Novel therapeutic agent for inflammatory disease
20250000876 ยท 2025-01-02
Inventors
- Dongwoo KHANG (Seoul, KR)
- Jun-Young PARK (Incheon, KR)
- Youn Joo KANG (Seoul, KR)
- Sang-Hyun Kim (Daegu, KR)
- Song KWON (Incheon, KR)
Cpc classification
B82Y5/00
PERFORMING OPERATIONS; TRANSPORTING
A61P29/00
HUMAN NECESSITIES
A61K47/6933
HUMAN NECESSITIES
International classification
A61K31/573
HUMAN NECESSITIES
A61P29/00
HUMAN NECESSITIES
Abstract
The present invention provides a novel therapeutic agent for treating inflammatory diseases which reduces the pro-inflammatory response and increases M2 macrophages according to the repolarization of macrophages, thereby exhibiting fewer side effects and excellent anti-inflammatory effects even at low doses compared to conventional steroid anti-inflammatory agent.
Claims
1. A method of treating inflammatory disease in a subject comprising administrating therapeutically effective amount of a gold nanoparticle-steroid complex in which a steroid anti-inflammatory agent is loaded on the surface of gold nanoparticle (AuNPs) coated with PEG having a number average molecular weight of 3,000 Da to 5,000 Da by covalent or non-covalent bond to the subject.
2. The method of claim 1, wherein the steroid anti-inflammatory agent is covalently bound to the gold nanoparticles coated with PEG by a thiol functionalized compound.
3. The method of claim 1, wherein the thiol-functionalized compound is cystamine, thiol-PEG, glutathione, cysteine or mercaptopropionic acid.
4. The method of claim 1, wherein the steroid anti-inflammatory agent is triamcinolone, hydrocortisone, prednisolone, betamethasone, or dexamethasone.
5. The method of claim 1, wherein the inflammatory disease is arthritis, psoriasis, or atopic dermatitis.
6. The method of claim 5, wherein the arthritis is osteoarthritis or rheumatoid arthritis.
7. The method of claim 1, wherein the loading ratio of the steroid anti-inflammatory agent to the PEG-coated gold nanoparticles is 6:4 to 7:3.
8. The method of claim 1, wherein the PEG-coated gold nanoparticles have a size of 20 to 100 nm.
9. The method of claim 1, wherein the gold nanoparticle-steroid complex has a hydrodynamic size of 25 to 150 nm.
10. The method of claim 1, wherein the gold nanoparticle-steroid complex reduces the expression of pro-inflammatory cytokines and increases the expression of anti-inflammatory cytokines.
11. The method of claim 10, wherein the pro-inflammatory cytokine is TNF-, IL-1, IL-6, INF-, MMP-1 or MMP-3 and the anti-inflammatory cytokine is IL-4, IL-10 or Arg-1.
12. The method of claim 1, wherein the gold nanoparticle-steroid complex induces repolarization from M1 macrophages to M2 macrophages.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
BETS MODES
Definition of Terms
[0065] As used herein, the term crosstalk refers to the case in which one or more components in one signal transduction pathway affect another. Biological interactions can be achieved in a number of ways, with interactions between signaling cascade proteins being the most common. In these signal transduction pathways, there are often shared components that can interact with either pathway. More complex interactions can be observed with crossmembrane crosstalk between the extracellular matrix (ECM) and the cytoskeleton.
[0066] As used herein, the term triamcinolone is a white crystalline powder-like adrenocortical steroid, used as an anti-inflammatory agent.
[0067] As used herein, the term dexamethasone is a synthetic adrenocortical hormone with anti-inflammatory action, and prepared as tablets, injections, ophthalmic preparations, oral ointments, nasal sprays, creams, etc.
[0068] As used herein, the term matrix metalloproteinases (MMP) is a proteolytic enzyme that degrades the matrix components of bone and cartilage and plays a major role in pathological conditions such as atherosclerosis, tumor invasion and arthritis. Among them, MMP-1 and MMP-3 are expressed in regions where rheumatoid arthritis (RA)-related bone erosion occurs, and are known as predictors of joint destruction in early RA patients.
[0069] As used herein, the term PEGylation refers to a process of covalently and non-covalently attaching polyethylene glycol, a non-toxic additive, to increase half-life of drugs.
DETAILED DESCRIPTION OF THE INVENTION
[0070] According to one aspect of the present invention, there is provided is a pharmaceutical composition for treating inflammatory disease comprising a gold nanoparticle-steroid complex in which a steroid anti-inflammatory agent is loaded on the surface of gold nanoparticle (AuNPs) coated with PEG by covalent or non-covalent bond as an active ingredient.
[0071] In the pharmaceutical composition, the gold nanoparticles may be gold nanoparticles whose surface is thiolated by a thiol-functionalized compound, and the thiol-functionalized compound may be cystamine, thiol-PEG, glutathione, cysteine, or mercaptopropionate.
[0072] In the pharmaceutical composition, the steroid anti-inflammatory agent may be triamcinolone, hydrocortisone, prednisolone, betamethasone, or dexamethasone.
