A PROMOTER ACTIVATION SEQUENCE, AN EXPRESSION VECTOR COMPRISING THE PROMOTER ACTIVATION SEQUENCE, AND A MAMMALIAN CELL COMPRISING THE EXPRESSION VECTOR
20250002963 ยท 2025-01-02
Assignee
- Tokyo University Of Pharmacy And Life Sciences (Tokyo, JP)
- National University Corporation Tottori University (Tottori-shi, Tottori, JP)
Inventors
Cpc classification
International classification
Abstract
A promoter activation sequence that allows for stable and efficient expression of a DNA of interest in a mammalian cell is provided. The promoter activation sequence has a nucleotide sequence represented by SEQ ID NO: 1, or a nucleotide sequence of 850 or more in a nucleotide sequence having 85% or higher sequence identity thereto. Also disclosed are an expression vector having the promoter activation sequence, a promoter, and a DNA of interest, a mammalian cell and a mammal including the expression vector.
Claims
1. A promoter activation sequence comprising a nucleotide sequence represented by SEQ ID NO: 1 or a nucleotide sequence of 850 or more in a nucleotide sequence having 85% or higher sequence identity thereto.
2. An expression vector comprising the promoter activation sequence according to claim 1, a promoter, and a DNA of interest.
3. The expression vector according to claim 2, wherein the promoter is a constitutive expression promoter.
4. The expression vector according to claim 3, wherein the constitutive expression promoter is selected from the group consisting of EF1 promoter, PGK promoter, and UBC promoter.
5. The expression vector according to claim 2, wherein the promoter activation sequence is comprised at 5 upstream of the promoter.
6. The expression vector according to claim 2, wherein the expression vector is a mammalian artificial chromosome vector.
7. The expression vector according to claim 6, wherein the expression vector is a human artificial chromosome vector.
8. A mammalian cell carrying the expression vector according to claim 2.
9. The cell according to claim 8, wherein the mammalian cell is a human cell or a CHO cell.
10. The cell according to claim 9, wherein the human cell is a human pluripotent stem cell or a human somatic stem cell.
11. The cell according to claim 10, wherein the human pluripotent stem cell is a human iPS cell or a human ES cell, and the human somatic stem cell is a human MSC cell.
12. A nonhuman mammal comprising the expression vector according to claim 2.
13. A method for producing a protein encoded by a DNA of interest, comprising culturing the mammalian cell according to claim 8 in a medium for animal cell culture, and collecting the protein encoded by the DNA of interest from a culture product obtained by the culture.
14. A method for suppressing the silencing of a DNA of interest in a cell by transferring the expression vector according to claim 2 to the cell.
15. A method for enhancing the expression of a DNA of interest in a cell by transferring the expression vector according to claim 2 to the cell.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
DESCRIPTION OF EMBODIMENTS
1. Promoter Activation Sequence of the Present Invention
[0067] The promoter activation sequence of the present invention comprises a nucleotide sequence represented by SEQ ID NO: 1, or a nucleotide sequence of 850 or more in a nucleotide sequence having a mutation in the nucleotide sequence. The nucleotide sequence represented by SEQ ID NO: 1 is a sequence positioned further upstream of an expression promoter of UbC gene on human chromosomal DNA. More specifically, the nucleotide sequence represented by SEQ ID NO: 1 is a nucleotide sequence of 2549 bp corresponding to positions from 124,927,045 to 124,929,593 of human chromosome 12. The nucleotide sequence of human chromosome 12 is disclosed under NC_000012.12 in GenBank of the National Center for Biotechnology Information (NCBI). The nucleotide sequence of SEQ ID NO: 1 is shown in Table 1.
TABLE-US-00001 TABLE1 SEQIDNO:1 ccaggaagttcaggaaattggctgacccagtgcatccatttggaagtgtagtgggcatct 60 cgaaacgtaacatgcctgtgactgaagtcttgatttccttactcactctgaggcacctgc 120 cctcgggcaagagcatcaccatccgtccagtagcccagacagccgctgggtgtcatcctt 180 cacccccctttctttcccctttccctatatgaaatccatcaacaagtcctcccaccctcc 240 ttctgaagccagtctcaaattcgtcccttcatcaacacctccaactgcctcctcgctgga 300 cttcctgctgccactctggctggccagtccattctccacccagcagccggggtgactttg 360 cagatggaaatcatctcactcccccatggctttccaagatccagggcacccaggctcatc 420 tcctaggcctccaaagatggcgagatctggtctccgccccacattcagaccttgccccct 480 cccctcactcctcttcccctccacctcttccatcatgacttctttctgtccctctgacaa 540 gccaacctggtttcaacctcaggacctttgtactagctgttccctccgtctgtgatgctc 600 ttcctccaggtcttcccgtggctcttcagtcttctggtcttctcagatcttcccttctct 660 tgctgcccccacagtgcaggtattttatttttcttagcatttactattatgtggacttat 720 tttgttattgtatttggcttttttttttttttttaataagatagggagctcactattttg 780 cccagactggtctcgaactcctacccacaagcgagtctgctttcacctgggcctcccaaa 840 gctctgggattactaggttgagcccccgcacctggcctgttaattgtatttgttgatggg 900 tcagacgattattaggtgctcggcgaatgcttcttgaatgacttcaggtcatgagggatt 960 tcctgattctttcccggacaacacccgcaccgtccaaccgcccacttcccgaagcgaaga 1020 gcccagtctggatgccaacctgttgacgtcttcccgcttggaagctgagcaggtgctcac 1080 aagcatggaggccacactcggaggccggatctgagtcactccctgcccgaggaacgctgc 1140 gttccggctgacgcgtcctcccgtaggccctggcgaggtcaacatccctgccacgcctcg 1200 cgctgcttgcggagctgcgcccaggggatgacctttttcctttgcgcggagaagggggct 1260 tgagaaacccgagctctgaaccaggtgggattcattcattcacgcatgcattcattcatg 1320 tagtcagtcagtcaatcagtcaacaaatatttgtcaaggccccacaatgtgctaggcact 1380 gttctaggtactgagggacacagcggtgcccgaggtagacaaggttcctgctcctcttgt 1440 gtttgtcatgcttgctggggagacggacaaggaaaatgataaagttaacagtaaatagta 1500 aaggctgggccatggcgggagatgtgatcagagaaggcttctcagaggtcgtggccttga 1560 cagacgaacaggccaccgcacgcagtccctgctgaacctgcattcccagcgtctgtgtca 1620 aagacccggggcggcaaaacgaccaggaggataaaagagcatcgcagtcgtaacggctgc 1680 cgaaatagctcagttgggagagcgttagactgaagatctaaaggtccctggttcgatccc 1740 gggtttcggcacttcctctttttccttccccccgggggaaaaaggaggtgcatagacgaa 1800 gccgattccttccaattgatcaaaggcttttactttctatatttaacaaagccccgagca 1860 gtgtccgcgaggagccagagggaaaggaaactccccctccactccccgtttgggtaaatc 1920 aaataaggtcaagtttttcccgtctccacctcctccatgtctcaaatgcacatttgttga 1980 tgcctgtttgttcatttttgctttctgttttttaacgtctgctttctgaactggaaacga 2040 tcgccttaaaatggcatgaagtcaagtcggacctgttgttttgtgggaaatacaagatac 2100 ttaattctttggaaagtgtttagggaaagctacgtttaccttaaaacagtctcttgaaga 2160 acctgttttatgggcggtcctcgttagtatagtggtgagtatccccgcctgtcacgcggg 2220 agaccggggttcgattccccgacggggaggccaagtacgtttttaccattcttccgtatt 2280 tttccttactcttcctatgaagaataaacccggcaggtaaacgggactctggttctgtgg 2340 ttgtctctggcctcgttgcgtgccacactgttacaggaaagcaagaaaaaggcagtgctc 2400 gcatgtggaagtgttcatccatttcgttctttttttttggagaccatttctttttttttt 2460 tttttttcctcagacagagtctcgctctgtctcccaggctggagtgcagtggcccgatct 2520 cagctcactgtaacctccgccttccgggt 2549
[0068] The promoter activation sequence of the present invention most preferably consists of the whole nucleotide sequence of SEQ ID NO: 1, i.e., the nucleotide sequence of 2549 bp of SEQ ID NO: 1. However, the promoter activation sequence of the present invention may be a shorter partial sequence of SEQ ID NO: 1. The promoter activation sequence of the present invention may consist of, for example, 1500 bp or more, 1000 bp or more, or 850 bp or more of the nucleotide sequence of SEQ ID NO: 1.
