded oligonucleotides was obtained.
[0047] Cloning and sequencing: According to the fluorescence enrichment rate during the screening process (as shown in
Example 3
Affinity and Specificity Analysis
(1) Affinity Analysis Based on Isothermal Titration Calorimetry (ITC)
[0048] PEAQ-ITC (Malvern Instruments Co., Ltd.) was used to analyze the binding ability of 10 candidate sequences. 300 μL of β-lactoglobulin solution (6 μM) was injected into the sample cell, and 38 μL of the candidate sequence solution (100 μM) was taken by the injection needle. The program was set such that the volume of the initial first drop titrated by the injection needle was 0.4 μL (to avoid the reaction of the sample in the top of the injection needle with the sample in the sample cell to affect the final result). Then 18 drops were injected and each drop was 2 μL, with an interval of 150 s. The rotation speed of the injection needle was 750 rpm to ensure sufficient reaction upon each injection. At the same time, the dilution heat caused by the titration of the buffer into the β-lactoglobulin solution was eliminated. The binding force and thermodynamic parameters in the binding process were obtained by fitting in the PEAQ-ITC analysis software.
[0049] The buffer used in the isothermal titration calorimetry (ITC) was 10 mM Tris-HCl, pH 7.4.
[0050] As a result, it was found that the aptamer (Lg-18) has the best ability of binding to β-lactoglobulin. The sequence of the aptamer (Lg-18) is shown below.
TABLE-US-00002 Lg-18 (SEQ ID NO: 1): AGCAGCACAGAGGTCAGATGTTCGGCCTTTGCGTTAACGAACTTCTAG CTATGCGGCGTACCTATGCGTGCTACCGTGAA
[0051] The analysis result by ITC of the aptamer (Lg-18) is shown in
[0052] In the upper panel of
[0053] In the lower panel of
[0054] In addition, the homologous sequences (Lg-9 and Lg-16) of the aptamer Lg-18 also have good ability of binding to β-lactoglobulin.
[0055] The sequences of Lg-9 and Lg-16 were as follows:
TABLE-US-00003 Lg-9 (SEQ ID NO: 2): AGCAGCACAGAGGTCAGATGGTTTTGTTGGGTCTGCTACGGACTTTGT TGACCTTTGCTCCCTATGCGTGCTACCGTGAA Lg-16 (SEQ ID NO: 3): AGCAGCACAGAGGTCAGATGTCGTTTGTGGCTGTCAATTGGTGTGTTT ACCTGTTTTGGCCTATGCGTGCTACCGTGAA
(2) Affinity and Specificity Analysis of Aptamer Recognition Based on Magnetic Separation
[0056] The aptamers used were Lg-18, Lg-9, and Lg-16 where the sequence was modified with a FAM fluorophore or other fluorescent molecules at the 5′ terminal.
[0057] Various concentrations (10 nM, 25 nM, 50 nM, 75 nM, 100 nM, 150 nM, 200 nM, and 300 nM) of the aptamer were respectively mixed with the biotinylated complementary short chain at a molar ratio of 1:1.5, denatured at 95° C. for 10 min, and slowly cooled to 37° C. for 3 h until the two were fully hybridized. The mixture was reacted with a certain amount of streptavidin-coupled magnetic beads (where the weight ratio of the aptamer to the magnetic beads was 1:400) at 37° C. and 200 rpm for 2 h to immobilize the aptamer on the magnetic beads by the strong binding between the biotin and streptavidin. The immobilized magnetic beads were incubated with 50 μg/mL β-lactoglobulin in a 300 μL system at 37° C. and 200 rpm. After magnetic separation, the supernatant was subjected to fluorescence measurement at an excitation wavelength of 485 nm and an emission wavelength of 522 nm. The relative fluorescence intensity at various aptamer concentrations was nonlinearly fitted by GraphPad prism 5.0 software, and the dissociation constant Kd of the aptamer was calculated (see Table 1).
[0058] The specificity of the aptamer (Lg-18) was evaluated by the same method. 200 nM aptamer was immobilized on the magnetic beads and incubated respectively with 50 μg/mL coexisting substances (α-lactalbumin and casein) and structural analogues (BSA and IgG). After magnetic separation, the fluorescence intensity of the supernatant was measured respectively, and then the specificity of the aptamer was evaluated. The results are shown in
TABLE-US-00004 TABLE 1 Sequence Dissociation constant Kd (nM) Lg-9 71.85 ± 16.06 Lg-16 65.85 ± 15.16 Lg-18 65.00 ± 27.42
Example 4
[0059] Sensitive Detection and Analysis of β-lactoglobulin Based on Recognition by Nucleic Acid Aptamer
[0060] Construction of a recognition probe (Lg-18): The nucleic acid aptamer was uniformly mixed with the complementary short chain thereof at a molar ratio of 1:1, denatured at 95° C. for 10 min, and then slowly cooled to 37° C. for 3 h until the two were fully hybridized.