[0073] In the pharmaceutical composition, the inflammatory disease may be arthritis, psoriasis or atopic dermatitis, and the arthritis may be osteoarthritis or rheumatoid arthritis.
[0074] In the pharmaceutical composition, the PEG may have a number average molecular weight of 3000 Da to 5000 Da.
[0075] In the pharmaceutical composition, the loading ratio of the steroid anti-inflammatory agent to the gold nanoparticles coated with PEG may be 6 to 4 to 7 to 3, and the size of the gold nanoparticles coated with PEG may be 20 to 100 nm. And the steroid-based anti-inflammatory agent may be covalently bonded to the thiol-functionalized gold nanoparticles.
[0076] Pharmaceutical composition may reduce the expression of pro-inflammatory cytokines and increase the expression of anti-inflammatory cytokines, and the pro-inflammatory cytokines are TNF-, IL-1, IL-6, INF-, MMP-1 or MMP-3 and the anti-inflammatory cytokine may be IL-4, IL-10 or Arg-1 and the anti-inflammatory cytokine may induce repolarization from M1 macrophages to M2 macrophages.
[0077] According to another aspect of the present invention, there is provided is a method of treating inflammatory disease in a subject comprising administrating therapeutically effective amount of a gold nanoparticle-steroid complex in which a steroid anti-inflammatory agent is loaded on the surface of gold nanoparticle (AuNPs) coated with PEG by covalent or non-covalent bond to the subject.
[0078] According to another aspect of the present invention, there is provided is use of a gold nanoparticle-steroid complex in which a steroid anti-inflammatory agent is loaded on the surface of gold nanoparticle (AuNPs) coated with PEG by covalent or non-covalent bond in the manufacture of a therapeutic agent for treating inflammatory disease.
[0079] In the method, the pharmaceutical composition may be administered through oral or parenteral administration, and oral administration is more preferable, but is not limited thereto. When administered parenterally, it is possible to administer it through various routes, such as intravenous injection, intranasal inhalation, intramuscular administration, intraperitoneal administration, and transdermal absorption.
[0080] The preferred dosage of the pharmaceutical composition of the present invention varies depending on the condition and body weight, the severity of the disease, the drug form, the route and duration of administration, but may be appropriately selected by those skilled in the art. Preferably, it is administered at 0.01 to 1000 mg/kg per day for adults (60 kg body weight), and to be more effective, it is preferably administered at 1 to 100 mg/kg. The dosage and frequency of administration may be administered once a day, or may be administered in several divided doses. The dosage and frequency of administration do not limit the scope of the present invention in any way.
[0081] The pharmaceutical composition according to an embodiment of the present invention may include a pharmaceutically acceptable carrier, and may additionally include a pharmaceutically acceptable adjuvant, excipient or diluent in addition to the carrier.
[0082] As used herein, the term pharmaceutically acceptable refers to components which are physiologically acceptable and does not normally cause gastrointestinal disorders, allergic reactions such as dizziness or similar reactions when administered to humans. Examples of such carriers, excipients and diluents include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. In addition, fillers, anti-agglomeration agents, lubricants, wetting agents, fragrances, emulsifiers and preservatives may be further included. In addition, the pharmaceutical composition according to an embodiment of the present invention may be formulated using a method known in the art to enable rapid, sustained or delayed release of the active ingredient when administered to a mammal. Formulations include powders, granules, tablets, emulsions, syrups, aerosols, soft or hard gelatin capsules, sterile injectable solutions, and sterile powder forms.
[0083] Recently, studies on gold nanoparticles (AuNPs)-based drug delivery have been conducted to improve the treatment of inflammatory diseases such as arthritis, and modulation of the immune response using nanomaterials is a promising strategy for the treatment of arthritis diseases (H. Hillaireau, et al., Cell Mol. Life Sci., 66 (17): 2873-96. 2009). The biomedical applications of AuNPs are rapidly expanding due to their diverse properties, including relatively low toxicity, high capacity for cell targeting, easily functionalized surfaces, sustained drug release, and the tunable light absorption and heat treatment capabilities of these nanoparticles (NPs). Although most nanomaterials are recognized as unsuitable for clinical application due to side effects and clearance problems during intravenous injection, AuNPs are still considered promising biomaterials in rheumatological applications (Wang et al., Biomater. Sci., 5 (8): 1407-1420. 2017).
[0084] In addition, understanding the crosstalk between synoviocytes and macrophages is very important for developing strategies for regulating the inflammatory response in inflamed synovium. Simultaneous modulation of pro- and anti-inflammatory responses of synovial cells and macrophages (repolarization) is important in the treatment of arthritis.
