TAG PROTEIN FOR INCREASING WATER SOLUBILITY AND HEAT STABILITY OF TARGET PROTEIN, AND FUSION PROTEIN COMPRISING SAME
20220340628 · 2022-10-27
Assignee
Inventors
- Dae-Hyuk KWEON (Suwon-si, Gyeonggi-do, KR)
- Yun-Jeong PARK (Suwon-si, Gyeonggi-do, KR)
- Ki-Jun JEONG (Daejeon, KR)
- Yoon-Jin BAE (Hwaseong-si, Gyeonggi-do, KR)
Cpc classification
C12Y204/01214
CHEMISTRY; METALLURGY
C12N9/0073
CHEMISTRY; METALLURGY
C07K2319/80
CHEMISTRY; METALLURGY
C07K2319/74
CHEMISTRY; METALLURGY
C12Y204/01069
CHEMISTRY; METALLURGY
C12N15/63
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to a fusion protein in which a target protein and an Oct-1 protein-containing protein tag are linked, an expression structure comprising a nucleotide sequence encoding same, a recombinant vector including same, and a transformed cell including same.
Claims
1. A fusion protein comprising: a target protein; and a protein tag linked to the target protein, the protein tag comprising an octameric transcription factor-1 (Oct-1) protein.
2. The fusion protein according to claim 1, wherein the Oct-1 protein is encoded by a nucleotide sequence set forth in SEQ ID NO: 1.
3. The fusion protein according to claim 1, wherein the protein tag is linked to an amino terminus or a carboxyl terminus of the target protein.
4. The fusion protein according to claim 1, wherein the target protein comprises at least one selected from the group consisting of an antigen, an antibody, a cell receptor, an enzyme protein, a structural protein, serum and a cellular protein.
5. The fusion protein according to claim 4, wherein the enzyme protein is selected from fucose transferases, Baeyer-Villiger monooxygenases (BVMOs), and combinations thereof.
6. The fusion protein according to claim 4, wherein the antigen is selected from hemagglutinin (HA), neuraminidase (NA), and combinations thereof.
7. An expression construct comprising a nucleotide sequence encoding the fusion protein according to claim 1.
8. A recombinant vector comprising the expression construct according to claim 7.
9. The recombinant vector according to claim 8, not comprising a binding sequence of Oct-1.
10. A transformed cell comprising the recombinant vector according to claim 8.
11. The transformed cell according to claim 10, wherein the cell is a microbial cell of genus Escherichia, Mannheimia, Rhodobacter, or Methylobacterium.
Description
DESCRIPTION OF DRAWINGS
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
BEST MODE
[0028] Hereinafter, embodiments of the present invention will be described in detail with reference to the accompanying drawings such that they can be easily implemented by those skilled in the art. However, the present invention may be implemented in several different forms and is not limited to the embodiments described herein. Also, parts not related to the description are omitted from the drawings for clear description of the present invention.
[0029] As used throughout this specification, it will be understood that, when a part is referred to as “comprising” an element, the term permits the presence of other elements, and does not preclude the presence or addition of such other elements unless otherwise defined.
[0030] As used herein, the terms “about or approximately” or “substantially” are intended to have meanings close to numerical values or ranges specified with an allowable error in production and substances and intended to prevent accurate or absolute numerical values disclosed for understanding of the present invention from being illegally or unfairly used by any unconscionable third party. As used throughout this specification, the terms “˜˜ step” or “step of ˜” does not mean “step for”.
[0031] As used herein, the term “combination (s) thereof” included in the expression of the Markush form means a mixture or combination of one or more selected from the group consisting of the elements described in the expression of the Markush form, and is meant to include one or more selected from the group consisting of the elements.
[0032] As used herein, the expression “A and/or B” encompasses both “A or B” and “A and B”.
[0033] As used herein, the term “nucleotide” or “polynucleotide” refers to a nucleic acid, preferably DNA or RNA.
[0034] As used herein, the term “vector” means a DNA product containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing the DNA in a suitable host. Vectors may be plasmids, phage particles or simply potential genomic inserts. When transformed into suitable hosts, vectors may be replicated or perform functions independent of the host genomes, or some thereof may be integrated with the genomes. Plasmids are currently the most commonly used forms of vector. Therefore, as used herein, the terms “plasmid” and “vector” are often used interchangeably.