[0069] As mentioned above, the promoter activation sequence of the present invention also encompasses a nucleotide sequence having a mutation in the nucleotide sequence of SEQ ID NO: 1. Specifically, examples of the nucleotide sequence having a mutation in the nucleotide sequence of SEQ ID NO: 1 can include nucleotide sequences having preferably 85% or higher, more preferably 90% or higher, more preferably 95% or higher, more preferably 97% or higher, further preferably 98% or higher, particularly preferably 99% or higher homology to the nucleotide sequence represented by SEQ ID NO: 1. The homology between the nucleotide sequences can be determined using algorithm BLAST by Karlin and Altschul [Pro. Natl. Acad. Sci. USA, 90, 5873 (1993)] or FASTA [Methods Enzymol., 183, 63 (1990)]. In the case of analyzing the nucleotide sequences by BLASTN based on BLAST, parameters can be set to, for example, score=100 and wordlength=12.
[0070] The promoter activation sequence of the present invention also encompasses a nucleotide sequence derived from the nucleotide sequence represented by SEQ ID NO: 1 by the deletion, substitution, addition, or insertion of one to several bases. In this context, the term several means 10 or less, preferably 8 or less, more preferably 6 or less, most preferably 4 or less.
[0071] The promoter activation sequence of the present invention also encompasses a nucleotide sequence that hybridizes under stringent conditions to a complementary strand of the nucleotide sequence represented by SEQ ID NO: 1. In this context, examples of the stringent conditions include conditions described in Current Protocols in Molecular Biology, John Wiley & Sons, 6.3.1-6.3.6, 1999, for example, hybridization in 6SSC (sodium chloride/sodium citrate) at 45 C. followed by washing once or more with 0.2SSC and 0.1% SDS at 50 to 65 C. Those skilled in the art can appropriately select hybridization conditions that provide stringency equivalent thereto.
[0072] As shown in Examples described below, an intended effect was not obtained when a nucleotide sequence of approximately 0.8 kb in
TABLE-US-00002 TABLE2 SEQIDNO:2 cgcacgcagtccctgctgaacctgcattcccagcgtctgtgtcaaagacccggggcggca 60 aaacgaccaggaggataaaagagcatcgcagtcgtaacggctgccgaaatagctcagttg 120 ggagagcgttagactgaagatctaaaggtccctggttcgatcccgggtttcggcacttcc 180 tctttttccttccccccgggggaaaaaggaggtgcatagacgaagccgattccttccaat 240 tgatcaaaggcttttactttctatatttaacaaagccccgagcagtgtccgcgaggagcc 300 agagggaaaggaaactccccctccactccccgtttgggtaaatcaaataaggtcaagttt 360 ttcccgtctccacctcctccatgtctcaaatgcacatttgttgatgcctgtttgttcatt 420 tttgctttctgttttttaacgtctgctttctgaactggaaacgatcgccttaaaatggca 480 tgaagtcaagtcggacctgttgttttgtgggaaatacaagatacttaattctttggaaag 540 tgtttagggaaagctacgtttaccttaaaacagtctcttgaagaacctgttttatgggcg 600 gtcctcgttagtatagtggtgagtatccccgcctgtcacgcgggagaccggggttcgatt 660 ccccgacggggaggccaagtacgtttttaccattcttccgtatttttccttactcttcct 720 atgaagaataaacccggcaggtaaacgggactctggttctgtggttgtctctgg 774
[0073] As already mentioned, Patent Literature 1 and Non Patent Literature 1 disclose that a DNA sequence of approximately 15 kb positioned upstream of a promoter of UbC gene on human chromosomal DNA enhances gene expression.
[0074] In
[0075] Patent Literature 1 and Non Patent Literature 1 disclose that an activity enhancing effect was reduced as the promoter activation sequence was shortened to 15 kb, 4 kb, and 1.3 kb. Specifically, Patent Literature 1 and Non Patent Literature 1 disclose that activity enhancing effects of 4.5 times, 2.5 times, and 1.2 times were obtained with the amount of erythropoietin produced from erythropoietin gene serving as a gene of interest as an index in CHO cells harboring vectors with promoter activation sequences of 15 kb, 4 kb, and 1.3 kb linked to a promoter, respectively. According to the disclosure of Patent Literature 1 and Non Patent Literature 1, the long sequence (15 kb) had a higher activity enhancing effect, and the shorter partial sequences each used alone cannot achieve an activity enhancing effect equivalent to that of the sequence of 15 kb.
[0076] Accordingly, it has not been predicted that the promoter activation sequence of the present invention comprising the sequence of approximately 2.5 kb of the present invention (SEQ ID NO: 1), which is a partial sequence of the 15 kb described above, has a promoter activation effect at the same level as that of the sequence of 15 kb in the conventional technique.
[0077] In addition, it is generally considered that: all of general used EF1, PGK, or UbC promoters are positioned at a region of 2 kb or less; and sequence elements necessary for functions of the housekeeping gene promoters are contained at a region of 1 to 2 kb containing a transcriptional initiation site. Accordingly, in this respect as well, it has not been predicted that the nucleotide sequence of SEQ ID NO: 1 of the present invention (2549 bp) which is distant by approximately 13 kb from human UbC gene promoter and is positioned near the middle between the promoter and adjacent DEAH-box helicase 37 (DHX37) gene has an activity enhancing effect equivalent to that of the region of approximately 15 kb.
[0078] For the reasons mentioned above, it was not expected that the nucleotide sequence consisting of SEQ ID NO: 1 or a partial sequence thereof (i.e., the promoter activation sequence of the present invention) had a function as the promoter activation sequence, and the effect is surprising.
2. Expression Vector of Present Invention
[0079] The expression vector of the present invention comprises the promoter activation sequence described in 1, a promoter, and a DNA of interest.
[0080] The DNA of interest according to the present invention is a DNA intended to obtain a protein encoded thereby through expression or a DNA that achieves an intended effect of gene therapy by transfer thereof, and includes, for example, a gene or gene locus, or a nucleic acid such as cDNA, recombinant DNA, or modified DNA.
[0081] The DNA of interest according to the present invention encompasses, for example, but not limited to, disease causative genes, therapeutic genes, chromosome fragments containing genes thereof, and genes necessary for cell differentiation, and can include genes or DNA encoding proteins, for example, cytokines, interferon, interleukin, chemokines (factors having cell migratory activity), granulocyte-colony stimulating factors, tumor necrosis factors, growth factors (e.g., platelet-derived growth factors, vascular endothelial growth factors, hepatocyte growth factors, keratinocyte growth factors, nerve growth factors, epithelial stem cell growth factors, and hematopoietic stem cell growth factors), nutritional factors (e.g., neurotrophic factors and brain-derived neurotrophic factors), erythropoietin, blood-clotting proteins, platelet production promoters, hormones, antibodies (e.g., monoclonal antibodies and recombinant antibodies such as scFv), and enzymes. The DNA of interest can further include therapeutic genes or DNA related to diseases such as muscular dystrophy, hemophilia, neurodegenerative diseases, autoimmune diseases, allergic diseases, genetic diseases, and tumors, and immune system genes or DNA such as chimeric antigen receptor (CAR), T cell receptor (TCR), and human leukocyte antigen (HLA).
[0082] A protein encoded by the DNA of interest according to the present invention is expressed therefrom. In the present specification, the term protein includes a protein, a polypeptide, and a peptide unless otherwise specified, and may be any industrially useful protein and is preferably a human-derived protein. Examples of the protein include arbitrary proteins for use in the treatment or prevention of the diseases described above or the diagnosis of the diseases.
[0083] The expression vector of the present invention may comprise the promoter activation sequence of the present invention at 5 upstream or at 3 downstream of the promoter. More preferably, the expression vector of the present invention comprises the promoter activation sequence of the present invention at 5 upstream of the promoter.
[0084] The promoter comprised in the vector of the present invention is not particularly limited, and any promoter can be used as long as a function as the promoter can be exerted in mammalian cells. A constitutive promoter always causes expression of the DNA of interest in a given amount and is therefore advantageous for the object of the present invention. Accordingly, preferably, the promoter used in the present invention is a constitutive expression promoter known in the art to activate constitutive expression of the expression vector, preferably a promoter of a housekeeping gene.
