Baculovirus expression system
12188052 ยท 2025-01-07
Assignee
- Centre National De La Recherche Scientifique (Cnrs) (Paris, FR)
- Institut National De La Recherche Agronomique (Paris, FR)
Inventors
- Martine CERUTTI (Saint Christol Les Ales, FR)
- Sylvie JULIANT (Saint Christol Les Ales, FR)
- Coralie BERNON (BOISSET-ET-GAUJAC, FR)
Cpc classification
C12N7/00
CHEMISTRY; METALLURGY
C12N2710/14043
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
International classification
C12N7/00
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
Abstract
Method for preparing, in an insect cell, a recombinant baculovirus comprising one or more transgene(s) each encoding a protein maturation enzyme and n transgenes each encoding a polypeptide of interest, by homologous recombination between a replication deficient baculovirus genome which comprises one or more transgene(s) each encoding a protein maturation enzyme and n transfer vectors each comprising one of the n transgenes each encoding a polypeptide of interest, n being an integer at least equal to 2.
Claims
1. A method for producing a recombinant baculovirus of which the genome comprises: one or more transgene(s) each encoding a protein maturation enzyme, and n transgenes each encoding a polypeptide of interest to be expressed at a different locus, said method comprising the steps of: a) preparing, in an insect cell, a recombinant baculovirus genome capable of replicating which comprises said one or more transgene(s), each encoding a protein maturation enzyme, and said n transgenes each encoding a polypeptide of interest, by homologous recombination between: a1) a replication deficient baculovirus genome in which n genes essential for viral replication located in different regions of the viral genome are non-functional and which comprises said one or more transgene(s), each encoding a protein maturation enzyme, and a2) n transfer vectors each comprising: i) a nucleotide sequence enabling to restore the function of one of the n non-functional genes essential for viral replication located in different regions of the viral genome, ii) one of said n transgenes encoding a polypeptide of interest, each polypeptide of interest to be expressed at a different locus, the set of nucleotide sequences i) of the n transfer vectors being capable of restoring the replication of the replication deficient baculovirus genome, n being an integer at least equal to 2; and b) generating a recombinant baculovirus in an insect cell which comprises the recombinant baculovirus genome obtained at step a), wherein said homologous recombination between the replication deficient baculovirus genome and the n transfer vectors takes place in a single transfection step in the insect cell.
2. The method according to claim 1, wherein said replication deficient baculovirus genome of step a1) is prepared, in a bacterial cell, by homologous recombination between: a replication deficient baculovirus genome in which n genes essential for viral replication are non-functional, and one or more nucleotide sequence(s) each comprising one or more transgene(s) each encoding a protein maturation enzyme.
3. The method according to claim 1, wherein the genes essential for viral replication are selected from the group consisting of: 1629 (ORF9), Pk1 (ORF10), lef-1 (ORF14), ORF34, lef-11 (ORF37), p47 (ORF40), lef8 (ORF50), DNAJ domain (ORF51), ORF53, vp1054 (ORF54), Lef-9 (ORF62), DNA Pol (ORF65), lef-3 (ORF67), ORF73, ORF75, ORF81, p95 (ORF83), vp39 (ORF89), lef-4 (ORF90), p33 (ORF92), helicase (ORF95), vp80 (ORF104), ORF106-107, odv-ec43 (ORF109), gp64/67 (ORF128), ORF132, ORF133, odv-ec27 (ORF144), ORF146, ie1 (ORF147), and lef-2 (ORF6).
4. The method according to claim 1, wherein the n non-functional genes essential for viral replication are each adjacent to a gene not essential for viral replication.
5. The method according to claim 4, wherein the gene not essential for viral replication is selected from the group consisting of: Ph (ORF 8), ORF11, ORF13, egt (ORF15), v-ubiquitin (ORF35), 39K (ORF36), ORF38, p43 (ORF39), lef-12 (ORF41), pcna (ORF49), ORF52, ORF55, Fp (ORF61), ORF63, gp37 (ORF64), ORF68, ORF72, ORF74, ORF82, cg30 (ORF88), ORF91, pif-4 (ORF96), he65 (ORF105), ORF108, ORF110, cathepsin (ORF127), p24 (ORF129), pp34 (ORF131), ORF134, ORF145, odv-e56 (ORF148), and ORF5.
6. The method according to claim 1, wherein the n transgenes encoding a polypeptide each recombine at the locus of a gene not essential for viral replication adjacent to a non-functional gene essential for viral replication.
7. The method according to claim 1, wherein the protein maturation enzyme is selected from the group consisting of: a signal peptidase, a furin, a proprotein convertase, a glycosyltransferase, a glycosidase, a chaperone protein, an isomerase disulphide, an acyltransferase, a methyltransferase, a hydroxylase, a transglutaminase, a farnesyltransferase, a geranylgeranyl-transferase, a N-myristoyltransferase, a palmityltransferase, a phosphatase, a transpeptidase, a carboxylase, and a ubiquitin ligase.
8. The method according to claim 2, wherein the one or more transgene(s), each encoding a protein maturation enzyme, each recombines at the locus of a gene not essential for viral replication.
9. The method according to claim 8, wherein the gene not essential for viral replication is selected from the group consisting of: ptp (ORF1), ctx (ORF3), ORF4, ORF7, odv-e26 (ORF16), ORF17, ORF18, ORF19, ARIF-1 ORF20-21, pif2 (ORF22), protein F (ORF23), iap1 (ORF27), lef6 (ORF28), ORF29, ORF30, sod (ORF31), fgf (ORF32), gta (ORF42), ORF43, ORF44, ORF45, odv-e66 (ORF46), ORF47, ORF56, ORF57, chaB-like (ORF58/59), chaB-like (ORF60), mtase (ORF69), hcf-1 (ORF70), iap2 (ORF71), ORF86, ORF87, ORF111, ORF114, pif3 (ORF115), ORF116, ORF117, pif1 (ORF119), ORF120, ORF121, ORF122, pk2 (ORF123), ORF124, lef7 (ORF125), chitinase (ORF126), gp16 (ORF130), p35 (ORF135), p26 (ORF136), p10 (ORF137), p74 (ORF138), ORF149, ORF150, ie2 (ORF151), pe38 (ORF153) and ORF154.
10. The method according to claim 1, wherein the insect cell is selected from the group consisting of: Sf9, Sf21, Tn5-b14, lepidoptera cell lines sensitive to the baculovirus AcMNPV.
11. The method according to claim 2, wherein the bacterial cell is E. coli selected from DH10B and EL350.
12. The method according to claim 1, wherein the replication deficient baculovirus genome is obtained from a baculovirus genome selected from or derived from the genome of one of the following baculovirus: BmNPV, AcMNPV, ApNPV, BsSNPV, CfMNPV, EoSNPV, HaNPV, HzNPV, LdMNPV, MbMNPV, OpMNPV, SIMNPV, SeMNPV and TeNPV.
13. The method according to claim 1, wherein n is an integer ranging from 2 to 31.
14. A recombinant baculovirus or recombinant baculovirus genome, susceptible to be obtained by the production method according to claim 1, comprising: a) One or more transgene(s) each encoding a protein maturation enzyme, and b) n nucleotide sequences of formula (I):
[transgene encoding a polypeptide of interest][spacer nucleotide sequence][gene essential for functional viral replication](I), said spacer nucleic acid sequence being constituted of 0 to 600 base pairs, said gene essential for functional viral replication being selected from the group consisting of: 1629 (ORF9), Pk1 (ORF10), lef-1 (ORF14), ORF34, lef-11 (ORF37), p47 (ORF40), lef8 (ORF50), DNAJ domain (ORF51), ORF53, vp1054 (ORF54), Lef-9 (ORF62), DNA Pol (ORF65), lef-3 (ORF67), ORF73, ORF75, ORF81, p95 (ORF83), vp39 (ORF89), lef-4 (ORF90), p33 (ORF92), helicase (ORF95), Vp80 (ORF104), ORF106-107, odv-ec43 (ORF109), gp64/67 (ORF128), ORF132, ORF133, odv-ec27 (ORF144), ORF146, ie1 (ORF147), and lef-2 (ORF6); and n being an integer at least equal to 2.