[0085] In the present invention, pegylated AuNPs with a size of 20 nm were conjugated with clinical grade Triamcinolone (hereinafter, referred to as Triam). The AuNPs conjugated with triamcinolone (hereinafter, referred to as Triam-AuNPs) effectively inhibited inflammation mediated by patient-derived primary RA FLSs and patient-derived OA FLSs with the same aspect. In addition, Triam-AuNPs simultaneously increased the anti-inflammatory response of FLSs and macrophages repolarized from M1 (pro-inflammatory) to M2 (anti-inflammatory) phenotype. In an in vivo experiment, macrophages were repolarized from M1 to M2 phenotype or only the pro-inflammatory response of FLS and M1 macrophages was inhibited without activation of the anti-inflammatory response of FLSs. Modulation of dynamic immunomodulation (both down-regulation of pro-inflammatory responses and up-regulation of anti-inflammatory responses) with Triam-AuNPs may provide ideal conditions for the treatment of arthritis models. In addition, the present inventors demonstrated that AuNPs themselves can catalyze the degradation of H.sub.2O.sub.2, an essential element for ROS production, but despite the strong H.sub.2O.sub.2 degradation ability of AuNPs, the effect of AuNPs on intracellular ROS levels was not significant. In contrast, Triam-AuNPs not only reduced ROS and inflammatory levels of TNF--stimulated FLS, but also exhibited the ability to clear ROS from activated macrophages.
[0086] In addition, in experiments on a collagen-induced arthritis (CIA) mouse model, compared with Triam alone treatment, Triam-AuNPs showed significant pro-inflammatory markers (IL-6, IL-1, INF-, and TNF-) in cartilage tissue and increased the number of M2 macrophages in the cartilage tissue by effectively repolarizing the macrophage activity in the inflammatory synovial membrane, thereby greatly promoting cartilage regeneration (indicated by Safranin-O staining). The above results clearly suggest that the Triam-AuNPs of the present invention have immune crosstalk between FLSs and macrophages in inflammatory joints.
[0087] In the present invention, it was found that the interaction between synovial cells and macrophages is significantly involved in the activation and inactivation of the inflammatory response in the synovial membrane. In addition, according to the increase in the secretion of anti-inflammatory cytokines by FLSs and macrophages induced by the treatment of Triam-AuNPs, the nanodrugs of the present invention (Triam-AuNPs) more strongly modulate the immune response than conventional glucocorticoid (GC) drugs. Therefore, the nanodrug of the present invention, Triam-AuNPs, can be used as a next-generation novel drug candidate for the treatment of RA and OA.
[0088] Hereinafter, the present invention will be described in more detail through examples. However, the present invention is not limited to the embodiments disclosed below, but it is provided to fully inform the methods be implemented in a variety of different forms.
General Methods
Synthesis of AuNPs
[0089] Citrate-stabilized AuNPs (20 nm) of the present invention were synthesized according to the traditional Turkevich-Frens method. Specifically, after adding a 2.2 mM sodium citrate solution to distilled water (DW), it was heated with a heating mantle under vigorous stirring for 15 minutes. When the temperature of the solution reached 100 C., a gold (III) chloride trihydrate (HAuCl.sub.4) solution (25 mM, Sigma, St. Louis, MO, USA; Cat: 5209258) was added to obtain a gold seed solution. After synthesizing the gold seed, the temperature of the solution was lowered to 90 C., HAuCl.sub.4 solution (25 mM) was added, and the reaction solution was vigorously stirred for 30 minutes. Thereafter HAuCl.sub.4 solution (25 mM) was added and the process of stirring for 30 minutes was repeated twice to obtain 20 nm AuNPs coated with citrate ions, which are negatively charged.
Conjugation of Triam and AuNPs
[0090] Conjugation of Triam-AuNPs was prepared by first coating citrate-stabilized AuNPs with -mercapto--carboxy PEG solution (10 M, MW=5 kDa, Sigma; Cat No.: 712523) under moderate agitation overnight. At the same time, Triam solution was prepared by mixing Triamcinolone acetonide (10 mg/mL) and carbonyldiimidazole (10 mg) in 1 mL of dimethylformamide (DMF) for 2 hours, then adding 1 mL of cysteamine (20 M) and reacting overnight. The PEGylated AuNP solution was then centrifuged (4,000 rpm, room temperature, 15 min, Fleta 5, Hanil, Korea) using a filter tube (Ultracell-30K, 30 kDa, Millipore, Billerica, MA, USA; Cat: UFC903024) and washed three times with DW. Then, the pegylated AuNP solution was resuspended in 4 mL of DW and added to the Triam solution for conjugation at 4 C. for 24 hours. Finally, the Triam-AuNPs solution was collected after washing with DW by centrifugation at 4,000 rpm for 15 minutes at 4 C., and the Triam-AuNPs were resuspended in 1 mL of DW and stored at 4 C. for use.
Conjugation of Dexamethasone with AuNPs
[0091] Conjugation of Dex-AuNPs was performed by first coating AuNPs stabilized with cetrimonium bromide with -mercapto--carboxy PEG solution (10 M, MW=5 kDa, Sigma; Cat No.: 712523) under moderate stirring overnight (
Analyses of Physicochemical Properties
[0092] The concentration of Triam covalently bound to AuNPs and the concentration of AuNPs were analyzed through absorbance measurement using a UV-vis spectrophotometer (Libra S50, Biochrom, Cambridge, UK). Specifically, the concentration of AuNPs was quantified by measuring the peak absorbance at 520 nm, and the concentration of Triam on AuNPs was determined by subtracting this value from the initial and final absorbances of the conjugated AuNPs and measuring the absorbance at 242 nm. The concentration of each solution was inferred based on a linear standard curve for AuNPs. The size distribution and potential of the Triam-AuNPs complex were analyzed using a Zetasizer Nano (Malvern, UK; Cat: ZS90), and for FTIR (Nicolet iS5, Thermo, MA, Waltham, USA) analysis, samples were completely lyophilized (below 50 C.) for 24 h using a freeze dryer (Alpha 1-2 LD plus, Martin christ, Germany). In addition, FTIR with attenuated total reflectance (ATR) was used to confirm the attachment of Triam molecules to AuNPs, and each spectrum was obtained using 32 scans with a resolution of 4/cm. In addition, the visual crystallinity and surface morphology of AuNPs and Triam-AuNP complexes were analyzed using TEM (F30, Tecnai, State missing, USA).