[0035] As used herein, the term “recombinant plasmid” refers to a recombinant vector capable of expressing a target protein in an appropriate host cell, and is a type of expression vector including essential regulatory elements operably linked so as to express the inserted recombinant gene. The recombinant plasmid may include, as elements contained in a conventional recombinant plasmid, expression regulatory elements such as promoters, operators, start codons, and stop codons, and the start codons and stop codons are generally considered to be parts of nucleotide sequences encoding polypeptides. The recombinant plasmid must have activity when introduced into host cells and must be in frame with the coding sequence. The promoter of the vector may be constitutive or inducible.
[0036] Hereinafter, the fusion protein, the expression construct, the recombinant vector, and the transformed cell according to the present invention will be described in detail with reference to the embodiments, examples, and drawings. However, the present invention is not limited to these embodiments, examples, and drawings.
[0037] In a first aspect, the present invention is directed to a fusion protein including a target protein and a protein tag linked to the target protein and containing an octameric transcription factor-1 (Oct-1) protein.
[0038] The fusion protein of the present invention may include a target protein, and Oct-1, which is a protein tag that is fused with the target protein to increase soluble and active expression of the target protein, thus being useful for mass production of useful substances through protein production and metabolic engineering technology. Specifically, in the present invention, by expressing octameric transcription factor-protein of interest (Oct-1-POI) or protein of interest-octameric transcription factor-1 (POI-Oct-1), which is the fusion protein of the target protein and the oct-1 protein tag, the active-form expression of the fusion protein is increased.
[0039] According to the present invention, the fusion protein in which Oct-1 is linked to the target protein is expressed in a soluble form in cells to be used for the production of a soluble target protein, and is expressed in an active form in cells to improve the efficiency upon mass production of useful substances through a whole-cell catalytic reaction and to enhance the yield of high value-added products.
[0040] In addition, the fusion protein according to the present invention can bind to a plasmid in a stable state in the cytoplasm where the biotransformation reaction occurs to form an intracellular immobilized enzyme using the plasmid as an immobilization carrier and thus efficiently increase product yield when applied to enzymes used for biotransformation. For example, compared to a target protein to which no protein tag is bound, the fusion protein according to the present invention can increase product yield by about 50% or more, about 100% or more, about 200% or more, about 300% or more, or about 400% or more.
[0041] In addition, the present invention may provide an intracellular immobilized enzyme system (IIES), which is a multi-purpose platform developed for intracellular protein stabilization. IIES forms a plasmid-protein complex under the influence of the DNA-binding protein and the binding sequence on the plasmid. A plasmid is known to be stable in cells, so the enzyme can be stabilized in the cytoplasm, like an immobilized enzyme bound to a solid surface, when used as an immobilization carrier.
[0042] When IIES is applied to prepare a whole-cell biocatalyst through metabolic engineering, the fusion protein of the present invention can substantially increase the productivity of high-addition products. In the examples of the present invention, increased production of 2′-fucosyllactose and 3′-fucosyllactose was observed. Accordingly, the plasmid-protein complex formed according to the production of the fusion protein of the present invention forms an immobilized enzyme, and the plasmid construct can act as an intracellular immobilization carrier.
[0043] According to one embodiment of the present invention, the Oct-1 protein may be encoded by the nucleotide sequence set forth in SEQ ID NO: 1, but is not limited thereto, and the Oct-1 protein may include mutations, such as insertions, deletions, substitutions, additions, and translocations, which do not substantially affect the function of the fusion protein of the present invention. For example, the Oct-1 protein may be derived from a human, but is not limited thereto.
[0044] According to one embodiment of the present invention, the protein tag may be linked to the amino terminus or the carboxyl terminus of the target protein, but is not limited thereto. That is, even when the protein tag is linked either to the amino terminus or to the carboxyl terminus of the target protein, the solubility and/or thermal stability of the fusion protein can be improved due to the protein tag.