15. The recombinant baculovirus or recombinant baculovirus genome according to claim 14, wherein said recombinant baculovirus or recombinant baculovirus genome do not comprise n genes not essential for viral replication chosen from the group consisting of: Ph (ORF 8), ORF11, ORF13, egt (ORF15), v-ubiquitin (ORF35), 39K (ORF36), ORF38, p43 (ORF39), lef-12 (ORF41), pcna (ORF49), ORF52, ORF55, Fp (ORF61), ORF63, gp37 (ORF64), ORF68, ORF72, ORF74, ORF82, cg30 (ORF88), ORF91, pif-4 (ORF96), he65 (ORF105), ORF108, ORF110, cathepsin (ORF127), p24 (ORF129), pp34 (ORF131), ORF134, ORF145, odv-e56 (ORF148), and ORF5.
16. A set of homologous recombination elements comprising: a) a replication deficient baculovirus genome in which n genes essential for viral replication located in different regions of the viral genome are non-functional and which comprises one or more transgene(s) each encoding a protein maturation enzyme; b) n transfer vectors each comprising: i) a nucleic acid sequence enabling to restore the function of one of the n non-functional genes essential for viral replication, ii) a transgene encoding a polypeptide of interest, each polypeptide of interest expressed at a different locus, n being an integer at least equal to 2.
17. A cell comprising a recombinant baculovirus or a recombinant baculovirus genome according to claim 14.
18. A process for the production of n polypeptides of interest comprising producing the polypeptides from a recombinant baculovirus or a recombinant baculovirus genome according to claim 14.
19. The method according to claim 10, wherein the insect cell is Sf9.
20. The method according to claim 12, wherein the replication deficient baculovirus genome is obtained from a baculovirus genome selected from or derived from AcMNPV.
21. The method according to claim 13, wherein n is equal to or greater than 3.
22. A cell comprising a set of homologous recombination elements according to claim 16.
23. A process for the production of n polypeptides of interest comprising producing the polypeptides in a cell according to claim 17.
24. The method according to claim 8, wherein the one or more transgene(s), each encoding a protein maturation enzyme each recombine at the locus of a gene not essential for viral replication non-adjacent to a non-functional gene essential for viral replication.
Description
FIGURES
(1)
(2) Caption:
(3) ORF: open reading frame Polyhedrin or PH: baculovirus gene encoding polyhedrin: gene not essential for viral replication. ORF603: baculovirus gene encoding the protein 603, non-essential gene. ORF1629: baculovirus gene encoding the protein 1629: gene essential for viral replication pVT: plasmid transfer vector. Mini-F: origin of bacterial replication. Kan: bacterial expression cassette expressing the kanamycin resistance gene. Amp: bacterial expression cassette expressing the ampicillin resistance gene. Recombination fragment: fragment of DNA containing the expression cassette to integrate in the target DNA. This fragment has flanking regions on either side of the expression cassette to be able to target specifically the region that will undergo homologous recombination via Red Recombinase.
(4)
(5) Caption:
(6) gp37: baculovirus gene encoding glycoprotein gp37, gene not essential for viral replication. gp37 252 aa: gene gp37 deleted from the region encoding the 252 N-terminal amino acids. DNAPol: baculovirus gene encoding viral DNA polymerase, gene essential for viral replication. DNAPol-466 aa: dna pol gene deleted from the region encoding the 466 C-terminal amino acids. Hygro: bacterial expression cassette expressing the hygromycin resistance gene. Recombination fragment: fragment of DNA containing the expression cassette to integrate in the target DNA. This fragment has flanking regions on either side of the expression cassette to be able to target specifically the region that will undergo homologous recombination via Red Recombinase.
(7)
(8) Caption:
(9) Chit: baculovirus gene encoding chitinase, gene not essential for viral replication. Cath: baculovirus gene encoding viral cathepsin, gene not essential for viral replication. gp64: baculovirus gene encoding viral glycoprotein gp64, gene essential for viral replication. gp64-188 aa: gene gp64 deleted from the region encoding the 188 C-terminal amino acids. Zeo: bacterial expression cassette expressing the zeocin resistance gene. Recombination fragment: fragment of DNA containing the expression cassette to integrate in the target DNA. This fragment has flanking regions on either side of the expression cassette to be able to target specifically the region that will undergo homologous recombination via Red Recombinase.
(10)
(11) Caption:
(12) pVT: plasmid transfer vector. gp37: baculovirus gene encoding the glycoprotein gp37, gene not essential for viral replication. DNAPol: baculovirus gene encoding viral DNA polymerase, gene essential for viral replication. DNAPol.466 aa: dna pol gene deleted from the region encoding the 466 C-terminal amino acids. Exogenous gene: transgene of interest. P: viral or cellular promoter which controls the expression of the transgene. Hygro: bacterial expression cassette expressing the hygromycin resistance gene.
(13)
(14) Caption:
(15) pVT/PH: polyhedrin transfer vector plasmid. PH: all or part of the baculovirus gene encoding polyhedrin, gene not essential for viral replication. ORF603: baculovirus gene encoding protein 603, non-essential gene. ORF1629: baculovirus gene encoding protein 1629, gene essential for viral replication. Exogenous gene: transgene of interest. P: viral or cellular promoter which controls the expression of the transgene. Kan: bacterial expression cassette expressing the kanamycin resistance gene. Mini-F: origin of bacterial replication.
(16)
(17) Caption:
(18) pVT: plasmid transfer vector. pVT/gp37-C1: plasmid transfer vector specific to the heavy chain of an immunoglobulin. C1: DNAc encoding the constant domain 1 of a human immunoglobulin. VH: DNAc encoding the variable domain of the heavy chain of an immunoglobulin. DNAPol: baculovirus gene encoding viral DNA polymerase, gene essential for viral replication. DNAPol466 aa: DNAPol gene deleted from the region encoding the 466 C-terminal amino acids. P: viral or cellular promoter which controls the expression of the transgene. Hygro: bacterial expression cassette expressing the hygromycin resistance gene. PS: DNAc encoding a signal sequence (secretion of the heavy chain).
(19)
(20) Caption:
(21) ORF603: baculovirus gene encoding protein 603. ORF1629: baculovirus gene encoding protein 1629: gene essential for viral replication. Mini-F: origin of bacterial replication. pVT: plasmid transfer vector. pVT/PH-C: plasmid transfer vector specific to the light chain of an immunoglobulin. Cc: DNAc encoding the kappa constant domain of a human immunoglobulin. VL: DNAc encoding the variable domain of the light chain of an immunoglobulin. P: viral or cellular promoter which controls the expression of the transgene. Kan: bacterial expression cassette expressing the kanamycin resistance gene. PS: DNAc encoding a signal sequence (secretion of the light chain).
(22)
(23) Caption:
(24) pVT Chit/Cath: plasmid transfer vector capable of recombining at the locus of the region comprising the 2 non-essential genes, ChiA encoding chitinase and Cath encoding cathepsin. gp64188 aa: gp64 gene, essential gene, deleted from the region encoding the 188 C-terminal amino acids. Exogenous gene: transgene of interest. P: viral or cellular promoter which controls the expression of the transgene. Zeo: bacterial expression cassette expressing the zeocin resistance gene.
(25)
(26) Caption:
(27) A: analysis of the organisation of the genomes of 3 independent recombinant baculoviruses expressing the antibodies 13B8II. These baculoviruses were isolated from a single transfection experiment. The hybridizations carried out respectively with a probe specific to the constant region of the kappa light chain: probe C and a probe specific to the constant region of the heavy chain gamma 1: probe C1 demonstrates a correct and identical organisation of the 3 recombinant viruses. B. Analysis by electrophoresis in polyacrylamide gel (SDS, 2-mercaptoethanol) and silver staining of the purified recombinant antibodies. The antibodies secreted in the culture medium of cells infected with the recombinant baculovirus were purified on a Protein A Sepharose column. PC1: Plasmid control, plasmid containing the gene of the kappa light chain, PC2: Plasmid control, plasmid containing the gene of the heavy chain 1, R1-3, recombinant baculovirus 1, 2 and 3, MW: size marker.
(28)
(29) Caption:
(30) M: gene of the flu virus encoding the matrix protein. HA: gene of the flu virus encoding hemagglutinin. NA: gene of the flu virus encoding neuraminidase. bp: size of the DNA fragments expressed in pairs of bases.