H.sub.2O.sub.2 Decomposition and O.sub.2 Production Analysis
[0093] H.sub.2O.sub.2 (2.5 mM), AuNPs (10 g/mL), Triam (5 g/mL) and Triam-AuNPs were mixed in PBS at room temperature. Then, 50 l of the solution was added to a solution of 100 L of Ti (SO.sub.4).sub.2 containing 1.33 mL of 24% Ti(SO.sub.4).sub.2 and 8.33 mL of H.sub.2SO.sub.4 in 50 mL of deionized water after 24 hours. After the reaction was completed, the absorbance of the solution was measured at 405 nm to evaluate the H.sub.2O.sub.2 concentration. In addition, in order to observe O.sub.2 bubbles in the Eppendorf tube, AuNPs, Triam, and Triam-AuNPs at the same concentration were mixed in 5 M H.sub.2O.sub.2 for 2 hours and monitored.
Cell Culture and Cell Viability
[0094] FLSs were isolated by enzymatic dispersion of synovial tissues of arthritis patients (E. J. Nam et al., Arthritis Rheum., 65 (7): 1753-1763. 2013). Specifically, synovial tissue samples were obtained from RA and OA patients during joint surgery. The age of the arthritis patient was between 32 and 59 years old, and the obtained tissues were monolayer cultured. Informed consent was obtained from all patients, and the Ethics Committee of Eulji University approved the study of the present invention. FLSs were cultured in DMEM supplemented with non-heat-inactivated 10% FBS and 1% antibiotics under conditions of 5% CO.sub.2 and 37 C., and FLSs were used for experiments at passages 3-7.
Preparation of Triam-AuNPs Labeled with Alexa Fluor 488
[0095] Triam-AuNPs labeled with Alexa Fluor 488 were prepared by mixing Triamcinolone and Alexa Fluor 488 (S11223, Molecular Probes, OR, USA, USA) with a pegylated AuNP solution in DW. The mixture was incubated overnight without light and the conjugation reaction was stopped by centrifugation to remove free Triamcinolone and Alexa Fluor 488. Triam-AuNPs labeled with Alexa Fluor 488 were washed three times with DW, and fluorescence was confirmed using a Victor 1420 Multilabel Counter (PerkinElmer, Waltham, MA, USA) at an excitation wavelength of 485 nm and an emission wavelength of 535 nm.
Uptake Analysis of Triam-AuNPs in FLSs and J774 Cells
[0096] FLSs and J774 cells were seeded on poly-d-lysine-coated coverslips (510 4 cells) and incubated overnight. The cells were incubated various inhibitors at various concentrations (50 UM EIPA, 20 M CPZ or 200 UM of GEN, Sigma) for 30 min at 37 C. to inactivate micropinocytosis, caveolae-mediated and clathrin-mediated pathway. Then, 0.5 g/mL streptavidin- and Alexa 488-conjugated Triam-AuNPs (Alexa 488-Triam-AuNPs) were added to the cells and incubated at 37 C. for 6 hours. All samples were then fixed overnight in 4% paraformaldehyde in medium at 4 C. and signals from the various treatment groups were obtained using an LSM700 confocal microscope (Carl Zeiss) with the same settings.
ROS Detection In Vitro
[0097] For in vitro ROS detection, cells were pretreated with experimental drugs (ie, PBS, AuNPs, Triam and Triam-AuNPs) at a concentration of 500 ng/mL for 24 h. Then, dihydroethidium bromide (DHE), a ROS probe, was added to the cells at a concentration of 400 nM, and incubated at 37 C. for 10 minutes. In the presence of ROS, the DHE is rapidly oxidized to form a bright product. ROS signals in the various treatment groups were obtained with the same settings using an LSM700 confocal microscope (Carl Zeiss). Red fluorescence intensity was quantified using ImageJ software.