[0045] In one embodiment of the present invention, the target protein may include at least one selected from the group consisting of antigens, antibodies, cell receptors, enzyme proteins, structural proteins, serum and cellular proteins, but is not limited thereto.
[0046] In one embodiment of the present invention, the enzyme protein may be selected from fucose transferase, Baeyer-Villiger monooxygenases (BVMOs), and combinations thereof, but is not limited thereto.
[0047] In one embodiment of the present invention, the antigen may be selected from hemagglutinin (HA), neuraminidase (NA), and combinations thereof, which are surface antigen proteins in the envelope of influenza virus, but is not limited thereto.
[0048] As used herein, the term “surface antigen”, which is interchangeable with “cellular membrane antigen”, refers to a membrane-bound protein present in the membrane of a cell. In the present invention, “surface antigen” may be interpreted to mean a membrane-bound protein linked to a lipid bilayer of a virus having a lipid bilayer envelope, but the surface antigen is not particularly limited thereto, and may be, for example, hemagglutinin (HA), neuraminidase (neuraminidase; NA), or the like, which is an influenza virus of the surface antigen. As used herein, the term “hemagglutinin (HA)” refers to a transmembrane protein that is a type of surface antigen of the influenza virus and is composed of an HA1 subunit and an HA2 subunit that can be cleaved by trypsin. It is known that the HA1 subunit binds to sialic acid, whereas the HA2 subunit induces cell membrane fusion under low pH conditions.
[0049] For example, the fucose transferase may include, but is not limited to, a 1,2′-fucose transferase encoded by the nucleotide sequence of SEQ ID NO: 2 and/or a 1,3′-fucose transferase encoded by the nucleotide sequence of SEQ ID NO: 3. For example, the Baeyer-Villiger monooxygenases (BVMOs) may be one encoded by the nucleotide sequence of SEQ ID NO: 4, but is not limited thereto. For example, the hemagglutinin may be represented by the amino acid sequence of SEQ ID NO: 5 or encoded by the nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 5, but is not limited thereto.
[0050] When a fusion protein using, as a target protein, a fucose transferase, for example, 1,2′-fucose transferase or 1,3′-fucose transferase, is expressed in a host cell, 1,2′-fucose transferase or 1,3′-fucose transferase is produced using lactose as a carbon source. The products, 2′-fucosyllactose and 3′-fucosyllactose, are the main components of human milk oligosaccharides, and are useful as functional substances having a prebiotic effect and an effect of preventing pathogenic infection.
[0051] When a fusion protein using hemagglutinin as a target protein is expressed in a host cell such as Escherichia coli, it can be useful for the development of influenza drugs or vaccines and research on the molecular mechanism of influenza infection.
[0052] The fusion protein of the present invention does not necessarily require a DNA-binding sequence present outside the Oct-1 sequence in order to exhibit the functions thereof. Specifically, as described above, the fusion protein of the present invention uses the plasmid as an immobilization carrier by forming a plasmid-protein complex. It is generally known that an Oct-1 binding sequence (BS) is required in order to attach Oct-1 to plasmid DNA. However, the Oct-1 binding sequence is not essential in order to bind the fusion protein of the present invention to a plasmid to thereby form a complex, so the design, production and subsequent biotransformation of the fusion protein can be performed more easily.
[0053] In a second aspect, the present invention is directed to an expression construct including a nucleotide sequence encoding the fusion protein according to the first aspect. Details described relating to other aspects of the present invention may be equally applied to the second aspect of the present invention, unless otherwise specified.
[0054] In a third aspect, the present invention is directed to a recombinant vector including the expression construct according to the second aspect. Details described relating to other aspects of the present invention may be equally applied to the third aspect of the present invention, unless otherwise specified.
[0055] In one embodiment of the present invention, the recombinant vector may not include an Oct-1 binding sequence outside the Oct-1 gene, but is not limited thereto.
[0056] For example, the recombinant vector of the present invention may further include other nucleotide sequences that can contribute to the production of proteins expressing genes and having normal functions. For example, the nucleotide sequence that may be further included in the recombinant vector may include a nucleotide sequence encoding an enhancer and a polyA signal, and also a sequence encoding a tag for purifying the resulting fusion protein, for example, a histidine tag, but is not limited thereto.