(31)
(32) Caption:
(33) A: Diagrammatical representation of the structure of the bispecific antibodies. L1: light chain of the antibodies 1; L2, light chain of the antibodies 2. B: Purified bispecific antibodies, analysed by electrophoresis on polyacrylamide gel. The proteins were revealed by silver staining. (1) electrophoresis under reducing conditions (SDS, 2-mercaptoethanol). (2) electrophoresis under non-reducing conditions. H: heavy chain of the antibodies, L: light chain of the antibodies, H2L4: composition of the bispecific antibodies: 2 fused heavy chains bound by 4 disulphide bridges at the level of 2 hinge regions+4 light chains (2 chains L1+2 chains L2) paired in a specific manner to the corresponding regions VH1-CH1 and VH2-CH1.
(34)
(35)
(36)
(37)
(38) Two expression cassettes were successively inserted into the region IG35/36 cloned beforehand in a plasmid pUC (i) a viral expression cassette, composed of an early viral promoter (see Table 2) and the gene encoding GNT-II and (ii) a bacterial expression cassette controlling the zeocin resistance gene (Zeo). A recombination fragment containing the 2 cassettes was generated by digestion of the above plasmid by 2 restriction endonucleases. The latter was introduced into the bacterium EL350/BacMid2 by electroporation. A homologous recombination took place via Red Recombinase between the flanking regions of the recombination fragment and the DNA of BacMid2 enabling the integration of the 2 expression cassettes. The recombinant bacteria thus obtained were selected with zeocin then the gene encoding the resistance to this antibiotic was eliminated from the DNA of the bacmid by simple digestion/reparation/relegation. The bacmid obtained, called BacMid2-GNTII, was re-introduced by electroporation into a bacterium EL350 (EL350/BacMid2-GNT-II).
(39)
Caption: A, Agarose gel stained with ethidium bromide, Well 1: restriction profile EcoRI of BacMid2Gal-Fur, Well 2: Restriction profile EcoRI of BacMid2-Fur. B. Southern blot, Well 1: restriction profile EcoRI of BacMid2Gal-Fur, Well 2: restriction profile EcoRI of BacMid2-Fur. C and D: two recombinant viruses co-expressing the polyprotein Pr55Gag and gp160 of the virus HIV-1 were constructed one from BacMid2 and the other from BacMid2-Fur. The Sf9 cells were infected for 48 hours with the different viruses and the proteins secreted in the culture supernatant were concentrated or not with a solution of Retro Concentin Virus Precipitation (SBI, reference RV100A-1) then deposited on a polyacrylamide gel at 10% under denaturing and reducing conditions then analysed by Western blot. C. The proteins were revealed with an anti-gp120 antibody (reference Ab21179, Abcam). D. The proteins were revealed with an anti-Pr55.sup.Gag antibody (reference. 63917, Abcam).
Caption: BACWT: wild baculovirus, BACgp160/Gag/Fur: triple-recombinant baculovirus expressing gp160 and polyprotein Pr55.sup.Gag of HIV-1 as well as the furin of the cell Sf9 BACgp160/Gag: double-recombinant baculovirus expressing gp160 and polyprotein Pr55.sup.Gag of HIV-1, BACgp120: mono-recombinant baculovirus expressing gp120 of HIV-1, BACGag: mono-recombinant baculovirus expressing polyprotein Pr55.sup.Gag of HIV-1.
(40)
Caption: GE: Essential gene GNE: Non-essential gene pVT/PH: Transfer vector which targets the couple GNE/GE PH/1629 pVT/gp37: Transfer vector which targets the couple GNE/GE gp37/DNAPol DNA Pol.sup.NF: Gene encoding non-functional viral DNA polymerase DNA Pol.sup.F: Gene encoding functional viral DNA polymerase 1629.sup.NF: Gene encoding the non-functional protein 1629 1629.sup.F: Gene encoding the functional protein 1629 1,4 GalT: 1,4 galactosyltransferase GNT-II: N acetylglucosaminyltransferase II Kan: kanamycin resistance gene mini-F: origin of bacterial replication PH: polyhedrin gene
(41)
(42) Caption:
(43) GE: Essential gene GNE: Non-essential gene pVT/PH: Transfer vector which targets the couple GNE/GE PH/1629 pVT/gp37: transfer vector which targets the couple GNE/GE gp37/DNAPol DNA Pol.sup.NF: Gene encoding non-functional viral DNA polymerase DNA Pol.sup.F: Gene encoding functional viral DNA polymerase 1629.sup.NF: Gene encoding the non-functional protein 1629 1629.sup.F: Gene encoding the functional protein 1629 1,4 GalT: 1,4 galactosyltransferase GNT-II: N acetylglucosaminyltransferase II Kan: kanamycin resistance gene mini-F: origin of bacterial replication PH: polyhedrin gene
(44)
(45) Caption:
(46) A and B. Western blot. A: the membrane was incubated with a sheep anti-human IgG whole antibody peroxidase conjugated (reference NA933V, GE Healthcare). B: The membrane was incubated with a sheep anti-mouse IgG whole antibody peroxidase conjugated (reference NA931V, GE Healthcare). A. Well 1: Fetuin (61-68 kDa), supplied in the Dig Glycan Differentiation kit from Roche, this 2,3 and 2,6 sialylated protein constitutes the positive control for analyses with lectin blot whether for SNA, MAA or diCBMA. According to the supplier, the molar mass (*) of this protein varies between 68 and 61 kDa, Well 2: Recombinant antibodies 13B8II/BacGal, Well 3: Recombinant antibody 13B8II/BacMan, B. Well 1: Recombinant mouse antibody/BacGal, Well 2: Recombinant mouse antibody/BacMan, C. Lectin blot. The membrane was incubated in the presence of RCA.sub.120 conjugated with biotin. The presence of lectin was revealed as described in example 17. Well 1: Fetuin (61-68 kDa) Well 2: Recombinant mouse antibody/BacMan, Well 3: Recombinant mouse, antibody/BacGal, Well 4: Recombinant antibody 13B8II/BacMan, Well 5: Recombinant antibody 13B8II/BacGal.
(47)
(48) Caption:
(49) GE: Essential gene GNE: Non-essential gene pVT/PH: Transfer vector which targets the couple GNE/GE PH/1629 pVT/gp37: Transfer vector which targets the couple GNE/GE gp37/DNAPol DNA Pol.sup.NF: Gene encoding non-functional viral DNA polymerase DNA Pol.sup.F: Gene encoding functional viral DNA polymerase 1629.sup.NF: Gene encoding the non-functional protein 1629 1629.sup.F: Gene encoding the functional protein 1629 1,4 GaIT: 1,4 galactosyltransferase GNT-II: N acetylglucosaminyltransferase II 2,3 ST: 2,3 sialyltransferase 2,6 ST: 2,6 sialyltransferase Kan: kanamycin resistance gene mini-F: origin of bacterial replication PH: polyhedrin gene
(50)
(51) Caption:
(52) a: Analysis of the electrophoretic profile of digestion by EcoRI of 2 clones of BacMid2Sia6-II (1 and 2) in comparison with BacMid2-GNTII-1,4GT-CMPNeuAcS-NeuAcS (T) shows that the integration of the cassette ST6GalI in the region Pif1 generates 2 fragments EcoRI of 3122 pb and 6138 pb. b: The hybridisation carried out with a probe specific to ST6GalI makes it possible to verify the marking of the 2 fragments EcoRI of 3122 pb and 6138 pb and the control plasmid (PC), plasmid containing the ST6GalI gene and demonstrates a correct and identical organisation of the 2 BacMids obtained. MW: Smart Ladder (Eurogentec)
(53)
Caption: Fet: Fetuin Mq: Molecular weight markers ST3: Virus generated from the bacmid BacSia3 ST6: Virus generated from the bacmid BacSia6 ST3/6: Virus generated from the bacmid BacSia3/6 Man: Virus generated from BacMid2
(54)
(55) Caption:
(56) Well 1, the protein X was produced after infection of the Sf9 cells with a recombinant baculovirus generated from BacMid2. Well 2, the protein X was produced after infection of the Sf9 cells with a recombinant baculovirus generated from BacSia6. Well 3, commercially available Protein X produced in CHO cells. The presence of lectin was revealed as described in example 17. MW: Molecular weight marker (Pre-stained marker, Biolabs reference P7706).