[0085] Examples of such a constitutive promoter can include nonviral promoters such as human polypeptide elongation factor 1 gene promoter (EF1 promoter), phosphoglycerate kinase promoter (PGK promoter), and human ubiquitin C (UBC) promoter, and viral promoters such as CMV promoter, SV40 promoter, and CAG. The promoter used in the present invention is particularly preferably EF1 promoter, PGK promoter, or UBC promoter used in Examples described below.
[0086] The expression vector of the present invention can be prepared by inserting a DNA cassette comprising the promoter activation sequence of the present invention, a promoter, and a DNA of interest to an expression vector. In the present invention, the expression vector to which the promoter activation sequence, a promoter, and the DNA of interest are inserted is not particularly limited as long as the expression vector has the promoter at a position appropriate for expressing the DNA of interest inserted in the vector and allows for expression of a protein from the DNA of interest in mammalian cells. One example of the DNA cassette can include, but is not limited to, pUL2.5 ms having ampicillin resistance gene, HS4 (insulator sequence mentioned below), a polyA sequence, a coding region sequence of red fluorescent protein (mCherry) gene, a UBCP promoter sequence, the promoter activation sequence of the present invention (2.5 kb), and further HS4 (see
[0087] In the present invention, a mammalian artificial chromosome vector or a plasmid vector is preferably used, though the present invention is not limited thereby. However, a conventional vector system such as a virus, YAC, BAC, PAC, or a cosmid may be used in the present invention, though the present invention is not limited thereby.
[0088] In this context, examples of the mammalian artificial chromosome vector can include, but are not particularly limited to, artificial chromosome vectors of primates such as humans, monkeys, chimpanzees, and gorillas, rodents such as mice, rats, hamsters, and guinea pigs, ungulates such as bovines, sheep, and goats, dogs, cats, and the like. The mammalian artificial chromosome vector is particularly preferably a human artificial chromosome (HAC) vector, a mouse artificial chromosome (MAC) vector, or a rat artificial chromosome (RAC) vector. A human artificial chromosome vector is the most preferable vector. Specific examples of the human artificial chromosome vector can include 21HAC based on human chromosome 21, 14HAC based on human chromosome 14, and 2HAC based on human chromosome 2.
[0089] In the present specification, the artificial chromosome vector refers to an artificially prepared chromosome-derived vector comprising the centromere of a chromosome derived from the mammal, a fragment proximal to the centromere of a long arm and, if any, a short arm (from which genes and the like have been removed as much as possible), and natural or artificial telomere.
[0090] The mouse artificial chromosome vector is described in, for example, JP Patent Nos. 5557217 and 4997544, and the human artificial chromosome vector is described in, for example, JP Patent No. 4895100.
[0091] The human chromosome for use in the preparation of the human artificial chromosome vector may be any of human chromosomes 1 to 22, X, and Y and is preferably any of chromosomes 1 to 22. Alternatively, a human iPS cell-derived chromosome can be used as a human chromosome vector. For the preparation of the human artificial chromosome, see, for example, methods described in JP Patent Publication (Kokai) No. 2010-004887 A (2010) and WO2008/013067, or approaches described in the literatures regarding the preparation of the mouse artificial chromosome vector.
[0092] The mouse chromosome for use in the preparation of the mouse artificial chromosome vector may be any of mouse chromosomes 1 to 19, X, and Y and is preferably any of chromosomes 1 to 19. For example, in the case of an artificial chromosome vector derived from a mouse chromosome 11 fragment, the long arm fragment consists of, for example, but not limited to, a long arm fragment from which a region distal to AL671968, or BX572640 (positioned on the more centromere side than AL671968), CR954170 (positioned on the more centromere side than AL671968 and BX572640), or AL713875 (positioned on the more centromere side than AL671968) of the long arm of the chromosome 11 has been deleted. Alternatively, in the case of a mouse artificial chromosome derived from a mouse chromosome 15 fragment, the long arm fragment consists of, for example, a long arm fragment from which a region distal to a position such as AC121307 or AC161799 has been deleted. Alternatively, in the case of a mouse artificial chromosome derived from a mouse chromosome 16 fragment, the long arm fragment consists of, for example, a long arm fragment from which a region distal to a position such as AC127687 or AC140982 has been deleted.
[0093] The artificial chromosome vector described above can further comprise a DNA sequence insertion site such as loxP (Cre recombinase recognition site), FRT (Flp recombinase recognition site), C31attB and C31attP (C31 recombinase recognition sites), R4attB and R4attP (R4 recombinase recognition sites), TP901-1attB and TP901-1attP (TP901-1 recombinase recognition sites), or Bxb1attB and Bxb1attP (Bxb1 recombinase recognition sites) for inserting a desired nucleic acid (e.g., a gene, a gene locus, or a chromosome fragment). The artificial chromosome vector described above can comprise a site for inserting a desired nucleic acid sequence. Therefore, the integration of a desired nucleic acid to this site enables the desired nucleic acid to be expressed when the artificial chromosome vector is transferred to arbitrary cells.
[0094] The object of the present invention can be achieved by transferring a DNA cassette comprising the promoter activation sequence of the present invention, a promoter, and a DNA of interest to an artificial chromosome without the use of a particular DNA sequence insertion site for inserting a desired nucleic acid sequence.
[0095] Examples 13 and 14 described below are examples in which neither site-directed recombinase nor a recognition site of the enzyme was used in inserting the DNA cassette to the artificial chromosome vector. In this case, the DNA cassette is randomly inserted to an arbitrary site other than centromere and telomere in the vector, or the genome of the cells.
[0096] Alternatively, the DNA cassette may be inserted either specifically for the genome of cells or randomly by transferring another vector such as a plasmid vector or a virus vector having an insert of the DNA cassette to the cells. The DNA cassette may be inserted either to a desired target site or randomly by use of, for example, a gene targeting method or a genome editing technique as a technique of inserting the DNA cassette to the genome.
[0097] The genome editing is a technique of performing genomic DNA editing or gene modification using, for example, an artificial cleavage enzyme such as TALEN (transcription activator-like effector nuclease) or ZFN (zinc finger nuclease), or a CRISPR-Cas system. Among these systems, a CRISPR/Cas9 system has been found from the adaptive immune system against a bacterial or archaebacterial virus or plasmid and is capable of relatively conveniently constructing a vector and modifying a plurality of genes at the same time (Jinek et al., Science, 17, 337 (6096): 816-821, 2012; and Sander et al., Nature Biotechnology, 32 (4): 347-355, 2014). This system comprises Cas9 nuclease which cleaves double-stranded DNA on the genome, and guide RNA (sgRNA or crRNA (CRISPR RNA)+tracrRNA (trans-activating CRISPR RNA)) having a sequence of approximately 20 base pairs that recognizes a target sequence on the genome. By their coexpression in cells, the gRNA recognizes a PAM sequence proximal to the target sequence and specifically binds to target genomic DNA while the Cas9 protein induces a double-stranded break (DSB) at 5 upstream of the PAM sequence (NGG (N=C, G, A, or T)). In this event, the DNA cassette can be inserted to the cleavage site provided that cells contains a vector comprising the DNA cassette.
[0098] Preferably, a reporter gene may be inserted, in addition to the sequence of the gene or locus of interest, to the mammalian artificial chromosome vector. Examples of reporter genes include, but are not particularly limited to, fluorescent protein genes (e.g., green fluorescent protein (GFP or EGFP) gene and yellow fluorescent protein (YFP) gene), tag-protein-encoding DNA, -galactosidase gene, and luciferase gene.
[0099] The mammalian artificial chromosome vector may further comprise a selection marker gene. A selection marker is effective when selecting a cell transformed with the vector. As a selection marker gene, either or both of a positive selection marker gene and a negative selection marker gene are exemplified. Examples of positive selection marker genes include drug-resistant genes such as neomycin-resistant gene, ampicillin-resistant gene, blasticidin S (BS)-resistant gene, puromycin-resistant gene, geneticin (G418)-resistant gene, and hygromycin-resistant gene. In addition, examples of negative selection marker genes include herpes simplex thymidine kinase (HSV-TK) gene and diphtheria toxin A fragment (DT-A) gene. In general, HSV-TK is used in combination with ganciclovir or acyclovir.
[0100] The artificial chromosome vector serving as the expression vector according to the present invention comprises a nucleic acid insertion site to which a nucleic acid comprising the promoter activation sequence of the present invention, a promoter, and a DNA of interest can be inserted. The nucleic acid is inserted to this site.