[0057] In a fourth aspect, the present invention is directed to a transformed cell including the recombinant vector according to the third aspect. Details described relating to other aspects of the present invention may be equally applied to the fourth aspect of the present invention, unless otherwise specified.
[0058] As used herein, the term “transformation” refers to any action that causes genetically stable inheritance so that the expression construct or the recombinant vector can move into the genome of host cells to express the desired fusion protein. The transformation may be performed using any transformation method, and may be easily performed according to a conventional method known in the art. General transformation methods include CaCl.sub.2 precipitation, a Hanahan method, which is a CaCl.sub.2 method using a reducing material called “DMSO” (dimethyl sulfoxide) to increase efficiency, electroporation, calcium phosphate precipitation, protoplasmic fusion, agitation using silicon carbide fibers, agrobacterium-mediated transformation, transformation using PEG, and dextran sulfate, lipofectamine and drying/inhibition-mediated transformation.
[0059] The host cells to be transformed may be selected without limitation from among microorganisms, and may be microorganisms from a genus such as Escherichia, Mannheimia, Rhodobacter, or Methylobacterium, and are preferably E. coli, but are not limited thereto.
[0060] The cells may be cultured using any known culture method, such as batch culture, continuous culture, and fed-batch culture. Culture conditions suitable for the selected host cells may be easily adjusted by those skilled in the art, and the medium that is used herein should contain all nutrients essential for the growth and survival of the cells.
Mode For Invention
[0061] Hereinafter, the present invention will be described in more detail with reference to the following examples, but the scope of the present invention is not limited to the examples, and includes variations and technical concepts equivalent thereto.
EXAMPLE
Example 1: Construction of Recombinant Plasmid to Produce Fusion Protein
[0062] A recombinant plasmid was constructed for the preparation of the fusion protein. An E. coli Top10 strain was used as a strain for cloning, and a gene (set forth in SEQ ID NO: 2) encoding 1,2-fucosyltransferase (1,2′-FT) derived from Pedobacter saltans was used as a target gene used for constructing the recombinant plasmid. In addition, a human-derived octameric transcription factor-1 (Oct-1) gene (set forth in SEQ ID NO: 1) was used as a DNA-binding protein. In addition, for the construction of the recombinant plasmid, a gene (set forth in SEQ ID NO: 3) encoding 1,3′-fucosyltransferase (1,3-FT) derived from H. pylori or a gene (set forth in SEQ ID NO: 4) encoding Baeyer-Villiger monooxygenases (BVMOs) derived from Pseudomonas putida KT2440 was used. [72] A schematic diagram of a recombinant plasmid for expression of a fusion protein fused with an Oct-1 protein tag is shown in
Example 2: Expression of Fusion Protein in E. coli
[0063] E. coli BL21 (DE3) was used to express the fusion protein from the recombinant plasmid constructed in Example 1 above. 1,2-fucose transferase (1,2-FT), which is a type of fucose transferase derived from Pedobacter saltans (PS), was used as the POI.
[0064] A transformant obtained by transformation using the recombinant plasmid was incubated at 37° C. in an LB medium containing 50 μg/ml of kanamycin. When an OD.sub.600 reached 0.5, the transformant was added with 0.1 mM IPTG, and the culture product was further incubated at 25° C. for 4 hours.
[0065] For further analysis, the cells were collected by centrifugation at 7,000 rpm for 5 minutes and the cell precipitate was disrupted using Bugbuster reagent. Total cell lysate (T) was obtained from the disrupted cell solution and was centrifuged at 9,700 g for 10 minutes to obtain a soluble cell lysate (S) from the supernatant. Then, the fusion protein expressed from the recombinant plasmid was analyzed using 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (
[0066]
Example 3: Application to Biotransformation of Fusion Protein Bound with Protein Tag
[0067] For application of the fusion protein expressed by the recombinant plasmid constructed in Example 1 to biotransformation, dLM15 strain E. coli ΔL M15 from which lacZ was deleted was transformed. As the POI, a 1,2-fucose transferase (1,2-FT) gene, which is a type of fucose transferase (PS), was used. 1,2-FT uses lactose as a substrate in transformants to yield 2′-fucosyllactose (2-FL) as a product (Y. W. Chin et al., Journal of Biotechnology, 210, 2015, pp 107-115).