(57)
(58) A and B: Analysis of the Protein VSVg.
(59) A. Western blot, after electrophoresis in polyacrylamide gel then transfer onto a membrane, the proteins were incubated in the presence of a specific antibody directed against VSVg (mouse antibodies peroxidase conjugated, reference A5977 Sigma).
Caption: Well 1, Fetuin, Well 2, and 3, Sf9 cells infected with a recombinant baculovirus expressing the protein VSVg generated from BacSia6 (Well 2) or Bacmid2 (Well 3). B. Lectin blot. The proteins transferred onto a nitrocellulose membrane were placed in the presence of lectin SNA (Sambucus nigra agglutinin) specific to residues of 2,6 bound sialic acids. The presence of lectin was revealed as described in example 17. C and D. Analysis of the viral protein gp64. We also verified that the recombinant baculovirus expressing sialylated VSVg was also bearing a sialylated gp64. To do so, the baculoviruses secreted in the culture supernatant were sedimented then taken up by a lysis buffer to be analysed by Western blot then by lectin blot. C. Western blot, gp64 was revealed with a specific antibody (antibodies anti-gp64 AcV5, reference SC65499, Santa Cruz Biotechnology). D. Lectin blot. In the presence of lectin SNA as described in example 17.
Caption: Well 1, Fetuin, Wells 2, and 3, particles of baculovirus prepared from the culture supernatants of cells infected with the recombinant baculovirus expressing protein VSVg and generated from BacMid2-Sia6 (Well 2) or a Bacmid2 (Well 3).
EXAMPLES
(60) Examples 1 to 3 are relative to the construction of replication deficient baculoviruses, in which 1, 2 or 3 genes respectively are non-functional.
(61) Examples 4 and 5 describe the generation of recombinant baculoviruses having integrated 2 or 3 transgenes, respectively.
(62) Examples 6 to 8 are relative to the use of these recombinant baculoviruses having integrated 2 or 3 transgenes for the production of proteins of interest.
(63) Examples 9 to 15 describe the construction of recombinant baculoviruses comprising transgenes encoding for protein maturation enzymes.
(64) Examples 16 to 19 demonstrate that proteins of interest produced thanks to the baculoviruses of examples 9 to 15 have satisfactory maturation and/or glycosylation.
Example 1: Construction of a Replication Deficient Baculovirus Genome in which 1 Gene Essential for Viral Replication is Non-Functional (BacMid1)
(65) BacMid1 has the deletion of a gene essential for viral replication, the gene 1629.
(66) 1. Integration of the Origin of Bacterial Replication in a Genome of the Baculovirus
(67) This operation is carried out in the insect cell.
(68) The origin of bacterial replication Mini-F was introduced into the polyhedrin locus of the baculovirus genome AcMNPV by homologous recombination in insect Sf9 cells (Spodoptera frugiperda). To do so, the cells were transfected with (i) a transfer vector PH (pVT/Mini-F-Kan) in which the sequence of the gene ph was replaced by a fragment of DNA bearing the Mini-F+a bacterial expression cassette conferring kanamycin resistance (Kan), and (ii) a baculovirus genome AcMNPV (baculovirus isolated from the lepidoptera Autographa californica). The baculovirus generated were purified by the phage plaque assay technique then characterised in order to confirm that they had indeed integrated the Mini-F and the expression cassette Kan. A baculovirus was selected and was next transferred into the bacterium E. coli EL350, thus generating a first BacMid (BacMid0, non-deficient for viral replication in insect cells).
(69) 1. Deletion of the Essential Gene 1629
(70) A bacterial expression cassette conferring ampicillin resistance (Amp) and having on 5 and 3 the restriction site MauBIsite absent from the baculovirus genome AcMNPVwas integrated downstream of the bacterial expression cassette Kan by homologous recombination in the bacterium E. coli EL350. In the course of this recombination, a fragment of DNA encoding the 27 C-terminal amino acids of the protein 1629 was deleted, making the protein 1629 non-functional (BacMid0/Amp). The ampicillin resistance gene was next eliminated after digestion by MauBI then relegation, thus generating BacMid1. The genome of the baculovirus (i.e. BacMid1) is then deficient for replication in insect cells, because a gene essential for viral replication (i.e. the gene encoding the protein 1629) is non-functional. The bacteria containing BacMid1 are called hereafter bacteria E. coli EL350/BacMid1.
(71)
Example 2: Construction of a Replication Deficient Baculovirus Genome in which 2 Genes Essential for Viral Replication are Non-Functional (BacMid2)
(72) BacMid2 exhibits the deletion of 2 genes essential for viral replication, the gene 1629 and the gene encoding viral DNA polymerase (DNAPol). From BacMid1, the deletion of the gene DNAPol was carried out in the bacteria E. coli EL350/BacMid1 after electroporation of a recombination fragment of 4222 bp in which a part of the genes encoding gp37 (252 amino acids) and DNAPol (466 C-terminal amino acids) was deleted and replaced by a bacterial expression cassette enabling the production of hygromycin B phosphotransferase (Hygro) thus conferring hygromycin resistance (Hygro). The Hygro gene was placed under the control of the bacterial promoter EM7 (derived from the commercially available vector pSelect-Hygro-mcs, Invitrogen), the terminator glms was introduced downstream of the Hygro gene (Gay N. J. et al. Biochem J., 1986, 234, 111-11). The bacteria containing BacMid2 (E. coli EL350/BacMid2) were selected for their hygromycin resistance. The baculovirus genome (i.e. BacMid2) is deficient for replication in insect cells, because two genes essential for viral replication (i.e. the gene encoding the protein 1629 and the gene encoding DNAPol) are non-functional.
(73)
(74) Note: It is possible to use BacMid2 to produce a single protein (see Example 4). It suffices to have two transfer vectors, one providing the transgene and all or part of the deleted essential gene 1 and the other providing the wild gene corresponding to the deleted essential gene 2. The two deleted genes are repaired during homologous recombination.
Example 3: Construction of a Replication Deficient Baculovirus Genome in which 3 Genes Essential for Viral Replication are Non-Functional (BacMid3)
(75) BacMid3 has the deletion of 3 essential genes, 1629, DNAPol and gp64. From BacMid2, the deletion of gene gp64 was carried out in the bacteria E. coli EL350/BacMid2 after electroporation of a recombination fragment of 3260 pb in which the totality of the gene of the cathepsin plus 779 bp of the sequence encoding 259 amino acids of chitinase and a part of the gene of gp64, deletion of 566 bp encoding 188 amino acids, was replaced by a bacterial expression cassette conferring zeocin resistance (Zeo) (Drocourt et al., Nucleic Acids Research, vol. 18n 13, 1990). The Zeo gene derived from the commercially available plasmid pCR-Blunt (Invitrogen) was placed under the control of the bacterial promoter T5N25, derived from the phage T5 (Gentz and Bujard, J. Bacteriology, vol. 164n 1, 1985) and followed by the transcription terminator rrnBT1 (E. coli ribosomal RNA operon T1 terminator) (Kwon et al., J Biol. Chem., vol 274 n 41, 1999). The bacteria containing BacMid3 (E. coli EL350/BacMid3) were selected for their zeocin resistance. The baculovirus genome (i.e. BacMid3) is deficient for replication in insect cells, because three genes essential for viral replication (i.e. the gene encoding protein 1629 and the gene encoding DNAPol and the gene encoding gp64) are non-functional.
(76)
Example 4: Use of BacMid2
(77) A transfer vector pVT/gp37 was constructed to be able to generate recombinant baculoviruses expressing 2 transgenes. To do so, the fragment EcoRI F of the baculovirus genome AcMNPV containing the gene gp37 and the gene DNAPol was cloned in a bacterial plasmid pUC, thus generating pUC/gp37.
(78) This plasmid was next modified in the following manner: a large part of the gene encoding gp37 was deleted (724 pb), the ATG initiator was mutated and replaced by two unique restriction sites XbaI and AvrII enabling the integration of a transgene under control of the natural promoter of gp37. These modifications thus led to the transfer vector pVT/gp37 being obtained.