[0101] At least one insulator sequence may be allowed to reside in the vicinity of the nucleic acid insertion site or on both sides of the insertion site in the artificial chromosome of the present invention. The insulator sequence has an enhancer blocking effect (i.e., neighboring genes are not influenced by each other) or a chromosome boundary effect (i.e., a region that assures gene expression and a region that suppresses gene expression are separated and distinguished from each other). Such a sequence may encompass, for example, human globin HS1 to HS5 or chicken globin HS4.
[0102] A nucleic acid comprising the promoter activation sequence of the present invention, a promoter, and a DNA of interest can be transferred to the donor cell, for example by using a gene transfer technique such as a genome editing method or a site-directed recombination method, onto an artificial chromosome such as a human artificial chromosome or a mammalian artificial chromosome in the donor cells. After transfer of the nucleic acid, the donor cells comprising the DNA of interest can be detected and recovered by, for example, a HAT selection method.
3. Mammalian Cell of Present Invention
[0103] A mammalian cell comprising the expression vector of the present invention (hereinafter, simply referred to as the mammalian cell of the present invention) can be prepared by transferring the vector for foreign gene expression described above to a mammalian cell serving as a host cell.
[0104] The mammalian cell that is used as a host cell in the present invention is not particularly limited as long as the mammalian cell can cause nucleic acid amplification of the DNA of interest. Examples thereof include mammalian somatic cells, mammalian stem cells, established mammalian cell lines, human cells, and rodent cells (hamster cells, mouse cells, rat cells, etc.). As a preferred example, human cells or hamster cells are particularly preferably used.
[0105] Human-derived stem cells, for example, human pluripotent stem cells or human somatic stem cells, can be used as the human cells. Particularly preferably, human mesenchymal stem cells (MSC cells) are used as the human somatic stem cells, and human induced pluripotent stem cells (iPS cells) are used as the human pluripotent stem cells.
[0106] Mouse- or rat-derived stem cells, for example, mouse- or rat-derived pluripotent stem cells or somatic stem cells, can be used as the mouse cells or the rat cells. Mouse or rat MSC cells are particularly preferably used as the mouse or rat somatic stem cells. Mouse or rat induced pluripotent stem cells (iPS cells) are particularly preferably used as the mouse or rat pluripotent stem cells, and mouse or rat embryonic stem cells (ES cells) are also particularly preferably used. As with the case of mouse ES cells (M. J. Evans and M. H. Kaufman, Nature 1981; 292 (5819): 154-156), rat ES cells are pluripotent and self-reproducible cell lines that are established from the inner cell mass of the rat blastocyst stage embryo or 8-cell-stage embryo.
[0107] Chinese hamster ovary cells (CHO cells) are preferably used as the hamster cells. More specifically, for example, CHO-K1, CHO-S, or DG44 is particularly preferred.
[0108] Examples of the somatic cells can include, but are not limited to, hepatocytes, enterocytes, renal cells, splenocytes, lung cells, cardiac cells, skeletal muscle cells, brain cells, skin cells, bone marrow cells, fibroblasts, hematopoietic stem cells, T cells, and B cells.
[0109] In the present specification, the embryonic stem cells or the ES cells are pluripotent and semi-immortalized stem cells that are established from an inner cell mass of a blastocyst of a fertilized egg derived from a mammal (M. J. Evans and M. H. Kaufman (1981) Nature 292:154-156; J. A. Thomson et al. (1999) Science 282:1145-1147; J. A. Thomson et al. (1995) Proc. Natl. Acad. Sci. USA 92:7844-7848; J. A. Thomson et al. (1996) Biol. Reprod. 55:254-259; J. A. Thomson and V. S. Marshall (1998) Curr. Top. Dev. Biol. 38:133-165).
[0110] Cells artificially induced by the reprogramming of somatic cells, which have properties equivalent to the ES cells, are induced pluripotent stem cells or iPS cells (K. Takahashi and S. Yamanaka (2006) Cell 126:663-676; K. Takahashi et al. (2007) Cell 131:861-872; J. Yu et al. (2007) Science 318:1917-1920). The iPS cells can form colonies in approximately 3 to 5 weeks by introducing certain reprogramming factors (DNA or proteins) into somatic cells (including somatic stem cells), and culturing and subculturing the cells in an appropriate medium. A known combination of the reprogramming factors is, for example, a combination of Oct3/4, Sox2, Klf4, and c-Myc; a combination of Oct3/4, Sox2, and Klf4; a combination of Oct4, Sox2, Nanog, and Lin28; or a combination of Oct3/4, Sox2, Klf4, c-Myc, Nanog, and Lin28 (K. Takahashi and S. Yamanaka, Cell 126:663-676 (2006); WO2007/069666; M. Nakagawa et al., Nat. Biotechnol. 26:101-106 (2008); K. Takahashi et al., Cell 131:861-872 (2007); J. Yu et al., Science 318:1917-1920 (2007); J. Liao et al., Cell Res. 18, 600-603 (2008)).
[0111] The mammalian artificial chromosome vector of the present invention can be introduced or transferred to arbitrary mammalian cells. Examples of the approach therefor include microcell fusion, lipofection, a calcium phosphate method, microinjection, and electroporation. The approach is preferably microcell-mediated chromosome transfer disclosed in WO2020/075823.
[0112] The microcell-mediated chromosome transfer is a method for transferring a mammalian artificial chromosome vector into a desirable cell by microcell fusion between a cell capable of forming microcells and comprising the mammalian artificial chromosome vector and the desirable cell. The cell capable of forming microcells is treated with a polyploid inducer (e.g., colcemid or colchicine) to form multinucleated micronucleate cells, which can then be treated with cytochalasin to form microcells, followed by cell fusion of the microcells to the desirable cell.
[0113] The mammalian cell comprising the expression vector of the present invention can achieve stable high expression of DNA intended to be expressed, owing to the presence of the promoter activation sequence of the present invention comprised in the expression vector. Examples mentioned below have demonstrated that the stable high expression of such DNA of interest is brought about by an expression enhancing activity and/or an anti-silencing activity against the DNA of interest.
4. Protein Production Method of Present Invention
[0114] A desired protein can be produced by culturing the mammalian cell described in 3. in a medium for animal cell culture, and collecting a protein encoded by the DNA of interest (hereinafter, referred to as the desired protein) from a culture product obtained by the culture. As mentioned above, the presence of the promoter activation sequence of the present invention brings about stable high expression of the DNA of interest.
[0115] The culture of the animal cell of the present invention can be performed in accordance with a usual method for use in mammalian cell culture.
[0116] The protein production method of the present invention includes a method of producing the protein within host cells, a method of secreting the protein outside of the host cells, or a method of producing the protein on outer membranes of host cells. An appropriate method can be selected by changing the host cells used or the structure of the protein to be produced.
[0117] A medium suitable for the type of the cell used is selected as the culture medium for the mammalian cell. For example, MEM medium, DMEM medium, RPMI medium, F12 medium, Macy's 5A medium, or a mixed medium thereof (e.g., DMEM/F12) can be used as a basal medium usually used. The basal medium can be further replenished with at least one component, for example, a supplement such as serum, a serum replacement, an antibiotic, glutamic acid, or pyruvic acid. The pH of the medium is, for example, 7.2 to 7.4.
[0118] Exemplary culture of iPS cells involves using a mitomycin C-treated mouse embryonic fibroblast cell line (e.g., STO) as feeder cells, and culturing somatic cells (e.g., approximately 10.sup.4 to 10.sup.5 cells/cm.sup.2) harboring the vector at a temperature of approximately 37 C. using a medium for an ES cell on the feeder cell layer. The feeder cells are not always necessary (Takahashi, K. et al., Cell 131, 861-872, (2007)). Examples of the basic medium include Dulbecco's modified Eagle's medium (DMEM), Ham's F-12 medium, and mixed media thereof. For example, a medium for a mouse ES cell or a medium for a primate ES cell (Reprocell Inc.) can be used as the medium for an ES cell. For example, human iPS cells or human ES cells can be cultured under feeder-free conditions using StemFit AK02N medium (Takara Bio Inc.) free from an animal-derived component.
[0119] As for rat ES cells, for example, rat blastocysts with egg zona pellucida dissolved are cultured on mouse embryonic fibroblast (MEFF) feeder using a medium containing leukemia inhibitory factor (LIF), and outgrowth formed from the blastocysts is dispersed 7 to 10 days later, then transferred to MEF feeder, and cultured so that ES cells appear approximately 7 days later. The preparation of the rat ES cells is described in, for example, K. Kawaharada et al., World J. Stem Cells 2015; 7 (7): 1054-1063. Mouse ES cells can be cultured in the same manner as in the rat ES cells.