[0068] The transformant was incubated at 37° C. in 10 mL of LB medium containing 50 μg/ml of kanamycin. For the main culture, LB was removed at a constant OD.sub.600 and the culture was inoculated into 50 mL of R-medium containing an appropriate amount of antibiotics. When OD.sub.600 reached 0.5, 0.1 mM IPTG and 5 g/L lactose were added thereto, and the culture solution was further incubated at 25° C. or 30° C. and 200 rpm for 84 hours. The cultures were collected at 12-hour intervals for HPLC analysis, and cell concentration was measured using a UV spectrophotometer. For analysis samples, the supernatant was used alone after the cells were removed by centrifugation from the culture.
Example 4: Effect of Fusion Protein Bound with Protein Tag on Improvement of Thermal Stability
[0069]
[0070] E. coli BL21 (DE3) was used to express the fusion protein from the recombinant plasmid. A 1,2-FT gene was used as the POI. A transformant obtained by transformation with the recombinant plasmid was incubated at 25° C. in LB medium containing 50 μg/ml of kanamycin. When the OD.sub.600 reached 0.5, the transformant was added with 0.1 mM IPTG, and the culture product was further incubated at 25° C. for 28 hours.
[0071] In
Example 5: Identification of Necessity for DNA-Binding Sequence
[0072]
[0073] The fusion protein was purified using the histidine tag, and the protein for the histidine tag was identified using western blot (C of
Example 6: Analysis of Production of Fucosyllactose Through HPLC
[0074] The production (yield) of 2′-fucosyllactose (referred to as “2-FL”), which is a product from the culture, after biotransformation using a plasmid recombined with 1,2-FT (referred to as “PS”) and Oct-1 and fermenting the transformant at 25° C., was analyzed by HPLC. The result is shown in
[0075]
Example 7: Analysis of Production of Fucosyllactose Through HPLC
[0076] The production (yield) of 3′-fucosyllactose (referred to as “3-FL”), which is a product from the culture, after biotransformation using a plasmid recombined with 1,3-FT (referred to as “FT1-1”) and Oct-1 and fermenting the transformant at 25° C., was analyzed by HPLC. The result is shown in
[0077]
Example 8: Analysis of Ester Conversion Efficiency Using Baeyer-Villiger Monooxygenase
[0078]
[0079] Specifically, the transformed microorganism was inoculated into 50 mL R-medium containing antibiotics, and was incubated at 25° C. in a culture medium supplemented with 0.1 mM IPTG when OD.sub.600 reached 5. Protein expression was allowed to occur for 2 hours, the pH was adjusted to 8 using KOH, and 10 mM ricinoleic acid was added. During incubation at 35° C., culture samples were collected at 2-hour intervals over a total of 8 hours, and three substances, namely, ricinoleic acid, ester, and keto-oleic acid, were analyzed through gas chromatography.
[0080] BVMO is an enzyme used to convert ricinoleic acid to ester. Low efficiency causes accumulation of keto. Compared to A in
Example 9: Analysis of Production of Fucosyllactose Through HPLC
[0081] E. coli ΔL M15 was transformed in the same manner as in Example 3, except that a vector into which no binding sequence (BS, 5′-ATGCAAAT-3′) was inserted was used. Then, fucose transferase was used for biotransformation in the same manner as in Example 6, and the content of 2-FL present in the supernatant sample at 72 hours was analyzed through HPLC. The result of the analysis showed that the product yield was increased even in the absence of the binding sequence.