(79) The Sf9 cells were transfected by lipofection with the transfer vectors pVT/PH and pVT/gp37 loaded with the transgenes and DNA of BacMid2. The viruses generated after homologous recombination were cloned by the phage plaque assay method. The production of the recombinant protein was verified by a suitable method (e.g. for example ELISA, Western blot, enzymatic assay). The genome of the recombinant viruses was verified by Southern blot and the sequence of the transgene integrated in the viral genome was verified by sequencing after PCR amplification.
(80)
(81) The genomes of recombinant baculoviruses generated after homologous recombination between BacMid2 and the transfer vectors no longer express gp37 (protein not essential for viral replication).
(82) In order that the viral DNA is repaired in the 2 loci of BacMid2, a second recombination must take place with a transfer vector PH loaded or not with a transgene. In all cases, the DNA of the baculovirus genome will be repaired and thus infectious.
(83) It will also be possible to use pVT/PH containing a wild sequence, that is to say containing the wild expression cassette (non-modified) leading to the production of polyhedrin. The pVT/PH could also be empty that is to say not contain transgene or polyhedrin gene.
(84) In the same way it will be possible to integrate the transgene in the locus PH. In this case, a pVT/gp37 not deleted (functional non-essential gene) or deleted totally or partially such as described in
(85) TABLE-US-00002
Direction of Transcription of the Gene
Caption: Sequence of the gene in bold type ATG initiator underlined Polylinker XbaI/AvrII/BamHI in boxed section The nucleic sequence illustrated above is the sequence SEQ ID NO: 16
(86)
(87) Expression of the Heavy Chain of an Antibody.
(88) Construction of a specific pVT/gp37, pVT/gp37-C1 This transfer vector contains the following expression cassette: Wild viral promoter P10 (SEQ ID NO: 1) DNA sequence encoding a signal sequence of a human immunoglobulin (secretion sequence) 2 unique restriction sites for the cloning in phase of the variable region (VH) of the antibodies (region which gives the specificity of the antibodies) DNA sequence which encodes a constant region of epsilon, mu, or alpha human IgG (1-4).
(89)
(90) Expression of the Light Chain of an Antibody.
(91) Construction of a specific pVT/PH, pVT/PH-CL.
(92) This transfer vector contains the following expression cassette: Viral promoter P10 P10S1B (SEQ ID NO: 3) DNA sequence encoding a signal sequence of a human immunoglobulin (secretion sequence) 2 unique restriction sites for the cloning in phase of the variable region (VL) of the antibodies (region which gives the specificity of the antibodies) DNA sequence which encodes a constant region of light chain (CL) kappa () or lambda () of human IgG.
(93)
Example 5: Use of BacMid3
(94) A transfer vector, pVT/Chit-Cath, was constructed to be able to generate genomes of recombinant baculoviruses expressing 3 transgenes.
(95) The fragment BstXI-XbaI derived from the regions EcoRI E and H of the baculovirus AcMNPV was cloned in a plasmid pUC. A deletion EcoNI-EcoRI of 1175 pb makes it possible to inactivate the genes encoding chitinase, non-essential, and cathepsin, also non-essential. The addition of a site XbaI between the sites EcoNI and EcoRI makes it possible to integrate a transgene. These modifications thus led to the transfer vector pVT/Chit-Cath being obtained. The Sf9 cells are transfected by lipofection with the transfer vectors pVT/PH, pVT/gp37 and pVT/chitCath loaded with the transgenes and the DNA of BacMid3. The viruses generated during homologous recombination were cloned by the phage plaque assay method. The production of the recombinant protein was controlled by a suitable method, ELISA, Western blot, enzymatic assay, etc., the genome of the recombinant viruses was controlled by Southern blot and the sequence of the transgene was controlled after PCR amplification.
(96)
Example 6: Production of a Monoclonal Antibody Anti-CD4 (13B81) Using BacMid2
(97) The DNAc encoding the regions VH and VL of the antibodies were integrated respectively in the transfer vectors pVT/PH-C.sup. and pVT/gp37-C1. Recombinant baculoviruses were generated after homologous recombination between 2 pVT and the DNA of BacMid2 of example 4:
(98) The DNAc encoding the region VL of the antibodies was introduced into pVTPH/Ck which recombines with the region PH/1629 of BacMid2,
(99) The DNAc encoding the region VH of the antibodies was cloned in pVT/gp37-C1 which recombines with the region gp37 of BacMid2.
(100) The Sf9 cells were transfected by lipofection with BacMid2 and the 2 transfer vectors obtained in example 4 then incubated for 4 days at 28 C. The culture supernatants were collected and the recombinant baculoviruses generated and secreted in the culture medium were cloned by the phage plaque assay technique.
(101) The organisation of the genome of the recombinant baculoviruses was controlled by Southern blot (see
Example 7: Use of BacMid3 for the Production of VLP (Virus-Like-Particle)
(102) Production of Flu VLP
(103) To produce these VLPs, the 3 genes of the flu virus, M, HA and NA, were co-expressed. These 3 genes were integrated in the three transfer vectors necessary to recombine with the BacMid3 of example 5:
(104) The gene M was introduced into the transfer vector pVT/PH as described in
(105) The gene HA was introduced into the transfer vector pVT/gp37 as described in
(106) The gene NA was introduced into the transfer vector pVT/Chit/Cath as described in
(107) The Sf9 cells were transfected by lipofection with BacMid3 and the 3 transfer vectors obtained above, then incubated for 4 days at 28 C. The recombinant baculoviruses generated then secreted in the culture supernatant were cloned by the phage plaque assay method.
(108) The organisation of the genomes of recombinant baculoviruses was controlled by Southern blot (see
Example 8: Use of BacMid3 for the Production of Bispecific Antibodies
(109) The bispecific antibody constructed according to the international application WO 2013/005194 is constituted of a heavy chain composed of the domains VH+CH1+CH2+CH3 of an antibody 1, N-terminal fused to the domains VH+CH1 of an antibody 2. Mutations introduced at the interface of the regions CL and CH1 of the antibodies 1 favour the correct pairings between the domains VL1 and VL2 of the light chains L1 and L2 which are produced separately and the corresponding domains VH1 and VH2. The production of this antibody necessitates the simultaneous production and in equal quantity of 3 chains, the fused heavy chain, the light chain L1 and the light chain L2.
(110) The DNAc encoding the light chain L1 was introduced into the transfer vector pVT/PH as described in
(111) The DNAc encoding the light chain L2 was introduced into the transfer vector pVT/gp37 as described in
(112) The DNAc encoding the fused heavy chain was introduced into the transfer vector pVT/Chit-Cath as described in
(113)
Example 9: Construction of BacMid2-Fur Enabling the Generation of Recombinant Baculoviruses Correctly Expressing Matured Mannosylated Proteins
(114) The general principle that was used to introduce into the bacmids the genes enabling to optimise post translational modifications of the proteins (BacMid2/MPT (MPT: Post-Translational Modification) is described in
(115) TABLE-US-00003 TABLE 2 Promoter used to Name of the gene involved control the expression in post translational modification Integration site in Origin of the RNA polymerase Origin of the the viral genome promoter used Gene gene Reference Intergenic v-ubi P9 promoter of JcNDV Cellular GNT-II Human Tan et al. (orf35)/39k (orf36) 1995 pos. 29226 egt (orf15) pos. 12786 Promoter of the gene Cellular and 1,4GalTI Bovine d'Agostaro Integration in the gp64 of OpMNPV viral et al. 1989 gene egt iap2 (orf71) pos. 61222 Promoter of the gene Cellular CMP NeuAc synthase Human Munster et Integration in the gene ie1 of CfMNPV al. 1998 iap2 and deletion of Promoter of the gene Cellular NeuAc synthase Human Lawrence 335nt (112 aa) of iap2 ie1 of LdMNPV et al. 2000 Intergenic orf51/orf52 Promoter of the Cellular ST3GalIV Human Kitagawa and pos. 44298 gene ie1 of WSSV Paulson, 1994 Promoter of the gene Cellular ST6GalI Human Grundmann ie1 of WSSV et al. 1990 Promoter of the gene Cellular ST3GalIV + ST6GalI Human actin 3 of B. mori and promoter of the gene ie1 of WSSV pif1 (Orf119) pos. 100697 Promoter of the gene Cellular ST6GalI Human Integration in the place of ie1 of WSSV the gene pif1 which is entirely deleted chit/cath (orf126/orf127) Synthetic promoter P10S1 Viral Sf9-fur Lepidoptera Cieplik et pos. 106160 Deletion of Cell Sf9 al. 1998 787nt of chit(263 aa N-terminal) and 342nt of cath (114 aa N-terminal) Numbering of the bases conforming to the sequence of the virus AcMNPV filed in GenBank under the reference NC_001623, Autographa californica nucleopolyhedrosis genome, complete sequence
reference NC_001623, Autographa californica nucleopolyhedrosis genome, complete sequence
(116) Caption of table 2: the genes involved in the elaboration of the post-translational modifications (example: glycosylation, endoproteolytic cleavage) were inserted into non-essential genes/regions of the bacmids. Except in the case of the over-expression of cellular furin which is produced under the control of a strong late promoter P10S1, the promoters used to control the expression of these genes are early so as to produce these enzymes before the biosynthesis of the proteins of interest that will be expressed under the control of late promoters.
