Rice grain with reduced ROS1a activity
12178174 ยท 2024-12-31
Assignee
- Commonwealth Scientific And Industrial Research Organisation (Acton, AU)
- Institute of Botany, Chinese Academy of Sciences (Beijing, CN)
Inventors
- Ronald Chun Wai Yu (Gungahlin, AU)
- Crispin Alexander Howitt (Evatt, AU)
- Philip John Larkin (Weston, AU)
- Chun-Ming Liu (Beijing, CN)
- Xiao-Ba Wu (Florey, AU)
- Jinxin Liu (Beijing, CN)
Cpc classification
A01H1/12
HUMAN NECESSITIES
A01H1/06
HUMAN NECESSITIES
A01H1/102
HUMAN NECESSITIES
International classification
A01H6/46
HUMAN NECESSITIES
A01H1/00
HUMAN NECESSITIES
A01H1/06
HUMAN NECESSITIES
Abstract
The present invention relates to rice grain with thickened aleurone. Also provided is a rice plant comprising at least one genetic variation which reduces the activity of at least one ROS1a gene in the plant. Grain of the invention, or aleurone therefrom, has improved nutritional properties, and hence is particularly useful for human and animal feed products.
Claims
1. A method of producing a rice plant which produces grain comprising an aleurone that is thickened compared to aleurone from a corresponding wild-type grain, the method comprising the steps of i) introducing into one or more rice cells a mutation of an endogenous ROS1a gene such that the mutated ROS1a gene encodes a ROS1a polypeptide whose amino acid sequence is different compared to the amino acid sequence of the corresponding wild-type ROS1a polypeptide, ii) obtaining one or more rice plants from the one or more cells obtained from step i), the one or more rice plants comprising the mutations of the endogenous ROS1a gene introduced in step i), and iii) detecting the mutation of the endogenous ROS1a gene and measuring the aleurone of the one or more plants of step ii), and selecting a plant of step ii) which produces grain comprising the mutation of the endogenous ROS1a gene and an aleurone that is thickened compared to aleurone from a corresponding wild-type grain thereby producing the rice plant.
2. A method of selecting a rice plant which produces a rice grain comprising an aleurone that is thickened compared to aleurone from a corresponding wild-type grain, the method comprising the steps of i) screening a population of rice plants or grain, each of which were obtained from a mutagenic treatment of progenitor rice cells, grain or plants for grain with aleruone that is thickened compared to aleurone from a corresponding wild-type grain and the presence of a mutation in a ROS1a gene, and ii) selecting from the population of step (i) a rice plant which comprises said mutation and which produces grain with an aleurone that is thickened compared to aleurone from a corresponding wild-type grain, thereby selecting the rice plant.
3. The method of claim 1, further comprising harvesting grain from the plant selected in step iii).
4. The method of claim 3, further comprising producing one or more generations of progeny plants from the harvested grain.
5. The method of claim 4, further comprising harvesting grain from the one or more generations of progeny plants.
6. The method of claim 4, wherein the one or more generations of progeny plants are homozygous for the mutation of the endogenous ROS1a gene.
7. The method of claim 5, wherein the grain harvested from the one or more generations of progeny plants are homozygous for the mutation of the endogenous ROS1a gene.
8. The method of claim 5, further comprising processing the grain to produce flour, bran, wholemeal, malt starch, or oil.
9. The method of claim 5, further comprising processing the grain or bran, flour, wholemeal, malt, starch or oil from the grain, to produce a food or beverage ingredient.
10. The method of claim 5, further comprising mixing the grain or bran, flour, wholemeal, malt, starch or oil from the grain, with a food or beverage ingredient.
11. The method of claim 4, wherein producing one or more generations of progeny plants from the harvested grain comprises backcrossing with a recurrent parent plant.
12. The method of claim 2, further comprising harvesting grain from the plant selected in step ii).
13. The method of claim 12, further comprising producing one or more generations of progeny plants from the harvested grain.
14. The method of claim 13, further comprising harvesting grain from the one or more generations of progeny plants.
15. The method of claim 13, wherein the one or more generations of progeny plants are homozygous for the mutation of the endogenous ROS1a gene.
16. The method of claim 14, wherein the grain harvested from the one or more generations of progeny plants are homozygous for the mutation of the endogenous ROS1a gene.
17. The method of claim 14, further comprising processing the grain to produce flour, bran, wholemeal, malt starch, or oil.
18. The method of claim 14, further comprising processing the grain or bran, flour, wholemeal, malt, starch or oil from the grain, to produce a food or beverage ingredient.
19. The method of claim 14, further comprising mixing the grain or bran, flour, wholemeal, malt, starch or oil from the grain, with a food or beverage ingredient.
20. The method of claim 13, wherein producing one or more generations of progeny plants from the harvested grain comprises backcrossing with a recurrent parent plant.
Description
BRIEF DESCRIPTION OF THE ACCOMPANYING DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
KEY TO THE SEQUENCE LISTING
(7) SEQ ID NO: 1Rice ROS1a mutant (Ta2) polypeptide.
(8) SEQ ID NO: 2Wild-type rice ROS1a polypeptide.
(9) SEQ ID NO: 3Wild-type rice ROS1b polypeptide.
(10) SEQ ID NO: 4Wild-type rice ROS1c polypeptide.
(11) SEQ ID NO: 5Wild-type rice ROS1d polypeptide.
(12) SEQ ID NO: 6Arabidopsis DEMETER polypeptide.
(13) SEQ ID NO: 7Full length cDNA encoding rice ROS1a mutant (Ta2) polypeptide. Open reading frame spans nucleotides 341 to 6220.
(14) SEQ ID NO: 8Full length cDNA encoding rice ROS1a polypeptide. Open reading frame spans nucleotides 341 to 6199.
(15) SEQ ID NO: 9Rice ROS1a gene. Promoter and 5UTR: nucleotides 1-4726, translation start codon ATG 4727-4729; translation stop codon TAG 15867-15869; 3-UTR from 15870-16484, downstream of the gene from 16485-16885. Nucleotide positions of introns are: intron 1, 7494-7724; 2, 7816-7909; 3, 9426-9571; 4, 9652-10452; 5, 10538-10628; 6, 10721-10795; 7, 10865-10951; 8, 10989-11069; 9, 11153-11834; 10, 12282-12385; 11, 12423-12508; 12, 12567-12650; 13, 12791-13017; 14, 13084-13201; 15, 13317-14668; 16, 14708-15732.-11006. The sequence includes 401 nucleotides at the 3 end which does not form part of the gene.
(16) SEQ ID NO: 10 Partial wild type rice ROS1a cDNA sequence provided in
(17) SEQ ID NO: 11 Partial mutant (Ta2) rice ROS1a cDNA sequence provided in
(18) SEQ ID NO: 12 Partial wild type rice ROS1a protein sequence provided in
(19) SEQ ID NO: 13 Partial mutant (Ta2) rice ROS1a protein sequence provided in
(20) SEQ ID NO: 14 Additional amino acids in ROS1a mutant (Ta2) polypeptide when compared to wild type (SEQ ID NO:2).
(21) SEQ ID NOs 15 to 43 Oligonucleotide primers.
(22) SEQ ID NO's 44 to 49Highly conserved amino acid motifs within the glycosylase domain of the wild-type rice ROS1a polypeptide.
(23) SEQ ID NO: 50Arabidopsis ROS1a polypeptide.
DETAILED DESCRIPTION OF THE INVENTION
General Techniques and Definitions
(24) Unless specifically defined otherwise, all technical and scientific terms used herein shall be taken to have the same meaning as commonly understood by one of ordinary skill in the art (e.g., in cell culture, molecular genetics, plant molecular biology, protein chemistry, and biochemistry).
(25) Unless otherwise indicated, the recombinant protein, cell culture, and immunological techniques utilized in the present invention are standard procedures, well known to those skilled in the art. Such techniques are described and explained throughout the literature in sources such as, J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984), J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbour Laboratory Press (1989), T. A. Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991), D. M. Glover and B. D. Hames (editors), DNA Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and 1996), and F. M. Ausubel et al. (editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1988, including all updates until present), Ed Harlow and David Lane (editors) Antibodies: A Laboratory Manual, Cold Spring Harbour Laboratory, (1988), and J. E. Coligan et al. (editors) Current Protocols in Immunology, John Wiley & Sons (including all updates until present).
(26) The term and/or, e.g., X and/or Y shall be understood to mean either X and Y or X or Y and shall be taken to provide explicit support for both meanings or for either meaning.
(27) As used herein, the term about, unless stated to the contrary, refers to +/10%, more preferably +/5%, more preferably +/2.5%, even more preferably +/1%, of the designated value. The term about includes the exact designated value.
(28) Throughout this specification the word comprise, or variations such as comprises or comprising, will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.
Selected Definitions
(29) The terms aleurone and aleurone layer are used interchangeably herein. The aleurone layer is the outermost layer of the endosperm of rice grain, distinct from the inner starchy endosperm, and surrounds the starchy endosperm and part of the embryo. The cells that make up the aleurone layer are therefore the outermost cells of the endosperm, the starchy component of the grain. While it is technically part of the endosperm, sometimes referred to as the peripheral endosperm, the aleurone is considered part of the bran from a practical standpoint as it is removed with the pericarp and testa layers of the bran. Unlike cells of the starchy endosperm, aleurone cells remain alive at grain maturity. The aleurone layer is an important part of the nutritional value of rice grain comprising minerals, vitamins such as vitamin A and B group vitamins, phytochemicals, and fiber.
(30) Embodiments of the invention relate to a range of number of layers of cells, at least in part because at any one cross sectional point of grain of the invention, the layers of cells observed at any single point within the cross section, or between cross sections, may vary to some extent. More specifically, an aleurone with, for example, seven layers of cells may not have the seven layers surrounding the entire inner starchy endosperm but has seven layers surrounding at least half of the inner starchy endosperm.
(31) The term thickened when used in relation to aleurone of grain of the invention is a relative term used when comparing grain of the invention to a corresponding wild-type grain. Aleurone of grain of the invention has an increased number of cells and/or increased number of layers of cells when compared to aleurone of corresponding wild-type grain. The aleurone is thereby increased in thickness as measured in m. In an embodiment, the thickness is increased by at least 50%, preferably by at least 100%, and may be increased by as much as 500% or 600%, each percentage being relative to the thickness of the aleurone of a corresponding wild-type grain, and understanding each percentage to be the average increase over the ventral side of the grain and preferably over the whole grain. In an embodiment, the thickness of the aleurone layer is determined across an entire cross section of the grain. In an embodiment, the thickness of the aleurone is determined by at least analysis on the ventral side of the grain. In another embodiment, thickened aleurone of grain of the invention comprises cells of varying size and irregular orientation compared to that of corresponding wild-type grain where the aleurone generally has regularly oriented rectangular cells.
Polypeptides
(32) As used herein, the term ROS1 polypeptide refers to a member of a protein family of DNA glycosylase related molecules which are related in amino acid sequence to SEQ ID NOs: 1 to 5 in that they are at least 95% identity to one or more of the amino acid sequences set forth in SEQ ID NOs: 1 to 5. ROS1 polypeptides include the ROS1a, ROS1b, ROS1c and ROS1d polypeptides of wild-type rice, including naturally occurring variants and mutant forms thereof. ROS1 polypeptides include such polypeptides found in wild-type rice plants as well as variants thereof produced either artificially or found in nature, such as found in either Indica and Japonica rice plants, and either have or do not have DNA glycosylase activity, including ROS1 polypeptides which have some DNA glycosylase activity but at a reduced level compared to a corresponding wild-type ROS1 polypeptide. Examples of ROS1 polypeptides of wild-type rice plants include those which have the amino acid sequence set forth in one of SEQ ID NOs: 2 to 5, as well as variant polypeptides which have an amino acid sequence which is at least 95%, at least 97%, or preferably at least 99% identical to one or more of the amino acid sequences set forth in SEQ ID NOs: 2 to 5 and which are found in nature. As used herein, ROS1 polypeptides do not include Demeter (DME) polypeptides which are a related DNA glycosylase family which are much less than 95% identical in amino acid sequence to SEQ ID NOs:1 to 5.
(33) As used herein, the term ROS1a polypeptide means a DNA glycosylase related molecule whose amino acid sequence is at least 95% identical to SEQ ID NO: 2, preferably at least 97% or more preferably at least 99% identical to SEQ ID NO:2. ROS1a polypeptides include the polypeptides found in wild-type rice plants as well as variants thereof produced either artificially or found in nature, and either have or do not have DNA glycosylase activity, provided they have the required level of amino acid sequence identity to SEQ ID NO:2. For example, the ROS1a polypeptide whose sequence is provided as SEQ ID NO:1 is thought to have no DNA glycosylase activity, yet it is a ROS1a polypeptide as defined herein. In a preferred embodiment, the ROS1a polypeptide has some DNA glycosylase activity but at a reduced level compared to the wild-type ROS1a polypeptide whose amino acid sequence is provided as SEQ ID NO:2. For example, Table 3 lists ROS1a mutant polypeptides which are thought to have reduced DNA glycosylase activity.
(34) The skilled person can readily use known techniques to distinguish a ROS1a polypeptide from other structurally related proteins such as other ROS1 polypeptides, specifically from ROS1b, ROS1c and ROS1d polypeptides, for example, using in silica phylogenetic analysis or protein alignments. A ROS1a polypeptide can therefore be identified as a ROS1a polypeptide based on structural features alone. For example, see
(35) As used herein, the term which sequence is different to the amino acid sequence of the corresponding wild-type ROS1a polypeptide, or similar phrases, are comparative terms where the amino acid sequence of a ROS1a polypeptide of the invention is different to the amino acid sequence of the protein from which it is derived and/or most closely related that exists in nature. In an embodiment, the amino acid sequence of the ROS1a polypeptide has one or more insertions, deletions or amino acid substitutions (or a combination of these) relative to the corresponding wild-type amino acid sequence. The ROS1a polypeptide may have 2, 3, 4, 5 or 6-10 amino acid substitutions relative to the corresponding wild-type ROS1a polypeptide. In a preferred embodiment, the ROS1a polypeptide has only a single insertion, single deletion or single amino acid substitution relative to the corresponding wild-type polypeptide. In this context, the single insertion and single deletion includes where multiple (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more), contiguous amino acids are inserted or deleted, respectively and the corresponding wild-type polypeptide means the wild-type polypeptide from which the variant is derived and/or the natural polypeptide to which the variant is most closely related. The ROS1a polypeptide may be a truncated ROS1a polypeptide which may be encoded by, for example, a ROS1a gene which comprises a premature translational stop codon in the protein open reading frame relative to the wild-type ROS1a gene from which it is derived, or the ROS1a polypeptide may be full-length i.e. having the same number of amino acid residues as the corresponding wild-type ROS1a polypeptide. An example of a naturally occurring (wild-type) ROS1a polypeptide is one whose amino acid sequence is set forth as SEQ ID NO: 2, and examples of variant ROS1a polypeptides which have only a single insertion, deletion or amino acid substitution are given in SEQ ID NO:1 and Table 3.
(36) As used herein, the term DNA glycosylase activity refers to an enzyme involved in base excision repair (classified under EC number EC 3.2.2). The enzyme typically also has DNA lyase activity, in which the DNA base is excised and the backbone DNA strand is cleaved. In an embodiment, DNA glycosylase activity as used in the context of the present invention relates to active demethylation where 5-methylcytosine residues are excised and replaced with unmethylated cytosines. In a preferred embodiment, a ROS1a polypeptide of the invention with DNA glycosylase activity has at least five identifiable motifs. One is a helix-hairpin-helix (HhH) motif (for example, amino acids 1491-1515 in SEQ ID NO:2 or a homologous amino acid sequence). Another is a glycine/proline-rich motif followed by a conserved aspartic acid (GPD), and four conserved cysteine residues (in the region of amino acids 1582-1598 of SEQ ID NO:2) to hold a [4Fe-4S] cluster in place. There is also a lysine-rich domain (for example, amino acids 87-139 in SEQ ID NO:2 or a homologous amino acid sequence). Unlike other members of the HhH DNA glycosylase superfamily members, ROS1a polypeptide-family members contain two additional conserved domains (domains A and B) flanking the central glycosylase domain. In the rice ROS1a polypeptide (SEQ ID NO:2), domain A occurs at amino acids 859 to 965, the glycosylase domain occurs at amino acids 1403 to 1616, and domain B occurs at amino acids 1659 to 1933. Domain A contains a repetitive mixed-charge cluster at amino acids 882-892. DNA glycosylase activity can be measured using standard techniques known in the art, such as described in Example 8.
(37) Highly conserved amino acid motifs within the glycosylase domain of the wild-type rice ROS1a polypeptide include DHGSIDLEWLR (SEQ ID NO: 44, amino acids 1467-1477 in SEQ ID NO:2), GLGLKSVECVRLLTLHH (SEQ ID NO: 45, amino acids 1493-1509 in SEQ ID NO:2), AFPVDTNVGRI (SEQ ID NO: 46, amino acids 1511-1521 in SEQ ID NO:2), VRLGWVPLQPLPESLQLHLLE (SEQ ID NO: 47, amino acids 1523-1543 in SEQ ID NO:2), ELHYQMITFGKVFCTKSKPNCN (SEQ ID NO: 48, amino acids 1569-1590 in SEQ ID NO:2) and HFASAFASARLALP (SEQ ID NO: 49, amino acids 1600-1613 in SEQ ID NO:2). One or two amino acid substitutions may occur in these motifs, or not. Other conserved amino acids can be readily identified by aligning the amino acid sequences for wild-type rice ROS1a (SEQ ID NO:2) with the DME polypeptide from Arabidopsis thaliana (SEQ ID NO:6) and/or the A. thaliana ROS1a polypeptide (see
(38) As used herein, the terms which reduces DNA glycosylase activity compared to the corresponding wild-type ROS1a polypeptide, which has reduced, preferably no, DNA glycosylase activity when compared to the corresponding wild-type ROS1a polypeptide, or similar phrases, are relative terms where the DNA glycosylase activity of a variant/mutant ROS1a polypeptide is lower than the protein from which it is derived and/or most closely related that exists in nature. For instance, as the skilled person would appreciate, the rice Tat mutant described herein (SEQ ID NO:1) has reduced DNA glycosylase activity when compared to the corresponding wild-type rice ROS1a polypeptide (SEQ ID NO:2). Other examples of ROS1a polypeptides with reduced DNA glycosylase activity comprise mutations/variations corresponding to the amino acids described in Table 3 which confer a thickened aleurons phenotype such as substituting the serine at an amino acid position corresponding to amino acid number 156 of SEQ ID NO:2 with another amino acid such as a phenylalanine, substituting the serine at an amino acid position corresponding to amino acid number 214 of SEQ ID NO:2 with another amino acid such as a phenylalanine, substituting the serine at an amino acid position corresponding to amino acid number 1413 of SEQ ID NO:2 with another amino acid such as an asparagine, substituting the alanine at an amino acid position corresponding to amino acid number 441 of SEQ ID NO:2 with another amino acid such as a valine, substituting the serine at an amino acid position corresponding to amino acid number 1357 of SEQ ID NO:2 with another amino acid such as a phenylalanine, substituting the lysine at an amino acid position corresponding to amino acid number 501 of SEQ ID NO:2 with another amino acid such as a serine, and substituting the arginine at an amino acid position corresponding to amino acid number 482 of SEQ ID NO:2 with another amino acid such as a lysine. In a particularly preferred embodiment, the grain has at least some DNA glycosylase activity, preferably some ROS1a DNA glycosylase activity, because evidence suggests that the absence of DNA glycosylase activity in the egg cell and early in seed development is lethal to rice plants. In an embodiment, the grain has between about 30% and 98%, or between about 40% and 98%, or between about 40% and 90%, or between about 40% and 85%, or between about 40% and 80%, less DNA glycosylase activity when compared to grain from a corresponding isogenic plant lacking an genetic variation (preferably introduced genetic variation) which reduces DNA glycosylase activity in the grain.
(39) By substantially purified polypeptide or purified polypeptide we mean a polypeptide that has generally been separated from the lipids, nucleic acids, other peptides, and other contaminating molecules with which it is associated in its native state. Preferably, the substantially purified polypeptide is at least 90% free from other components with which it is naturally associated. In an embodiment, the polypeptide of the invention has an amino acid sequence which is different to a naturally occurring ROS1a polypeptide i.e. is an amino acid sequence variant, as defined above.
(40) Grain, plants and host cells of the invention may comprise an exogenous polynucleotide encoding a polypeptide of the invention. In these instances, the grain, plants and cells produce a recombinant polypeptide. The term recombinant in the context of a polypeptide refers to the polypeptide encoded by an exogenous polynucleotide when produced by a cell, which polynucleotide has been introduced into the cell or a progenitor cell by recombinant DNA or RNA techniques such as, for example, transformation. Typically, the cell comprises a non-endogenous gene that causes an altered amount of the polypeptide to be produced. In an embodiment, a recombinant polypeptide is a polypeptide made by the expression of an exogenous (recombinant) polynucleotide in a plant cell.
(41) The terms polypeptide and protein are generally used interchangeably.
(42) The % identity of a polypeptide is determined by GAP (Needleman, and Wunsch, 1970) analysis (GCG program) with a gap creation penalty=5, and a gap extension penalty=0.3. The query sequence is at least 1,000 amino acids in length, and the GAP analysis aligns the two sequences over a region of at least 1,000 amino acids. More preferably, the query sequence is at least 1,250 amino acids in length and the GAP analysis aligns the two sequences over a region of at least 1,250 amino acids. More preferably, the query sequence is at least 1,500 amino acids in length and the GAP analysis aligns the two sequences over a region of at least 1,500 amino acids. Even more preferably, the GAP analysis aligns two sequences over their entire length, which for a ROS1a polypeptide is about 1,800 to 2,100 amino acid residues.
(43) With regard to a defined polypeptide, it will be appreciated that % identity figures higher than those provided above will encompass preferred embodiments. Thus, where applicable, in light of the minimum % identity figures, it is preferred that the polypeptide comprises an amino acid sequence which is at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1%, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6%, more preferably at least 99.7%, more preferably at least 99.8%, and even more preferably at least 99.9% identical to the relevant nominated SEQ ID NO.
(44) As used herein, the phrase at a position corresponding to amino acid number or variations thereof refers to the relative position of the amino acid compared to surrounding amino acids. In this regard, in some embodiments a polypeptide of the invention may have deletional or substitutional mutation which alters the relative positioning of the amino acid when aligned against, for instance, SEQ ID NO: 2. Determining a corresponding amino acid position between two closely related proteins is well within the capability of the skilled person.