[0082] Example 10: Construction of Plasmid for Hemagglutinin Soluble Expression Using Oct1 Fusion
[0083] In order for hemagglutinin (HA), which is a membrane protein of influenza virus, to be expressed in a soluble state when binding to Oct1, a plasmid expressing A/PR8 influenza virus type A HA and a plasmid expressing Oct1 were used. Six histidine-Oct1-TEV protease cleavage site sequences were inserted before the sequence of the HA gene (the gene encoding the amino acid sequence set forth in SEQ ID NO: 5). Gene cloning was performed using overlap cloning, and the sequences of the primers used in the experiment are shown in Table 1 below. The structure of the final plasmid (Oct1-HA) is shown in
TABLE-US-00001 TABLE 1 SEQ. ID Primer Sequence NO. Insert Forward AGGAGATATACCATGCATCACCATCATCACCACATGGAGGAGC 6 (6xHis- Backward CAGTAGGTTTGCCTTGAATTCCGGGGATCCCAGGGGC 7 Oct1-TEV protease cleavage site) Vector Forward AAGGCAAACCTACTGGTCCTGTTATGTGCAC 8 (pET28b- Backward CATGGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGAGGGG 9 HA- 6XHis)
[0084] PCR was performed using primers designed such that, in the 6xHis-Oct1-TEV protease cleavage site in the pET-28b plasmid into which HA was inserted, 15 bp at the 3′ end of the pET-28b vector including the start codon was complementary to 15 bp at the 5′ end of the HA gene excluding the start codon behind the same. After completion of PCR, the result was treated with a Dpn1 solution at 37° C. for 1 hour to digest the methylated template (plasmid), and PCR products other than DNA were removed using a PCR preparation kit. Then, only the insert was treated with T4 kinase at 37° C. for 30 minutes for 5′ phosphorylation and then the PCR preparation kit was used once more. In order to ligate the vector (pET28b-HA-6xHis) to the insert (6xHis-Oct1-TEV protease cleavage site), treatment with T4 DNA polymerase, which functions as an exonuclease, was performed for 2 minutes and 30 seconds and treatment with ice was performed for 10 minutes to induce hydrogen bond between the vector and the inserts. 8 μl of the DNA solution obtained through the cloning process was added to 100 μl of the competent E. coli TOP 10 solution and the result was incubated on ice for 30 minutes and then heat-treated at 42° C. for 45 seconds. The reaction solution was added with 900 μl of LB (Luria-Bertani) liquid medium and was then cultured (at 37° C. for 1 hour), and the cells were collected by centrifugation (7,000 rpm, 5 minutes). The collected cell solution (0.1 ml) was seeded and cultured on kanamycin LB solid medium (at 37° C.), and one of colonies that formed was cultured in 10 ml LB liquid medium containing 0.1% kanamycin for 18 hours (at 37° C.). Cells were collected from the culture solution by centrifugation (4,000 rpm, 10 minutes), and the resulting plasmid was obtained using Plasmid DNA Miniprep Kits. The sequence of the plasmid was identified by a third party (Cosmo Jintech, Korea). The sequences of the primers used in the above process are shown in Table 1 above, and the detailed compositions and reaction conditions are shown in Table 2 below.
TABLE-US-00002 TABLE 2 PCR Distilled water 32.5 μl, 5× Phusion GC buffer 10 μl, composition 10 mM dNTPs 1 μl, 10 μM Forward Primer 2.5 μl, 10 μM Backward Primer 2.5 μl, Template DNA 1 μl, Phusion DNA Polymerase 0.5 μl VectorPCR Initial denaturation (98° C., 30 sec), 35 cycles: conditions denaturation (98° C., 10 sec) .fwdarw. annealing (61° C.,30 sec) .fwdarw. extension (72° C., 3 min), final extension (72° C., 10 min) InsertPCR Initial denaturation (98° C., 30 sec), 35 cycles: conditions denaturation (98° C., 10 sec) .fwdarw. annealing (61° C.,30 sec) .fwdarw. extension (72° C., 30 sec), final extension (72° C., 10 min) Dpn1 37° C., 1 hour, 5 μl (10× reaction buffer 4) + 44 μl treatment (vectoror insert PCR product) + 1 μl (Dpnl conditions solution) Ligation 1 μl (vector solution) + 7.5 μl (insert solution) + 1 μl (10× reaction buffer) + 1 μl (overlap cloner solution)
Example 11: Hemagglutinin Soluble Expression Test Using Oct1 Fusion