(117) BacMid2-Fur was constructed from the BacMid2 obtained in example 2. The gene encoding furin of the lepidoptera cell Sf9 (fur) was cloned downstream of a synthetic late promoter P10S1 of sequence:
(118) TABLE-US-00004 (SEQIDNO:17) 5-ATAAGTATTTTAATCTTTTCGTTTGTATATTAATTAAAATACTATAC TGTATAAAAAAACCTATAAATATCCCGGATTATTCATACCGTCCCACCAT CGGGCGTACGCCACC-3.
(119) The gene fur was integrated in the chitinase-cathepsin locus. The transfer vector, pVT/Chit-Cath of which the construction is described in example 5 was used. The expression cassette comprising the gene fur under control of the synthetic promoter P10S1 was introduced at the unique site XbaI of the pVT/Chit-Cath (position 106160 in the genome of the baculovirus), to give the plasmid pVT/Chit-Cath-Fur. The gene fur was cloned in the same direction as the inactivated cathepsin gene.
(120) A bacterial expression cassette zeocin resistance (Zeo) composed as follows: [Bacterial promoter T5N25-Zeo-terminator rrnBT1] containing a site Bsu36I on either side was cloned at the site EcoRI of pVT/Chit-Cath-Fur, to give the plasmid pVT/Chit-Cath-Fur-Zeo. This second cassette enables the expression of the gene Zeo and thus confers on the bacterium bearing this plasmid zeocin resistance.
(121) The recombination fragment of 5927 pb was prepared after digestion of the plasmid pVT/Chit-Cath-Fur-Zeo by BglII thus generating flanking regions for the homologous recombination of 652 pb and 704 pb on either side of the fragment. After electroporation in the bacterium EL350/BacMid2, the bacteria were selected on zeocin. As described in
(122) BacMid2/Fur was thus obtained. The genomes of these new BacMids were controlled by Southern (
Example 10: Construction of BacMid2-Gal Enabling the Generation of Recombinant Baculoviruses Expressing Galactosylated Proteins
(123) BacMid2-Gal was constructed from the BacMid2 obtained in example 2. The DNAc encoding 2 glycosyltransferases missing in lepidoptera cells and necessary for the biosynthesis of galactosylated glycans, human NI-acetylglucosaminyltransferase II (GNT-II) (EC 2.4.1.143, Accession n NM_002408.3) and bovine 1,4 galactosyltransferase (1,4GalT) (EC 2.4.1.38, Accession n NM_177512.2) were introduced into non-essential genes or regions of BacMid2 by homologous recombination. In order that the enzymatic activities of 1,4GaIT and GNT-II are expressed before the synthesis of the transgene(s) of interest encoding a polypeptide of interest, the transgenes encoding GNT-II and 1,4GaIT were cloned downstream of early viral promoters such as described in table 2.
(124)
(125) The addition of transgenes encoding respectively GNT-II and 1,4GaIT was carried out in an iterative manner in BacMid2. Insertion of the transgene GNT-II
(126) This transgene was introduced in position 29226 of the viral genome by homologous recombination between orf35 (v-ubi) and orf36 (39k) designated intergenic region IG35/36. In order to be able to insert the expression cassette in the genome of BacMid, the unique sites for cloning XbaI (italics) and Bsu36I (underlined) were integrated by PCR in the region IG35/36 with the following primers:
(127) TABLE-US-00005 antisenseig35/36 (SEQIDNO:7) 5-CCTGGTAATTTTTGACCACGG-3(position28806inthe viralgenome) and Sensemutig35/36 (SEQIDNO:6) 5-GCCTTAGGTCTAGAGTATATTTAATGGTTTTTATTATTGTTATTATT AATACCCTCC-3then Antisensemutig35/36 (SEQIDNO:5) 5-CTCTAGACCTAAGGCATAAAAGTTTTTTATTTAATCTGACATATTTG TATCTTGTGTATTATCGC-3 and Senseig35/36 (SEQIDNO:4) 5-CGCAGCAATTCCAGCGAGC-3(position29657inthe viralgenome)
(128) The PCR fragment obtained of 861 bp was cloned in a plasmid pGEM Teasy and controlled by sequencing, to give the plasmid pGEM-IG35/36.
(129) Two expression cassettes were introduced into the above plasmid pGEM-IG35/36.
(130) A viral expression cassette, composed as follows [Promoter P9 of the densovirusJcNDVtransgene encoding GNTIIstop TkpA] was inserted at the level of the site XbaI, to give the plasmid pGEM-IG35/36-GNTII. The Promoter P9 of the densovirus JcNDV is described in Shirk P D, Bossin H, Furlong R B, Gillett J L. Regulation of Junonia coenia densovirus P9 promoter expression. Insect Mol Biol. 2007 October; 16(5):623-33. Epub 2007 Aug. 22.
(131) The bacterial expression cassette zeocin resistance (Zeo) (obtained from the commercially available plasmid pCR Blunt, InVitrogen) composed as follows: [Bacteria/promoter T5N25-Zeoterminator rrnBT1] was cloned at the level of the site Bsu36I. This second cassette enables the expression of the Zeo gene and thus will confer on the bacterium bearing it zeocin resistance, to give the plasmid pGEM-IG35/36-GNTII-Zeo. The bacterial promoter T5N25 is described in Gentz R, Bujard H. Promoters recognized by Escherichia coli RNA polymerase selected by function: highly efficient promoters from bacteriophage T5. J Bacteriol. 1985 October; 164(1):70-7. The transcription terminator rrnBT1 is described in Kwon Y S, Kang C. Bipartite modular structure of intrinsic, RNA hairpin-independent termination signal for phage RNA polymerases. J Biol Chem. 1999 Oct. 8; 274(41):29149-55.
(132) The recombination fragment of 3493 bp<IG35/36-GN77I-Zeo> obtained after digestion by EcoRI of the plasmid generated above pGEM-IG35/36-GNTII-Ze and having flanking regions for the homologous recombination of 420 bp and 428 pb on either side of the recombination fragment, was electrophoresed in the bacteria EL350/BacMid2. The bacteria containing BacMid2/GNTII-Zeo (E. coli/EL350/BacMid2/GNTII-Zeo) were selected for their kanamycin, hygromycin and zeocin resistance. The DNA of 3 clones of Bacmid2/GNTII-Zeo selected was extracted then the GNT-II and Zeo genes inserted into the region IG35/36 were controlled by PCR then sequencing.
(133) The bacterial expression cassette flanked on either side of a site Bsu36I was next eliminated by simple digestion by Bsu36I, repair of the ends of the DNA with the DNA polymerase of Klenow then ligation of the plasmid on itself. It should be noted that the repaired sequence Bsu36I [5 CCTNATNAGG 3] was conserved in Bacmid2/GNTII thus generated after ligation of the plasmid. This sequence is thus present in the recombinant baculovirus and it may constitute a specific signature.
(134) The transgene encoding GNTII was cloned in the same direction as the gene 39K.