(45) Amino acid sequence mutants of the polypeptides of the present invention can be prepared by introducing appropriate nucleotide changes into a nucleic acid of the present invention, or by in vitro synthesis of the desired polypeptide. Such mutants include, for example, deletions, insertions or substitutions of residues within the amino acid sequence. A combination of deletion, insertion and substitution can be made to arrive at the final construct, provided that the final peptide product possesses the desired characteristics. Preferred amino acid sequence mutants have only one, two, three, four or less than 10 amino acid changes relative to the reference wildtype polypeptide. Mutant polypeptides of the invention have reduced ROS1a polypeptide activity when compared to a corresponding wild-type naturally occurring ROS1a polypeptide such as a polypeptide which comprises amino acids having a sequence set forth as SEQ ID NO: 2.
(46) Mutant (altered) polypeptides can be prepared using any technique known in the art, for example, using directed evolution or rational design strategies (see below). Products derived from mutated/altered DNA can readily be screened using techniques described herein to determine if they have reduced ROS1a polypeptide activity, such as reduced DNA glycosylase activity, when compared to one or more or all of a ROS1a polypeptide which comprises amino acids having a sequence provided as SEQ ID NO: 2. For instance, the method may comprise producing a transgenic plant expressing the mutated/altered DNA and determining i) the effect of the mutated/altered DNA on aleurone thickness and ii) whether a ROS1a gene has been mutated/altered.
(47) In designing amino acid sequence mutants, the location of the mutation site and the nature of the mutation will depend on characteristic(s) to be modified. The sites for mutation can be modified individually or in series, e.g., by (1) substituting with non-conservative amino acid choices, (2) deleting the target residue, or (3) inserting other residues adjacent to the located site.
(48) Amino acid sequence deletions generally range from about 1 to 15 residues, more preferably about 1 to 10 residues and typically about 1 to 5 contiguous residues.
(49) Substitution mutants have at least one amino acid residue in the polypeptide molecule removed and a different residue inserted in its place. Where it is not desirable to maintain a certain activity, or to reduce a certain activity, it is preferable to make non-conservative substitutions, particularly at amino acid positions which are highly conserved in the relevant protein family. Examples of conservative substitutions are shown in Table 1, and hence non-conservative substitutions will be those not shown in Table 1.
(50) In an embodiment a mutant/variant polypeptide has one or two or three or four amino acid changes when compared to a naturally occurring polypeptide. In a preferred embodiment, the changes are in one or more of the motifs which are highly conserved between the different ROS1a polypeptides provided herewith, particularly in known conserved structural domains. As the skilled person would be aware, such changes can reasonably be predicted to alter the activity of the polypeptide when expressed in a cell.
(51) The primary amino acid sequence of a polypeptide of the invention can be used to design variants/mutants thereof based on comparisons with closely related enzymes, particularly DNA glycosylases. As the skilled addressee will appreciate, residues highly conserved amongst closely related proteins are more likely to be able to be altered, especially with non-conservative substitutions, and activity reduced than less conserved residues (see above).
(52) TABLE-US-00001 TABLE 1 Conservative substitutions. Original Conservative Residue Substitutions Ala (A) val; leu; ile; gly Arg (R) lys Asn (N) gln; his Asp (D) glu Cys (C) ser Gln (Q) asn; his Glu (E) asp Gly (G) pro, ala His (H) asn; gln Ile (I) leu; val; ala Leu (L) ile; val; met; ala; phe Lys (K) arg Met (M) leu; phe Phe (F) leu; val; ala Pro (P) gly Ser (S) thr Thr (T) ser Trp (W) tyr Tyr (Y) trp; phe Val (V) ile; leu; met; phe, ala
(53) Also included within the scope of the invention are polypeptides of the present invention which are differentially modified after synthesis, e.g., by post-translational modification in a cell, for example by phosphorylation, which may modulate its activity.
Polynucleotides and Genes
(54) The present invention refers to various polynucleotides. As used herein, a polynucleotide or nucleic acid or nucleic acid molecule means a polymer of nucleotides, which may be DNA or RNA, and includes genomic DNA, mRNA, cRNA, dsRNA, and cDNA. It may be DNA or RNA of cellular, genomic or synthetic origin, for example made on an automated synthesizer, and may be combined with carbohydrate, lipids, protein or other materials, labelled with fluorescent or other groups, or attached to a solid support to perform a particular activity defined herein, or comprise one or more modified nucleotides not found in nature, well known to those skilled in the art. The polymer may be single-stranded, essentially double-stranded or partly double-stranded. Basepairing as used herein refers to standard basepairing between nucleotides, including G:U basepairs. Complementary means two polynucleotides are capable of basepairing (hybridizing) along part of their lengths, or along the full length of one or both. A hybridized polynucleotide means the polynucleotide is actually basepaired to its complement. The term polynucleotide is used interchangeably herein with the term nucleic acid. Preferred polynucleotides of the invention encode a polypeptide of the invention.
(55) By isolated polynucleotide we mean a polynucleotide which has generally been separated from the polynucleotide sequences with which it is associated or linked in its native state, if the polynucleotide is found in nature. Preferably, the isolated polynucleotide is at least 90% free from other components with which it is naturally associated, if it is found in nature. Preferably the polynucleotide is not naturally occurring, for example by covalently joining two shorter polynucleotide sequences in a manner not found in nature (chimeric polynucleotide).
(56) The present invention involves reduction of gene activity and the construction and use of chimeric genes. As used herein, the term gene includes any deoxyribonucleotide sequence which includes a protein coding region or which is transcribed in a cell but not translated, as well as associated non-coding and regulatory regions. Such associated regions are typically located adjacent to the coding region or the transcribed region on both the 5 and 3 ends for a distance of about 2 kb on either side. In this regard, the gene may include control signals such as promoters, enhancers, termination and/or polyadenylation signals that are naturally associated with a given gene, or heterologous control signals in which case the gene is referred to as a chimeric gene. The sequences which are located 5 of the coding region and which are present on the mRNA are referred to as 5 non-translated sequences. The sequences which are located 3 or downstream of the coding region and which are present on the mRNA are referred to as 3 non-translated sequences. The term gene encompasses both cDNA and genomic forms of a gene.
(57) An allele refers to one specific form of a genetic sequence (such as a gene) within a cell, an individual plant or within a population, the specific form differing from other forms of the same gene in the sequence of at least one, and frequently more than one, variant sites within the sequence of the gene. The sequences at these variant sites that differ between different alleles are termed variances, or polymorphisms. A polymorphism as used herein denotes a variation in the nucleotide sequence between alleles at a genetic locus of the invention, of different species, cultivars, strains or individuals of a plant. A polymorphic position is a preselected nucleotide position within the sequence of the gene at which the sequence difference occurs. In some cases, genetic polymorphisms cause an amino acid sequence variation within a polypeptide encoded by the gene, and thus a polymorphic position can result in the location of a polymorphism in the amino acid sequence at a predetermined position in the sequence of the polypeptide. In other instances, the polymorphic region may be in a non-polypeptide encoding region of the gene, for example in the promoter region and may thereby influence expression levels of the gene. Typical polymorphisms are deletions, insertions or substitutions. These can involve a single nucleotide (single nucleotide polymorphism or SNP) or two or more nucleotides.
(58) As used herein, a mutation is a polymorphism which produces a phenotypic change in the plant or a part thereof. As known in the art, some polymorphisms are silent, for example a single nucleotide change in a protein coding region which does not change the amino acid sequence of the encoded polypeptide due to the redundancy of the genetic code. A diploid plant will typically have one or two different alleles of a single gene, but only one if both copies of the gene are identical i.e. the plant is homozygous for the allele. Polyploid plants generally have more than one homoeolog of any particular gene. For instance, hexaploid wheat has three subgenomes (often referred to as genomes) designated the A, B and D genomes, and therefore has three homoeologs of most of its genes, one in each of the A, B and D genomes.
(59) The term ROS1a gene encoding a ROS1a polypeptide or ROS1a gene as used herein refers to a nucleotide sequence which encodes a ROS1a polypeptide as defined herein. The ROS1a gene may be an endogenous naturally occurring gene, or comprise a genetic variation (preferably an introduced genetic variation) as defined herein. A ROS1a gene encoding a ROS1a polypeptide in grain of the invention may or may not have introns. In one example, the grain of the invention is from rice and at least one allele of an ROS1a gene encodes a ROS1a polypeptide with reduced DNA glycosylase activity when compared to a ROS1a polypeptide from a corresponding a wild type rice plant (such as which comprises a sequence of amino acids as provided in 1.0 SEQ ID NO: 2). An example of such a ROS1a polypeptide with reduced DNA glycosylase activity is the rice Ta2 mutant (SEQ ID NO:1).
(60) As used herein, the phrase or inactivation of a ROS1a gene or reduction of expression of a ROS1a gene or variations thereof refers to any genetic variation which reduces (partially), or completely prevents, the expression of the gene encoding a functional ROS1a polypeptide. Such genetic variations include mutations in the promoter region of the gene which reduce transcription of the gene being transcribed, for example by using gene editing to delete or substitute nucleotides from the promoter of the ROS1a gene, or intron splicing mutations which alter the amount or position of splicing to form mRNA.
(61) A genomic form or clone of a gene containing the transcribed region may be interrupted with non-coding sequences termed introns or intervening regions or intervening sequences, which may be either homologous or heterologous with respect to the exons of the gene. An intron as used herein is a segment of a gene which is transcribed as part of a primary RNA transcript but is not present in the mature mRNA molecule. Introns are removed or spliced out from the nuclear or primary transcript; introns therefore are absent in the messenger RNA (mRNA). Exons as used herein refer to the DNA regions corresponding to the RNA sequences which are present in the mature mRNA or the mature RNA molecule in cases where the RNA molecule is not translated. An mRNA functions during translation to specify the sequence or order of amino acids in a nascent polypeptide. The term gene includes a synthetic or fusion molecule encoding all or part of the proteins of the invention described herein and a complementary nucleotide sequence to any one of the above. A gene may be introduced into an appropriate vector for extrachromosomal maintenance in a cell or, preferably, for integration into the host genome.
(62) As used herein, a chimeric gene refers to any gene that comprises covalently joined sequences that are not found joined in nature. Typically, a chimeric gene comprises regulatory and transcribed or protein coding sequences that are not found together in nature. Accordingly, a chimeric gene may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature. In an embodiment, the protein coding region of an ROS1a gene is operably linked to a promoter or polyadenylation/terminator region which is heterologous to the ROS1a gene, thereby forming a chimeric gene. In an alternate embodiment, a gene encoding a polynucleotide which, when present in grain of a rice plant, down regulates the production and/or activity of a ROS1a polypeptide in the grain is operably linked to a promoter or polyadenylation/terminator region which is heterologous to the polynucleotide, thereby forming a chimeric gene.
(63) The term endogenous is used herein to refer to a substance that is normally present or produced in an unmodified plant at the same developmental stage as the plant under investigation. An endogenous gene refers to a native gene in its natural location in the genome of an organism. As used herein, recombinant nucleic acid molecule, recombinant polynucleotide or variations thereof refer to a nucleic acid molecule which has been constructed or modified by recombinant DNA technology. The terms foreign polynucleotide or exogenous polynucleotide or heterologous polynucleotide and the like refer to any nucleic acid which is introduced into the genome of a cell by experimental manipulations.
(64) Foreign or exogenous genes may be genes that are inserted into a non-native organism, native genes introduced into a new location within the native host, or chimeric genes. A transgene is a gene that has been introduced into the genome by a transformation procedure. The term genetically modified includes introducing genes into cells by transformation or transduction, mutating genes in cells and altering or modulating the regulation of a gene in a cell or organisms to which these acts have been done or their progeny.
(65) Furthermore, the term exogenous in the context of a polynucleotide (nucleic acid) refers to the polynucleotide when present in a cell that does not naturally comprise the polynucleotide. The cell may be a cell which comprises a non-endogenous polynucleotide resulting in an altered amount of production of the encoded polypeptide, for example an exogenous polynucleotide which increases the expression of an endogenous polypeptide, or a cell which in its native state does not produce the polypeptide. Increased production of a polypeptide of the invention is also referred to herein as over-expression. An exogenous polynucleotide of the invention includes polynucleotides which have not been separated from other components of the transgenic (recombinant) cell, or cell-free expression system, in which it is present, and polynucleotides produced in such cells or cell-free systems which are subsequently purified away from at least some other components. The exogenous polynucleotide (nucleic acid) can be a contiguous stretch of nucleotides existing in nature, or comprise two or more contiguous stretches of nucleotides from different sources (naturally occurring and/or synthetic) joined to form a single polynucleotide. Typically such chimeric polynucleotides comprise at least an open reading frame encoding a polypeptide of the invention operably linked to a promoter suitable of driving transcription of the open reading frame in a cell of interest.
(66) The % identity of a polynucleotide is determined by GAP (Needleman and Wunsch, 1970) analysis (GCG program) with a gap creation penalty=5, and a gap extension penalty=0.3. The query sequence is at least 3,000 nucleotides in length, and the GAP analysis aligns the two sequences over a region of at least 3,000 nucleotides. Even more preferably, the query sequence is at least 3,750 nucleotides in length and the GAP analysis aligns the two sequences over a region of at least 3,750 nucleotides. Even more preferably, the query sequence is at least 4,500 nucleotides in length and the GAP analysis aligns the two sequences over a region of at least 4,500 nucleotides. Even more preferably, the GAP analysis aligns two sequences over their entire length.
(67) With regard to the defined polynucleotides, it will be appreciated that % identity figures higher than those provided above will encompass preferred embodiments. Thus, where applicable, in light of the minimum % identity figures, it is preferred that the polynucleotide comprises a polynucleotide sequence which is at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1%, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6%, more preferably at least 99.7%, more preferably at least 99.8%, and even more preferably at least 99.9% identical to the relevant nominated SEQ ID NO.
(68) The present invention also relates to the use of oligonucleotides, for instance in methods of screening for a polynucleotide of, or encoding a polypeptide of, the invention. As used herein, oligonucleotides are polynucleotides up to 50 nucleotides in length. The minimum size of such oligonucleotides is the size required for the formation of a stable hybrid between an oligonucleotide and a complementary sequence on a nucleic acid molecule of the present invention. They can be RNA, DNA, or combinations or derivatives of either. Oligonucleotides are typically relatively short single stranded molecules of 10 to 30 nucleotides, commonly 15-25 nucleotides in length. When used as a probe or as a primer in an amplification reaction, the minimum size of such an oligonucleotide is the size required for the formation of a stable hybrid between the oligonucleotide and a complementary sequence on a target nucleic acid molecule. Preferably, the oligonucleotides are at least 15 nucleotides, more preferably at least 18 nucleotides, more preferably at least 19 nucleotides, more preferably at least nucleotides, even more preferably at least 25 nucleotides in length. Oligonucleotides of the present invention used as a probe are typically conjugated with a label such as a radioisotope, an enzyme, biotin, a fluorescent molecule or a chemiluminescent molecule.
(69) The present invention includes oligonucleotides that can be used as, for example, probes to identify nucleic acid molecules, or primers to produce nucleic acid molecules. Probes and/or primers can be used to clone homologues of the polynucleotides of the invention from other species. Furthermore, hybridization techniques known in the art can also be used to screen genomic or cDNA libraries for such homologues.
(70) Polynucleotides and oligonucleotides of the present invention include those which hybridize under stringent conditions to one or more of the sequences provided as SEQ ID NO: 1 or 2. As used herein, stringent conditions are those that (1) employ low ionic strength and high temperature for washing, for example, 0.015 M NaCl/0.0015 M sodium citrate/0.1% NaDodSO.sub.4 at 50 C.; (2) employ during hybridisation a denaturing agent such as formamide, for example, 50% (vol/vol) formamide with 0.1% bovine serum albumin, 0.1% Ficoll, 0.1% polyvinylpyrrolidone, 50 mM sodium phosphate buffer at pH 6.5 with 750 mM NaCl, 75 mM sodium citrate at 42 C.; or (3) employ 50% formamide, 5SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5Denhardt's solution, sonicated salmon sperm DNA (50 g/ml), 0.1% SDS and 10% dextran sulfate at 42 C. in 0.2SSC and 0.1% SDS.
(71) Polynucleotides of the present invention may possess, when compared to naturally occurring molecules, one or more mutations which are deletions, insertions, or substitutions of nucleotide residues. Mutants can be either naturally occurring (that is to say, isolated from a natural source) or synthetic (for example, by performing site-directed mutagenesis on the nucleic acid). A variant of a polynucleotide or an oligonucleotide of the invention includes molecules of varying sizes of, and/or are capable of hybridising to, the rice genome close to that of the reference polynucleotide or oligonucleotide molecules defined herein, preferably the endogenous ROS1a gene. For example, variants may comprise additional nucleotides (such as 1, 2, 3, 4, or more), or less nucleotides as long as they still hybridise to the target region. Furthermore, a few nucleotides may be substituted without influencing the ability of the oligonucleotide to hybridise to the target region. In addition, variants may readily be designed which hybridise close to, for example to within 50 nucleotides, the region of the plant genome where the specific oligonucleotides defined herein hybridise. In particular, this includes polynucleotides which encode the same polypeptide or amino acid sequence but which vary in nucleotide sequence by redundancy of the genetic code. The terms polynucleotide variant and variant also include naturally occurring allelic variants.
Genetic Variations
(72) As used herein, the term genetic variation refers to one or more cells of the grain, preferably cells in at least one or more or all of aleurone, pericarp, nucellar projection, ovary, testa and starchy endosperm of the developing grain, or of a plant or part thereof of the invention which have a genetic modification which may be introduced by man, or may be naturally occurring in rice plant (for example, crossed to produce a plant of the invention).
(73) As used herein, the term one or more introduced genetic variations refers to one or more cells of the grain, preferably cells in at least one or more or all of aleurone, pericarp, nucellar projection, ovary, testa and starchy endosperm of the developing grain, or of a plant or part thereof of the invention which have a genetic modification introduced by man. In a preferred embodiment, every cell in the grain or the plant or part thereof comprises the introduced genetic variation. As the skilled person would understand, there are many different types of genetic modifications which can be made such as, but not limited to, a nucleic construct encoding an exogenous polynucleotide which reduces the expression of a ROS1a gene (such as a dsRNA molecule or microRNA), a nucleic construct encoding an exogenous polynucleotide which encodes a ROS1a polypeptide whose amino acid sequence is different to the amino acid sequence of a corresponding wild-type ROS1a polypeptide and which has reduced (preferably some but can be no) DNA glycosylase activity when compared to the corresponding wild-type ROS1a polypeptide, the genome manipulated by gene editing to reduce the activity of an endogenous ROS1a gene, and using TILLING to introduce mutations and select for plants producing grain with reduced ROS1a polypeptide DNA glycolyase activity.
(74) As used herein, the term reduce the activity of at least one ROS1a gene as it relates to the one or more genetic variations or one or more introduced genetic variations refers to the genetic variation resulting in a reduction in the amount or activity of a ROS1a polypeptide expressed by the gene when compared to a corresponding wild-type rice plant. In an embodiment, the grain comprises a ROS1a polypeptide with at least some DNA glycolyase activity.
(75) In an embodiment, the genetic variation does not down-regulate the DNA glycolyase activity of a non-ROS1a polypeptide. For example, the genetic variation does not reduce the DNA glycosylase activity of each of the ROS1b, ROS1c and ROS1d polypeptides by more than 10% or 30% in the rice plant of the invention. Alternatively, the genetic variation reduces the DNA glycosylase activity of at least one of the ROS1b, ROS1c and ROS1d polypeptides by at least 30%.
RNA Interference
(76) RNA interference (RNAi) is particularly useful for specifically reducing the expression of a gene, which results in reduced production of a particular protein if the gene encodes a protein. Although not wishing to be limited by theory, Waterhouse et al. (1998) have provided a model for the mechanism by which dsRNA (duplex RNA) can be used to reduce protein production. This technology relies on the presence of dsRNA molecules that contain a sequence that is essentially identical to the mRNA of the gene of interest or part thereof. Conveniently, the dsRNA can be produced from a single promoter in a recombinant vector or host cell, where the sense and anti-sense sequences are flanked by an unrelated sequence which enables the sense and anti-sense sequences to hybridize to form the dsRNA molecule with the unrelated sequence forming a loop structure. The design and production of suitable dsRNA molecules is well within the capacity of a person skilled in the art, particularly considering Waterhouse et al. (1998), Smith et al. (2000), WO 99/32619, WO 99/53050, WO 99/49029 and WO 01/34815.
(77) In one example, a DNA is introduced that directs the synthesis of an at least partly double stranded RNA product(s) with homology to a ROS1a gene. The DNA therefore comprises both sense and antisense sequences that, when transcribed into RNA, can hybridize to form the double stranded RNA region. In one embodiment of the invention, the sense and antisense sequences are separated by a spacer region that comprises an intron which, when transcribed into RNA, is spliced out. This arrangement has been shown to result in a higher efficiency of gene silencing (Smith et al., 2000). The double stranded region may comprise one or two RNA molecules, transcribed from either one DNA region or two. The presence of the double stranded molecule is thought to trigger a response from an endogenous system that destroys both the double stranded RNA and also the homologous RNA transcript from the target gene, efficiently reducing or eliminating the activity of the target gene.
(78) The length of the sense and antisense sequences that hybridize should each be at least 19 contiguous nucleotides, preferably at least 30 or at least 50 contiguous nucleotides, more preferably at least 100 or at least 200 contiguous nucleotides. Generally, a sequence of 100-1000 nucleotides corresponding to a region of the target gene mRNA is used. The full-length sequence corresponding to the entire gene transcript may be used. The degree of identity of the sense sequence to the targeted transcript (and therefore also the identity of the antisense sequence to the complement of the target transcript) should be at least 85%, at least 90%, or 95-100%, preferably is identical to the targeted sequence. The RNA molecule may of course comprise unrelated sequences which may function to stabilize the molecule. The RNA molecule may be expressed under the control of a RNA polymerase II or RNA polymerase III promoter. Examples of the latter include tRNA or snRNA promoters.
(79) Preferred small interfering RNA (siRNA) molecules comprise a nucleotide sequence that is identical to about 19-25 contiguous nucleotides of the target mRNA. Preferably, the siRNA sequence commences with the dinucleotide AA, comprises a GC-content of about 30-70% (preferably, 30-60%, more preferably 40-60% and more preferably about 45%-55%), and does not have a high percentage identity to any nucleotide sequence other than the target in the genome of the organism in which it is to be introduced, for example, as determined by standard BLAST search.
(80) DsRNA's useful for the invention could readily be produced using routine procedures.