[0120] The culture is performed in an atmosphere of air containing approximately 2 to 10% (usually, approximately 5%) CO.sub.2, and a temperature of approximately 35 to 40 C. (usually, approximately 37 C.) is suitable.
[0121] The culture method may be any of batch culture, flask culture, fed-batch culture, continuous culture, suspension culture, shake culture, stirring culture, circulation culture, and the like. In order to suppress cell aggregation, a method of allowing a culture solution to pass through a hollow fiber filter to disintegrate the aggregate during culture may be used.
[0122] An apparatus for use in animal cell culture can be used as a culture apparatus. The apparatus is preferably equipped with aeration, temperature control, stirring, pH adjustment, and DO adjustment functions. Culture can be performed using, for example, a fermenter tank culture apparatus, an airlift culture apparatus, a fluidized bed culture apparatus, a hollow fiber culture apparatus, a roller bottle culture apparatus, a packed bed culture apparatus, or a bag culture apparatus as the apparatus.
[0123] Another example of high expression of a protein includes high expression of a reporter gene for monitoring the behavior or biological functions of the protein of interest in mammalian cells. For example, a reporter gene (e.g., DNA encoding a fluorescent protein or a luminescent protein) linked to a gene control sequence (e.g., a promoter or an enhancer) can be operably inserted to, for example, the DNA of interest. High expression of the reporter gene can enhance the detection sensitivity of reporter assay. This enables the behavior of the DNA of interest expressed by certain stimulation in cells to be observed with florescence or luminescence as an index. Since such observation can usually be performed in laboratories, cells can be cultured using a solid medium depending on the type of the cells. In general, the observation can be performed using, for example, a fluorescence microscope with a camera.
[0124] When the protein is produced within host cells or on outer membranes of host cells, the desired protein can be aggressively secreted outside the host cells by use of the method of Paulson et al. [J. Biol. Chem., 264, 17619 (1989)], the method of Lowe et al. [Proc. Natl. Acad. Sci., USA, 86, 8227 (1989); and Genes Develop., 4, 1288 (1990)], or a method described in, for example, JP Patent Publication (Kokai) No. 05-336963 A (1993) or WO94/23021.
[0125] The amount of the desired protein produced may be elevated through the use of a gene amplification system using dihydrofolate reductase gene or the like (JP Patent Publication (Kokai) No. 2-227075 A (1990)).
[0126] In the collection step, for example, a supernatant or cells after centrifugation or filtration can be subjected to, for example, column chromatography such as affinity column chromatography, gel filtration chromatography, or ion exchange chromatography, filtration, ultrafiltration, salting out, dialysis, or a combination thereof, in order to obtain the desired protein produced by the culture. The recovery method is not limited to the methods described above and encompasses every method that may generally be used in protein purification.
[0127] Particularly, when the desired protein is a glycoprotein such as an antibody, the glycoprotein can be recovered using a protein A column, a protein G column, a protein L column, or an IgG-binding peptide column.
[0128] When the desired protein is expressed in a dissolved state in cells, the cells are recovered by centrifugation after the completion of culture, then suspended in an aqueous buffer solution, and disrupted using a sonicator, a French press, a Manton-Gaulin homogenizer, or Dyno-Mill to obtain cell-free extracts. From a supernatant obtained by the centrifugation of the cell-free extracts, a purified preparation can be obtained by using, singly or in combination, usual protein isolation or purification methods, i.e., approaches including solvent extraction, salting out with ammonium sulfate or the like, desalting, precipitation with an organic solvent, anion exchange chromatography using a resin such as diethylaminoethyl (DEAE)-Sepharose or DIAION HPA-75 (manufactured by Mitsubishi Chemical Corp.), cation exchange chromatography using a resin such as S-Sepharose FF (manufactured by Pharmacia), hydrophobic chromatography using a resin such as butyl-Sepharose or phenyl-Sepharose, gel filtration using a molecular sieve, affinity chromatography, chromatofocusing, and electrophoresis such as isoelectric focusing electrophoresis.
[0129] When the desired protein is expressed in an insoluble form in cells, the cells are recovered and then disrupted in the same manner as above, and centrifuged to recover the insoluble form of the protein as a precipitated fraction. The recovered insoluble form of the protein is solubilized with a protein denaturant. The solubilized solution is diluted or dialyzed so that the protein restores its normal conformation. Then, a purified polypeptide preparation can be obtained by the same isolation or purification methods as above.
[0130] When the desired protein or its derivative such as a sugar-modified form is secreted outside cells, the protein or its derivative such as a sugar-modified form can be recovered in a culture supernatant. The culture product is treated by an approach such as centrifugation in the same manner as above to obtain a soluble fraction. From the soluble fraction, a purified preparation can be obtained by use of the same isolation or purification methods as above.
5. Nonhuman Animal Carrying Expression Vector of Present Invention
[0131] The present invention further provides a nonhuman animal carrying the expression vector of the present invention. In the present specification, the term nonhuman animal includes, but not limited to, mammals, for example, primates, except for humans, such as monkeys and chimpanzees, rodents such as mice, rats, hamsters, and guinea pigs, and ungulates such as bovines, pigs, sheep, goats, horses, and camelids.
[0132] In the preparation of the nonhuman animal, the nonhuman animal can be obtained, for example, by transferring the expression vector to ES cells or iPS cells, injecting the cells into early embryo, transplanting the embryo into the uterus of a surrogate mother, and allowing the surrogate mother to give birth. Hereinafter, the preparation method will be described.
[0133] The ES cells can be established and maintained by isolating an inner cell mass from a blastocyst of a fertilized egg of an animal of interest and using mitomycin C-treated mouse embryonic fibroblast cells as a feeder (M. J. Evans and M. H. Kaufman, Nature 292:154-156 (1981)).
[0134] The iPS cells form colonies in approximately 3 to 5 weeks by introducing certain reprogramming factors (DNA or proteins) into somatic cells (including somatic stem cells), and culturing and subculturing the cells in an appropriate medium. A known combination of the reprogramming factors is, for example, a combination of Oct3/4, Sox2, Klf4, and c-Myc; a combination of Oct3/4, Sox2, and Klf4; a combination of Oct4, Sox2, Nanog, and Lin28; or a combination of Oct3/4, Sox2, Klf4, c-Myc, Nanog, and Lin28 (K. Takahashi and S. Yamanaka, Cell 126:663-676 (2006); WO2007/069666; M. Nakagawa et al., Nat. Biotechnol. 26:101-106 (2008); K. Takahashi et al., Cell 131:861-872 (2007); J. Yu et al., Science 318:1917-1920 (2007); J. Liao et al., Cell Res. 18, 600-603 (2008)). Exemplary culture involves using a mitomycin C-treated mouse embryonic fibroblast cell line (e.g., STO) as feeder cells, and culturing somatic cells (approximately 10.sup.4 to 10.sup.5 cells/cm.sup.2) harboring the vector at a temperature of approximately 37 C. using a medium for an ES cell on the feeder cell layer. The feeder cells are not always necessary (Takahashi, K. et al., Cell 131, 861-872, (2007)). Examples of the basic medium include Dulbecco's modified Eagle's medium (DMEM), Ham's F-12 medium, and mixed media thereof. For example, a medium for a mouse ES cell or a medium for a primate ES cell (Reprocell Inc.) can be used as the medium for an ES cell.
[0135] The ES cells and the iPS cells are known to contribute to the germline transmission. Therefore, the nonhuman animal (or a transgenic nonhuman animal) can be prepared by an approach involving injecting these cells harboring the expression vector of the present invention comprising the DNA of interest to early embryo of the same mammalian species as that from which the cells are derived, transplanting the embryo into the uterus of a surrogate mother, and allowing the surrogate mother to give birth. In addition, a male and a female of the obtained transgenic animals can be crossbred with each other to prepare homozygous animals and further, their offsprings.
[0136] In the case of using the nonhuman animal to produce, for example, a protein of different species (e.g., a human protein) encoded by the DNA of interest, an animal in which an endogenous gene corresponding to the DNA of interest has been deleted or completely inactivated can be used.
6. Gene and Cell Therapy with Expression Vector of Present Invention
[0137] Gene therapy can be performed by administering the expression vector of the present invention to a mammal, particularly, a human, and causing a protein encoded by the DNA of interest to be expressed in the body of the mammal.