Real-Time PCR
[0098] To measure cytokine expression, RT-PCR (CFX 384, Bio-Rad, Hercules, CA, USA) was performed according to the manufacturer's protocol. Specifically, FLSs were pretreated with Triam and Triam-AuNPs for 1 hour and then stimulated with TNF- (20 ng/ml) for 12 hours. Then, total RNA was isolated from cells (510.sup.5 cells/well in a total of 6-well plates) using TRIzol (15596018, Thermo Fisher Scientific) and first strand complementary DNA (cDNA) using RT premix (Promega) was synthesized. Reverse transcription conditions were carried out at 45 C. for 60 minutes and at 95 C. for 5 minutes. Briefly, in each final reaction tube, 2 L of cDNA (1 g), 1 L of sense and antisense primer solutions (0.4 M), 12.5 L of SYBR Premix Ex Taq (Takara Bio Inc.) and 9.5 L of dH.sub.2O. The cycle threshold (Ct) value was calculated using the CFX96 Real-Time PCR Detection System (Bio-Rad) software, and the comparative Ct method (2Ct model) was used to calculate the relative fold change of gene expression. It was then normalized to mean GAPDH expression. The nucleic acid sequences of the primers used in the present invention are summarized in Tables 1 and 2 below.
TABLE-US-00001 TABLE1 Informationofnucleotidesequences ofprimers SEQ ID Primer NucleotideSequences(5.fwdarw.3) Nos: TNF-F CTCTTCTCCTTCCTGATCGTG 1 TNF-R CCAGAGGGCTGATTAGAGAGA 2 IL-1F GCTCGCCAGTGAAATGATG 3 IL-1R CAGAGGGCAGAGGTCCAG 4 IL-6F CCTCCAGAACAGATTTGAGAGTA 5 IL-6R TCAGGGGTGGTTATTGCATCTA 6 IL-4F ATGGGTCTCACCTCCCAAC 7 IL-4R ATATCGCACTTGTGTCCGTG 8 IL-10F TGCCTTTAATAAGCTCCAAGAG 9 IL-10R TCTTCATTGTCATGTAGGCTTC 10 Arg-1F AGGAATTGGCAAGGTGATGG 11 Arg-1R GTGAAAGATGGGTCCAGTCC 12 iNOSF TCTACCAGGAGGAGATGCTG 13 iNOSR CCTGAACATAGACCTTGGGC 14 MMP-1F GAGTTCCTGACGTTGGTCAC 15 MMP-1R ACAGCATCTTTTGGCAAATC 16 MMP-3F TCCCAAGCAAATAGCTGAAG 17 MMP-3R CATTTGGGTCAAACTCCAAC 18 GAPDHF GTATGACAACGAATTTGGCTACAG 19 GAPDHR TCTCTCTCTTCCTCTTGTGCTCTT 20
TABLE-US-00002 TABLE2 Informationofnucleotidesequences ofprimers SEQ ID Primer NucleotideSequences(5.fwdarw.3) Nos: TNF-F TGTCTACTGAACTTCGGGGT 21 TNF-R GAGGGTCTGGGCCATAGAA 22 IL-1F CTGTTCTTTGAAGTTGACGGAC 23 IL-1R GCGAGATTTGAAGCTGGATG 24 IL-6F CTTCACAAGTCGGAGGCTTAAT 25 IL-6R AGTGCATCATCGTTGTTCATAC 26 IL-4F ATCATCGGCATTTTGAACGAGGTC 27 IL-4R ACCTTGGAAGCCCTACAGACGA 28 IL-10F GTCATCGATTTCTCCCCTGTG 29 IL-10R GTAGACACCTTGGTCTTGGAG 30 Arg-1F GCAGAGGTCCAGAAGAATGG 31 Arg-1R ACACATAGGTCAGGGTGGAC 32 iNOSF GGGAGCCACAGCAATATAGG 33 iNOSR TCAGCCTCATGGTAAACACG 34 GAPDHF TGCTGAGTATGTCGTGGAGT 35 GAPDHR AGATGATGACCCTTTTGGCTC 36
Collagen-Induced Arthritis (CIA) Model
[0099] DBA/1 mice (male, 4-6 weeks old, body weight 20-25 g) were purchased from Orient Bio (Seoul, Korea) and the mice were subjected to a 12-hour light/dark cycle (lit at 6:30 AM) for 7-14 days. They were placed in a specific pathogen-free environment with temperature and humidity controlled and acclimatized before the experiment. All animal experiments were performed according to the Gachon University Laboratory Animal Care and Use Guide. Arthritis was also induced by tail-based intradermal injection of 2 mg/mL CFA (Chondrex). Animals with AIA-induced arthritis were randomly assigned to 6 groups (n=6) after the first signs of inflammation were observed on day 27.
Atopic Dermatitis Model
[0100] BALB/c mice (female, 6-10 weeks old, body weight 16-22 g, n=5) were purchased from the Korea Laboratory Animal Center (Daejeon, Korea) and the mice were subjected to a 12-hour light/dark cycle for 7 days (6 am at 6:30 am). 30), and were accommodated in a specific pathogen-free environment with temperature and humidity controlled and acclimatized before the experiment. All animal experiments were performed according to the guide for the care and use of laboratory animals at Kyungpook National University. In addition, dinitrochlorobenzene (2,4-DNCB) and house dust mite extract (DFE) were alternately applied to induce atopic dermatitis. To put it simply, 30 l of dinitrochlorobenzene is applied to the back twice in the first week after hair removal of the mouse, etc. From the second week to the third week, 30 l of dinitrochlorobenzene is applied once and 30 l of house dust mite (1 mg/mL) is applied twice. After the second week, Dex-AuNPs are applied to the induced area according to the concentration. Mice are sacrificed by completing the experiment on day 21.