MicroRNA
(81) MicroRNAs (abbreviated miRNAs) are non-coding RNA molecules having a length generally 19-25 nucleotides (commonly about 20-24 nucleotides in plants) that are derived from larger precursors that form imperfect stem-loop structures. The miRNA is typically fully complementary to a region of a target mRNA whose expression is to be reduced, but need not be fully complementary.
(82) miRNAs bind to complementary sequences on target messenger RNA transcripts (mRNAs), usually resulting in translational repression or target degradation and gene silencing. Artificial miRNAs (amiRNAs) can be designed based on natural miRNAs for reducing the expression of any gene of interest, as well known in the art.
(83) In plant cells, miRNA precursor molecules are believed to be largely processed in the nucleus. The pri-miRNA (containing one or more local double-stranded or hairpin regions as well as the usual 5 cap and polyadenylated tail of an mRNA) is processed to a shorter miRNA precursor molecule that also includes a stem-loop or fold-back structure and is termed the pre-miRNA. In plants, the pre-miRNAs are cleaved by distinct DICER-like (DCL) enzymes, yielding miRNA:miRNA* duplexes. Prior to transport out of the nucleus, these duplexes are methylated.
(84) In the cytoplasm, the miRNA strand from the miRNA:miRNA duplex is selectively incorporated into an active RNA-induced silencing complex (RISC) for target recognition. The RISC-complexes contain a particular subset of Argonaute proteins that exert sequence-specific gene repression (see, for example, Millar and Waterhouse, 2005; Pasquinelli et al., 2005; Almeida and Allshire, 2005).
(85) MicroRNA's useful for the invention could readily be produced using routine procedures. For example, the design of a ROS1a amiRNA (artificial microRNA) construct may be based on the general method described by Fahim et al. (2012). WMD3 software (www.wmd3.weigelworld.org/) can be used to identify suitable amiRNA targets in a ROS1a gene. The amiRNA targets are selected according to four criteria: 1) relative 5 instability by using sequences which are AT rich at the 5-end and GC rich at the 3-end; 2) U at position 1 and A at the cleavage site (between positions 10 and 11); 3) maximum of 1 and 4 mismatches at positions 1 to 9, and 13 to 21, respectively; and 4) having a predicted free energy (G) of less than 30 kcal mol.sup.1 when the amiRNA would hybridise to the target RNA (Ossowski et. al., 2008). For gene-specific reduction of expression, candidate amiRNA sequences are chosen in a region which shows the lowest homology upon the alignment of all the homologs of OsROS1, thus reducing the potential for off-target reduction of the expression of ROS1 homologs and homoeologs. The precursor of rice miR395 (Guddeti et al., 2005; Jones-Rhoades and Bartel, 2004; Kawashima et al., 2009) may be chosen as the amiRNA backbone for insertion of the amiRNA sequences. To design and make the construct, five endogenous miRNA targets in the miR395 were replaced by five amiRNA targets for TA2 knock down.
Cosuppression
(86) Genes can suppress the expression of related endogenous genes and/or transgenes already present in the genome, a phenomenon termed homology-dependent gene silencing. Most of the instances of homology dependent gene silencing fall into two classesthose that function at the level of transcription of the transgene, and those that operate post-transcriptionally.
(87) Post-transcriptional homology-dependent gene silencing (i.e., cosuppression) describes the loss of expression of a transgene and related endogenous or viral genes in transgenic plants. Cosuppression often, but not always, occurs when transgene transcripts are abundant, and it is generally thought to be triggered at the level of mRNA processing, localization, and/or degradation. Several models exist to explain how cosuppression works (see in Taylor, 1997).
(88) Cosuppression involves introducing an extra copy of a gene or a fragment thereof into a plant in the sense orientation with respect to a promoter for its expression. The size of the sense fragment, its correspondence to target gene regions, and its degree of sequence identity to the target gene can be determined by those skilled in the art. In some instances, the additional, copy of the gene sequence interferes with the expression of the target plant gene. Reference is made to WO 97/20936 and EP 0465572 for methods of implementing co-suppression approaches.
Antisense Polynucleotides
(89) The term antisense polynucleotide shall be taken to mean a DNA or RNA molecule that is complementary to at least a portion of a specific mRNA molecule encoding an endogenous polypeptide and capable of interfering with a post-transcriptional event such as mRNA translation. The use of antisense methods is well known in the art (see for example, G. Hartmann and S. Endres, Manual of Antisense Methodology, Kluwer (1999)). The use of antisense techniques in plants has been reviewed by Bourque (1995) and Senior (1998). Bourque (1995) lists a large number of examples of how antisense sequences have been utilized in plant systems as a method of gene inactivation. Bourque also states that attaining 100% inhibition of any enzyme activity may not be necessary as partial inhibition will more than likely result in measurable change in the system. Senior (1998) states that antisense methods are now a very well established technique for manipulating gene expression.
(90) In one embodiment, the antisense polynucleotide hybridises under physiological conditions, that is, the antisense polynucleotide (which is fully or partially single stranded) is at least capable of forming a double stranded polynucleotide with mRNA encoding an endogenous ROS1a polypeptide under normal conditions in a cell.
(91) Antisense molecules may include sequences that correspond to the structural genes or for sequences that effect control over the gene expression or splicing event. For example, the antisense sequence may correspond to the targeted coding region of endogenous gene, or the 5-untranslated region (UTR) or the 3-UTR or combination of these. It may be complementary in part to intron sequences, which may be spliced out during or after transcription, preferably only to exon sequences of the target gene. In view of the generally greater divergence of the UTRs, targeting these regions provides greater specificity of gene inhibition.
(92) The length of the antisense sequence should be at least 19 contiguous nucleotides, preferably at least 30 or at least 50 nucleotides, and more preferably at least 100, 200, 500 or 1000 nucleotides. The full-length sequence complementary to the entire gene transcript may be used. The length is most preferably 100-2000 nucleotides. The degree of identity of the antisense sequence to the targeted transcript should be at least 90% and more preferably 95-100%, typically 100% identical. The antisense RNA molecule may of course comprise unrelated sequences which may function to stabilize the molecule.
Genome Editing Using Site-Specific Nucleases
(93) Genome editing uses engineered nucleases composed of sequence specific DNA binding domains fused to a non-specific DNA cleavage module. These chimeric nucleases enable efficient and precise genetic modifications by inducing targeted DNA double stranded breaks that stimulate the cell's endogenous cellular DNA repair mechanisms to repair the induced break. Such mechanisms include, for example, error prone non-homologous end joining (NHEJ) and homology directed repair (HDR).
(94) In the presence of donor plasmid with extended homology arms, HDR can lead to the introduction of single or multiple transgenes to correct or replace existing genes. In the absence of donor plasmid, NHEJ-mediated repair yields small insertion or deletion mutations of the target that cause gene disruption.
(95) Engineered nucleases useful in the methods of the present invention include zinc finger nucleases (ZFNs), transcription activator-like (TAL) effector nucleases (TALEN) and CRISPR-Cas9 type site-specific nucleases.
(96) Typically nuclease encoded genes are delivered into cells by plasmid DNA, viral vectors or in vitro transcribed mRNA. The use of fluorescent surrogate reporter vectors also allows for enrichment of ZFN-, TALEN- or CRISPR-modified cells.
(97) Complex genomes often contain multiple copies of sequences that are identical or highly homologous to the intended DNA target, potentially leading to off-target activity and cellular toxicity. To address this, structure (Miller et al., 2007; Szczepek et al., 2007) and selection based (Doyon et al., 2011; Guo et al., 2010) approaches can be used to generate improved ZFN and TALEN heterodimers with optimized cleavage specificity and reduced toxicity.
(98) In order to target genetic recombination or mutation by ZFN according to a preferred embodiment of the present invention, two 9 bp zinc finger DNA recognition sequences must be identified in the host DNA. These recognition sites will be in an inverted orientation with respect to one another and separated by about 6 bp of DNA. ZFNs are then generated by designing and producing zinc finger combinations that bind DNA specifically at the target locus, and then linking the zinc fingers to a DNA cleavage domain.
(99) A transcription activator-like (TAL) effector nuclease (TALEN) comprises a TAL effector DNA binding domain and an endonuclease domain.
(100) TAL effectors are proteins of plant pathogenic bacteria that are injected by the pathogen into the plant cell, where they travel to the nucleus and function as transcription factors to turn on specific plant genes. The primary amino acid sequence of a TAL effector dictates the nucleotide sequence to which it binds. Thus, target sites can be predicted for TAL effectors, and TAL effectors can be engineered and generated for the purpose of binding to particular nucleotide sequences.
(101) Fused to the TAL effector-encoding nucleic acid sequences are sequences encoding a nuclease or a portion of a nuclease, typically a nonspecific cleavage domain from a type II restriction endonuclease such as Fold (Kim et al., 1996). Other useful endonucleases may include, for example, HhaI, HindIII, Nod, BbvCI, EcoRI, BglI, and AlwI. The fact that some endonucleases (e.g., FokI) only function as dimers can be capitalized upon to enhance the target specificity of the TAL effector. For example, in some cases each FokI monomer can be fused to a TAL effector sequence that recognizes a different DNA target sequence, and only when the two recognition sites are in close proximity do the inactive monomers come together to create a functional enzyme. By requiring DNA binding to activate the nuclease, a highly site-specific restriction enzyme can be created.
(102) A sequence-specific TALEN can recognize a particular sequence within a preselected target nucleotide sequence present in a cell. Thus, in some embodiments, a target nucleotide sequence can be scanned for nuclease recognition sites, and a particular nuclease can be selected based on the target sequence. In other cases, a TALEN can be engineered to target a particular cellular sequence.
Nucleic Acid Constructs
(103) The present invention includes nucleic acid constructs comprising the polynucleotides of or useful for the invention, and vectors and host cells containing these, methods of their production and use, and uses thereof.
(104) The present invention refers to elements which are operably connected or linked. Operably connected or operably linked and the like refer to a linkage of polynucleotide elements in a functional relationship. Typically, operably connected nucleic acid sequences are contiguously linked and, where necessary to join two protein coding regions, contiguous and in reading frame. A coding sequence is operably connected to another coding sequence when RNA polymerase will transcribe the two coding sequences into a single RNA, which if translated is then translated into a single polypeptide having amino acids derived from both coding sequences. The coding sequences need not be contiguous to one another so long as the expressed sequences are ultimately processed to produce the desired protein.
(105) As used herein, the term cis-acting sequence, cis-acting element or cis-regulatory region or regulatory region or similar term shall be taken to mean any sequence of nucleotides, which when positioned appropriately and connected relative to an expressible genetic sequence, is capable of regulating, at least in part, the expression of the genetic sequence. Those skilled in the art will be aware that a cis-regulatory region may be capable of activating, silencing, enhancing, repressing or otherwise altering the level of expression and/or cell-type-specificity and/or developmental specificity of a gene sequence at the transcriptional or post-transcriptional level. In preferred embodiments of the present invention, the cis-acting sequence is an activator sequence that enhances or stimulates the expression of an expressible genetic sequence.
(106) Operably connecting a promoter or enhancer element to a transcribable polynucleotide means placing the transcribable polynucleotide (e.g., protein-encoding polynucleotide or other transcript) under the regulatory control of a promoter, which then controls the transcription of that polynucleotide. In the construction of heterologous promoter/structural gene combinations, it is generally preferred to position a promoter or variant thereof at a distance from the transcription start site of the transcribable polynucleotide which is approximately the same as the distance between that promoter and the protein coding region it controls in its natural setting; i.e., the gene from which the promoter is derived. As is known in the art, some variation in this distance can be accommodated without loss of function. Similarly, the preferred positioning of a regulatory sequence element (e.g., an operator, enhancer etc) with respect to a transcribable polynucleotide to be placed under its control is defined by the positioning of the element in its natural setting; i.e., the genes from which it is derived.
(107) Promoter or promoter sequence as used herein refers to a region of a gene, generally upstream (5) of the RNA encoding region, which controls the initiation and level of transcription in the cell of interest. A promoter includes the transcriptional regulatory sequences of a classical genomic gene, such as a TATA box and CCAAT box sequences, as well as additional regulatory elements (i.e., upstream activating sequences, enhancers and silencers) that alter gene expression in response to developmental and/or environmental stimuli, or in a tissue-specific or cell-type-specific manner. A promoter is usually, but not necessarily (for example, some PolIII promoters), positioned upstream of a structural gene, the expression of which it regulates. Furthermore, the regulatory elements comprising a promoter are usually positioned within 2 kb of the start site of transcription of the gene. Promoters may contain additional specific regulatory elements, located more distal to the start site to further enhance expression in a cell, and/or to alter the timing or inducibility of expression of a structural gene to which it is operably connected.
(108) Constitutive promoter refers to a promoter that directs expression of an operably linked transcribed sequence in many or all tissues of an organism such as a plant. The term constitutive as used herein does not necessarily indicate that a gene is expressed at the same level in all cell types, but that the gene is expressed in a wide range of cell types, although some variation in level is often detectable. Selective expression as used herein refers to expression almost exclusively in specific organs of, for example, the plant, such as, for example, endosperm, embryo, leaves, fruit, tubers or root. In a preferred embodiment, a promoter is expressed selectively or preferentially in grain of a plant, preferably a rice plant. Selective expression may therefore be contrasted with constitutive expression, which refers to expression in many or all tissues of a plant under most or all of the conditions experienced by the plant.
(109) Selective expression may also result in compartmentation of the products of gene expression in specific plant tissues, organs or developmental stages. Compartmentation in specific subcellular locations such as the plastid, cytosol, vacuole, or apoplastic space may be achieved by the inclusion in the structure of the gene product of appropriate signals, eg. a signal peptide, for transport to the required cellular compartment, or in the case of the semi-autonomous organelles (plastids and mitochondria) by integration of the transgene with appropriate regulatory sequences directly into the organelle genome.
(110) A tissue-specific promoter or organ-specific promoter is a promoter that is preferentially expressed in one tissue or organ relative to many other tissues or organs, preferably most if not all other tissues or organs in, for example, a plant. Typically, the promoter is expressed at a level 10-fold higher in the specific tissue or organ than in other tissues or organs.
(111) Seed specific promoters for the invention which are suitable are the oilseed rape napin gene promoter (U.S. Pat. No. 5,608,152), the Vicia faba USP promoter (Baumlein et al., 1991), the Arabidopsis oleosin promoter (WO 98/45461), the Phaseolus vulgaris phaseolin promoter (U.S. Pat. No. 5,504,200), the Brassica Bce4 promoter (WO 91/13980) or the legumin B4 promoter (Baumlein et al., 1992), and promoters which lead to the seed-specific expression in rice and the like. Notable promoters which are suitable are the barley LPT2 or LPT1 gene promoters (WO 95/15389 and WO 95/23230) or the promoters described in WO 99/16890 (promoters from the barley hordein gene). Other promoters include those described by Broun et al. (1998), Potenza et al. (2004), US 20070192902 and US 20030159173. In an embodiment, the seed specific promoter is preferentially expressed in defined parts of the seed such as the endosperm, preferably the developing aleurone. In a further embodiment, the seed specific promoter is not expressed, or is only expressed at a low level, after the seed germinates.
(112) In an embodiment, the promoter is at least active at a time point between the time of anthesis and 7 days post-anthesis, or active entirely during this period. An example of such a promoter is a ROS1a gene promoter.
(113) In an embodiment, the promoter operably linked to an exogenous polynucleotide which reduces the expression of a ROS1a gene is not a high MW glutenin promoter.
(114) The promoters contemplated by the present invention may be native to the host plant to be transformed or may be derived from an alternative source, where the region is functional in the host plant. Other sources include the Agrobacterium T-DNA genes, such as the promoters of genes for the biosynthesis of nopaline, octapine, mannopine, or other opine promoters, tissue specific promoters (see, e.g., U.S. Pat. No. 5,459,252 and WO 91/13992); promoters from viruses (including host specific viruses), or partially or wholly synthetic promoters. Numerous promoters that are functional in mono- and dicotyledonous plants are well known in the art (see, for example, Greve, 1983; Salomon et al., 1984; Garfinkel et al., 1983; Barker et al., 1983); including various promoters isolated from plants and viruses such as the cauliflower mosaic virus promoter (CaMV 35S, 19S). Non-limiting methods for assessing promoter activity are disclosed by Medberry et al. (1992 and 1993), Sambrook et al. (1989, supra) and U.S. Pat. No. 5,164,316.
(115) Alternatively or additionally, the promoter may be an inducible promoter or a developmentally regulated promoter which is capable of driving expression of the introduced polynucleotide at an appropriate developmental stage of the, for example, plant. Other cis-acting sequences which may be employed include transcriptional and/or translational enhancers. Enhancer regions are well known to persons skilled in the art, and can include an ATG translational initiation codon and adjacent sequences. When included, the initiation codon should be in phase with the reading frame of the coding sequence relating to the foreign or exogenous polynucleotide to ensure translation of the entire sequence if it is to be translated. Translational initiation regions may be provided from the source of the transcriptional initiation region, or from a foreign or exogenous polynucleotide. The sequence can also be derived from the source of the promoter selected to drive transcription, and can be specifically modified so as to increase translation of the mRNA.
(116) The nucleic acid construct of the present invention may comprise a 3 non-translated sequence from about 50 to 1,000 nucleotide base pairs which may include a transcription termination sequence. A 3 non-translated sequence may contain a transcription termination signal which may or may not include a polyadenylation signal and any other regulatory signals capable of effecting mRNA processing. A polyadenylation signal functions for addition of polyadenylic acid tracts to the 3 end of a mRNA precursor. Polyadenylation signals are commonly recognized by the presence of homology to the canonical form 5 AATAAA-3 although variations are not uncommon. Transcription termination sequences which do not include a polyadenylation signal include terminators for Poll or PolIII RNA polymerase which comprise a run of four or more thymidines. Examples of suitable 3 non-translated sequences are the 3 transcribed non-translated regions containing a polyadenylation signal from an octopine synthase (ocs) gene or nopaline synthase (nos) gene of Agrobacterium tumefaciens (Bevan et al., 1983). Suitable 3 non-translated sequences may also be derived from plant genes such as the ribulose-1,5-bisphosphate carboxylase (ssRUBISCO) gene, although other 3 elements known to those of skill in the art can also be employed.
(117) As the DNA sequence inserted between the transcription initiation site and the start of the coding sequence, i.e., the untranslated 5 leader sequence (5UTR), can influence gene expression if it is translated as well as transcribed, one can also employ a particular leader sequence. Suitable leader sequences include those that comprise sequences selected to direct optimum expression of the foreign or endogenous DNA sequence. For example, such leader sequences include a preferred consensus sequence which can increase or maintain mRNA stability and prevent inappropriate initiation of translation as for example described by Joshi (1987).
Vectors
(118) The present invention includes use of vectors for manipulation or transfer of genetic constructs. By chimeric vector is meant a nucleic acid molecule, preferably a DNA molecule derived, for example, from a plasmid, bacteriophage, or plant virus, into which a nucleic acid sequence may be inserted or cloned. A vector preferably is double-stranded DNA and contains one or more unique restriction sites and may be capable of autonomous replication in a defined host cell including a target cell or tissue or a progenitor cell or tissue thereof, or capable of integration into the genome of the defined host such that the cloned sequence is reproducible. Accordingly, the vector may be an autonomously replicating vector, i.e., a vector that exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a linear or closed circular plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector may contain any means for assuring self-replication. Alternatively, the vector may be one which, when introduced into a cell, is integrated into the genome of the recipient cell and replicated together with the chromosome(s) into which it has been integrated. A vector system may comprise a single vector or plasmid, two or more vectors or plasmids, which together contain the total DNA to be introduced into the genome of the host cell, or a transposon. The choice of the vector will typically depend on the compatibility of the vector with the cell into which the vector is to be introduced. The vector may also include a selection marker such as an antibiotic resistance gene, a herbicide resistance gene or other gene that can be used for selection of suitable transformants. Examples of such genes are well known to those of skill in the art.
(119) The nucleic acid construct of the invention can be introduced into a vector, such as a plasmid. Plasmid vectors typically include additional nucleic acid sequences that provide for easy selection, amplification, and transformation of the expression cassette in prokaryotic and eukaryotic cells, e.g., pUC-derived vectors, pSK-derived vectors, pGEM-derived vectors, pSP-derived vectors, pBS-derived vectors, or binary vectors containing one or more T-DNA regions. Additional nucleic acid sequences include origins of replication to provide for autonomous replication of the vector, selectable marker genes, preferably encoding antibiotic or herbicide resistance, unique multiple cloning sites providing for multiple sites to insert nucleic acid sequences or genes encoded in the nucleic acid construct, and sequences that enhance transformation of prokaryotic and eukaryotic (especially plant) cells.
(120) By marker gene is meant a gene that imparts a distinct phenotype to cells expressing the marker gene and thus allows such transformed cells to be distinguished from cells that do not have the marker. A selectable marker gene confers a trait for which one can select based on resistance to a selective agent (e.g., a herbicide, antibiotic, radiation, heat, or other treatment damaging to untransformed cells). A screenable marker gene (or reporter gene) confers a trait that one can identify through observation or testing, i.e., by screening (e.g., -glucuronidase, luciferase, GFP or other enzyme activity not present in untransformed cells). The marker gene and the nucleotide sequence of interest do not have to be linked.
(121) To facilitate identification of transformants, the nucleic acid construct desirably comprises a selectable or screenable marker gene as, or in addition to, the foreign or exogenous polynucleotide. The actual choice of a marker is not crucial as long as it is functional (i.e., selective) in combination with the plant cells of choice. The marker gene and the foreign or exogenous polynucleotide of interest do not have to be linked, since co-transformation of unlinked genes as, for example, described in U.S. Pat. No. 4,399,216 is also an efficient process in plant transformation.
(122) Examples of bacterial selectable markers are markers that confer antibiotic resistance such as ampicillin, erythromycin, chloramphenicol or tetracycline resistance, preferably kanamycin resistance. Exemplary selectable markers for selection of plant transformants include, but are not limited to, a hyg gene which encodes hygromycin B resistance; a neomycin phosphotransferase (nptII) gene conferring resistance to kanamycin, paromomycin, G418; a glutathione-S-transferase gene from rat liver conferring resistance to glutathione derived herbicides as, for example, described in EP 256223; a glutamine synthetase gene conferring, upon overexpression, resistance to glutamine synthetase inhibitors such as phosphinothricin as, for example, described in WO 87/05327, an acetyltransferase gene from Streptomyces viridochromogenes conferring resistance to the selective agent phosphinothricin as, for example, described in EP 275957, a gene encoding a 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) conferring tolerance to N-phosphonomethylglycine as, for example, described by Hinchee et al. (1988), a bar gene conferring resistance against bialaphos as, for example, described in WO91/02071; a nitrilase gene such as bxn from Klebsiella ozaenae which confers resistance to bromoxynil (Stalker et al., 1988); a dihydrofolate reductase (DHFR) gene conferring resistance to methotrexate (Thillet et al., 1988); a mutant acetolactate synthase gene (ALS), which confers resistance to imidazolinone, sulfonylurea or other ALS-inhibiting chemicals (EP 154,204); a mutated anthranilate synthase gene that confers resistance to 5-methyl tryptophan; or a dalapon dehalogenase gene that confers resistance to the herbicide.