(135) BacMid2/GNTII was thus obtained then controlled as described above before being used for the insertion of the gene encoding 1,4GaIT. Insertion of the gene 1,4GaIT
(136) The transgene encoding 1,4GalT was integrated in the locus of the non-essential gene egt (Ecdysteroid glycosyltransferase, ORF15, position in the genome position 11426-12946 of the viral genome AcMNPV) of BacMid2/GNTII according to the general principle described above. The fragment PstI-BamHI of 5110 bp (position 9999 to 15110 in the viral genome of AcMNPV) containing the gene egt, was cloned beforehand in a plasmid pUC to give the plasmid pUC-EGT. Then, the viral expression cassette comprising the DNAc encoding bovine 1,4GaIT under control of the promoter gp67 of OpMNPV was introduced into the gene egt by insertion (inactivation of the gene by insertion) at the unique site XbaI (position 12782 in the genome of the baculovirus) present in the sequence encoding the gene egt, to give the plasmid pUC-EGT-GaIT. The transgene encoding 1,4GT was cloned in the same direction as the gene egt.
(137) An adaptor NsiI-Bsu36I-NsiI was next inserted in the site NsiI situated downstream of the gene 1,4GaIT, which enabled the introduction of the bacterial expression cassette Zo in Bsu36I generating the plasmid pUC-EGT-GalT-Zeo.
(138) The recombination fragment of 3128 bp was prepared after digestion of the above plasmid pUC-EGT-GalT-Zeo by SnaBI-NruI thus generating flanking regions for the homologous recombination of 474 bp and 866 pb on either side of the fragment. After electroporation in the bacterium EL350/BacMid2-GNTII, the bacteria were selected on zeocin. As previously, the bacterial expression cassette Zo was eliminated by digestion Bsu36I, repair then ligation.
(139) BacMid2/GNTII/1,4GalT (also called BacMid2-Gal or BacGal) was thus obtained. The genome of BacMid2-Gal was controlled by Southern then sequencing of all the integrated genes.
Example 11: Construction of BacMid2Gal-Fur Enabling the Generation of Recombinant Baculoviruses Correctly Expressing Matured Galactosylated Proteins
(140) BacMid2-Gal-Fur was constructed as described for BacMid2-Fur (Example 9).
(141) The bacteria EL350/BacMid2-Gal were electrophoresed with the recombination fragment of 5927 pb described in example 9, then selected on zeocin. As previously, the bacterial expression cassette Zo was eliminated by digestion Bsu36I, repair then ligation. BacMid2Gal-Fur was thus obtained. The genome of the bacmid was controlled by Southern (
Examples 12: Construction of BacMid-Sia3 (or BacSia3)
(142) The transgenes encoding human CMPNeuAc synthase (CMPNeuAc synthase or CMPNeuAcS) (EC 2.7.7.43, accession n NM_018686.5), human NeuAc synthase (NeuAc Synthase or NeuAcS) (EC 2.5.1.56, accession n AF257466) and human 2,3 sialyltransferase (ST3), ST3GalIV (EC 2.4.99.4, accession n X74570) were inserted into BacMid2/GNTII-1,4GT in an iterative manner according to the general principle described in
(143) The Applicant chose to clone these two enzymes head to tail under the control of very early promoters, the promoter IE1 (immediate-early 1) of the baculovirus of Choristoneura fumiferana for the control of the expression of the gene CMP NeuAc synthase and that of the baculovirus of Lymantria dispar for the control of the expression of the gene NeuAc synthase (see Table 2) The region comprising the gene iap2 (ORF71) of the baculovirus AcMNPV (position in the genome 61016-61765) was amplified beforehand by double PCR with the following primers:
(144) TABLE-US-00006 Senseiap2 (SEQIDNO:8) 5-GATATTGTGTGCTCAATGTC-3(Position60736inthe viralgenome) AntisenseBstBI (SEQIDNO:9) 5-CCTAAGGTCTAGATTCGAATACGTGTGTCG-3then SenseBstBI (SEQIDNO:10) 5-CGAATCTAGACCTTAGGCCGCGGCTAAGCGTTAAACC-3 Antisenseiap2 (SEQIDNO:11) 5-CGATCACCGTCGCTGTCGTCTTC-3(Position61951in theviralgenome)
(145) These successive PCRs also made it possible (i) to integrate the unique sites Bsu36I (underlined above) and XbaI (double underlined above) and (ii) to delete a large part of the sequence encoding iap2, deletion of 335 bp/112 amino acids. The amplified fragment of 896 bp was cloned in a plasmid pGEM Teasy, to give the plasmid pGEM-IAP2.
(146) A viral expression cassette, composed as follows [Stop SV40-CMPNeuAc Synthase-Promoter IE1Cf-Promoter IE1Ld-NeuAcSynthase] was inserted at the site XbaI of pGEM-IAP2, to give the plasmid pGEM-iap2-CMPNeuAcS-NeuAcS.
(147) The bacterial expression cassette zeocin resistance (Zeo) composed as follows: [Bacterial promoter T5N25-Zeo-terminator rrnBT1] was cloned at site Bsu36I of pGEM-iap2-CMPNeuAcS-NeuAcS, to give the plasmid pGEM-iap2-CMPNeuAcS-NeuAcS-Zeo. This second cassette enables the expression of the Zeo gene and thus confers on the bacterium bearing this plasmid zeocin resistance.
(148) The recombination fragment [CMPNeuAc-NeuAcS-Zeo] of 4548 pb was prepared after digestion of the plasmid pGEM-iap2-CMPNeuAcS-NeuAcS-Zeo by the restriction endonuclease NotI which generates flanking regions for the homologous recombination of 486 bp and 396 pb on either side of the fragment. The bacteria EL350/BacMid2-GNTII-1,4GT were electrophoresed with the recombination fragment thus generating BacMid2-GNTII-1,4GT-CMPNeuAcS-NeuAcS-Zo. As previously, the zeocin resistance cassette was eliminated after digestion by Bsu36I, repair then relegation. BacMid2-GNTII-1,4GT-CMPNeuAcS-NeuAcS was thus obtained. Cloning of the transgene a2,3-sialyltransferase IV (ST3GalIV) in the intergenic region comprised between orf51 and orf52 (IG51/52) of BacMid2-GNTII-1,4GT-CMPNeuAcS-NeuAcS.
(149) This region located in the fragment EcoRI N of the baculovirus AcMNPV was isolated after amplification by double PCR with the following primers:
(150) TABLE-US-00007 SenseIG51/52 (SEQIDNO:12) 5-GGAAAACTTTCCGAAGACGAAC(position43814inthe viralgenome) and AntisenseXba/IG51/52 (SEQIDNO:13) 5-CCTAAGGTCTAGAGTGCCTTTTGTTTGCTATTTTGCGCCG-3 then SenseXba/IG51/52 (SEQIDNO:14) 5-CTCTAGACCTTAGGTCCGCGCTCTCCCACGC-3 and AntisenseIG51/52 (SEQIDNO:15) 5-GGTGCAGAACATAATGACGTGGCCTTAC(position44723 intheviralgenome)
(151) During these successive PCRs there is addition of 2 unique sites Bsu36I (underlined above) and XbaI (double underlined above) in the intergenic region ORF51/ORF52 which will enable integration of the expression cassette ST3 at site XbaI in position 44298 in the viral genome. The fragment obtained of 922 bp was cloned in a pGEM T easy (Promega), to give the plasmid pGEM-IG51/52.
(152) As for the other enzymes, ST3GalIV must be present in the cells before the glycoproteins of interest are expressed. We chose the promoter IE1 of the shrimp virus WSSV (White Spot Syndrome Virus) identified as being a functional cell promoter 519 of immediate-early type (See Table 2)(Liu et al., Virology, 2005; Liu et al. J of virology, 2007; Gao et al., J. Biotechnology, 2007).
(153) A viral expression cassette, composed as follows [promoter WSSV-ST3] was inserted at site XbaI of pGEM-IG51/52, to give the plasmid pGEM-IG51/52-ST3. ST3GalIV was cloned in the opposite direction of orf51.
(154) The bacterial expression cassette zeocin resistance (Zeo) composed as follows: [Bacterial promoter T5N25-Zeo-terminator rrnBT1] was cloned at site Bsu36I of pGEM-ORF51-ST3, to give the plasmid pGEM-IG51/52-ST3-Zeo. This second cassette enables the expression of the Zeo gene and thus confers on the bacterium bearing this plasmid zeocin resistance.