Psoriasis Model
[0101] BALB/c mice (female, 9-10 weeks old, weight 18-20 g, n=5) were purchased from the Korea Laboratory Animal Center (Daejeon, Korea), and the mice were subjected to a 12-hour light/dark cycle (6 am to 6 am) for 7 days and were acclimatized in a specific pathogen-free environment with temperature and humidity controlled. Aldara cream (5% imiquimod) was used to induce psoriatic dermatitis. Briefly describing the induction of psoriasis, the hair on the back of the mouse is removed using an epilator and a depilatory agent. And leave it for 2 days to get rid of the effect of the depilatory cream. And after that, Aldara cream (62.5 mg) is applied to the back of the mouse every day and 2 hours later, Dex-AuNPs are treated. Repeat this process for 7 days. The next day the mice are sacrificed.
Scoring of Arthritis and Treatment of RA Mice with Triam-AuNPs
[0102] The status of RA was assessed visually by grading paw swelling according to the following criteria: 0, no swelling; 1, inflammation and swelling in one toe; 2, more than one toe, but inflammation and swelling throughout the foot; 3, moderate swelling of the entire foot; 4, Severe erythema and swelling of the entire foot and ankle (H. E. Scales, et al., Rheumatology (Oxford) 55 (3): 564-572, 2016). A total score of four paws was recorded for each mouse as the arthritis index. After the RA model was established, mice scoring 3 points were randomly classified into the following 7 groups: saline, AuNPs, low-dose Triam (2 mg/kg), high-dose Triam (5 mg/kg), and low-dose Triam-AuNPs (2 mg/kg Triam) and high-dose Triam-AuNPs (5 mg/kg Triam) (n=5). Each treatment group was administered twice weekly for 3 weeks, 2 mg/kg or 5 mg/kg condition, and the arthritis index of each group was recorded over time. After 3 weeks of treatment, mice were sacrificed, and limbs were collected and histological analysis was performed.
Tissue-Fluorescence Analysis
[0103] Histopathology was evaluated to determine the characteristics of RA including macrophage phenotype, synovitis and cartilage destruction. Specifically, on day 48, the mice were sacrificed and the ankle joint was recovered. The knee joint was fixed in 4% paraformaldehyde at 4 C. for 3 days, transferred to a descaling solution (Sigma), and left on an orbital shaker. Then, the tissue was decalcified at room temperature for 14 days, and the non-calcified ankle joint was embedded in paraffin and then cut into 3 m using a microtome. For immunofluorescence histochemistry, tissue sections were dewaxed and TNF- (Abcam, ab1793), IL-1 (Abcam, ab9722), IL-6 (Abcam, ab7737), INF- (Novus Biotech, NBP1), CD86 (Invitrogen, 13-0862-82), and Dectin-1 (Abcam, ab140039) were stained with primary antibodies. The secondary antibodies used in the present invention are goat anti-rat Alexa Fluor 488 (Abcam) for INF-, goat anti-mouse Alexa Fluor 488 (Abcam) for TNF-, goat anti-mouse Alexa Fluor 568 for CD86 (Abcam), goat anti-rabbit Alexa Fluor 488 (Abcam) for IL-1 and IL-6 and goat anti-rabbit Alexa Fluor 568 (Abcam) for Dectin-1. The tissue sections were then stained with DAPI mounting solution and observed using a confocal fluorescence microscope (LSM700, Carl Zeiss) and EVOS M7000, Invitrogen. Fluorescence intensity was also quantified using ImageJ, Zen Lite (Zeiss) and Celleste (Invitrogen).
Ethics
[0104] Synovial cells (FLSs) used in the present invention were isolated from rheumatoid arthritis patients at Kyungpook National University and osteo-degenerative arthritis patients at Nowon Eulji Medical Center (IRB numbers: 2052-040903 and 2017-10-009-005), respectively.
Statistical Analysis
[0105] The significance of the difference between the mean values obtained in the two sample groups was analyzed using Student's t-tests. Differences were considered significant if the p-value was less than or equal to 0.05. Analysis of variance (ANOVA) followed by the Newman-Keuls 3 multiple comparison test was used to analyze the significance of differences between different sample means. Asterisks (*, ** and ***) indicate the meaning of the p values (<0.05, <0.01 and <0.001, respectively).