(123) Preferred screenable markers include, but are not limited to, a uidA gene encoding a -glucuronidase (GUS) enzyme for which various chromogenic substrates are known, a -galactosidase gene encoding an enzyme for which chromogenic substrates are known, an aequorin gene (Prasher et al., 1985), which may be employed in calcium-sensitive bioluminescence detection; a green fluorescent protein gene (Niedz et al., 1995) or derivatives thereof; a luciferase (luc) gene (Ow et al., 1986), which allows for bioluminescence detection, and others known in the art. By reporter molecule as used in the present specification is meant a molecule that, by its chemical nature, provides an analytically identifiable signal that facilitates determination of promoter activity by reference to protein product.
(124) Preferably, the nucleic acid construct is stably incorporated into the genome of, for example, the plant or cell of the invention. Accordingly, the nucleic acid comprises appropriate elements which allow the molecule to be incorporated into the genome, or the construct is placed in an appropriate vector which can be incorporated into a chromosome of a plant cell.
(125) One embodiment of the present invention includes a recombinant vector, which includes at least one polynucleotide molecule of the present invention, inserted into any vector capable of delivering the nucleic acid molecule into a host cell. Such a vector contains heterologous nucleic acid sequences, that is nucleic acid sequences that are not naturally found adjacent to nucleic acid molecules of the present invention and that preferably are derived from a species other than the species from which the nucleic acid molecule(s) are derived. The vector can be either RNA or DNA, either prokaryotic or eukaryotic, and typically is a virus or a plasmid.
(126) A number of vectors suitable for stable transfection of plant cells or for the establishment of transgenic plants have been described in, e.g., Pouwels et al., Cloning Vectors: A Laboratory Manual, 1985, supp. 1987; Weissbach and Weissbach, Methods for Plant Molecular Biology, Academic Press, 1989; and Gelvin et al., Plant Molecular Biology Manual, Kluwer Academic Publishers, 1990. Typically, plant expression vectors include, for example, one or more cloned plant genes under the transcriptional control of 5 and 3 regulatory sequences and a dominant selectable marker. Such plant expression vectors also can contain a promoter regulatory region (e.g., a regulatory region controlling inducible or constitutive, environmentally- or developmentally-regulated, or cell- or tissue-specific expression), a transcription initiation start site, a ribosome binding site, an RNA processing signal, a transcription termination site, and/or a polyadenylation signal.
(127) The level of a ROS1s polypeptide may be modulated by decreasing the level of expression of a gene encoding the protein in the rice plant, leading to increased aleurone thickness. The level of expression of a gene may be modulated by altering the copy number per cell, for example by introducing a synthetic genetic construct comprising the coding sequence and a transcriptional control element that is operably connected thereto and that is functional in the cell. A plurality of transformants may be selected and screened for those with a favourable level and/or specificity of transgene expression arising from influences of endogenous sequences in the vicinity of the transgene integration site. A favourable level and pattern of transgene expression is one which results in increased aleurone thickness. Alternatively, a population of mutagenized seed or a population of plants from a breeding program may be screened for individual lines with increased aleurone thickness.
Recombinant Cells
(128) Another embodiment of the present invention includes a recombinant cell comprising a host cell transformed with one or more recombinant molecules of the present invention, or progeny cells thereof. Transformation of a nucleic acid molecule into a cell can be accomplished by any method by which a nucleic acid molecule can be inserted into the cell. Transformation techniques include, but are not limited to, transfection, electroporation, microinjection, lipofection, adsorption, and protoplast fusion. A recombinant cell may remain unicellular or may grow into a tissue, organ or a multicellular organism. Transformed nucleic acid molecules of the present invention can remain extrachromosomal or can integrate into one or more sites within a chromosome of the transformed (i.e., recombinant) cell in such a manner that their ability to be expressed is retained. Preferred host cells are plant cells, more preferably a rice cell.
Plants with Genetic Variations
(129) The term plant as used herein as a noun refers to whole plants and refers to any member of the Kingdom Plantae, but as used as an adjective refers to any substance which is present in, obtained from, derived from, or related to a plant, such as for example, plant organs (e.g. leaves, stems, roots, flowers), single cells (e.g. pollen), seeds, plant cells and the like. Plantlets and germinated seeds from which roots and shoots have emerged are also included within the meaning of plant. The term plant parts as used herein refers to one or more plant tissues or organs which are obtained from a plant and which comprises genomic DNA of the plant. Plant parts include vegetative structures (for example, leaves, stems), roots, floral organs/structures, seed (including embryo, cotyledons, and seed coat), plant tissue (for example, vascular tissue, ground tissue, and the like), cells and progeny of the same. The term plant cell as used herein refers to a cell obtained from a plant or in a plant and includes protoplasts or other cells derived from plants, gamete-producing cells, and cells which regenerate into whole plants. Plant cells may be cells in culture. By plant tissue is meant differentiated tissue in a plant or obtained from a plant (explant) or undifferentiated tissue derived from immature or mature embryos, seeds, roots, shoots, fruits, tubers, pollen, tumor tissue, such as crown galls, and various forms of aggregations of plant cells in culture, such as calli. Exemplary plant tissues in or from seeds are cotyledon, embryo and embryo axis. The invention accordingly includes plants and plant parts and products comprising these.
(130) The terms grain and seed are used interchangeably herein. Grain can refer to mature grain in the plant, developing grain in the plant, harvested grain or to grain after processing such as, for example, milling or polishing, where most of the grain stays intact, or after imbibition or germination, according to the context. Mature grain commonly has a moisture content of less than about 18-20%. In an embodiment, developing grain of the invention is at least about 10 days after pollination (DAP). In an embodiment, developing grain of the invention is at least includes grain between anthesis and 7 days post-anthesis.
(131) A transgenic plant as used herein refers to a plant with one or more genetic variations as defined herein such contains a nucleic acid construct not found in a wild-type plant of the same species, variety or cultivar. That is, transgenic plants (transformed plants) contain genetic material (a transgene) that they did not contain prior to the transformation. The transgene may include genetic sequences obtained from or derived from a plant cell, or another plant cell, or a non-plant source, or a synthetic sequence. Typically, the transgene has been introduced into the plant by human manipulation such as, for example, by transformation but any method can be used as one of skill in the art recognizes. The genetic material is preferably stably integrated into the genome of the plant. The introduced genetic material may comprise sequences that naturally occur in the same species but in a rearranged order or in a different arrangement of elements, for example an antisense sequence. Plants containing such sequences are included herein in transgenic plants.
(132) A non-transgenic plant is one which has not been genetically modified by the introduction of genetic material by recombinant DNA techniques.
(133) Wild-type, as used herein, refers to a cell, tissue, grain or plant that has not been modified according to the invention. Wild-type cells, tissue or plants may be used as controls to compare levels of expression of an exogenous nucleic acid or the extent and nature of trait modification with cells, tissue, grain or plants modified as described herein.
(134) As used herein, the term corresponding wild-type rice plant or grain, or similar phrases, refers to a rice plant or grain which comprises at least 50%, more preferably at least 75%, more preferably at least 95%, more preferably at least 97%, more preferably at least 99%, and even more preferably 99.5% of the genotype of a rice plant or grain of the invention, but does not comprise the one or more genetic variations (such as introduced genetic variations) which each reduce the activity of a ROS1a gene in the plant or grain, and/or a thickened aleurone. In an embodiment, a rice grain or plant of the invention is isogenic relative a wild-type rice grain or plant apart from the one or more genetic variations (such as introduced genetic variations). Preferably, the corresponding wild-type plant or grain is of/from the same cultivar or variety as the progenitor of the plant/grain of the invention, or a sibling plant line which lacks the one or more genetic modifications and/or does not have a thickened aleurone, often termed a segregant. In an embodiment, the rice plant or grain of the invention has a genotype that is less than 50% identical to the genotype of rice cultivar Zhonghua 11 (ZH11). ZH11 has been commercially available since 1986.
(135) Transgenic plants, as defined in the context of the present invention include progeny of the rice plants which have been genetically modified using recombinant techniques, wherein the progeny comprise the transgene of interest. Such progeny may be obtained by self-fertilization of the primary transgenic plant or by crossing such plants with another rice plant. This would generally be to modulate the production of at least one protein defined herein in the desired plant or plant organ. Transgenic plant parts include all parts and cells of said plants comprising the transgene such as, for example, cultured tissues, callus and protoplasts.
(136) As used herein, the term rice refers to any species of the Genus Oryza, including progenitors thereof, as well as progeny thereof produced by crosses with other species. It is preferred that the plant is of a Oryza species which is commercially cultivated such as, for example, a strain or cultivar or variety of Oryza sativa or suitable for commercial production of grain.
(137) As used herein, brown rice means the whole grain of rice including the bran layer and embryo (germ) but not the hull which has been removed, usually during harvesting. That is, brown rice has not been polished to remove the aleurone and embryo. The brown refers to the presence of brown or yellow-brown pigments in the bran layer. Brown rice is considered a wholegrain. As used herein white rice (milled rice) means rice grain from which the bran and germ have been removed i.e. essentially the starchy endosperm of the whole rice grain. Both of these classes of rice grain may come in short, medium or long grain forms. Compared with white rice, brown rice has a higher content of protein, minerals and vitamins and a higher lysine content in its protein content.
(138) As used herein, pigmented rice includes black rice and red rice, each of which contain pigments in the aleurone layer, such as proanthocyanidins (tannins). Pigmented rice has a higher riboflavin content than non-pigmented rice, but similar thimine content. Black rice has a black or almost black coloured bran layer due to anthocyanins, and may turn a deep purple colour upon cooking. Purple rice (also known as forbidden rice) is a short grain variant of black rice and is included in black rice as defined here. It is purple in colour in the uncooked state and deep purple when cooked. Red rice contains a variety of anthocyanins that gives the bran a red/maroon colour, including cyanidin-3-glucoside (chrysanthemin) and peonidin-3-glucoside (oxycoccicy-anin).
(139) Each of these types of rice grain may be treated so as prevent germination, for example by cooking (boiling) or by dry heating. Brown and pigmented rice is typically cooked for 20-40 min, depending on the desired texture, whereas white rice is typically cooked for 12-18 min. Cooking or heating reduces the levels of antinutritional factors in rice grain such as trypsin inhibitor, oryzacystatin and haemagglutinins (lectins) by denaturation of these proteins, but not of the phytate content. Rice grain may also be soaked in water before cooking, or slow-cooked for longer times, as known in the art. Rice grain may also be cracked, parboiled, or heat-stabilised. Rice bran may be steam treated to stabilise it, for example for about 6 min at 100 C.
(140) In an embodiment, grain of the invention has delayed grain maturation when compared to corresponding wild-type grain. Delayed maturation can be determined by using the seed setting rate (%) which entails calculating the percentage of florets in the plant that were filled by a seed by the mature grain stage.
(141) In an embodiment, grain of the invention has a decreased germination capacity when compared corresponding wild-type grain. For example, the grain has about 70% to about 80%, or about 75%, preferably 70% to 100%, of the germination capacity of corresponding wild-type grain when cultured at 28 C. under 12 h light/12 h dark cycles without humidity control in a growth chamber. The term germination as used herein is defined as when the radicle had visibly emerged through the seed coat.
(142) In an embodiment, plants of the invention have one or more or all of normal plant height, fertility (male and female), grain size and 1000 grain weight relative to the wild-type parental variety (such as an isogenic plant comprising a ROS1a polypeptide with a sequence of amino acids provided as SEQ ID NO: 2). In an embodiment, grain of the invention is capable of producing a rice plant which has one or more or all of: normal plant height, fertility (male and female), grain size and 1000 grain weight relative to the wild-type parental variety. As used herein, the term normal can be determined by measuring the same trait in the wild-type parental variety grown under the same conditions as a plant of the invention. In an embodiment, to be normal a plant of the invention has +/10%, more preferably +/5%, more preferably +/2.5%, even more preferably +/1%, of the level/number etc of the defined feature when compared to the wild-type parental variety.
(143) Transgenic plants, as defined in the context of the present invention include plants (as well as parts and cells of said plants) and their progeny which have been genetically modified using recombinant techniques to cause production of at least one polypeptide of the present invention in the desired plant or plant organ. Transgenic plants can be produced using techniques known in the art, such as those generally described in A. Slater et al., Plant BiotechnologyThe Genetic Manipulation of Plants, Oxford University Press (2003), and P. Christou and H. Klee, Handbook of Plant Biotechnology, John Wiley and Sons (2004).
(144) In a preferred embodiment, the transgenic plants are homozygous for each and every gene or nucleic acid construct that has been introduced (transgene) so that their progeny do not segregate for the desired phenotype. The transgenic plants may also be heterozygous for the introduced transgene(s), such as, for example, in F1 progeny which have been grown from hybrid seed. Such plants may provide advantages such as hybrid vigour, well known in the art.
(145) In an embodiment, a method of selecting a rice plant of the invention further comprises analysing a DNA sample from the plant for at least one other genetic marker. As used herein, the other genetic marker may be any molecules which are linked to a desired trait of a plant. Such markers are well known to those skilled in the art and include molecular markers linked to genes determining traits such disease resistance, yield, plant morphology, grain quality, dormancy traits, grain colour, gibberellic acid content in the seed, plant height, flour colour and the like. Examples of such genes are the Rht genes that determine a semi-dwarf growth habit and therefore lodging resistance.
(146) Four general methods for direct delivery of a gene into cells have been described: (1) chemical methods (Graham et al., 1973); (2) physical methods such as microinjection (Capecchi, 1980); electroporation (see, for example, WO 87/06614, U.S. Pat. Nos. 5,472,869, 5,384,253, WO 92/09696 and WO 93/21335); and the gene gun (see, for example, U.S. Pat. Nos. 4,945,050 and 5,141,131); (3) viral vectors (Clapp, 1993; Lu et al., 1993; Eglitis et al., 1988); and (4) receptor-mediated mechanisms (Curiel et al., 1992; Wagner et al., 1992).
(147) Acceleration methods that may be used include, for example, microprojectile bombardment and the like. One example of a method for delivering transforming nucleic acid molecules to plant cells is microprojectile bombardment. This method has been reviewed by Yang et al., Particle Bombardment Technology for Gene Transfer, Oxford Press, Oxford, England (1994). Non-biological particles (microprojectiles) that may be coated with nucleic acids and delivered into cells by a propelling force. Exemplary particles include those comprised of tungsten, gold, platinum, and the like. A particular advantage of microprojectile bombardment, in addition to it being an effective means of reproducibly transforming monocots, is that neither the isolation of protoplasts, nor the susceptibility of Agrobacterium infection are required. A particle delivery system suitable for use with the present invention is the helium acceleration PDS-1000/He gun is available from Bio-Rad Laboratories. For the bombardment, immature embryos or derived target cells such as scutella or calli from immature embryos may be arranged on solid culture medium.
(148) In another alternative embodiment, plastids can be stably transformed. Method disclosed for plastid transformation in higher plants include particle gun delivery of DNA containing a selectable marker and targeting of the DNA to the plastid genome through homologous recombination (U.S. Pat. Nos. 5,451,513, 5,545,818, 5,877,402, 5,932,479, and WO 99/05265.
(149) Agrobacterium-mediated transfer is a widely applicable system for introducing genes into plant cells because the DNA can be introduced into whole plant tissues, thereby bypassing the need for regeneration of an intact plant from a protoplast. The use of Agrobacterium-mediated plant integrating vectors to introduce DNA into plant cells is well known in the art (see, for example, U.S. Pat. Nos. 5,177,010, 5,104,310, 5,004,863, 5,159,135). Further, the integration of the T-DNA is a relatively precise process resulting in few rearrangements. The region of DNA to be transferred is defined by the border sequences, and intervening DNA is usually inserted into the plant genome.
(150) A transgenic plant formed using Agrobacterium transformation methods typically contains a single genetic locus on one chromosome. Such transgenic plants can be referred to as being hemizygous for the added gene. More preferred is a transgenic plant that is homozygous for the added structural gene; i.e., a transgenic plant that contains two added genes, one gene at the same locus on each chromosome of a chromosome pair. A homozygous transgenic plant can be obtained by sexually mating (selfing) an independent segregant transgenic plant that contains a single added gene, germinating some of the seed produced and analyzing the resulting plants for the gene of interest.
(151) Other methods of cell transformation can also be used and include but are not limited to introduction of DNA into plants by direct DNA transfer into pollen, by direct injection of DNA into reproductive organs of a plant, or by direct injection of DNA into the cells of immature embryos followed by the rehydration of desiccated embryos.
(152) The regeneration, development, and cultivation of plants from single plant protoplast transformants or from various transformed explants is well known in the art (Weissbach et al., Methods for Plant Molecular Biology, Academic Press, San Diego, (1988)). This regeneration and growth process typically includes the steps of selection of transformed cells, culturing those individualized cells through the usual stages of embryonic development through the rooted plantlet stage. Transgenic embryos and seeds are similarly regenerated. The resulting transgenic rooted shoots are thereafter planted in an appropriate plant growth medium such as soil.
(153) The development or regeneration of plants containing the foreign, exogenous gene is well known in the art. Preferably, the regenerated plants are self-pollinated to provide homozygous transgenic plants. Otherwise, pollen obtained from the regenerated plants is crossed to seed-grown plants of agronomically important lines. Conversely, pollen from plants of these important lines is used to pollinate regenerated plants. A transgenic plant of the present invention containing a desired exogenous nucleic acid is cultivated using methods well known to one skilled in the art.
(154) To confirm the presence of the transgenes in transgenic cells and plants, a polymerase chain reaction (PCR) amplification or Southern blot analysis can be performed using methods known to those skilled in the art. Expression products of the transgenes can be detected in any of a variety of ways, depending upon the nature of the product, and include Western blot and enzyme assay. One particularly useful way to quantitate protein expression and to detect replication in different plant tissues is to use a reporter gene, such as GUS. Once transgenic plants have been obtained, they may be grown to produce plant tissues or parts having the desired phenotype. The plant tissue or plant parts, may be harvested, and/or the seed collected. The seed may serve as a source for growing additional plants with tissues or parts having the desired characteristics.
Marker Assisted Selection
(155) Marker assisted selection is a well recognised method of selecting for heterozygous plants required when backcrossing with a recurrent parent in a classical breeding program. The population of plants in each backcross generation will be heterozygous for the gene of interest normally present in a 1:1 ratio in a backcross population, and the molecular marker can be used to distinguish the two alleles of the gene. By extracting DNA from, for example, young shoots and testing with a specific marker for the introgressed desirable trait, early selection of plants for further backcrossing is made whilst energy and resources are concentrated on fewer plants. To further speed up the backcrossing program, the embryo from immature seeds (25 days post anthesis) may be excised and grown up on nutrient media under sterile conditions, rather than allowing full seed maturity. This process, termed embryo rescue, used in combination with DNA extraction at the three leaf stage and analysis of at least one genetic variation that alters ROS1a activity and that confers upon the plant increased aleurone thickness, allows rapid selection of plants carrying the desired trait, which may be nurtured to maturity in the greenhouse or field for subsequent further backcrossing to the recurrent parent.
(156) Any molecular biological technique known in the art can be used in the methods of the present invention. Such methods include, but are not limited to, the use of nucleic acid amplification, nucleic acid sequencing, nucleic acid hybridization with suitably labeled probes, single-strand conformational analysis (SSCA), denaturing gradient gel electrophoresis (DGGE), heteroduplex analysis (HET), chemical cleavage analysis (CCM), catalytic nucleic acid cleavage or a combination thereof (see, for example, Lemieux, 2000; Langridge et al., 2001). The invention also includes the use of molecular marker techniques to detect polymorphisms linked to alleles of the (for example) ROS1a gene which alters ROS1a activity and that confers upon the plant increased aleurone thickness. Such methods include the detection or analysis of restriction fragment length polymorphisms (RFLP), RAPD, amplified fragment length polymorphisms (AFLP) and microsatellite (simple sequence repeat, SSR) polymorphisms. The closely linked markers can be obtained readily by methods well known in the art, such as Bulked Segregant Analysis, as reviewed by Langridge et al. (2001).
(157) In an embodiment, a linked loci for marker assisted selection is at least within 1 cM, or 0.5 cM, or 0.1 cM, or 0.01 cM from a gene encoding a polypeptide of the invention.
(158) The polymerase chain reaction (PCR) is a reaction in which replicate copies are made of a target polynucleotide using a pair of primers or set of primers consisting of upstream and a downstream primer, and a catalyst of polymerization, such as a DNA polymerase, and typically a thermally-stable polymerase enzyme. Methods for PCR are known in the art, and are taught, for example, in PCR (M. J. McPherson and S. G Moller (editors), BIOS Scientific Publishers Ltd, Oxford, (2000)). PCR can be performed on cDNA obtained from reverse transcribing mRNA isolated from plant cells expressing a ROS1a gene or allele which upon the plant increased aleurone thickness. However, it will generally be easier if PCR is performed on genomic DNA isolated from a plant.
(159) A primer is an oligonucleotide sequence that is capable of hybridising in a sequence specific fashion to the target sequence and being extended during the PCR. Amplicons or PCR products or PCR fragments or amplification products are extension products that comprise the primer and the newly synthesized copies of the target sequences. Multiplex PCR systems contain multiple sets of primers that result in simultaneous production of more than one amplicon. Primers may be perfectly matched to the target sequence or they may contain internal mismatched bases that can result in the introduction of restriction enzyme or catalytic nucleic acid recognition/cleavage sites in specific target sequences. Primers may also contain additional sequences and/or contain modified or labelled nucleotides to facilitate capture or detection of amplicons. Repeated cycles of heat denaturation of the DNA, annealing of primers to their complementary sequences and extension of the annealed primers with polymerase result in exponential amplification of the target sequence. The terms target or target sequence or template refer to nucleic acid sequences which are amplified.