[0138] Gene and cell therapy can be performed by administering or transplanting mammalian cells, particularly, human cells harboring the expression vector of the present invention, or cells or tissues prepared by the differentiation of pluripotent stem cells such as human iPS cells harboring the vector, and causing a protein encoded by the DNA of interest to be expressed in the body of the mammal.
[0139] Specifically, it is expected that an effect of gene and cell therapy is obtained by administering or transplanting the expression vector of the present invention comprising a disease causative gene or a therapeutic gene as the DNA of interest, or cells or tissues harboring the expression vector to a patient. For example, to a patient having, for example, cancer, muscular dystrophy, hemophilia, a neurodegenerative disease, an autoimmune disease, an allergic disease, or a genetic disease, the expression vector of the present invention comprising a causative gene or a therapeutic gene of these diseases (for example, chimeric antigen receptor (CAR)) or cells or tissues harboring the expression vector is administered or transplanted to the patient. As a result, a therapeutic effect brought about by the transferred gene can be expected.
[0140] In Examples described below, HAC vector was constructed which had the promoter activation sequence of the present invention (2549 bp: SEQ ID NO: 1) at 5 upstream of a promoter (UBCP promoter, EF1 promoter, and PGK promoter) and had an indicator gene (red fluorescent protein gene or orange fluorescent protein) at 3 downstream of the promoter. The HAC vector was transferred to CHO cells or human mesenchymal cells, and the promoter activation sequence of the present invention was evaluated for its anti-silencing effect and activity manifestation enhancing effect with the expression of the indicator protein as an index. As a result, the promoter activation sequence of the present invention was demonstrated to actually have the anti-silencing effect and the activity manifestation enhancing effect.
EXAMPLES
[0141] The present invention will be described further specifically with reference to Examples described below. However, the technical scope of the present invention is not limited by these Examples.
[Example 1] Construction of Red Fluorescent Protein (mCherry) Expression Vector for Human Artificial Chromosome (HAC) Transfer
[0142] An additional sequence element was studied for its anti-silencing effect and activity enhancing effect on a generally used promoter in a CHO hprt-deficient (hprt-) cell line carrying HAC vector (21HAC2) (21HAC2/CHOhprt-; Kazuki Y et al., Gene Ther 18 (4): 384-93, 2011). 21HAC2/CHOhprt-is cotransfected with a vector obtained from I-EGFP-I-loxP-3HPRT vector (
1. Construction of pUms Vector
[0143] A fragment comprising HS4 (chicken insulator sequence element) and NotI/SalI/SpeI was amplified with the I-EGFP-I-loxP-3HPRT vector as a template. PCR reaction of 35 cycles each involving 98 C. for 10 seconds.fwdarw.68 C. for 4 minutes was performed using primers given below and Primestar GXL premix (Takara Bio Inc.). The I-EGFP-I-loxP-3HPRT vector was digested with restriction enzymes NcoI (NEB) and SpeI (NEB), and the amplified fragment was inserted thereto to prepare X3.1-MCS vector (
TABLE-US-00003 HS4-F2: (SEQIDNo.3) 5-ATCCATGGATCGACTCTAGAGGGACAGCC-3 HS4-R1: (SEQIDNo.4) 5-ATAACTAGTCGACGCGGCCGCCTCACTGACTCCGTCCTGGA-3
2. Construction of mCherry Expression Vector with Genomic Sequence Upstream of UbC Gene Added to pUms Vector
[0144] Vectors for HAC transfer having an expression unit of UbCP/mCherry gene/SV40 polyA sequence to which a region of approximately 2.5 kb (
TABLE-US-00004 pUL0.8ms-F: (SEQIDNo.5) 5-CATGTCGACCCAGAGACAACCACAGAACC-3 pUL0.8ms-R: (SEQIDNo.6) 5-AGTGGTACCCGCACGCAGTCCCTGCTGAA-3 pUL2.5ms-F: (SEQIDNo.7) 5-CATGTCGACACCCGGAAGGCGGAGGTTAC-3 pUL2.5ms-R: (SEQIDNO.8) 5-AGTGGTACCAGGAAGTTCAGGAAATTGGC-3
3. Construction of pSUL15 ms Vector
[0145] A vector for HAC transfer having an expression unit of UbCP/mCherry gene/SV40 polyA sequence with UL15 added was prepared by the following procedures. pSTV28 vector (Takara Bio Inc.) was digested with EcoRI and XbaI, and a DNA fragment comprising AscI and SmaI sites prepared by the annealing of the following synthetic DNA sequences was inserted thereto to prepare pSTV28+MCS vector (
TABLE-US-00005 pSTV28-MCS_1: (SEQIDNo.9) 5-CTAGACCCGGGATTGGCGCGCCG-3 pSTV28-MCS_2: (SEQIDNO.10) 5-AATTCGGCGCGCCAATCCCGGGT-3
[0146] Vectors for HAC transfers having an expression unit of UbCP/mCherry gene/SV40 polyA sequence to which a region of approximately 4 kb proximal to a UBC gene coding region and a region of approximately 11 kb distal to the UBC gene coding region in a genomic sequence of approximately 15 kb (hereinafter, referred to as UL15) at 5 upstream of human UbC gene were added respectively, were prepared by the method as described in 2. (referred to as pUL4 ms vector and pUL11 ms vector, respectively). These two genomic sequences at 5 upstream of the human UbC gene were each prepared by PCR amplification with a human chromosomal BAC clone RP11-59202 as a template using primers given below. PCR reaction of 5 cycles each involving 98 C. for 10 seconds.fwdarw.72 C. for 10 minutes, 5 cycles each involving 98 C. for 10 seconds.fwdarw.70 C. for 10 minutes, and 30 cycles each involving 98 C. for 10 seconds.fwdarw.68 C. for 10 minutes was performed using primers given below and Primestar GXL premix (Takara Bio Inc.). The amplified fragment was further digested with SalI and KpnI, and the obtained fragment was cloned into the pUms vector digested with SalI and KpnI.
TABLE-US-00006 pUL4ms-F: (SEQIDNo.11) 5-ACTGGTACCATCGATTCAGCCAGGCACATTAGCTC-3 pUL4ms-R: (SEQIDNo.12) 5-GAGGTCGACCGGGAGCGGGTGGGCGGCCC-3 pUL11ms-F: (SEQIDNo.13) 5-TATGTCGACATCGATATACAGACATGAGCTAATGT-3 pUL11ms-F: (SEQIDNO.14) 5-AGTGGTACCAGGAAGTTCAGGAAATTGGC-3
[0147] A DNA fragment between the AscI and SmaI sites of the pSTV28+MCS vector was substituted by a DNA fragment between the ScaI and AscI sites comprising UL4-UbCP-mCherry-SV40 pA of the pUL4 ms vector to prepare pSTV-UL4-UbCP-mCherry-SV40 pA (
[Example 2] Study on Anti-Silencing Effect and Activity Enhancing Effect of Additional Sequence Element on UBCP-Mcherry Expression Unit in CHO Cell
[0148] The pUms vector or the pUL2.5 ms vector prepared in Example 1 was inserted to 21HAC2 vector in 21HAC2/CHOhprt-cells. The expression vector was transferred together with a recombinase (Cre) expression vector pBS185 (Kazuki Y et al., Gene Ther 18 (4): 384-93, 2011) to the 21HAC2/CHOhprt-cells carrying the 21HAC2 vector by the electrical pulse method using NEPA21 (Nepa Gene Co., Ltd., 150 V, 5.0 msec). After transfer by electrical pulse, the cells were inoculated to one 10 cm dish and 48 hours later, cultured in Ham's F12 medium containing 2% HAT (Sigma-Aldrich Co., LLC) and 10% FBS (Nichirei Corp.) to obtain HAT-resistant colonies. The obtained HAT-resistant cell populations were subjected to FACS analysis after 7 weeks from transfer and evaluated for the expression of the red fluorescent protein. The results are shown in
[Example 3] Study on Anti-Silencing Effect and Activity Enhancing Effect of Additional Sequence Element on UBCP-Mcherry Expression Unit in Human Mesenchymal Stem Cell
[0149] The pUms vector, the pUL0.8 ms vector, or the pUL2.5 ms vector prepared in Example 1 was inserted to 21HAC2 vector in a hprt-line of 21HAC2/human immortalized mesenchymal stem cells (Okamoto T et al., BBRC 295:354-361, 2002). The expression vector was transferred together with a recombinase (Cre) expression vector pBS185 (Kazuki Y et al., Gene Ther 18 (4): 384-93, 2011) to the 21HAC2/hiMSChprt-cells carrying the 21HAC2 vector by the electrical pulse method using NEPA21 (Nepa Gene Co., Ltd., 150 V, 5.0 msec). After transfer by electrical pulse, the cells were inoculated to a 10 cm dish and 48 hours later, cultured in DMEM medium containing 2% HAT (Sigma-Aldrich Co., LLC) and 10% FBS (Nichirei Corp.) to obtain HAT-resistant colonies. The obtained HAT-resistant cells were subjected to microscopic observation of the expression of the red fluorescent protein after 2 weeks from transfer. The results are shown in
[Example 4] Construction of Orange Fluorescent Protein (Kusabira Orange: KO) Expression Vector for Human Artificial Chromosome (HAC) Transfer
[0150] C31 attB-NeoR-pUbc-KO1 vector (described in Kazuki Y et al., Molecular Therapy: Nucleic Acids 23:629-639, 2021) comprises an expression unit composed of human ubiquitin C core promoter (approximately 1.2 kb; Schorpp M et al., Nucleic Acids Res. 24 (9): 1787-1788, 1996), a coding region of orange fluorescent protein KO (MBL) gene, and a bovine growth hormone gene-derived polyA sequence. Basal-HAC/CHO cells are cotransfected with the vector and a C31 integrase expression vector (Kazuki Y et al., Molecular Therapy: Nucleic Acids 23:629-639, 2021) to obtain G418-resistant clones with one copy of the expression unit inserted in Basal-HAC (Kazuki Y et al., Molecular Therapy: Nucleic Acids 23:629-639, 2021).