Example 1: Physicochemical Properties
[0106] The present inventors covalently conjugated PEGylated AuNPs with Triamcinolone through cysteamine (
TABLE-US-00003 TABLE 3 AuNP:Triam ratio NP:Triam(20 mg:10 mg) Mass of AuNP after conjugation with 16.76 triamcinolone 9) Normalized loss percentage of Au (%) 16.20 Mass of conjugated triamcinolone (g) 489 Percentage of conjugated 2.9 triamcinolone per Au (%) Final AuNP:Triam ratio 34:1
Example 2: Nanodrug Uptake Pathway of Inflammatory FLSs and M1 Macrophages
[0107] When NPs are surrounded by cells, the two main factors influencing internalization are the physicochemical properties of the NPs and the cell type (S. Behzadi et al., Chem. Soc. Rev., 46 (14): 4218-4244, 2017). Endocytosis (eg, micropinocytosis, clathrin- and caveolae-mediated endocytosis) is a major internalization pathway during NP internalization (Y. K. Lee et al., J. Mater. Chem. B, 4 (9): 1660-1671, 2016). In order to confirm the specific intracellular mechanism responsible for the uptake of Triam-AuNPs, the present inventors treated cells with inhibitors specific inhibiting three types of endocytosis, 5-(N-ethyl-N-isopropyl) amiloride (EIPA) as a micropinocytosis inhibitor, chlorpromazine (CPZ) as a clathrin-mediated endocytosis inhibitoromazine) and genistein (GEN) as a caveolae mediated endocytosis inhibitor, respectively. In addition, streptavidin-Alexa 488-conjugated Triam-AuNPs (Triam-Alexa 488-AuNPs) were used to investigate the intracellular uptake of Triam-AuNPs in FLSs and macrophages.
[0108] As a result, non-covalent Alexa 488 conjugation to Triam-AuNPs was confirmed with a fluorescence spectrophotometer, and strong absorbance was detected at 490 nm (
[0109] On the other hand, Triam-AuNP uptake was found to include all three uptake pathways in M1 macrophages, and among them, macropinocytosis and clathrin-mediated intracellular uptake pathways were confirmed to be significant (
Example 3: H.SUB.2.O.SUB.2.-Scavenging Effect of AuNPs and Intracellular Reactive Oxygen Species (ROS) Analysis
[0110] We performed H.sub.2O.sub.2-scavenging effect of AuNPs and intracellular ROS analysis before pro-inflammatory cytokine secretion assay. Specifically, after treatment with Triamcinolone and AuNPs under physiological conditions (pH 7.4), concentration of H.sub.2O.sub.2 was analyzed.
[0111] As a result, H.sub.2O.sub.2 concentration was reduced by about 48% after 24 hours of Triam treatment, but Triam-AuNPs and AuNPs (same AuNPs concentration) treatment showed that most of H.sub.2O.sub.2 was decomposed after 24 hours. These results suggest that AuNPs themselves exhibit a strong catalytic effect (
[0112] In addition, intracellular ROS generated by FLSs and J774 cells were analyzed after treatment with the drug for 24 hours. To this end, TNF- (20 ng/mL) was added to activated FLSs, and lipopolysaccharide (LPS, 50 ng/mL) was added to macrophages (J774). As a result, it was found that the Triam-AuNPs of the present invention significantly inhibited ROS activity in both FLSs and M1 macrophages (
Example 4: Low-Dose Anti-Inflammatory Effects of FLSs (RA and OA Patients)
[0113] Considering the side effects induced by repeated steroid injections, a low-dose and effective steroid anti-inflammatory agent is an advantageous approach (J. P. Raynauld et al., Arthritis Rheum., 48 (2): 370-377, 2003). Therefore, in order to investigate the effect of the developed low-dose Triam-AuNPs compared to the effect of the relatively high-dose Triamcinolone, the present inventors analyzed expression level of TNF-, IL-1, IL-6 and MMP, which are major inflammatory markers for investigating the inhibition of inflammation in FLSs.
[0114] As a result, RA patient-derived primary FLSs and OA-generated cartilage tissue-derived FLSs (
Example 5: Repolarization of FLSs by Nanodrugs
[0115] Recently, the role of macrophages in inflamed synovial membranes has been of great interest due to the inflammatory effects of these cells during pathogens of RA and OA in joints (A. Kennedy et al., Front. Immunol., 2:52, 2011). The present inventors therefore investigated the stimulation of FLS pro-inflammatory activity by activated M1 macrophage cytokines (from LPS-treated J774 cells to conditioned medium).