(160) Methods for direct sequencing of nucleotide sequences are well known to those skilled in the art and can be found for example in Ausubel et al., (supra) and Sambrook et al., (supra). Sequencing can be carried out by any suitable method, for example, dideoxy sequencing, chemical sequencing or variations thereof. Direct sequencing has the advantage of determining variation in any base pair of a particular sequence.
Tilling
(161) Plants of the invention can be produced using the process known as TILLING (Targeting Induced Local Lesions IN Genomes). In a first step, introduced mutations such as novel single base pair changes are induced in a population of plants by treating seeds (or pollen) with a chemical mutagen, and then advancing plants to a generation where mutations will be stably inherited. DNA is extracted, and seeds are stored from all members of the population to create a resource that can be accessed repeatedly over time.
(162) For a TILLING assay, PCR primers are designed to specifically amplify a single gene target of interest. Specificity is especially important if a target is a member of a gene family or part of a polyploid genome. Next, dye-labeled primers can be used to amplify PCR products from pooled DNA of multiple individuals. These PCR products are denatured and reannealed to allow the formation of mismatched base pairs. Mismatches, or heteroduplexes, represent both naturally occurring single nucleotide polymorphisms (SNPs) (i.e., several plants from the population are likely to early the same polymorphism) and induced SNPs (i.e., only rare individual plants are likely to display the mutation). After heteroduplex formation, the use of an endonuclease, such as Cel I, that recognizes and cleaves mismatched DNA is the key to discovering novel SNPs within a TILLING population.
(163) Using this approach, many thousands of plants can be screened to identify any individual with a single base change as well as small insertions or deletions (1-30 bp) in any gene or specific region of the genome. Genomic fragments being assayed can range in size anywhere from 0.3 to 1.6 kb. At 8-fold pooling, 1.4 kb fragments (discounting the ends of fragments where SNP detection is problematic due to noise) and 96 lanes per assay, this combination allows up to a million base pairs of genomic DNA to be screened per single assay, making TILLING a high-throughput technique.
(164) TILLING is further described in Slade and Knauf (2005), and Henikoff et al. (2004).
(165) In addition to allowing efficient detection of mutations, high-throughput TILLING technology is ideal for the detection of natural polymorphisms. Therefore, interrogating an unknown homologous DNA by heteroduplexing to a known sequence reveals the number and position of polymorphic sites. Both nucleotide changes and small insertions and deletions are identified, including at least some repeat number polymorphisms. This has been called Ecotilling (Comai et al., 2004).
(166) Each SNP is recorded by its approximate position within a few nucleotides. Thus, each haplotype can be archived based on its mobility. Sequence data can be obtained with a relatively small incremental effort using aliquots of the same amplified DNA that is used for the mismatch-cleavage assay. The left or right sequencing primer for a single reaction is chosen by its proximity to the polymorphism. Sequencher software performs a multiple alignment and discovers the base change, which in each case confirmed the gel band.
(167) Ecotilling can be performed more cheaply than full sequencing, the method currently used for most SNP discovery. Plates containing arrayed ecotypic DNA can be screened rather than pools of DNA from mutagenized plants. Because detection is on gels with nearly base pair resolution and background patterns are uniform across lanes, bands that are of identical size can be matched, thus discovering and genotyping SNPs in a single step. In this way, ultimate sequencing of the SNP is simple and efficient, made more so by the fact that the aliquots of the same PCR products used for screening can be subjected to DNA sequencing.
Grain Processing
(168) Due to the thickened aleurone, rice grain of the invention, and flour and bran therefrom, has an improved nutritional content. Isolated aleurone tissue should contain low levels of starch and pericarp, and represents a major portion of the grain's physiologically beneficial substances for human nutrition. For instance, grain of the invention and/or flour produced therefrom comprises, when compared to a corresponding wild-type grain and/or flour produced therefrom, one or more or all of the following, each on a weight basis, i) a higher mineral content such as about at least 20% or at least about 25% higher, preferably the mineral content is the content one or more or all of zinc (such as at least about 10% or at least about 15% higher), iron (such as at least about 10% or at least about 15% higher), potassium (such as at least about 20% or at least about 25% higher), magnesium (such as at least about 18% or at least about 22% higher), phosphorus (such as at least about 17% or at least about 21% higher) and sulphur (such as at least about 5% or at least about 8% higher), ii) a higher antioxidant content such as at least about 25%, or at least about 35%, more total phenolic compounds, and/or at least about 60%, or at least about 70%, more hydrophilic antioxidants, iii) a higher phytate content such as at least about 10% or at least about 15% higher, iv) a higher content of one or more or all of vitamins B3, B6 and B9, v) a higher dietary fibre content and/or insoluble fibre content (such as at least about 150%, or at least about 180%, higher total fibre), vi) a starch content which is between about 90% and about 100% by weight relative to the starch content of the corresponding wild-type grain, vii) a higher sucrose content, viii) a higher monosaccharide content (for example arabinose, xylose, galactose, glucose content) such as at least about 1.5 or at least about 2 fold higher, ix) higher fat content such as at least about 20%, at least about 30% or at least about 50%, or about 50%, higher, and x) similar nitrogen levels.
(169) Each of these nutritional components of grain can be determined using routine techniques such as outlined in Examples 1 and 5.
(170) In one embodiment, rice grain of the invention and/or flour produced therefrom, comprises one or more or all of the following, each on a weight basis, i) at least about 20%, at least about 30% or at least about 50%, or about 50% more fat when compared to corresponding wild-type grain/flour, ii) at least about 11 mg/g or at least about 12 mg/g total phytate, iii) at least about 20% or at least about 25% more mineral content in flour obtained from the grain when compared to flour from a corresponding wild-type grain, iv) at least about 14 mg/kg or at least about 15 mg/kg total zinc, v) at least about 13 mg/kg or at least about 13.5 mg/kg total iron, vi) at least about 150%, or at least about 180% more total fibre when compared to corresponding wild-type grain/flour, vii) a starch content which is between about 90% and about 100% by weight relative to the starch content of the corresponding wild-type grain/flour, viii) at least about 1.5 or at least about 2 fold higher monosaccharide content (for example arabinose, xylose, galactose, glucose content) when compared to corresponding wild-type grain/flour, and ix) at least about 25%, or at least about 35%, more total phenolic compounds, and/or at least about 60%, or at least about 70%, more hydrophilic antioxidants, when compared to corresponding wild-type grain/flour.
(171) In an embodiment, the grain comprises an increased proportion of amylose in its total starch content compared to the corresponding wild-type grain. Methods of producing such grain are described in, for example, WO 2002/037955, WO 2003/094600, WO 2005/040381, WO 2005/001098, WO 2011/011833 and WO 2012/103594.
(172) In an embodiment, grain of the invention comprises an increased proportion of oleic acid and/or a decreased proportion of palmitic acid in its total fatty acid content compared to the corresponding wild-type grain. Methods of producing such grain are described in, for example, WO 2008/006171 and WO 2013/159149.
(173) Grain/seed of the invention, or other plant parts of the invention, can be processed to produce a food ingredient, food or non-food product using any technique known in the art.
(174) As used herein, the term other food or beverage ingredient refers to any substance suitable for consumption by an animal, preferably any substance suitable for consumption by a human, when provided as part of a food or beverage. Examples include, but are not limited to, grain from other plant species, sugar, etc, but excluding water.
(175) In one embodiment, the product is whole grain flour such as, for example, an ultrafine-milled whole grain flour, or a flour made from about 100% of the grain. The whole grain flour includes a refined flour constituent (refined flour or refined flour) and a coarse fraction (an ultrafine-milled coarse fraction).
(176) Refined flour may be flour which is prepared, for example, by grinding and bolting cleaned grain. The particle size of refined flour is described as flour in which not less than 98% passes through a cloth having openings not larger than those of woven wire cloth designated 212 micrometers (U.S. Wire 70). The coarse fraction includes at least one of: bran and germ. For instance, the germ is an embryonic plant found within the grain kernel. The germ includes lipids, fiber, vitamins, protein, minerals and phytonutrients, such as flavonoids. The bran includes several cell layers and has a significant amount of lipids, fiber, vitamins, protein, minerals and phytonutrients, such as flavonoids. Further, the coarse fraction may include an aleurone layer which also includes lipids, fiber, vitamins, protein, minerals and phytonutrients, such as flavonoids. The aleurone layer, while technically considered part of the endosperm, exhibits many of the same characteristics as the bran and therefore is typically removed with the bran and germ during the milling process. The aleurone layer contains proteins, vitamins and phytonutrients, such as ferulic acid.
(177) Further, the coarse fraction may be blended with the refined flour constituent. The coarse fraction may be mixed with the refined flour constituent to form the whole grain flour, thus providing a whole grain flour with increased nutritional value, fiber content, and antioxidant capacity as compared to refined flour. For example, the coarse fraction or whole grain flour may be used in various amounts to replace refined or whole grain flour in baked goods, snack products, and food products. The whole grain flour of the present invention (i.e.-ultrafine-milled whole grain flour) may also be marketed directly to consumers for use in their homemade baked products. In an exemplary embodiment, a granulation profile of the whole grain flour is such that 98% of particles by weight of the whole grain flour are less than 212 micrometers.
(178) In further embodiments, enzymes found within the bran and germ of the whole grain flour and/or coarse fraction are inactivated in order to stabilize the whole grain flour and/or coarse fraction. Stabilization is a process that uses steam, heat, radiation, or other treatments to inactivate the enzymes found in the bran and germ layer. Flour that has been stabilized retains its cooking characteristics and has a longer shelf life.
(179) In additional embodiments, the whole grain flour, the coarse fraction, or the refined flour may be a component (ingredient) of a food product and may be used to product a food product. For example, the food product may be a bagel, a biscuit, a bread, a bun, a croissant, a dumpling, an English muffin, a muffin, a pita bread, a quickbread, a refrigerated/frozen dough product, dough, baked beans, a burrito, chili, a taco, a tamale, a tortilla, a pot pie, a ready to eat cereal, a ready to eat meal, stuffing, a microwaveable meal, a brownie, a cake, a cheesecake, a coffee cake, a cookie, a dessert, a pastry, a sweet roll, a candy bar, a pie crust, pie filling, baby food, a baking mix, a batter, a breading, a gravy mix, a meat extender, a meat substitute, a seasoning mix, a soup mix, a gravy, a roux, a salad dressing, a soup, sour cream, a noodle, a pasta, ramen noodles, chow mein noodles, lo mein noodles, an ice cream inclusion, an ice cream bar, an ice cream cone, an ice cream sandwich, a cracker, a crouton, a doughnut, an egg roll, an extruded snack, a fruit and grain bar, a microwaveable snack product, a nutritional bar, a pancake, a par-baked bakery product, a pretzel, a pudding, a granola-based product, a snack chip, a snack food, a snack mix, a waffle, a pizza crust, animal food or pet food.
(180) In alternative embodiments, the whole grain flour, refined flour, or coarse fraction may be a component of a nutritional supplement. For instance, the nutritional supplement may be a product that is added to the diet containing one or more additional ingredients, typically including: vitamins, minerals, herbs, amino acids, enzymes, antioxidants, herbs, spices, probiotics, extracts, prebiotics and fiber. The whole grain flour, refined flour or coarse fraction of the present invention includes vitamins, minerals, amino acids, enzymes, and fiber. For instance, the coarse fraction contains a concentrated amount of dietary fiber as well as other essential nutrients, such as B-vitamins, selenium, chromium, manganese, magnesium, and antioxidants, which are essential for a healthy diet. For example 22 grams of the coarse fraction of the present invention delivers 33% of an individual's daily recommend consumption of fiber. The nutritional supplement may include any known nutritional ingredients that will aid in the overall health of an individual, examples include but are not limited to vitamins, minerals, other fiber components, fatty acids, antioxidants, amino acids, peptides, proteins, lutein, ribose, omega-3 fatty acids, and/or other nutritional ingredients. The supplement may be delivered in, but is not limited to the following forms: instant beverage mixes, ready-to-drink beverages, nutritional bars, wafers, cookies, crackers, gel shots, capsules, chews, chewable tablets, and pills. One embodiment delivers the fiber supplement in the form of a flavored shake or malt type beverage, this embodiment may be particularly attractive as a fiber supplement for children.
(181) In an additional embodiment, a milling process may be used to make a multi-grain flour or a multi-grain coarse fraction. For example, bran and germ from one type of grain may be ground and blended with ground endosperm or whole grain cereal flour of another type of cereal. Alternatively bran and germ of one type of grain may be ground and blended with ground endosperm or whole grain flour of another type of grain. It is contemplated that the present invention encompasses mixing any combination of one or more of bran, germ, endosperm, and whole grain flour of one or more grains. This multi-grain approach may be used to make custom flour and capitalize on the qualities and nutritional contents of multiple types of cereal grains to make one flour.
(182) It is contemplated that the whole grain flour, coarse fraction and/or grain products of the present invention may be produced by any milling process known in the art. An exemplary embodiment involves grinding grain in a single stream without separating endosperm, bran, and germ of the grain into separate streams. Clean and tempered grain is conveyed to a first passage grinder, such as a hammermill, roller mill, pin mill, impact mill, disc mill, air attrition mill, gap mill, or the like. After grinding, the grain is discharged and conveyed to a sifter. Further, it is contemplated that the whole grain flour, coarse fraction and/or grain products of the present invention may be modified or enhanced by way of numerous other processes such as: fermentation, instantizing, extrusion, encapsulation, toasting, roasting, or the like.
EXAMPLES
Example 1. General Materials and Methods
Observation of Aleurone by Staining with Sudan Red Solution
(183) Stain solution was prepared by adding 1 g of Sudan red IV to 50 ml of polyethylene glycol solution (average molecular weight 400, Sigma, Cat. No. 202398), incubated at 90 C. for one hour, and mixed with equal volume of 90% glycerol. After removing the fruit coat (palea and lemma) of each grain, mature rice grains were incubated in distilled water for five hours and then sectioned transversely or longitudinally using a razor blade. Sections were stained in Sudan red solution at room temperature for 24 to 72 hours. The sections were then counter-stained with Lugol staining solution at room temperature for 20 min (Sigma, 32922) and observed under dissecting microscope (Sreenivasulu, 2010).
Staining of Aleurone with Evans Blue
(184) Evans Blue stain solution was prepared by dissolving 0.1 g of Evans blue (Sigma, E2129) in 100 ml distilled water. After removing the fruit coat (palea and lemma) of each grain, mature rice grains were sectioned transversely using a razor blade. Sections were incubated in distilled water at room temperature for 30 min, the stain added and left at room temperature for 2 min. The stain solution was then discarded, the sections washed twice with distilled water and observed under a dissecting microscope.
Light Microscopic Observation of Rice Endosperm
(185) Rice grains were fixed in formalin-acetic acid-alcohol (FAA) solution (60% ethanol, 5% glacial acetic acid and 2% formaldehyde), degassed for one hour, dehydrated in a series of alcohol solutions containing 70%, 80%, 95% and then 100% ethanol, infiltrated by LR white resin (Electron Microscopy Sciences, 14380) and polymerized for 24 hours at 60 C. Microtome sectioning was done using a Leica UC7 microtome. Sections were stained in 0.1% toluidine blue solution (Sigma, T3260) at room temperature for 2 min, then washed twice with distilled water and examined by light microscopy. Alternatively, sections were stained in 0.01% Calcofluor white solution (Sigma, 18909) at room temperature for 2 min and examined by light microscopy.
Staining with PAS and Commassie Blue
(186) The fixed sections on slides were incubated in preheated 0.4% periodic acid (Sigma, 375810) at 57 C. for 30 min, then rinsed three times in distilled water. Schiff reagent (Sigma, 3952016) was applied and the slides incubated at room temperature for 15 min, then rinsed three times in distilled water. The sections were then incubated in 1% Coomassie blue (R-250), ThermoScientific, 20278) at room temperature for 2 min, and rinsed three times in distilled water. Dehydration of the sections was achieved using a series of alcohol solutions having 30%, 50%, 60%, 75%, 85%, 95% to 100% ethanol for 2 min each, followed by clearing of each slide in 50% xylene and 100% xylene solution (Sigma, 534056) for 2 min each. Coverslips were then mounted with Eukitt quick hardening mounting medium (Fluka, 03989) and the sections observed under a light microscope.
DNA Extraction and PCR Conditions
(187) Two methods were used for DNA extraction from plant leaf samplesa rapid DNA extraction method to provide less pure DNA samples and a more extensive DNA extraction method for purer DNA, modified from Huang (2009). In the first method, four glass beads with diameter of 2 mm (Sigma, 273627), 1 to 2 mg of rice leaf tissue and 150 l of extraction buffer (10 mM Tris, pH9.5, 0.5 mM EDTA, 100 mM KCl) were added to each well of a 96-well PCR plate. The plate was sealed and mixtures homogenised using a Mini-Beadbeater-96 mixer (GlenMills, 1001) for 1 min. After centrifugation at 3000 rpm for 5 min, the extracted supernatants containing DNA were used in PCR reactions.
(188) In the second method, two glass beads with diameter of 2 mm and 0.2 g leaf were in 1.5 ml Eppendorf tubes were cooled in liquid nitrogen for 10 min. Samples were then homogenised in the Mini-Beadbeater-96 for 1 min, then 600 l DNA extraction buffer (2% SDS, 0.4M NaCl, 2 mM EDTA, 10 mM Tris-HCl, pH8.0) was added to each tube and the mixtures incubated at 65 C. for one hour. After cooling the mixtures, 450 l of 6M NaCl was added, mixed and centrifuged at 12000 rpm for 20 min. Each supernatant was transferred to a new tube and the DNA precipitated using an equal volume of 2-propanol at 20 C. for one hour. DNA was recovered by centrifugation at 2400 rpm at 4 C. for 20 min and the pellets washed twice with 75% ethanol. The pellets were air-dried at room temperature and each resuspended in 600 l distilled water containing 10 ng/ulRNAse (ThermoScientific, EN0201)) and used in PCR reactions.
(189) The PCR reactions used 5 l of 2PCR buffer containing Taq Polymerase (ThermoScientific, K0171), 5 and 3 oligonucleotide primers and 1 l of DNA sample in a total volume of 10 l. Amplification was performed using 35 cycles of 94 C. for sec, 55 C. for 30 sec and 72 C. for 30 sec. Amplification products were analysed by gel electrophoresis using 3% agarose gels. Control PCR reactions used DNA preparations from homozygous Zhonghua11 (ZH11) (wild-type japonica rice), homozygous NJ6 (wild type indica rice), and the mixture of ZH11 and NJ6.
(190) For genetic mapping of the ta2 allele, PCR amplifications for the genetic markers used the following primer pairs (5 to 3 sequences): INDEL 127 (position 6,343,260 on Chromosome 1), forward primer TGAGTAGTTGCGTTGTTCT (SEQ ID NO: 15), reverse primer TCTTAGTGAGCCGTTTCT (SEQ ID NO: 16); INDEL 129 (position 6,560,681 on Chromosome 1), forward primer CCTTCTGTGCTATGGGTT (SEQ ID NO: 17), reverse primer CATGCCAAGACACCACTT (SEQ ID NO: 18); INDEL 128 (position 6,470,027 on Chromosome 1), forward primer TGGCTTTGGAAACGGTAG (SEQ ID NO: 19), reverse primer TTTAGAGGGATGTGCGTCA (SEQ ID NO: 20); INDEL 149 (position 6,427,144 on Chromosome 1), forward primer AAACAACGATCCAGCAAA (SEQ ID NO: 21), reverse primer TTGGCACCGTATTACTTTC (SEQ ID NO: 22).
TILLING Assays
(191) The primers that were used in the TILLING assays had the nucleotide sequences:
(192) TABLE-US-00002 TA2-1F: (SEQIDNO:23) ACGCATTCTTCATTGACTGTATGT TA2-1R: (SEQIDNO:24) GCCCTTTCAATACAATGACTAGGT TA2-2F: (SEQIDNO:25) GAACATTTGAATCATGTTCCTCAC TA2-2R: (SEQIDNO:26) ACTATCCTTTGATGCAAGTTCTCC TA2-3F: (SEQIDNO:27) GTTGGAAGAGCAGTTAAAGCAAAT TA2-3R: (SEQIDNO:28) CTTCGGCAGTGAAATTTAGTAACA TA2-4F: (SEQIDNO:29) TACAGAACTTCTACGAATGCAGGA TA2-4R: (SEQIDNO:30) GCAACATGAATTGCTAAAGATGAG.
(193) The PCR amplifications with ExTaq were performed with the following reaction conditions: 95 C. for 2 min; 8 cycles of 94 C. for 20 s, 68 C. for 30 s (1 C. decrease per cycle), and 72 C. for 60 s for every 1 kb of amplicon length, followed by 35 cycles of 94 C. for 20 s, 60 C. for 30 s, and 72 C. for 60 s for each 1 kb of amplicon length, and a final extension at 72 C. for 5 min. PCR products from the wild-type and test samples were mixed and subjected to a complete denaturation-slow annealing program to form heteroduplexes under the following conditions: 99 C. for 10 mM for denaturation, followed by 70 cycles of decrements, starting at 70 C., 20 s each, with a 0.3 C. decrease per cycle, and then holding at 15 C. to reanneal the denatured PCR products to form heteroduplexes. Cell digestions of annealed PCR products were performed in 15 L reaction mixtures containing Cell buffer (10 mM HEPES, pH 7.5, 10 mM KCl, 10 mM MgSO.sub.4, 0.002% Triton X-100, and 0.2 ng/mL bovine serum albumin (BSA), 4 L of PCR product, and 1 unit Cell (10 units/L) if PCR products were polymerized by Ex Taq, or 20 units Cell if the PCR products were polymerized by KOD), at 45 C. for 15 min, followed by adding 3 L of 0.5 M EDTA (pH 8.0) to stop the reaction. Alternatively, the digestions were performed in 15-L reaction mixtures containing 4 L of PCR products and 2 units of mung bean nuclease (MBN, 10 units/L, Cat. No. M02505; New England Biolabs, USA) in MBN buffer (20 mM Bis-Tris, pH 6.5, 10 mM MgSO.sub.4, 0.2 mM ZnSO.sub.4, 0.002% Triton X-100, and 0.2 g/mL BSA) at 60 C. for 30 min, followed by adding 2 L of 0.2% SDS to stop the reaction.
(194) CelI-digested PCR products in 96-well PCR plates were diluted to 100 L with deionized water, and capillary electrophoresis was performed at 9 kV, 30 s for pre-run, 15 s for injection of 1 ng/L molecular weight marker 75 and 15 kb or 50 and 3 kb dsDNA (Fermentas, Canada), 45 s for sample injection, and 40 min for sample separations in an AdvanCE FS96 apparatus (Advanced Analytical Technologies, USA). Gel pictures were acquired and analysed using PROSize software (Advanced Analytical Technologies, USA) for capillary electrophoresis.