[0151] First, the C31 attB-NeoR-pUbc-KO1 vector was blunt-ended by digestion with KpnI and self-ligated to prepare C31 attB-NeoR-pUbc-KO1 (KpnI-) vector (
TABLE-US-00007 Fw.XhoI-KpnI-SalI: (SEQIDNo.15) 5-TCGAGAGTCGGTACCATGCG-3 XhoI-KpnI-SalI: (SEQIDNO.16) 5-TCGACGCATGGTACCGACTC-3
[0152] A vector with a genomic sequence of approximately 2.5 kb at 5 upstream of human UbC gene added to UBCP of the pUL vector was further constructed in the same manner as in Example 1 (
[0153] A DNA fragment between the PvuI and SacI sites of the pSTV28+MCS vector prepared in Example 1 was substituted by a DNA fragment between the PvuI and SacI sites comprising UbC-KO-BGHpA of the pUL vector to prepare pSTV-UbC-hKO-BGHpA vector (hereinafter, referred to as pSUkb vector;
[Example 5] Study on Anti-Silencing Effect and Activity Enhancing Effect of Additional Sequence Element on UBCP-KO Expression Unit in CHO Cell
[0154] The pUL vector, the pUL2.5 vector, or the pSUL15 vector prepared in Example 4 was inserted to Basal-HAC vector in Basal-HAC/CHO cells. The expression vector was transferred together with a recombinase (C31 integrase) expression vector (Kazuki Y et al., Molecular Therapy: Nucleic Acids 23:629-639, 2021) to the Basal-HAC/CHO cells by the electrical pulse method using NEPA21 (Nepa Gene Co., Ltd., 150 V, 5.0 msec). After transfer by electrical pulse, the cells were inoculated to a 96-well plate and 48 hours later, cultured in Ham's F12 medium containing G418 (FUJIFILM Wako Pure Chemical Corp.) and 10% FBS (Nichirei Corp.), and G418-resistant colonies were isolated and expansion-cultured. Five or more clones were selected for each vector, subjected to FACS analysis, and evaluated for the expression of the orange fluorescent protein. The results are shown in
[Example 6] Study on Anti-Silencing Effect and Activity Enhancing Effect of Additional Sequence Element on UBCP-KO Expression Unit in Human iPS Cell
[0155] The pUL vector or the pUL2.5 vector prepared in Example 4 was inserted to Basal-HAC vector in Basal-HAC/human iPS cells (Kazuki Y et al., Molecular Therapy: Nucleic Acids 23:629-639, 2021). The expression vector was transferred together with a recombinase (C31 integrase) expression vector (Kazuki Y et al., Molecular Therapy: Nucleic Acids 23:629-639, 2021) to the Basal-HAC/human iPS cells by the electrical pulse method. After transfer by electrical pulse, the cells were inoculated to a 96-well plate and 48 hours later, cultured in StemFit medium (Takara Bio Inc.) containing G418 (90 g/mL), and G418-resistant colonies were isolated and expansion-cultured. 12 or more single clones were selected for each vector, subjected to FACS analysis, and evaluated for the expression of the orange fluorescent protein Kusabira Orange (KO). Results of evaluating KO fluorescence intensity in the clones harboring each vector are shown in
[Example 7] Construction of mCherry Expression Vector Using EFIA Promoter with Genomic Sequence Upstream of UbC Gene Added
[0156] An expression unit composed of human elongation factor 11 (EF1) gene promoter (EF1AP; approximately 1.2 kb; Qin JY et al., PLOS One. 5 (5): e10611 2010), a coding region of red fluorescent protein mCherry gene, and a SV40 polyA sequence was designed such that NotI sites were located at both ends thereof. The resulting sequence was synthesized at VectorBuilder Inc. An EFIA-mCherry-SV40 pA sequence (NotI fragment) derived from the synthetic DNA was inserted to the X3.1-MCS vector digested with NotI in the same manner as in Example 1 to prepare X3.1-EF1A-mCherry-SV40 pA (hereinafter, referred to as pEFms vector;
[Example 8] Study on Anti-Silencing Effect and Activity Enhancing Effect of Additional Sequence Element on EF1AP-Mcherry Expression Unit in CHO Cell
[0157] The pEFms vector or the pEF2.5 ms vector prepared in Example 7 was inserted to 21HAC2 vector in 21HAC2/CHOhprt-cells. The expression vector was transferred together with a recombinase (Cre) expression vector pBS185 (Kazuki Y et al., Gene Ther 18 (4): 384-93, 2011) to the 21HAC2/CHOhprt-cells carrying the 21HAC2 vector by the electrical pulse method using NEPA21 (Nepa Gene Co., Ltd., 150 V, 5.0 msec). After transfer by electrical pulse, the cells were inoculated to one 10 cm dish and 48 hours later, cultured in Ham's F12 medium containing 2% HAT (Sigma-Aldrich Co., LLC) and 10% FBS (Nichirei Corp.) to obtain HAT-resistant colonies. The obtained HAT-resistant cell populations were subjected to FACS analysis after 4 weeks and 7 weeks from transfer and evaluated for the expression of the red fluorescent protein. The results are shown in
[Example 9] Construction of mCherry Expression Vector Using PGK Promoter with Genomic Sequence Upstream of UbC Gene Added
[0158] An expression unit composed of human phosphoglycerate kinase 1 (PGK) gene promoter (PGKP; approximately 0.5 kb; Kita-Matsuo H et al., PLOS One. 4 (4): e5046. 2009), a coding region of red fluorescent protein mCherry gene, and a SV40 poly A sequence was designed such that NotI sites were located at both ends thereof. The resulting sequence was synthesized at VectorBuilder Inc. A PGKP-mCherry-SV40 pA sequence (NotI fragment) derived from the synthetic DNA was inserted to the X3.1-MCS vector digested with NotI in the same manner as in Example 1 to prepare X3.1-PGKP-mCherry-SV40 pA (hereinafter, referred to as pPGKms vector;
[Example 10] Study on Anti-Silencing Effect and Activity Enhancing Effect of Additional Sequence Element on PGKP-Mcherry Expression Unit in CHO Cell
[0159] The pPGKms vector, the pPGK2.5 ms vector, or the pPGK4 ms vector prepared in Example 9 was inserted to 21HAC2 vector in 21HAC2/CHOhprt-cells. The expression vector was transferred together with a recombinase (Cre) expression vector pBS185 (Kazuki Y et al., Gene Ther 18 (4): 384-93, 2011) to the 21HAC2/CHOhprt-cells carrying the 21HAC2 vector by the electrical pulse method using NEPA21 (Nepa Gene Co., Ltd., 150 V, 5.0 msec). After transfer by electrical pulse, the cells were inoculated to one 10 cm dish and 48 hours later, cultured in Ham's F12 medium containing 2% HAT (Sigma-Aldrich Co., LLC) and 10% FBS (Nichirei Corp.) to obtain HAT-resistant colonies. The obtained HAT-resistant cell populations were subjected to FACS analysis after 4 weeks and 7 weeks from transfer and evaluated for the expression of the red fluorescent protein. The results are shown in
[Example 11] Study on Anti-Silencing Effect and Activity Enhancing Effect of Additional Sequence Element on PGKP-Mcherry Expression Unit in Human Mesenchymal Stem Cell
[0160] The pPGKms vector or the pPGK2.5 ms vector prepared in Example 9 was inserted to 21HAC2 vector in 21HAC2/CHOhprt-cells. The expression vector was transferred together with a recombinase (Cre) expression vector pBS185 (Kazuki Y et al., Gene Ther 18 (4): 384-93, 2011) to the 21HAC2/hiMSChprt-cells carrying the 21HAC2 vector by the electrical pulse method using NEPA21 (Nepa Gene Co., Ltd., 150 V, 5.0 msec). After transfer by electrical pulse, the cells were inoculated to a 10 cm dish and 48 hours later, cultured in DMEM medium containing 2% HAT (Sigma-Aldrich Co., LLC) and 10% FBS (Nichirei Corp.) to obtain HAT-resistant colonies. The obtained HAT-resistant cell populations were subjected to FACS analysis after 4 weeks from transfer and evaluated for the expression of the red fluorescent protein. The results are shown in