[0116] As a result, the levels of major pro-inflammatory cytokines (TNF-, IL-1 and IL-6) in FLSs were significantly increased by treatment with M1 medium (
Example 6: Macrophage Repolarization by Nanodrugs
[0117] Macrophages of the synovium can stimulate pro-inflammatory FLSs activity by infiltrating inflamed tissues and increasing pro-inflammatory cytokine levels (M. Asif Amin et al., Semin. Immunopathol., 39 (4): 385-393, 2017). For this reason, modulating macrophage differentiation (ie, repolarization) is important in alleviating arthritis disease (J. Kim et al., ACS Nano, 13 (3): 3206-3217, 2019). Therefore, the present inventors investigated macrophage repolarization (from M1 to M2 phenotype) in order to determine way of converting activated M1 macrophages into M2 macrophages with anti-inflammatory properties after treatment with Triam-AuNPs, and how macrophages are activated by FLSs (by the addition of activated FLSs medium to macrophage medium). M1 polarization occurred after treatment with TNF--activated FLSs medium (indicated by TNF-, IL-1 and IL-6 expression), but inflammatory marker levels were decreased significantly by Triam and Triam-AuNPs treatment (
[0118] Based on the above results, the present inventors confirmed that macrophage repolarization (from M1 to M2 phenotype) was induced only by Triam-AuNPs (
Example 7: Therapeutic Effect of Nanodrugs in CIA-Induced Mice
[0119] The present inventors established CIA-induced mice through intradermal injection of complete Freund's adjuvant (CFA) to evaluate the in vivo effect of Triam-AuNPs on RA treatment (
[0120] As a result, the paw edema and paw score of the group treated with phosphate-buffered saline (PBS) significantly increased after 48 days, whereas the group treated with low-dose (2 mg/kg) and high-dose (5 mg/kg) Triam-AuNP showed significantly decreased symptoms (
[0121] In addition, the present inventors evaluated the anti-inflammatory therapeutic effect of Triam-AuNPs according to an embodiment of the present invention by histological and immunohistochemical analysis. As a result, synovial inflammation was confirmed in the PBS-treated group in which the mouse ankle joint was stained with hematoxylin and eosin (H&E), but the Triam-AuNP combination treatment group showed significantly reduced synovial inflammation than the Triam alone treatment group (2 mg/kg and 5 mg/kg) (
[0122] In addition, as a result of observing the fluorescence intensity to evaluate the expression level of inflammatory cytokines in the ankle joint, the expression of major inflammatory cytokines (IL-6, IL-1, INF- and TNF-) in the Triam-AuNPs treatment group was found to be decreased (
Example 8: Induction of Macrophage Repolarization in the Synovial Membrane by Nanodrugs
[0123] The present inventors analyzed the proportion of M1 and M2 macrophages using immunofluorescence to investigate the repolarization of synovial macrophages in the ankle joint (J. Kim et al., ACS Nano 13 (3): 3206-3217, 2019).
[0124] As a result, treatment with Triam-AuNPs regulated macrophage repolarization from M1 to M2 phenotype (
Example 9: Chemical and Physical Properties of Dex-AuNPs
[0125] The present inventors covalently conjugated PEGylated AuNPs with Dex through cysteamine (
Example 10: Therapeutic Effect of Dex-AuNPs in Atopic Dermatitis Mice
[0126] The present inventors established atopic dermatitis mouse model by induced through repeated exposure to dinitrochlorobenzene and house dust mite extract to evaluate the in vivo effect of Dex-AuNPs on the treatment of atopic dermatitis. For the therapeutic efficacy of Dex-AuNPs, macroscopic observation, skin thickness measurement, epidermal and dermal thickness through histopathology, serum immunological response, and cytokine expression levels in tissues were measured.
[0127] As a result, superficial phenomena of keratosis and erythema and histopathological analysis showed epidermis and dermis thickening and keratosis in atopic dermatitis-induced mice repeatedly exposed to dinitrochlorobenzene and house dust mite extract. In addition, the ELISA results of serum immunoglobulins IgE, IgG2a, and DFE-speicif IgE were also elevated, and the cytokines IL-4 and TSLP in tissues were also increased. On the other hand, mice to which Dex-AuNPs were applied showed erythema and keratosis and decreased skin thickness. In addition, as a result of histopathological analysis, epidermal and dermal thickness and keratosis were decreased, and the ELISA results of serum immunoglobulins IgE, IgG2a, and DFE-specific IgE were also decreased. In particular, the cytokines IL-4 and TSLP in tissues were also significantly reduced (
Example 11: Psoriasis Treatment Efficacy by Dex-AuNPs
[0128] The present inventors established a psoriatic dermatitis model by continuously treating Aldara cream (62.5 mg) to confirm the in vivo effect of Dex-AuNPs on the treatment of psoriatic dermatitis. To confirm the therapeutic effect of Dex-AuNPs in psoriatic dermatitis, macroscopic observation, histopathological confirmation and immunological response, and psoriasis regional severity index were checked. As a result, it was confirmed that, when Aldara Cream was repeatedly treated, keratin, erythema, and skin thickness increased in the skin of mice with psoriatic dermatitis, and the serum immunoglobulin IgG2a, myeloperoxidase (MPO), and psoriasis regional severity index increased. However, in mice treated with Dex-AuNPs, keratin, erythema, skin thickness, immunoglobulin, and psoriasis regional severity index were all decreased (
[0129] In conclusion, the triamcinolone-gold nanoparticle (Triam-AuNPs) complex, which is a novel inflammatory disease treatment agent of the present invention, reduces pro-inflammatory responses and anti-inflammatory responses of synovial cells (FLSs) through repolarization of macrophages from M1 to M2 phenotype, effectively regulating the expression of pro-inflammatory and anti-inflammatory cytokines in FLSs, and effectively repolarizing macrophage activity in the inflammatory synovial membrane. In addition, since it is effective in skin diseases such as psoriasis and atopic dermatitis, it can be used as a new drug candidate for treating inflammatory diseases.
[0130] The research involved in the present patent application is supported by the National Research Foundation in Korea with grant numbers, 2020M3A9D3038894 and 2019R1A2C1085986.
[0131] Although the present invention has been described with reference to the above-described embodiment, it will be understood that this is merely exemplary, and that those skilled in the art can make various modifications and equivalent other embodiments therefrom. Therefore, the true technical protection scope of the present invention should be determined by the technical spirit of the appended claims.