DNA Glycosylase (DME) Enzyme Assays
(195) Demeter (DME) is a bifunctional DNA glycosylase/lyase with activity on 5-methylcytosine substrates. Plants have 5-methylcytosine in the three sequence contexts: CpG, CpNpG, and CpNpN and DME has activity on 5-methylcytosine in each of these sequence contexts. In the enzyme assay which is performed in vitro, the cleavage of the phosphodiester linkage on the 5 side of a methylated cytosine was detected, yielding elimination products. Treatment of the DNA reaction products with strong base (NaOH) prior to gel electrophoresis confirmed the elimination process at the predicted position.
(196) Synthetic oligonucleotides which were to be used as substrates in the enzyme assays were synthesized as follows with nucleotide modifications denoted within parentheses as shown below:
(197) TABLE-US-00003 MEA-1.6F, (SEQIDNO:31) 5-CTATACCTCCTCAACTCCGGTCACCGTCTCCGGCG MEA-1.6F18meC, (SEQIDNO:32) 5-CTATACCTCCTCAACTC(5-meC)GGTCACCGTCTCCGGCG MEA-1.6F17meC, (SEQIDNO:33) 5-CTATACCTCCTCAACT(5-meC)CGGTCACCGTCTCCGGCG MEA-1.6F22meC, (SEQIDNO:34) 5-CTATACCTCCTCAACTCCGGT(5-meC)ACCGTCTCCGGCG MEA-1.6F18AP, (SEQIDNO:35) 5-CTATACCTCCTCAACTC(abasic)GGTCACCGTCTCCGGCG MEA-1.6F17AP, (SEQIDNO:36) 5-CTATACCTCCTCAACT(abasic)CGGTCACCGTCTCCGGCG MEA-1.6F15AP, (SEQIDNO:37) 5-CTATACCTCCTCAA(abasic)TCCGGTCACCGTCTCCGGCG MEA-1;6F12AP, (SEQIDNO:38) 5-CTATACCTCCT(abasic)AACTCCGGTCACCGTCTCCGGCG MEA-1.6F18T, (SEQIDNO:39) 5-CTATACCTCCTCAACTCTGGTCACCGTCTCCGGCG MEA-1.6R, (SEQIDNO:40) 5-CGCCGGAGACGGTGACCGGAGTTGAGGAGGTATAG MEA-1.6R17meC, (SEQIDNO:41) 5-CGCCGGAGACGGTGAC(5-meC)GGAGTTGAGGAGGTATAG.
(198) Twenty pmol of each oligonucleotide was end-labelled in a 50 L reaction using units of T4 polynucleotide kinase in the presence of 30 Ci of (-32P)-ATP (6000 Ci/mmol, Perkin Elmer Life Sciences) at 37 C. for 1 hr. Each labelled oligonucleotide was purified using a Qiaquick Nucleotide Removal Kit (Qiagen) as described by the manufacturer. Labelled oligonucleotides were annealed to the appropriate complementary oligonucleotides in 10 mMTris-HCl (pH 8.0), 1 mM EDTA and 0.1 M NaCl. Each mixture was heated to 100 C. for 10 min and then slowly cooled to room temperature overnight. MspI or HpaII restriction endonuclease digestion followed by gel electrophoresis was used to determine the efficiency of annealing. Only substrates that were greater than 90% double-stranded were used in glycosylase activity assays.
(199) 5-labeled oligonucleotide substrates (13.3 nM) were incubated with DME protein (250 nM) in a 15 ml reaction with 40 mM HEPES-KOH (pH 8.0), 0.1M KCl, 0.1 mM EDTA, 0.5 mM dithiothreitol, and 200 mg/ml BSA at 37 for 1 hr. The reaction was terminated with 15 ml of 95% formamide, 20 mM EDTA, 0.05% bromophenol blue, 0.05% xylene cyanol FF and boiled for 5 mM. To induce elimination, NaOH was added at a final concentration of 0.1 M and the reaction was boiled for 7 min. Products were fractionated on a 15% polyacrylamide gel containing 7.5 M urea and 1TBE. Electrophoresis was done at 1000V for 4 hr with a Hoefer SQ3 gel apparatus. The gel was exposed to Kodak BioMax MR film at 80 C.
Analytical Methods
(200) Proximates and other major constituents in grain, food ingredients and food samples were determined using standard methods, for example as described below.
(201) Grain moisture content was measured according to (Association of Official Analytical Chemists) AOAC Method 925.10. Briefly, grain samples (2 g) were dried to constant weight in an oven at 130 C. for about 1 h.
(202) Ash content was measured according to AOAC Method 923.03. Samples used for moisture determination were ashed in a muffle furnace at 520 C. for 15 h.
Protein Content of Grain, Food Ingredients and Food Samples
(203) Protein content was measured according to AOAC Method 992.23. Briefly, total nitrogen was analysed by the Dumas combustion method using an automated nitrogen analyser (Elementar Rapid N cube, Elementar Analysensysteme GmbH, Hanau, Germany). The protein content of grain or food samples (g/100 g) was estimated by multiplying nitrogen content by 6.25.
Sugars, Starch and Other Polysaccharides
(204) Total starch content was measured according to AOAC Method 996.11 which uses the enzymatic method of McCleary et al. (1997).
(205) The amount of sugars was measured according to AOAC Method 982.14. Briefly, simple sugars were extracted with aqueous ethanol (80% ethanol) and then quantified by HPLC using a polyamine-bonded polymeric gel column, using acetonitrile:water (75:25 v/v) as the mobile phase and an evaporative light scattering detector.
(206) Total neutral non-starch polysaccharides (NNSP) were measured by the gas chromatographic procedure of Theander et al. (1995) with a slight modification which involved a 2 h hydrolysis with 1 M sulfuric acid followed by centrifugation.
(207) Fructans (fructo-oligosaccharides) were analysed by the method detailed by AOAC Method 999.03. Briefly, the fructo-oligosaccharides were extracted into water followed by digestion with a sucrase/maltase/invertase mixture. The resultant free sugars were then reduced with sodium borohydride and digested to fructose/glucose with fructanose. The released fructose/glucose was measured using p-hydroxybenzioc acid hydrazine (PAFIBAH).
Fibre Content
(208) Total Dietary Fibre (TDF) was measured according to AOAC Method 985.29 and Soluble and Insoluble Fibre (SIF) according to AOAC Method 991.43. Briefly, TDF was determined by the gravimetric technique of Prosky et al. (1985), as detailed in the AOAC Method 985.29, and SIF was determined by a gravimetric technique as described in AOAC 991.43.
Total Lipid
(209) Samples of 5 g flour were incubated with 1% Clarase 40000 (Southern Biological, MC23.31) at 45 C. for one hour. Lipids were extracted from the samples into chloroform/methanol by multiple extractions. After centrifugation to separate phases, the chloroform/methanol fraction was removed and dried at 101 C. for 30 min to recover the lipid. The mass of residue left represents the total lipid in the sample (AOAC Method 983.23).
Fatty Acid Profile of Lipids
(210) Lipid was extracted from milled flours into chloroform according to AOAC Method 983.23. A portion of the chloroform fraction containing the lipid was evaporated under a stream of nitrogen after addition of an aliquot of hepta-decanoic acid as an internal standard. The residue was suspended in 1% sulfuric acid in dry methanol and the mixture heated at 50 C. for 16 h. The mixture was diluted with water and extracted twice with hexane. The combined hexane solution was loaded onto a small column of Florisil and the column washed with hexane and the fatty acid methyl esters then eluted with 10% ether in hexane. The eluent was evaporated to dryness and the residue dissolved in iso-octane for injection onto the GC. Fatty acid methyl esters were quantified against a mixture of standard fatty acids. GC conditions: Column SGE BPX70 30 m0.32 mm0.25 um; Injection 0.5 L; Injector 250 C.; 15:1 split; Flow 1.723 ml/min constant flow; Oven 150 C. for 0.5 min, 10 C./min to 180 C., 1.5 C./min to 220 C., 30 C./min to 260 C. (total run-time 33 mins); Detector FID at 280 C.
Antioxidant Activity (ORAC-H)
(211) The hydrophilic antioxidant activity (ORAC-H) was determined following the method of Huang (2002a and 2002b) with modification as described by Wolbang et al. (2010). The samples were extracted for lipophilic antioxidants followed by hydrophilic antioxidants as follows: 100 mg of sample weighed in triplicate into 2 mL microtubes. 1 mL hexane:dichloromethane (50:50) was then added and mixed vigorously for 2 min and centrifuged at 13,000 rpm for 2 min at 10 C. The supernatant was transferred to a glass vial and the pellet re-extracted with a further 2 mL of hexane:dichloromethane mix. The mixing and centrifuge steps were then repeated, and the supernatant transferred to the same glass vial. Residual solvent from the pellet was evaporated under a gentle stream of nitrogen. 1 mL of acetone: water: acetic acid mix (70:29.5:0.5) then added and mixed vigorously for 2 min. The mixture was then centrifuged as before and the supernatant used in the ORAC-H plate assay. Samples were diluted as required with phosphate buffer. The area under the curve (AUC) was calculated and compared against AUC values for Trolox standards. The ORAC value is reported as uMTrolox equivalents/g of sample.
Phenolics
(212) Total phenolics content as well as phenolics in the free, conjugated and bound states were determined following extraction according to the method described by Li et al. (2008) with minor modifications. Briefly, the free phenolics were determined in 100 mg samples following extraction into 2 mL 80% methanol by sonication for 10 mins in a glass vial (8 ml capacity). The supernatant was transferred to a second glass vial and the extraction of the residue repeated. The combined supernatants were evaporated to dryness under nitrogen. 2 mL of acetic acid (2%) was added to adjust the pH to about 2 and then 3 mL ethyl acetate added to extract the phenolics with shaking for 2 mins. The vials were centrifuged at 2000g for 5 mins at 10 C. Supernatants were transferred to a clean glass vial and the extraction repeated twice more. Combined supernatants were evaporated under nitrogen at 37 C. Residues were dissolved in 2 mL 80% methanol and refrigerated.
(213) Samples for the conjugated phenolics were treated as for the free phenolic assay for the initial 80% methanol extraction. At this point 2.5 mL (2M) sodium hydroxide and a magnetic bar were added to the evaporated supernatants in the glass vial which was then filled with nitrogen and capped tightly. The vials were mixed and heated at 110 C. for 1 h with stirring. Samples were cooled on ice before extraction with 3 mL ethyl acetate by shaking for 2 min. The vials were centrifuged at 2000g for 5 min at 10 C. Supernatants were discarded and pH adjusted to about 2 with 12 M HCl. Phenolics were extracted using 33 mL aliquots of ethyl acetate as described for the free phenolics. The supernatants were combined and evaporated to dryness under nitrogen at 37 C. and the residue was taken up in 2 mL 80% methanol and refrigerated.
(214) Bound phenolics were measured from the residues following methanolic extraction of the free phenolics. 2.5 mL (2M) sodium hydroxide and a magnetic bar were added to the residue before filling the vial with nitrogen and capping it tightly. The vials were mixed and heated at 110 C. for 1 h with stirring. Samples were cooled on ice before extraction with 3 mL ethyl acetate by shaking for 2 mins. The vials were centrifuged at 2000g for 5 mins at 10 C. The supernatant was discarded and pH adjusted to about 2 with 12 M HCl. Phenolics were extracted with 33 mL aliquots of ethyl acetate as described for the free phenolics. The supernatants were combined and evaporated to dryness under nitrogen at 37 C. and the residue was taken up in 2 mL 80% methanol and refrigerated.
(215) Total phenolics were determined using 100 mg of samples by adding 200 uL 80% methanol to wet the samples prior to hydrolysis. 2.5 mL (2M) sodium hydroxide and a magnetic bar were added before filling the vial with nitrogen and capping tightly. The vials were mixed and heated at 110 C. for 1 hr with stirring. Samples were cooled on ice before extraction with 3 mL ethyl acetate by shaking for 2 mins. The vials were centrifuged at 2000g for 5 mins at 10 C. The supernatant was discarded and pH adjusted to about 2 with 12 M HCl. Phenolics were extracted with 33 mL aliquots of ethyl acetate as described for the free phenolics. The supernatants were combined and evaporated to dryness under nitrogen at 37 C. and the residue was taken up in 4 mL 80% methanol and refrigerated.
(216) The amount of phenolics in the treated/extracted samples was measured using Folin Ciocalteu's assay for determination of phenolics. Gallic acid standards at 0, 1.56, 3.13, 6.25, 12.5, and 25 g/mL were used to prepare a standard curve. 1 mL of standards were added to 4 mL glass tubes. For test samples, 100 L aliquots of thoroughly mixed samples were added to 900 L water in 4 mL glass tubes. 100 mL of Folin Ciocalteu's reagent was then added to each tube which was vortexed immediately. 700 sodium bicarbonate solution (1 M) was added after 2 min and then mixed by vortexing. Each solution was incubated at room temperature in the dark for 1 h and then absorbance read at 765 nm. Results were expressed in g gallic acid equivalents/g sample.
Phytate
(217) Determination of the phytate content of the flour samples was based on the method of Harland and Oberleas, as described in AOAC Official Methods of Analysis (1990). Briefly, a 0.5 g flour sample was weighed and extracted with 2.4% HCl using a rotating wheel (30 rpm) for 1 hour at room temperature. The mixture was then centrifuged at 2000g for 10 minutes and the supernatant extracted and diluted 20-fold with milli-Q water. An anion exchange column (500 mg Agilent Technologies) was placed on a vacuum manifold and conditioned for use following the manufacturer's instructions. The diluted supernatant was then loaded onto a column and non-phytate species removed by washing with 0.05 M HCl. Phytate was then eluted with 2 M HCl. The collected eluate was digested using a heating block. The sample was cooled and the volume made up to 10 mL with milli-Q water. Phosphorous levels were determined by spectrophotometer using the molybdate, sulphonic acid colouring method with absorbance readings at 640 nm. Phytate was calculated using the following formula:
Phytate (mg/g)=Pconc*V1*V2/(1000*sample weight*0.282)
where P cone is the concentration of phosphorous (g/mL), as determined by spectrophotometry, V1 is the volume of the final solution, V2 is the volume of the extracted phytate solution, and 0.282 is the phosphorus to phytate conversion factor.
Total Mineral Content Estimation
(218) Total mineral content of samples was measured by ash assay using AOAC Methods 923.03 and 930.22. About 2 g of flour was heated at 540 C. for 15 hours and the mass of ash residue was then weighed. Wholemeal flour samples of 0.5 g were digested using tube block digestion with 8M nitric acid at 140 C. for eight hours. Zinc, iron, potassium, magnesium, phosphorus and sulphur contents were then analysed using inductively coupled plasma atomic emission spectrometry (TCP-AES) according to Zarcinas (1983a and 1983b).
(219) Minerals were analysed at CSIRO, Urrbrae, Adelaide South Australia, at Waite Analytical Service (University of Adelaide, Waite, South Australia) and at Dairy Technical Services (DTS, North Melbourne, Victoria). Elements were determined by Inductively Coupled Plasma-Optical Emission Spectroscopy (ICP-OES) after digestion with nitric acid solution (CSIRO) or dilute nitric acid and hydrogen peroxide (DTS) or by Inductively Coupled Plasma Atomic Emission Spectroscopy (ICP-AES) after digestion with nitric/perchloric acid solution.
Vitamins
(220) Vitamins B1 (Niacin), B3 (Pyridoxine) and total folate analyses were performed by DTS as well as National Measurement Institute (NMI). Niacin was measured by AOAC Methods 13th Ed (1980) 43.045, according to Lahey, et al. (1999). Pyridoxine was measured according to Mann et al. (2001). The method incorporated a pre-column transformation of phosphorylated and free vitamin B6 forms into pyridoxine (pyridoxol). Acid phosphatase hydrolysis was used for dephosphorylation followed by de-amination with glyoxylic acid in the presence of Fe.sup.2+ to convert pyridoxamine to pyridoxal. Pyridoxal was then reduced by sodium borohydride to pyridoxine.
(221) Folic acid was measured either according to VitaFast Folic acid kit using the manufacturer's instructions, or according to AOAC method 2004.05.
Example 2. Isolation and Characterisation of Thick-Aleurone (Ta) Mutants
Establishment and Cultivation of a Mutagenized Rice Population
(222) About 8000 grains (designated M.sub.0 grains) from wild-type rice cultivar Zhonghua11 (ZH11) were mutagenized by treatment with 60 mM ethyl methane sulfonate (EMS) using standard conditions. Mutagenised grains were sown in the field and the resultant plants cultivated to produce M.sub.1 grains. M.sub.1 grains were harvested and then sown in the field to produce M.sub.1 plants. 8925 panicles were harvested from 1327 individual M.sub.1 plants. From these plants 36,420 M.sub.2 grains were screened, including at least 4 grains from each panicle.
Mutant Screening by Staining of Half Grains
(223) The fruit coat (palea and lemma) of M.sub.2 rice grains were removed. Each of the 36,420 grains was transverse bisected. The halves containing an embryo were saved in 96-well plates for subsequent germination, while each half grain without an embryo was stained with Evans Blue and observed under a dissecting microscope to detect mutant grains having thickened aleurones relative to the wild-type. The staining was based on the principle that Evans Blue could only penetrate and stain non-viable cells such as the cells of the starchy endosperm while no colour change was observed in the viable aleurone layer. From initial Evans Blue staining and histological analyses, individual grains exhibiting significant increases in aleurone thickness as well as grains showing a significant thickening in the ventral side aleurone of the seed were observed. Other grains showed an increase in aleurone thickness but to a lesser extent. The unstained region of the ventral side of each seed was especially examined for thickness of the aleurone layer. Variants with increases in thickness of the aleurone layer on the dorsal side of the grains were also observed. Only variants with significant increases in the thickness of the aleurone layer across the entire cross-section were chosen for further analysis.
(224) Compared with wild-type half-grains, the half-grains having a thicker unstained region with Evans Blue were selected. Amongst the 36,420 grains examined, 219 grains (0.60%) having differences in aleurone thickness were identified and selected. These had been obtained from 162 panicles from 140 individual M.sub.1 plants, and therefore most represented independent mutants. One mutant grain in particular was identified and characterised further as described below, having a mutation designated thick-aleurone 2 (ta2). The corresponding wild-type gene was therefore designated Ta2; that designation is used herein.
(225) To maintain the putative mutant lines, each corresponding embryonated half grain was germinated on medium containing half-strength MS salts medium (Murashige and Skoog, 1962) solidified with 1% Bacto agar (Bacto, 214030) and cultured at 25 C. under light of intensity 1500-2000 Lux with 16 h light/8 h dark cycles. The plantlets were transferred to soil at the two to three leaflet stage and the resultant plants grown to maturity. Upon the germination and cultivation of the corresponding embryonated half grains, 115 seeds (52.5% survival) were grown up to produce mature and fertile plants.
(226) Candidate mutant plants which exhibited little or no defects in general agronomical traits such as those that were of normal plant height, fertility (male and female fertility), grain size and 1000 grain weight relative to the wild-type parental variety as well as showing stable inheritance of the thickened aleurone trait were identified, selected and further analysed. Among them, a mutant designated ta2 which showed a more extreme multi-aleurone phenotype of six to seven cell layers was selected and analysed in detail. The wild-type grains exhibited an aleurone of one cell layer, as expected.
Histological Analyses of the Ta2 Mutant Grains
(227) Developing grain from wild-type ZH11 and ta2 mutant plants were studied and compared for morphological changes from 1 to 30 days after pollination (DAP). The ripening phase of rice grain can be said to have three stages: a milk grain stage, a dough grain stage and a mature grain stage. In the dough grain stage, the grains in wild-type panicles began to change in colour from green to yellow, following by a gradual destruction of vesicular tissue connecting the stalk and caryopsis. Grains in the ta2 panicles were delayed in the colour change. Microscopic examination of the transverse sections of the rice grains also showed an increase in the degree of chalkiness (opaqueness) in ta2 mutant grains. Scanning electron microscopy (SEM) was then used to study the structure of the starch granule organization in the middle part of the starchy endosperm. In wild-type grains, starch granules were tightly packed and showed a smooth surface and regular shape, while in ta2 grains, a looser packing of irregular-shaped starch granules was observed. In summary, at least three changes were observed in the plants and grain having the ta2 mutation: a delay in grain maturation, an increase in the degree of chalkiness of the grain and in starch granule structure.
(228) Developing mutant and wild-type grains at 6, 7, 8, 9, 10, 12, 15, 18, 21, 24, 27 and 30 DAP were stained with Evans Blue and the aleurone layers examined by light microscopy. No significant difference was observed in the thickness of the developing aleurone layers between wild-type and ta2 mutant grains up until 10 DAP. After 10 DAP, the aleurone layers of ta2 mutants were thicker than in the wild-type grains, and the difference reached a maximum at around 20 DAP. These results were consistent with those from Sudan red staining.
(229) The wild-type and ta2 mutant grains (30 DAP) were further examined for histological differences by sectioning (1 m), staining and light microscopy. After staining with 0.1% toluidine blue which stains nucleic acid blue and polysaccharide purple, a single layer of large, regularly oriented, rectangular cells was observed in wild-type aleurones. In contrast, sections of ta2 mutant grains had aleurone layers of six to eight cell layers, the cells also being of varying sizes and irregular orientation. These observations indicated that the thickened aleurones in the ta2 grains were mainly caused by the increase in the number of cell layers rather than the enlargement of individual aleurone cells.
(230) Further staining with 0.01% Calcoflour White, a fluorescent cell wall stain, showed no difference in cell wall thickness between wild-type and ta2 mutant grains. The cell walls of aleurone cells were thicker than cell walls in the starchy endosperm for both wild-type and ta2 grains.
Analysis of the Agronomical Characteristics of Ta2 Mutant Plants and Grains
(231) After backcrossed to wild-type (ZH11) plants for three generations in the field to yield the BC3F3 generation, thereby removing additional, unlinked mutations that might have arisen from the mutagenic treatment, ta2 mutant plants were analysed for some agronomical traits. The ta2 mutant plants and grain were not significantly different, compared to wild-type plants and grain, in plant height, 1000 grain-weight, grain size (length, width and thickness) and calyopsis morphology (Table 2). In contrast, wild-type plants showed a seed setting rate of 98.9% whereas ta2 mutant plants showed a decrease in seed setting rate at 73.4%. The seed setting rate was calculated as the percentage of florets in the plant that were filled by a seed by the mature grain stage. Moreover, the ta2 mutant grains showed a decrease in germination capacity of 75.1% in comparison with wild-type grain of 97.3% when cultured at 28 C. under 12 h light/12 h dark cycles without humidity control in a growth chamber. Germination was defined as when the radicle had visibly emerged through the seed coat.