[Example 12] Construction of mCherry Expression Vector for Random Insertion with Genomic Sequence Upstream of UbC Gene Added
[0161] A vector for random insertion having an expression unit of UbCP/mCherry-NeoR (neomycin-resistant) fusion gene/SV40 polyA sequence to which a region of approximately 2.5 kb (
[0162] A fragment with SpeI and FseI sites added to both ends of mCherry-NeoR was amplified by PCR with mCherry_NeoR-CMV_Luciferase vector synthesized at VectorBuilder Inc. as a template using primers described below. PCR reaction of 35 cycles each involving 98 C. for 10 seconds.fwdarw.60 C. for 5 seconds.fwdarw.68 C. for 5 seconds was performed using primers described below and KOD One PCR Master Mix (Toyobo Co., Ltd.). The pUL2.5 ms vector prepared in (Example 1) was digested with SpeI and FseI, and the mCherry-NeoR amplified fragment digested with SpeI and FseI was inserted thereto to prepare pUL2.5mNs vector. The configuration of the pUL2.5mNs vector is summarized in
TABLE-US-00008 SpeI_mCherryFw: (SEQIDNo.17) 5-TAGACTAGTAAATTGTCCGCTAAATTCTGGCCGTTTTTGGCTTTTT TGTTAGACAATGGTGAGCAAGGGCGAGGAGGA-3 FseI_NeoRRv: (SEQIDNO.18) 5-CTTAGGCCGGCCACTCGAGTCAGAAGAACTCGTCAAGAAGGCG-3
[0163] pUmNs vector obtained by the deletion of the region of approximately 2.5 kb from the pUL2.5mNs vector was prepared by digesting the pUL2.5mNs vector with SalI and KpnI, followed by blunt ending using Blunting Kit (Takara Bio Inc.). The structure of the pUmNs vector is summarized in
[Example 13] Study on Anti-Silencing Effect and Activity Enhancing Effect of Additional Sequence Element on UbCP-mCherry-NeoR Expression Unit in Gene Transfer by Random Insertion to CHO
[0164] The pUmNs vector or the pUL2.5mNs vector prepared in Example 12 was transferred to 21HAC2/CHOhprt-cells. Unlike Example 2, etc., a recombinase (Cre) expression vector was not transferred at the same time therewith. This produces neomycin (G418) resistance when the transferred vector is randomly inserted to the genome of CHO cells. The vector was digested with a restriction enzyme ScaI, then recovered by the ethanol precipitation method, and transferred to 21HAC2/CHOhprt-by the electrical pulse method using NEPA21 (Nepa Gene Co., Ltd., 150 V, 5.0 msec). After transfer by electrical pulse, the cells were inoculated to two 10 cm dishes and 48 hours later, cultured in Ham's F12 medium containing 800 g/mL G418 (FUJIFILM Wako Pure Chemical Corp.) and 10% FBS (Nichirei Corp.) to obtain drug-resistant colonies. A mixed cell population of the obtained drug-resistant colonies was subjected to FACS analysis after 2 weeks from transfer, and red fluorescence intensity was compared. The results are shown in
[Example 14] Study on Anti-Silencing Effect and Activity Enhancing Effect of Additional Sequence Element on UbCP-mCherry-NeoR Expression Unit in Gene Transfer by Random Insertion to Human iPS Cell
[0165] The pUmNs vector or the pUL2.5mNs vector prepared in Example 12 was transferred to human iPS cells (201B7: Riken Cell Bank No. HPS0063). Unlike Example 2, etc., a recombinase (Cre) expression vector was not transferred at the same time therewith. This produces neomycin (G418) resistance when the transferred vector is randomly inserted to the genome of CHO cells. The vector was digested with a restriction enzyme ScaI, then recovered by the ethanol precipitation method, and transferred to 201B7 by the electrical pulse method using NEPA21 (Nepa Gene Co., Ltd., 175 V, 2.5 msec). After transfer by electrical pulse, the cells were inoculated to two 10 cm dishes and 48 hours later, cultured in StemFit medium (Takara Bio Inc.) containing 70 g/mL G418 (FUJIFILM Wako Pure Chemical Corp.) to obtain drug-resistant colonies. One of the 10 cm dishes was treated with methanol for 15 minutes after 7 days from transfer, and stained with CBB staining solution (0.25% CBB/10% ethanol/40% methanol) for 15 minutes. The 10 cm dish thus stained was photographed, and the number of colonies was measured and compared. As a result, the rate of appearance of drug-resistant colonies was increased owing to the anti-silencing effect and the activity enhancing effect of the fragment of 2.5 kb on UBCP (
[Example 15] Construction of mCherry Expression Vector for Random Insertion Using EFIA Promoter with Genomic Sequence Upstream of UbC Gene Added
[0166] The vector for HAC transfer comprising an expression unit of EF1AP/red fluorescent protein mCherry gene coding region/SV40 polyA sequence (pEFms vector; the top vector of
[Example 16] Study on Anti-Silencing Effect and Activity Enhancing Effect of Additional Sequence Element on EF1A-mCherry-NeoR Expression Unit in Gene Transfer by Random Insertion to CHO Cell
[0167] The pEFmNs vector or the pEF2.5mNs vector prepared in Example 15 was transferred to 21HAC2/CHOhprt-cells in the same manner as in Example 13. Unlike Example 2, etc., a recombinase (Cre) expression vector was not transferred at the same time therewith. This produces neomycin (G418) resistance when the transferred vector is randomly inserted to the genome of CHO cells. The vector was digested with a restriction enzyme ScaI, then recovered by the ethanol precipitation method, and transferred to, 21HAC2/CHOhprt-by the electrical pulse method using NEPA21 (Nepa Gene Co., Ltd., 150 V, 5.0 msec). After transfer by electrical pulse, the cells were inoculated to two 10 cm dishes and 48 hours later, cultured in Ham's F12 medium containing 800 g/mL G418 (FUJIFILM Wako Pure Chemical Corp.) and 10% FBS (Nichirei Corp.) to obtain drug-resistant colonies. A mixed cell population of the obtained drug-resistant colonies was subjected to FACS analysis after 4 weeks from transfer, and red fluorescence intensity was compared. The results are shown in
INDUSTRIAL APPLICABILITY
[0168] A mammalian cell, having an expression vector of the present invention comprising a promoter activation sequence, a promoter, and a DNA of interest, is prepared. The mammalian cell is useful for the purpose of stably and efficiently production of a protein encoded by the DNA of interest in the mammalian cell.
Free Text of Sequence Listing
[0169] SEQ ID NOs: 3 to 8: Primer [0170] SEQ ID NOs: 9 and 10: Annealing sequence for preparing a DNA fragment comprising an AscI site and a SmaI site [0171] SEQ ID NOs: 11 to 14: Primer [0172] SEQ ID NOs: 15 and 16: Annealing sequence for preparing a DNA fragment comprising a SalI site and a KpnI site [0173] SEQ ID NOs: 17 and 18: Primer
[0174] All publications, patents, and patent applications cited herein are incorporated herein by reference in their entirety.