[0085] The constructed plasmid was transformed into BL21 (DE3) competent cells through a heat-shock method to perform a test to determine whether or not the protein was expressed. Colonies grown on a solid medium containing 50 μg/ml of kanamycin were inoculated into 10 ml of a liquid medium (terrific broth, TB medium) containing 50 μg/ml of kanamycin and incubated in a shaking incubator at 37° C. for 16 hours to prepare a cell stock containing 15% glycerol. 5 μl of the cell stock was inoculated into 5 ml of liquid medium (terrific broth, TB medium) containing 50 μg/ml of kanamycin and incubated in a shaking incubator at 37° C. for 15 hours, and the cell solution was secondarily inoculated into 25 mL of the same medium. When Escherichia coli grew to an OD.sub.600 of 0.4 to 0.6 in a shaking incubator at 37° C. and 180 rpm, it was treated with 1 mM isopropyl P-D-1-thiogalactopyranoside (IPTG) to promote protein expression. After protein expression at 25° C. and 120 rpm for 6 hours, the result was diluted 1/10 with TB medium to measure OD.sub.600. The measured value was obtained by multiplication by a dilution factor of 10. The cell solution was dispensed in an amount of 1 ml and centrifuged at 7,000 rpm for 5 minutes to remove the medium and obtain only the cells. The cells were lysed in PBS (pH 7.4) to adjust the OD.sub.600 to 7 and 250 μl of the cells were disrupted using ultrasonication. After centrifugation, 100 μl of a soluble fraction was mixed with 20 μl of 6×SDS sample buffer to perform sampling.
[0086] Transformation was performed in the same manner as above, except that a plasmid expressing an A/PR8 influenza virus type A HA was used to sample HA that was not fused with Oct1.
[0087] The soluble expression of the Oct1-HA fusion protein obtained by the method according to the present invention was compared with that of the HA (not fused with Oct1) protein using western blot.
[0088]
[0089] It was found that HA was not expressed in a soluble form, but only Oct1-HA was expressed in a soluble form. This indicates that the Oct1-HA fusion protein prepared using the method according to the present invention can be used in a state of expressing protein activity without an additional step after purification.
Example 12: Purification of Oct1-HA Fusion Protein
[0090] It was found from Example 11 that the Oct1-HA fusion protein was expressed in a soluble form and purification was performed under the same conditions. 7 μl of the transformed BL21 (DE3) was inoculated into 7 ml of liquid medium (Terrific broth, TB medium) containing μg/ml of kanamycin and incubated in a shaking incubator at 37° C. for 15 hours. Then, 6 ml of the transformed BL21 (DE3) was secondarily inoculated into 600 ml of a fresh batch of the same medium. When Escherichia coli grew to an OD.sub.600 of 0.4 to 0.6 in a shaking incubator at 37° C. and 180 rpm, it was treated with 1 mM isopropyl p-D-1-thiogalactopyranoside (IPTG) to induce protein expression. After protein expression at 25° C. and 120 rpm for 6 hours, centrifugation was performed at 8,000 rpm for 5 minutes to remove the medium and collect only cells. The cells were resuspended using a buffer containing Triton X-100, N-lauroylsarcosine sodium salt, EDTA, and a low concentration of imidazole, and were disrupted using ultrasonication. The cell substrate was isolated through centrifugation, and then Ni-NTA agarose beads were treated therewith. Substances that could not be bound to the beads were removed using the same buffer, and the protein to be purified (Oct1-HA fusion protein) was obtained through a buffer containing a high concentration of imidazole from which N-lauroylsarcosine sodium salt was removed.
[0091]
[0092] The result of SDS-PAGE showed that the Oct1-HA fusion protein was normally purified. In addition, it showed that soluble HA having activity in E. coli was obtained.
[0093] The present invention has been described for illustrative purposes, and it will be obvious to those skilled in the art that the embodiments can be implemented in other specific forms without changing the technical concepts or essential features of the present invention. Therefore, it should be construed that the aforementioned embodiments are illustrative and not restrictive in all respects. For example, respective elements described as having a combined form may be implemented separately, and likewise, elements described as being separate may also be implemented in a combined form.
[0094] It should be interpreted that the scope of the present invention is defined by the following claims rather than the above detailed description and all alterations or modifications derived from the meaning and scope of the claims and equivalents thereto fall within the scope of the present invention.