Example 3. Genetic Analysis of the Ta2 Mutant
(232) Based on the maternal origin of aleurone and endosperm tissues in a growing plant, two genetic experiments were performed to determine whether the thick aleurone phenotype was maternally determined. Firstly, a test cross was performed between a maternal ta2 (mutant) plant and a paternal wild-type plant, and F2 progeny grains obtained. Of the F2 grains, 49.4% (n=634) showed the thickened aleurone phenotype, which deviated significantly from the 3:1 (wild-type:mutant) ratio predicted for Mendelian inheritance of a dominant gene in an F2 population. Secondly, a reciprocal cross was performed between a 02 plant and a wild-type plant. All F1 seeds (100%; n=589) showed the thickened aleurone phenotype, while in the reciprocal cross using the wild-type as the maternal plant, all F1 seeds (n=197) resulted in the wild-type phenotype. These crosses showed that the aleurone phenotype was determined by the maternal plant genotype.
(233) TABLE-US-00004 TABLE 2 Comparison of wild-type (ZH11) and ta2 mutant plants for agronomical traits. ZH11 ta2 Plant Height (cm) 103.7 (3.24) 112.2 (6.05) Seed setting rate (%) 98.9 (3.41) 73.41 (3.41) 1000 seeds weight (g) 22.73 (0.17) 22.07 (0.33) Seed length (mm) 7.46 (0.26) 7.55 (0.27) Seed width (mm) 3.27 (0.12) 3.15 (0.10) Seed thickness (mm) 2.35 (0.10) 2.27 (0.11)
(234) In order to establish whether the maternal effect was determined by the gametophytic or sporophytic genotype, F1 plants which were heterozygous Tat/tat, obtained from a cross between homozygous Ta2/Ta2 and homozygous ta2/ta2 plants, were used in reciprocal crosses with either ta2 homozygous (ta2/ta2) or wild-type plants. In the reciprocal crosses between a maternal heterozygote and a paternal wild-type, 47.3% (n=188) of F1 grains showed the ta2 mutant phenotype, while in the reciprocal cross between a maternal ta2 plant and a paternal heterozygote, 99.3% (n=425) of F1 individuals showed the ta2 mutant phenotype. From these results, it was concluded that the TA2 gene conferred the phenotype by a gametophytic, maternal mode of inheritance.
(235) According to the above genetic analyses, a model of ta2 inheritance can be proposed, according to a gametophytic maternal mode of inheritance. When the genotype of the maternal gametophyte is ta2, the endosperm phenotype is the mutant ta2 (thickened aleurone) and is independent of the paternal genotype. Therefore, the thick aleurone phenotype was determined solely by the genotype of the maternal gametophyte during the development of the triploid starchy endosperm and aleurone, such that a maternal heterozygote resulted in 50% of progeny having a thick aleurone phenotype, independent of the paternal genotype, and a maternal ta2/ta2 homozygote resulted in 100% of progeny having a thick aleurone phenotype. Further experiments are needed to test whether the gametophytic maternal effect of TA2 is caused by the presence of the additional copy of the maternal gene in the triploid endosperm or by the effect of gene imprinting by the maternal gametophyte to suppress the expression of a paternal TA2 gene.
Example 4. Identification of the Ta2 Gene by Genetic Mapping and Sequence Analysis
Identification and Use of SSR and INDEL Markers for Gene Mapping
(236) For gene mapping, an F2 population of plants was produced from the genetic cross between a plant containing the ta2 mutation in the genetic background of ZH11 (a Japonica variety) and a plant of the Indica variety NJ6. To identify genetic markers which were polymorphic between ZH11 and NJ6 and which could then be used in the gene mapping, a set of PCR experiments was performed on leaf DNA samples from homozygous ZH11 plants, homozygous NJ6 plants and a 1:1 mixture of the DNAs. Analysis of the PCR products by gel electrophoresis allowed comparison of the products from ZH11, NJ6 and the mixtures to identify polymorphic markers. Primer pairs were selected for the gene mapping only if the amplifications with separate ZH11 and NJ6 DNAs showed discrete and different amplified products and the mixed DNA showed the combination of both products. A total of 124 primer pairs were thereby selected including 54 insertion-deletion polymorphisms (INDEL) and 70 short sequence repeats (SSR) polymorphisms. These genetic markers were distributed at approximately 3-4 Mbp intervals along the rice genome and gave good coverage for gene mapping.
(237) For genetic mapping of the ta2 allele, 143 plants from the F2 population were scored with the 124 polymorphic markers. Homozygosity of the individual F2 plants in the mapping population for the aleurone phenotype was assessed carefully by phenotyping of F3 progeny grains obtained from each F2 plant. Leaf DNA was extracted as described in Example 1. PCR amplifications were done as described in Example 1 and the products separated by gel electrophoresis through 3% agarose. It was concluded from the results that the ta2 locus was located between markers INDEL 127 and INDEL 129 on Chromosome 1 (
(238) Another 5000 F2 plants were screened with this pair of markers. 362 individuals were identified and selected which exhibited a recombination between INDEL 127 and INDEL 129. When these recombinant plants were phenotyped, the ta2 locus was thereby mapped to a 42.8 kb region which lay between the INDEL 149 and INDEL 128 markers (
(239) To obtain the nucleotide sequence of this region in the ta2 mutant plants and compare it to the wild-type sequence and thereby identify a mutation corresponding to ta2, primers flanking the genomic region were designed and DNA sequencing was carried out. The comparison of the genomic DNA sequences identified two single-nucleotide polymorphisms (SNPs) in the sequenced region, both in the gene annotated as LOC_01 g11900. The first was a single nucleotide G (wild-type) to A (ta2) polymorphism at nucleotide position Chr1: 6451738, with reference to the rice genome sequence of the Japonica variety, located in intron 14 between exon 14 and exon 15 of the gene LOC_01 g11900 in chromosome 1 (asterisk in
(240) Upon RNA extraction, reverse transcription and sequencing of the cDNA corresponding to the ta2 allele, it was observed that the first G to A polymorphism at Chr1: 6451738 was associated with an insertion of 21 bp (
(241) The gene at position LOC_01 g11900 in chromosome 1 of the rice genome has been annotated as the rice ROS1a gene (OsROS1), a homolog of the Arabidopsis thaliana Demeter gene (AtDME) which encodes a bifunctional DNA glycosylase/lyase. The Arabidopsis DME enzyme acts as a DNA demethylase, reducing methylation of C residues in DNA. Therefore the Tat gene is synonymous with OsROS1a gene and a homolog of the Arabidopsis DME gene.
(242) The nucleotide sequence of the rice ROS1a gene is shown in SEQ ID NO:9, including a promoter and 5-UTR (untranslated region) of 4726 nucleotides, a protein coding region from nucleotides 4727-15869 including 16 introns, and a 3UTR of 615 nucleotides. The nucleotide positions of the 16 introns are provided in the legend to SEQ ID NO:9. SEQ ID NO:9 also includes at its 3 end a downstream region of 401 nucleotides which is not considered to be part of the OcROS1 gene. The nucleotide sequence of the cDNA corresponding to wild-type OsROS1 gene is provided in SEQ ID NO:8, and the encoded polypeptide of 1952 amino acids is provided as SEQ ID NO:2.
(243) Rice has four ROS1 genes which encode polypeptides designated OsROS1a, OsROS1b (LOC_Os02 g29230), OsROS1c (LOC_Os05 g3735) and OsROS1d (LOC_Os05 g37410). Rice also has two other Demeter homologs which are thought to encode DNA glycosylases, namely Demeter-like-2 (DML2) and Demeter-like-3 (DML3).
Description of the Structural Features in the Wild-Type Rice TA2 Polypeptide
(244) After finding that the rice TA2 gene was the same as OsROS1, the OsTA2 (OsROS1) polypeptide amino acid sequence was examined. Several typical DNA glycosylase structural features were identified. The glycosylase domain of ROS1 proteins has at least three identified motifs which are sufficiently conserved to be recognisable: the helix-hairpin-helix (HhH) motif (represented by, for example, amino acids 1491-1515 in OsTA2), a glycine/proline-rich motif followed by a conserved aspartic acid (GPD), and four conserved cysteine residues (for example in the region of amino acids 1582-1598) to hold a [4Fe-4S] cluster in place. There was also a lysine-rich domain (represented by, for example, amino acids 87-139 in OsTA2). Unlike other members of the HhH DNA glycosylase superfamily, ROS1-family members contain two additional conserved domains (domains A and B) flanking the central glycosylase domain (Mok et al., 2010). In the rice TA2 polypeptide (SEQ ID NO:2), domain A occurs at amino acids 859 to 965, the glycosylase domain occurs at amino acids 1403 to 1616, and domain B occurs at amino acids 1659 to 1933. Domain A contains a repetitive mixed-charge cluster at amino acids 882-892. It has been reported that the conserved DNA glycosylase domain of AtDME and the flanking domains A and B are necessary and sufficient for DNA glycosylase/lyase enzymatic activity, as shown by mutagenesis analysis (Mok et al., 2010).
Example 5. Analysis of Nutritional Components in Ta2 Mutant Grain
(245) To measure the composition of mutant grain, particularly for nutritionally important components, ZH11 and ta2 plants were grown at the same time and under the same conditions in the field. Whole grain flour samples were prepared from grain harvested from the plants and used for the compositional analysis. The results (means of duplicate measurements) of the proximate analyses of the flours are given in Table 2.
(246) TABLE-US-00005 TABLE 2 Compositional analysis office grain (in g/100 g of grain) Total Total Total Total Soluble Insoluble Moisture Ash Protein Fat Starch Sugars Fibre Fibre Fibre ZH 11 9.54 1.79 15.3 3.30 66.0 1.02 1.6 0.7 2.9 ta2 8.99 2.27 15.6 4.96 60.3 2.58 4.9 0.4 3.9
(247) The proximate analyses indicated an increase of about 50% in the total fat content in the ta2 mutant flour. Total nitrogen analyses showed no significant change in the protein levels between the ta2 mutant and wild-type grains. Ash assays, which measured the amount of materials left behind after combustion of dehumidified flour samples, demonstrated an increase of 26% in ta2 grain relative to wild-type. The total fibre level increased by about 200% in ta2 grain. The starch content decreased by 8.6% in ta2 grain relative to wild-type. These data demonstrated that the increase in thickness of the aleurone layer in the ta2 mutant caused an increase in the level of aleurone-rich nutrients such as lipid, minerals and fibres without changing the size of the seed. In order to understand these and other changes in greater detail, more extensive analyses were done as follows.
Minerals
(248) To measure mineral contents, ICP-AES was used which combines inductively coupled plasma (ICP) with atomic emission spectrometry (AES) techniques. This is a standard method for measuring mineral content, providing a sensitive and high throughput quantitation of a large number of elements in a single analysis. The data obtained from the analysis showed that the mutant grain had levels of zinc and iron which were increased by about 15% on a weight basis relative to the wild-type grain. Zinc levels increased from 13.9 mg/kg to 16.0 mg/kg, while iron increased from 12.4 mg/kg to 14.2 mg/kg.
(249) Increases in potassium, magnesium, phosphorus and sulphur were also observed, being increased by about 28%, 23%, 22% and 9%, respectively. These results were consistent with the increase in ash content in ta2 grain, which measures mostly minerals.
Antioxidants
(250) Antioxidants are biomolecules capable of counteracting the negative effects of oxidation in animal tissues, thus protecting against oxidative stress-related diseases such as inflammation, cardiovascular disease, cancer and aging-related disorders (Huang, 2005).
(251) The antioxidant capacity in flours obtained from the to mutant and wild-type rice grain was measured by an oxygen radical absorbance capacity (ORAC) assay as described in Example 1. In the ORAC assay, the antioxidant capacity is represented by the competition kinetics between endogenous radical scavenging biomolecules and the oxidisable molecular fluorescent probe fluorescein, against the synthetic free radicals generated by AAPH (2,2-azobis(2-amidino-propane) dihydrochloride). The capacity was calculated by comparison of the area under the kinetic curve (AUC), representing the fluorescence degradation kinetics of the molecular probe fluorescein for the grains with the AUC generated by Trolox standards (Prior, 2005). An alternative approach to quantifying antioxidant capacity is through the use of the Folin-Ciocalteau reagent (FCR); this represents the antioxidant capacity by measuring the reducing capacity of the total phenolic compounds in the food sample. The FCR assay is relatively simple, convenient and reproducible. However, the more time-consuming ORAC assay measures more biologically relevant activity. Since antioxidants include a wide range of polyphenols, reducing agents and nucleophiles, measurement by both FCR and ORAC can provide a better coverage and more comprehensive representation of the total antioxidant capacity. As reported by Prior (2005), the results of FCR assay and ORAC measurement are usually consistent.
(252) Both of the FCR and ORAC assays showed increased antioxidant capacity of flour from the ta2 mutant whole grain flour relative to wild-type, ZH11 whole grain flour. FCR demonstrated an increase of about 35% in total phenolic compounds in the ta2 mutant. There was also an 83% increase in hydrophilic antioxidant content in the flour from the ta2 mutant.
Phytate
(253) When grown under conditions with adequate phosphorus, about 70% of total phosphorus content in rice grain is in the form of phytate or phytic acid (myo-inostitol-1,2,3,4,5,6-hexakisphosphate). Dietary phytate may also have beneficial roles for health as a strong antioxidant (Schlemmer, 2009). Total phytate analyses showed an increase in phytate content about 19% in ta2 as compared to the wild-type, increasing from about 10.8 mg/g to about 12.7 mg/g.
B Vitamins
(254) Levels of the vitamins B3, B6 and B9 in the ta2 flour were higher than those in wild-type flour by about 19%, 63% and 58%, respectively. When the assay was repeated with four replicates, the mean increases were about 20%, 33% and 38%, respectively. Aleurone was known to be richer in vitamins B3, B6 and B9 than endosperm (Calhoun, 1960), so the increase in aleurone thickness in the to mutant grains was concluded to be responsible for the increase in vitamin B3, B6 and B9 contents.
Dietary Fibre
(255) Total dietary fibre measured as described in Example 1 as was observed to increase by about 70%. Insoluble fibre increased by about 55%.
Carbohydrates
(256) There was a 9% decrease in the starch content of the ta2 grain on a weight basis. In contrast, sucrose levels increased by 2.5-fold in the mutant grain, and monosaccharides (arabinose, xylose, galactose, glucose) were increased from 31% to 118% relative to the wild-type.
Conclusions
(257) The nutritional analyses showed that wholegrain flour produced from field-grown ta2 grain was significantly increased relative to wild-type in most of the aleurone-rich nutrients including the macro-nutrients such as lipid and fibre, micronutrients such as minerals (iron, zinc, potassium, magnesium, phosphorus, sulphur), B vitamins such as B3, B6 and B9, antioxidants, and aleurone-associated biomolecules such as phenolic compounds and phytate. There was also a substantial increase in free sucrose and monosaccharides. Concomitant with the increase in these nutrients and micronutrients was a small decrease in starch content in the ta2 mutant, as a relative percentage.
Example 6. Screening for Additional Mutant Alleles in the Ta2 Gene
(258) The mutagenised population of rice plants in the ZH11 genetic background (Example 2) were screened by TILLING assays as described in Example 1 to identify further polymorphisms in the Ta2 gene, so that they could be tested for a thickened aleurone phenotype. The method used heteroduplexing of labelled wild-type RNA and candidate mutant RNA with digestion by endonuclease Cell essentially as described by Jiang et al. (2013). The 5 region of the TA2 gene was chosen for screening first of all, but any region of the gene could have been chosen.
(259) Numerous single nucleotide polymorphisms were identified in the 5 region of the Ta2 gene by the TILLING assays. Grains from the plants having the polymorphisms were examined for thickened aleurones and other grain phenotypes as for the first ta2 mutant. Some grains exhibited thickened aleurones. Those grains that exhibited mutant phenotypes were selected and progeny plants obtained from them. The nucleotide sequence of the Ta2 gene in each was determined, confirming the presence of the mutations. The altered nucleotide(s) in the Ta2 gene in each mutant was identified. Another three thick aleurone mutants are also being sequenced. Other grains which contained polymorphisms but which did not exhibit thickened aleurones were also identified and maintained for comparison. The mutants and the other polymorphic lines, and their aleurone phenotype, that were identified are summarised in Table 3. The mutants having thickened aleurone are shown as: ++, greatly thickened aleurone; +, weakly thickened aleurone; , unaltered aleurone phenotype. It was clear that a variety of mutations and resultant phenotypes was obtained.
(260) The aleurone in wild-type ZH11 grain showed one cell layer in thickness. In contrast in the specific mutants, the aleurones in the mutant grains comprising the V441A mutation were thickened in the dorsal side, comprising about 5-6 cell layers. The aleurones in mutant S1357F grains were about 4-5 cell layers in thickness and the grains were shrunken, whereas the aleurones of mutant R482K grains were 2-3 cell layers thick and the grains were not shrunken. The aleurones in mutant S214F grains contained 2-4 cell layers and the grains were shrunken, as were the grain from mutants S156F and S1413N. In contrast, the aleurones of K501S grains had 2-3 cell layers and its grains were not shrunken. Therefore, a variety of mutants and phenotypes were readily obtained in the Ta2 gene.
(261) TABLE-US-00006 TABLE 3 Mutations identified in rice Ta2 gene. Mutation Thick Seed designation Gene region Mutation aleurone phenotype A1810 Exon S156F ++ shrunken B19 Exon S214F ++ shrunken A155 Exon S1413N ++ shrunken A1774 Exon A441V ++ normal A2918 Exon S1357F ++ shrunken D11253 Exon K501S + normal A775 Exon R482K + normal A1711 Exon To be determined ++ D11190 Exon To be determined ++ B857 Exon To be determined + D11080 Exon D3V A654 Exon T221I D113281 Exon P883S D10394 Exon P843C A3033 Exon A78V B1193 Exon E123K D11321 Exon R487K A790 Exon R530K D11029 Exon D1425N A2004 Exon S1272N A1152 Exon P1225L A2435 Exon R1390N B696 Exon synonymous D11283 Exon synonymous D11184 Exon synonymous D11253 Exon synonymous A1687 Exon synonymous B1339 Exon synonymous B1979 Exon synonymous B2089 Exon synonymous A3033 Exon A78V
(262) Of the 60 newly identified lines having polymorphisms in the TA2 gene, 19 had amino acid changes (substitutions) in the predicted polypeptide products. Of those, at least 7 exhibited thickened aleurone phenotypes. The S1413N and D1425N mutations lay within the glycosylase domain; the other identified mutations lay outside of the glycosylase domain. Apart from the initial splice-site variant mutant, all of the identified mutations were amino acid substitutions. None were deletions or stop codons, leading the inventors to conclude that null mutations in OsROS1 might be lethal. It has been reported that in Arabidopsis, maternal dme mutations resulted in aborted seeds (Choi et al., 2002 and 2004). In rice, the presence of a ros1a maternal null allele resulted in early stage endosperm developmental failure regardless of the paternal genotype (Ono et al., 2012).
(263) The recovery of ten new, independent mutant alleles in the TA2 (OsROS1) gene, each of which had a thickened aleurone layer in the grain, indicated conclusively that the mutations in this gene had caused the thick aleurone phenotype. Furthermore these new mutations were all in a different region of the gene to the first ta2 mutation indicating that the gene could be altered in various positions along the full-length gene to achieve the thick aleurone phenotype.
(264) Several of the ta2 genes from the mutants showing thick aleurones are cloned and the encoded polypeptides are expressed and tested for DNA glycosylase/lyase activity. This confirms that the polypeptides have reduced DNA glycosylase/lyase activity compared to the wild-type polypeptide.
Example 7. Complementation Analysis of the Ta2 Mutant
(265) In order to strengthen the conclusion that mutations in the Ta2 (OsROS1a) gene were responsible for the thickened aleurone and associated phenotypes, complementation experiments were performed by introducing a wild-type copy of the gene into the mutant line by transformation. To construct the transformation plasmid for the complementation experiment, a 16,882 nucleotide DNA fragment (nucleotide sequence provided as SEQ ID NO:9) including the Ta2 gene was isolated from the wild-type rice genome. This fragment contained, in order, a 4726-bp upstream sequence which was considered to contain the promoter of the gene, the entire OsTA2 protein coding region including all of the introns, a 615 nucleotide 3-UTR and a 401-bp downstream region. It was amplified from ZH11 genomic DNA using a series of oligonucleotide primers, assembled, and then digested with KpnI and SalI and ligated to the binary vector pCAMBIA1300. That vector also contained a hygromycin resistance gene as a selectable marker gene. The plasmid for transformation and a control plasmid (empty vector) were each introduced into Agrobacterium tumefaciens strain EHA105 and used to transform rice recipient cells using the method as described by Nishimura et al. (2006). A total of 32 To transgenic plants were regenerated from the transformation with the wild-type Ta2 gene. These plants were transferred to soil and grown to maturity in a growth chamber. When PCR was used to test for the presence of the hygromycin resistance gene, 20 transformant lines were identified and selected which carried the hygromycin gene. These were grown to maturity and grain (T1 seed) harvested from each plant. Each of these plants contained the T-DNA from the vector containing the wild-type Ta2 gene as demonstrated by PCR assays.
(266) Grains harvested from these plants were examined for their aleurone phenotype by staining with Evans blue. At least three of the transformed plants produced grains with normal aleurones like the wild-type, indicating positive expression of the introduced gene and therefore complementation of the ta2 mutation. This conclusively proved that the mutations in the Ta2 gene caused the mutant phenotypes.
(267) The Ta2 gene is referred to hereinafter as the ROS1a gene; these terms are interchangeable.
Example 8. In Vitro Enzyme Activity Assays of Recombinantly Expressed TA2 and Ta2 Proteins
(268) As described in Example 4 above, the Ta2 gene in rice was the same as the OsROS1a gene, which is homologous to the Arabidopsis thaliana DNA demethylase/glycosylase named as Demeter (DME; Gehring et al., 2006). DME breaks the phosphodiester linkage on the 3 side of a 5-methylcytosine residue in a hemi-methylated DNA substrate.
(269) The enzyme activity from recombinantly expressed rice Ta2 and ta2 proteins is therefore tested by measuring their activity on a hemi-methylated DNA substrate which has been labelled, to generate end-labelled DNAs that migrate on denaturing polyacrylamide gels at the predicted position for elimination products, as described by Gehring et al. (2006).