[0061] Construction of a beacon hairpin molecule: A beacon hairpin molecule was dissolved in a binding buffer (100 mM NaCl, pH7.4), denatured at 95° C. for 10 min, and then gradually cooled to 37° C. for 3 h to ensure that a hairpin structure was fully formed.
TABLE-US-00005 Beacon hairpin molecule: 5′-ROX-ACCTCTGTATCGACATTCACAGAGGT- BHQ2 (labeled on base T)-CAGATGTT-3′
[0062] Enzymatic digestion and cyclic amplification: The recognition probe (200 nM), the beacon hairpin molecule (400 nM) and exonuclease III (0.25 U/μL) were uniformly mixed and co-incubated respectively with various concentrations (20 ng/mL, 50 ng/mL, 100 ng/mL, 200 ng/mL, 500 ng/mL, 1000 ng/mL, 2000 ng/mL, and 5000 ng/mL) of standard β-lactoglobulin solutions for 2 h in an incubation system of 400 μL. When to-be-detected β-lactoglobulin was present in the system, due to the stronger binding between the nucleic acid aptamer and β-lactoglobulin than the interaction between the aptamer and the complementary short chain, the complementary short chain fell off from the aptamer, and bound to the 3′ terminus of the beacon hairpin molecule to form a double-stranded region. Therefore, the beacon hairpin molecule was opened and the fluorescence was restored. At the same time, the exonuclease III in the system acted on the double-stranded region, to digest the single-stranded oligonucleotide along the 3′-5′ of the beacon hairpin molecule, so that the complementary short chain was released and recycled, and the fluorescence signal was further enhanced. F7000 fluorescence spectrometer was used for fluorescence measurement at an excitation wavelength of 575 nm and an emission wavelength of 606 nm.
[0063] Plotting of a standard detection curve: According to the changes in the intensity of the fluorescence signals at various concentrations of β-lactoglobulin, a standard curve for the sensitive detection of β-lactoglobulin based on recognition by the aptamer with the logarithm of the concentration of β-lactoglobulin as a horizontal ordinate and the fluorescence intensity as a vertical ordinate was plotted, as shown in
Example 5
Analysis of the Secondary Structure of the Aptamer (Lg-18) by Mfold Online Tool
[0064] The aptamer sequence was introduced into Mfold, and the forming conditions of the secondary structure were set (Na.sup.+: 100 mM; Mg.sup.2+: 1 mM; 37° C.). The formed secondary structure is shown in
Example 6
Simulation of the Interaction Between the Aptamer Lg-18 and β-lactoglobulin by Molecular Docking
[0065] Preparation of the three-dimensional conformation of the aptamer: The Vienna format of the aptamer Lg-18 sequence was generated by the Mfold online tool, and then an optimal three-dimensional conformation of the corresponding sequence in the Vienna format was generated by the RNAcomposer software.
[0066] Simulation of docking: The three-dimensional conformation of β-lactoglobulin (PDB: 2Q2M) was downloaded from the PDB website, and a series of pre-treatments including removing water molecules, adding non-polar hydrogen, and adding Kollman Charges were performed by the MGL Tools. Finally, a .pdbqt file was generated. The three-dimensional conformation of the aptamer Lg-18 was introduced as a ligand, and adding non-polar hydrogen and adding Kollman Charges were performed as described above. The docking was simulated by Autodock vina, to search for the optimum binding sites of the aptamer and β-lactoglobulin. The docking parameters are as follows: [0067] receptor=lacg.pdbqt [0068] ligand=apt.pdbqt [0069] center_x=41.408 [0070] center_y=54.25 [0071] center_z=25.132 [0072] size_x=125 [0073] size_y=125 [0074] size_z=12 [0075] out=vina.pdbqt
[0076] Analysis of docking results: After docking by Autodock vina, the binding sites of the aptamer Lg-18 and β-lactoglobulin was preliminarily determined. There are many binding modes with binding energy around −17 kcal/mol. One of these modes where there are a variety of hydrogen bonds between the two was analyzed for the binding sites by the pymol software. The results are shown in
[0077] While the present invention has been described above by way of preferred examples, the present invention is not limited thereto. Various modifications and changes can be made by those skilled in the art without departing from the spirit and scope of the present invention as defined by the appended claims.