(270) In order to recombinantly express and purify the Ta2 and ta2 polypeptides, full-length ROS1a cDNAs from the wild-type and mutant ta2 plants are used as templates in a PCR reaction with oligonucleotides JH021 (5-TTAATCTAGAATGCAGAGCATTATGGACTCG-3; SEQ ID NO:42) and JH017 (5-CGGTCGACTTAGGTTTTGTTGTTCTTCAATTTGC-3; SEQ ID NO:43), which add XbaI and SalI restriction sites, respectively, to the ends of the amplified DNA fragment. The PCR products are digested with XbaI and SalI and cloned into the pMAL-c2x vector (NEB) to create c2x-ROS1a genetic constructs. The genetic constructs are transformed into E. coli Rosetta cells (Novagen). To produce the polypeptides, transformed cells are grown at 28 C. in LB supplemented with 0.2% glucose, 100 g/mL of ampicillin and 50 g/mL of chloramphenicol until an OD600 of 0.4 is reached. ROS1a-Mal fusion protein expression is induced with 10 M of IPTG at 18 C. for 1 hr. The cultures are centrifuged at 6,500 rpm for 15 min at 4 C. and the pellet is resuspended in 30 mL of 4 C. column buffer (20 mM Tris-HCl, pH 7.4, 200 mM NaCl, 1 mM EDTA). Cells are sonicated for 2 min on ice using a Branson Sonifier 250 at output power setting of 4. The lysates are centrifuged at 9,000 rpm for 25 min at 4 C. and the supernatants collected and subjected to gravity column purification. The ROS1a-Mal fusion proteins are purified through amylose resin following the manufacturer's protocol (New England Biolabs). Eluted proteins are dialyzed in the Slide-A-Lyzer dialysis cassette (10,000 MWCO; Pierce) against 50% glycerol at 4 C. overnight. Protein concentrations are determined by the Bradford method using the Protein Assay kit (Bio-Rad Laboratories) and the proteins stored at 20 C. until further use.
(271) The ROS1a-Mal fusion proteins are assayed for DNA glycosylase activity against hemi-methylated double-stranded DNA substrates as described in Example 1 (Gehring et al., 2006).
(272) As controls, no lyase activity or covalent trapping is detected when ROS1a is incubated with non-methylated DNA oligonucleotides or when hemi-methylated DNA substrate is incubated in the absence of enzyme.
Example 9. Homologues of the ROS1a Gene in Rice
(273) The plant genes that encode DNA glycosylases which mediate DNA demethylation have been characterised mainly in Arabidopsis thaliana (Chan et al., 2005; Law and Jacobsen, 2010; Zhu, 2009). They include the Demeter (DME, Choi et al., 2002; Gehring et al., 2006), ROS1 (Gong et al., 2002; Agius et al., 2006), Demeter-like 2 (DML2) and Demeter-like 3 genes (DML3, Choi et al., 2002; Ortega-Galisteo et al., 2008). The largest of these genes (and encoded polypeptides), DME, is expressed most strongly in the homodiploid central cell of the female gametophyte before fertilisation where it promotes maternal allele-specific global hypomethylation and expression of imprinted genes including in the endosperm. In contrast, ROS1, DML2 and DML3 are expressed in vegetative tissues (Gong et al., 2002; Penterman et al., 2007). Compared with ROS1, the level of expression of the DML2 and DML3 genes was low (Mathieu et al., 2007). Moreover, homozygous mutations in ros1, dml2 and dml3 yielded no obvious morphological phenotypes whereas a maternal dme mutation resulted in aborted seeds, i.e. embryo lethal, and was not transmitted to progeny (Choi et al., 2002 and 2004). Despite their low expression levels, the ROS1, DML2 and DML3 polypeptides still function as DNA glycosylases/lyases (Gong et al., 2002; Morales-Ruiz et al., 2006; Penterman et al., 2007). From this data, one would not have expected a ROS1 mutation to have caused a thickened aleurone phenotype.
(274) Phylogenetic analysis revealed that the rice genome encodes 6 putative DNA glycosylases for cytosine demethylation, including four that appear to be ROS1 orthologs (OsROS1a, OsROS1b, OsROS1c, OsROS1d) and two apparent DML3 orthologs (Zemach et al., 2010). A null mutation in OsROS1a was identified but was not transmitted from either male or female plants containing the mutation to progeny, presumably because ROS1a wild-type DNA glycosylase is indispensible in both male and female gametophytic development (Ono et al., 2012). The inventors are not aware of any published reports of partial mutations in OsROS1a.
(275) The three identified motifs in the DNA glycosylase domain, namely the helix-hairpin-helix (HhH) motif, a glycine/proline-rich motif followed by a conserved aspartic acid (GPD), and the four conserved cysteine residues (Example 4) were present in each member of the Demeter family. The glycosylase domain structure was also found in human 8-oxoguanine DNA glycosylase (hOGG1), E. coli adenine DNA glycosylase (MutY), and endonuclease III (Endo III) (Bruner et al. 2000; Guan et al. 1998; Mok et al., 2010). Unlike other members of the HhH DNA glycosylase superfamily, DME-family members contained two additional conserved domains (domain A and domain B) flanking the central glycosylase domain (Mok et al., 2010).
(276) The nucleotide sequences of the protein coding regions for the homologous genes were aligned by ClustalW (www.ebi.ac.uk/Tools/msa/clustalw2/). The extent of sequence identity of the rice ROS1a protein coding region to the corresponding region of the homologous genes in other species is shown in Table 4.
(277) The inventors concluded from these analyses that rice has multiple ROS1 gene homologs but no DME genes. In rice, as for Arabidopsis, ROS1 was clearly distinguishable from its homologs DML2 and DML3 in the same species in terms of the extent of sequence identity.
(278) TABLE-US-00007 TABLE 4 Nucleotide sequence identity to coding region of rice OsROS1a or TaROS1a-5B. Identity to Gene Accession Number OsROS1a OsROS1a LOC_Os01g11900 100% OsROS1b LOC_Os02g29230 41.7% OsROS1c LOC_Os05g37350 42.0% OsROS1d LOC_Os05g37410 41.9% OsDML3a LOC_Os02g29380 34.9% OsDML3b LOC_Os04g28860 33.2% AtDME NM001085058.1 40.6% AtROS1 NM129207.4 41.5% AtDML2 NM111836.5 39.2% AtDML3 NM119567.3 40.4%
Example 10. Expression of ROS1a Gene in Rice
(279) Experiments were carried out to analyse expression of the TA2 gene in different rice tissues, including in parts of the developing grain. In a first experiment, TA2 mRNA was detected in rice tissue sections by in situ hybridisation as described by Brewer et al. (2006). Briefly, various rice tissues were fixed in FAA fixative for 8 h at 4 C. after vacuum infiltration, dehydrated using a graded ethanol series followed by a xylene series, and embedded in Paraplast Plus (Sigma-Aldrich). Microtome sections (8 m) were mounted on Probe-On Plus microscope slides (Fisher).
(280) From the hybridisation signals, it was concluded that TA2 was expressed in the pericarp, testa and aleurone tissues and in the starchy endosperm of rice, but not in the vascular bundle.
(281) Realtime reverse transcription polymerase chain reaction (RT-PCR) was used to assay relative expression levels in different plant tissues. Surprisingly, the results indicated highest relative expression in pollen, followed by anthers, young panicles and aleurone tissue (
(282) Expression of ROS1a in the developing seed increased to 10 days post anthesis and then declined thereafter. Strong expression was observed in both the starchy endosperm and aleurone tissues. The expression pattern early in seed development was consistent with the formation of thickened aleurone, prior to cellularisation of the endosperm during seed development. The inventors concluded that reduced expression of ROS1a in the period from the day of anthesis to 7 days post anthesis (pollination) (0-7 DAP) was critical to formation of the thick alerone.
Example 11. Patterns of Gene Methylation in Rice
(283) To determine the patterns of methylation of all rice genes, collectively, in the ta2 mutant plants relative to the wild-type TA2 plants, DNA was isolated from endosperms and embryos and treated with bisulfite which reacts with unmethylated cytosines, followed by Illumina sequencing. Endosperms were isolated at 10 DAP from the developing rice grains of the ta2 and wild-type (ZH11) plants, and embryos from the wild-type plants at the same stage of grain development. For sequencing following bisulfite treatment, custom Illumina adapters were synthesized in which cytosines were replaced by 5-methylcytosines, so that the adapters would survive the bisulfite conversion. Paired end (PE) adapters were synthesized which allowed each molecule to be sequenced from both ends, thus facilitating subsequent alignment to the genomic scaffold sequence. About 0.5-1 g of genomic DNA was isolated from endosperms dissected from each of the wild-type and ta2 plants as well as from wild-type embryos. The isolated DNA preparations were sheared by sonication to fragments of 100-500 bp. The adapters were ligated to the sheared fragments following the Illumina protocol. The DNAs were then treated twice with sodium bisulfite, which converts unmethylated cytosines (C) to uridines (U), using the Qiagen EpiTect kit and amplified by 18 cycles of PCR using PfuTurboCx DNA polymerase (Stratagene), a proofreading enzyme that tolerates uridines in the template strand. This PCR amplification resulted in a library of DNA fragments with distinct adapters at each end, so that the forward Illumina sequencing primer yielded a nucleotide sequence from the original genomic DNA-derived strand (where a C corresponded to a methylated C, and a T corresponded to a non-methylated C where a C occurred in the genomic sequence), and the reverse Illumina sequencing primer produced a nucleotide sequence from the complementary strand (where a G corresponded to a methylated C on the opposite strand, and an A corresponded to a non-methylated C where a C occurred in the genomic sequence).
(284) The extent of CG and CHG methylation in the DNA obtained from the ta2 endosperms was greater than that in the DNA obtained from the control ZH11 endosperms, indicating that the mutation of TA2 (OsROS1a) reduced the demethylation process in rice endosperm, whereas the extent of CHH methylation in the ta2 endosperm was not significantly different to that in wild-type ZH11 endosperm.
Example 12. Further Analysis of Nutritional Components in Ta2 Mutant Grain
(285) Further analyses were carried out to measure the nutritional components of mutant grain compared to the corresponding wild-type grain (ZH11), grown at the same time and under the same conditions in the field. Whole grain flour samples were prepared from the grain harvested from the plants and used for compositional analysis as described in Example 5. The results of the proximate analyses of the flours for grain grown in Australia are given in Table 5. The results for grain grown in China are given in Table 6.
(286) The proximate analyses indicated an increase of about 50% in the total lipid content in the ta2 mutant flour. Total nitrogen analyses showed a significant change in the protein levels between the ta2 mutant and wild-type grains in China but not in Australia, which may have due to different nitrogen fertiliser regimes. The total fibre level increased by about 66% or 91% in ta2 grain. The starch content decreased by 9% in ta2 grain relative to wild-type. These data confirmed that the increase in thickness of the aleurone layer in the ta2 mutant caused an significant increase in the levels of aleurone-rich nutrients such as lipid, minerals and fibres without changing the size of the seed. Even though the absolute numbers differed in the two growth environments, the relative increases in ta2 grain were reasonably consistent.
(287) TABLE-US-00008 TABLE 5 Composition of ros1a mutant rice grain (Australia) compared to wild-type % Component Units ZH11 ta2 change Total Starch g/100 g 67.9 61.8 9% Fibre Total Dietary fibre g/100 g 3.45 5.73 66% Soluble Dietary g/100 g 0.54 0.56 4% Fibre Insoluble Dietary g/100 g 2.74 4.26 55% Fibre B Vitamins Niacin (Vitamin B3) mg/100 g 6.53 7.90 21% Pyridoxine mg/100 g 0.10 0.13 33% (Vitamin B6) Folate (Vitamin B9) g/100 g 19.4 25.6 32% Mineral Total Ash g/100 g 1.79 2.39 33% Iron mg/kg 12.4 14.2 14% Zinc mg/kg 13.7 16.0 17% Potassium mg/kg 3,930 4,780 22% Magnesium mg/kg 1,270 1,560 23% Sulphur mg/kg 1,240 1,350 9% Simple sugar Sucrose g/100 g 0.95 2.54 169% NNSP Total mg/100 mg 1.54 2.48 61% NNSP Arabinose mg/100 mg 0.28 0.62 61% components Xylose mg/100 mg 0.26 0.50 89% Mannose mg/100 mg 0.11 0.16 59% Galactose mg/100 mg 0.10 0.20 53% Glucose mg/100 mg 0.77 1.01 47% Protein g/100 g 15.18 15.26 1% Phytate mg/g 10.79 12.69 18% Phenolics Total Phenolics g/g 3,180 4,570 43% Free Phenolics g/g 529 665 26% Conjugated g/g 348 692 99% Phenolics Bound Phenolics g/g 2,250 2,950 31% Antioxidants ORAC mol/g 12.3 22.6 84% Moisture 9.5 8.9 6% Lipid Total lipid g/100 g 3.29 4.95 50% Lipid Fatty acid 18:0 5.1% 4.5% 13% composition Fatty acid 18:1n9t 3.3% 2.6% 22% Fatty acid 18:1n9c 32.7% 43.2% 32% Fatty acid 18:1n7 1.7% 1.4% 19% Fatty acid 18:2n6 36.0% 27.9% 22%
(288) TABLE-US-00009 TABLE 6 Composition of ros1a mutant rice grain (China) compared to wild-type Specific Component component ZH11 ta2 % change Protein total protein 12.38 14.12 14.05 Amino acids Asparagine 1.16 1.53 31.90 Threonine 0.45 0.54 20.00 Serine 0.64 0.73 14.06 Glutamine 2.29 2.40 4.80 Glycine 0.59 0.76 28.81 Alanine 0.71 0.84 18.31 Cysteine 0.26 0.30 15.38 Valine 0.72 0.79 9.72 Methionine 0.22 0.22 0.00 Isoleucine 0.50 0.53 6.00 Leucine 1.02 1.05 2.94 Tyrosine 0.59 0.58 1.69 Phenylalanine 0.66 0.69 4.55 Histidine 0.43 0.54 25.58 Lysine 0.43 0.60 39.53 Arginine 1.14 1.39 21.93 Proline 0.52 0.59 13.46 Starch amylose 9.80 5.14 47.55 Minerals Selenium (Se) 0.03 0.03 8.78 Calcium 167.89 231.39 37.82 Fe 15.24 17.76 16.54 Zn 28.68 41.37 44.25 Antioxidants total 0.06 0.08 33.33 flavonoids Fibre Total dietary 3.26 6.23 91.10 fibre Vitamins Vitamin A 1.53 5.52 260.78 Vitamin E 0.47 1.00 112.77 Vitamin B1 0.50 0.57 12.97 Vitamin B2 0.04 0.08 116.67
(289) It will be appreciated by persons skilled in the art that numerous variations and/or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive.
(290) This application claims priority from AU 2015904754 filed 18 Nov. 2015, the entire contents of which are incorporated herein by reference.
(291) All publications discussed and/or referenced herein are incorporated herein in their entirety.
(292) Any discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is solely for the purpose of providing a context for the present invention. It is not to be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in the field relevant to the present invention as it existed before the priority date of each claim of this application.
REFERENCES
(293) Agius et al. (2006) Proc. Natl. Acad. Sci. U.S.A. 103:11796-11801. Almeida and Allshire (2005) TRENDS Cell Biol 15: 251-258. Barker et al. (1983) Plant Mol. Biol. 2: 235-350. Baumlein et al. (1991) Mol. Gen. Genet. 225:459-467. Becraft et al. (2001a) In Bhojwani and Soh (eds). Current Trends in the Embryology of Angiosperms, Kluwer Academic Publishers, pp 353-374. Becraft et al. (2001b) Plant Physiol. 127:4039-4048. Becraft et al. (2002) Development 129:5217-5225. Becraft and Yi (2011) J. Exp. Botany 62:1669-1675. Bevan et al. (1983) Nucl. Acid Res. 11: 369-385. Bourque (1995) Plant Sci. 105: 125-149. Brewer et al. (2006) Nature Protocols. 1:1462-1467. Broun et al. (1998) Plant J. 13:201-210. Bruner et al. (2000) Nature 403:859-866. Buri et al. (2004) Cereal Foods World 49:274-282. Buttrose et al. (1963) Aust. J. Biol. Sci. 16:768-774. Calhoun (1960) Cereal Chemistry. 37:755. Capecchi (1980) Cell 22:479-488. Chan et al. (2005) Nature Rev. Genet. 6:351-360. Choi et al. (2002) Cell 110:33-42. Choi et al. (2004) Proc. Natl. Acad. Sci. U.S.A. 101:7481-7486. Clapp (1993) Clin. Perinatol. 20:155-168. Curiel et al. (1992) Hum. Gen. Ther. 3:147-154. Comai et al. (2004) Plant J 37: 778-786. Doyon et al. (2011) Nat. Methods 8:74-79. Eglitis et al. (1988) Biotechniques 6:608-614. Fahim (2012) Plant Biotechnology Journal. 10:150-163. Garfinkel et al. (1983) Cell 27: 143-153. Gehring (2006) Cell 124:495-506. Gong et al. (2002) Cell 111:803-814. Graham et al. (1973) Virology 54:536-539. Greve (1983) J. Mol. Appl. Genet. 1: 499-511. Guan et al. (1998) Nature Structural Biology 5:1058-1064. Guddeti (2005) Cell Research. 15:631-638. Guo et al. (2010) J. Mol. Biol. 400:96-107. Harland and Oberleadls (1990) Newer methods for the analysis of phytate and its hydrolysis products. In: Spiller G A, ed. CRC handbook of dietary fiber in human nutrition. 2nd ed. Boca Raton, Florida: CRC Press; pages 101-104. Henikoff et al. (2004) Plant Physiol 135: 630-636. Hinchee et al. (1988) Biotech. 6:915. Hoshikawa (1993) in Matsuo and Hoshikawa (eds), Science of the Rice Plant: Morphology. Nobunkyo, Tokyo, pp 339-376. Huang (2002a) Journal of Agricultural and Food Chemistry. 50:1815-1821. Huang (2002b) Journal of Agricultural and Food Chemistry. 50:4437-4444. Huang (2005) Journal of Agricultural and Food Chemistry. 53:1841-1856. Jiang et al (2013) Molecular Cell. 14:787-799. Jones (1969) Planta 85:359-375. Jones-Rhoades and Bartel (2004) Mol. Cell 14:787-799. Joshi (1987) Nucl. Acids Res. 15:6643-6653. Kapazoglou et al. (2012) BMC Plant Biology 13:172. Kawakatsu et al. (2009) The Plant J. 59:908-920. Kawashima (2009) The Plant Journal. 57:313-321. Kessler et al. (2002) Development 129:1859-1869. Kim et al. (1996) Proc. Natl. Acad. Sci. USA 93:1156-1160. Lahey et al. (1999) Food Chemistry 65:129-133. Langridge et al. (2001) Aust. J. Agric. Res. 52: 1043-1077. Law and Jacobsen (2010) Nature Rev. Genet. 11:204-220. Lemieux (2000) Current Genomics 1: 301-311. Lewis et al. (2009) Plant and Cell Physiol. 50:554-571. Li et al. (2008) J. Agric. Food Chem. 56:9732-9739. Lid et al. (2004) Planta 218:370-378. Lu et al. (1993) J. Exp. Med. 178:2089-2096. Mann et al. (2001) J. AOAC Int. 84:1593. Mathieu et al. (2007) Cell 130:851-862. McCleary et al. (1997) J AOAC Int. 80:571-580. Medberry et al. (1992) Plant Cell 4: 185-192. Medberry et al. (1993) Plant J. 3: 619-626. Miller et al. (2007) Nat. Biotechnol. 25:778-785. Millar and Waterhouse (2005) Funct Integr Genomics 5:129-135. Mok et al. (2010) Proc. Natl. Acad. Sci. U.S.A. 107:19225-19230. Morales-Ruiz et al. (2006) Proc. Natl. Acad. Sci. U.S.A. 103:6853-6858. Murashige and Skoog (1962) Physiologia Plantarum 15:473-497. Needleman and Wunsch (1970) J. Mol Biol. 45:443-453. Niedz et al. (1995) Plant Cell Reports 14: 403-406. Nishimura et al. (2006) Nature Protocols. 1:2796-2802. Ono et al. (2012) Plant J. 71:564-574. Ortega-Galisteo et al. (2008) Plant Mol. Biol. 67:671-681. Ossowski (2008) The Plant Journal. 53:674-690. Ow et al. (1986) Science 234:856-859. Pasquinelli et al. (2005) Curr Opin Genet Develop 15: 200-205. Penterman et al. (2007) Proc. Natl. Acad. Sci. U.S.A. 104:6752-6757. Potenza et al. (2004) In Vitro Cell Dev. Biol. Plant 40:1-22. Prasher et al. (1985) Biochem. Biophys. Res. Comm. 126: 1259-68. Prior (2005) Journal of Agricultural and Food Chemistry. 53:4290-4302. Prosky et al. (1985) AOAC Official method 991. Salomon et al. (1984) EMBO J. 3: 141-146. Schlemmer (2009) Molecular Nutrition and Food Research. 55 (Supplement 2):S330-S375. Senior (1998) Biotech. Genet. Engin. Revs. 15: 79-119. Shen et al. (2003) Proc. Natl. Acad. Sci. USA 100:6552-6557. Slade and Knauf (2005) Transgenic Res. 14: 109-115. Smith et al. (2000) Nature 407: 319-320. Sreenivasulu (2010) The Plant Journal. 64:589-603. Stalker et al. (1988) Science 242:419-423. Szczepek et al. (2007) Nat. Biotechnol. 25:786-793. Taylor (1997) The Plant Cell 9:1245-1249. Theander et al. (1995) J AOAC Int. 78:1030-1044. Thillet et al. (1988) J. Biol. Chem. 263:12500. Wagner et al. (1992) Proc. Natl. Acad. Sci. USA 89:6099-6103. Walbot (1994) p78-80 in Freeling and Walbot (eds), The Maize Handbook, Springer Verlag, New York. Waterhouse et al. (1998) Proc. Natl. Acad. Sci. USA 95: 13959-13964. Wolbang (2010) J. Agric Food Chem. 58, 1732-1740. Zarcinas (1983a) CSIRO Division of Soils Technical Paper. 1-36. Zarcinas (1983b) Communications in Soil Science and Plant Analysis. 18:131-146. Zemach et al. (2010) Proc. Natl. Acad. Sci. U.S.A. 107:18729-18734. Zhu (2009) Annual Review of Genetics 43:143-166. Zhu et al. (2007) Current Biology 17:54-59.