(155) A recombination fragment [ST3Ga/IV-Zeo] of 2589 pb was generated from pGEM-IG51/52-ST3-Zeo by digestion by the restriction endonuclease NotI. This digestion generated flanking regions for the homologous recombination of 498 bp and 411 pb on either side of the expression cassette. Homologous recombination was carried out in the bacterium EL350/BacMid2-GNTII-1,4GT-CMPNeuAcS-NeuAcS, generating BacMid2-GNTII-1,4GT-CMPNeuAcS-NeuAcS-ST3. (or BacSia3). The genome of BacSia3 was controlled by Southern then sequencing of all the integrated genes.
Example 13: Construction of BacMid-Sia6 (or BacSia6)
(156) Cloning of the transgene a2,6-sialyltransferase I (ST6GalI) in the intergenic region orf51/orf52 (IG51/52) of BacMid2-GNTII-1,4GT-CMPNeuAcS-NeuAcS.
(157) The method for cloning the gene encoding human 2,6 sialyltransferase, ST6GalI (EC 2.4.99.1, accession n X17247) is similar to that described in example 12 for the transgene encoding ST3GalIV, summarised as follows: a viral expression cassette, composed as follows [promoter WSSV-ST6] was inserted at site XbaI of pGEM-IG51/52, to give the plasmid pGEM-IG51/52-ST6. ST6GalI is cloned in the opposite direction to orf51 the bacterial expression cassette zeocin resistance (Zeo) composed as follows: [Bacterial promoter T5N25-Zeo-terminator rrnBT1] was cloned at site Bsu36I of pGEM-ORF51-ST6 generating the plasmid pGEM-IG51/52-ST6-Zeo. This second cassette enables the expression of the Zeo gene and thus confers on the bacterium bearing this plasmid zeocin resistance. A recombination fragment [ST6Ga/I-Zeo] of 2825 pb was generated from pGEM-IG51/52-ST6-Zeo by digestion by restriction endonuclease NotI. This digestion generated flanking regions for the homologous recombination of 498 bp and 411 pb on either side of the expression cassette. The homologous recombination was carried out in the bacterium EL350/BacMid2-GNTII-1,4GT-CMPNeuAcS-NeuAcS, generating BacMid2-GNTII-1,4GT-CMPNeuAcS-NeuAcS-ST6 (or BacSia6). The genome of BacSia6 was controlled by Southern then sequencing of all the integrated genes.
Example 14: Construction of BacMid-Sia6II (or BacSia6-II)
(158) a. Cloning of the transgene a2,6-sialyltransferase I (ST6GalI) in ORF119 (PIF1) of BacMid2-GNTII-1,4GT-CMPNeuAcS-NeuAcS.
(159) ORF119 (position in the genome 100699-102291), encoding PIF1, protein not essential for viral replication, is located in the fragment EcoRI E of the baculovirus AcMNPV. A fragment on either side of the gene was obtained after amplification by double PCR with the following primers:
(160) TABLE-US-00008 Sensepif1 (SEQIDNO:18) 5-GAATACAACGCCACATCTATTCCTAGTACAAC-3(position 100247intheviralgenome) and pif1bac5 (SEQIDNO:19) 5-CTAGAGGCGTTAACCTAAGGTACTTATTGGAGAATGTCCGAGTATTT TTG-3then pif1for3 (SEQIDNO:20) 5-CCTTAGGTTAACGCCTCTAGAACATGAGCATTTTAAAAGTTGTAGA AGCG-3 and RevPif1 (SEQIDNO:21) 5-CATTAACAATTACTACGGCGCATTTTGACCATC-3(position 102825intheviralgenome)
(161) These successive PCRs made it possible to eliminate the totality of ORF119, to integrate the unique sites Bsu36I (underlined above) and XbaI (double underlined above). The site XbaI will enable the integration of the expression cassette ST6 in position 100697 in the viral genome. The fragment obtained of 998 bp was cloned in a pGEM Teasy (Promega), to give the plasmid pGEM-PIF1.
(162) The viral expression cassette, described in example 12 [promoter WSSV-ST6] was inserted at site XbaI of pGEM-PIF1, to give the plasmid pGEM-PIF1-ST6. ST6GalI was cloned in the direction of pif1.
(163) The bacterial expression cassette zeocin resistance (Zeo) composed as follows: [Bacterial promoter T5N25-Zeo-terminator rrnBT1] was cloned at site Bsu36I of pGEM-PIF1-ST6, to give the plasmid pGEM-PIF1-ST6-Zeo. This second cassette enables the expression of the Zeo gene and thus confers on the bacterium bearing this plasmid zeocin resistance.
(164) A recombination fragment [ST6Ga/I-Zeo] of 2903 pb was generated from pGEM-PIF1-ST6-Zeo by digestion by the restriction endonuclease NotI. This digestion generated flanking regions for the homologous recombination of 498 bp and 411 pb on either side of the expression cassette. The homologous recombination was carried out in the bacterium EL350/BacMid2-GNTII-1,4GT-CMPNeuAcS-NeuAcS, generating BacMid2-GNTII-1,4GT-CMPNeuAcS-NeuAcS-ST6-II (or BacSia6-II). The genome of BacSia6-II was controlled by Southern (
Example 15: Construction of BacMid-Sia3/6 or BacSia3/6
(165) Head to tail cloning of the transgenes ST6GalI and ST3GalIV in the intergenic region orf51/orf52 (IG51/52) in BacMid2-GNTII-1,4GT-CMPNeuAcS-NeuAcS.
(166) The cloning method is similar to that described in Examples 12 and 13 for the transgene encoding ST3GalIV and the transgene encoding ST6GalI, summarised as follows: a viral expression cassette comprising a transgene encoding ST6GalI and a transgene encoding ST3GalIV, composed as follows [ST6-promoter WSSV-actin promoter 3 B, mori-ST3-Stop actin 3] was inserted at site XbaI of pGEM-IG51/52, to give the plasmid pGEM-IG51/52-ST3/ST6. the bacterial expression cassette zeocin resistance (Zeo) composed as follows: [Bacterial promoter T5N25-Zeo-terminator rrnBT1] was cloned at site Bsu36I of pGEM-IG51/52-ST3/ST6, to give the plasmid pGEM-IG51/52-ST3/ST6-Zeo. This second cassette enables the expression of the Zeo gene and thus confers on the bacterium bearing this plasmid zeocin resistance.
(167) A recombination fragment [ST3/ST6-Zeo] of 5008 pb was generated from pGEM-IG51/52-ST3/ST6-Zeo by digestion by the restriction endonuclease NotI. This digestion generated flanking regions for the homologous recombination of 490 bp and 426 pb on either side of the expression cassette. The homologous recombination was carried out in the bacterium EL350/BacMid2-GNTII-1,4GT-CMPNeuAcS-NeuAcS, to give BacMid2-GNTII-1,4GT-CMPNeuAcS-NeuAcS-ST3/ST6 (or BacSia3/6). The genome of BacSia3/6 was controlled by Southern then sequencing of all the integrated genes.
Example 16: Use of BacMid2-Fur for the Production of Mature HIV1 Glycoprotein Gp160
(168) HIV1 gp160 must undergo a step of maturation in order that the virus is infectious and that the surface glycoproteins of the virus are organised into trimers. These structures are today considered as essential for the formation of epitopes of interest necessary for the elaboration of a vaccine against HIV-1. This maturation is carried out by cellular furin which is going to cleave gp160 into gp120+gp41. The production of gp160 in a recombinant form in general leads to a partially matured form and does so whatever the expression system.
(169) In order to obtain a completely matured gp160 we integrated the gene encoding furin of the Sf9 cell in the viral genome under the control of a very active promoter, a promoter P10-like called P10S1 and constructed BacMid2-Fur (Example 9).
(170) From this bacmid, we constructed a double-recombinant virus expressing 2 proteins of HIV1, polyprotein Pr55Gag and gp160. The production of these 2 proteins leads to the secretion in the culture medium of virus-like-particles (VLP). In this experiment we concentrated (noted C and NC for non-concentrated) the VLP secreted with a solution of Retro Concentin Virus Precipitation (SBI, reference RV100A-1). The different samples obtained after infection with a wild virus BACWT or multi-recombinant viruses expressing gp160 and Pr55Gag (BAC/gp160/Gag), gp160 and Pr55Gag and furin (BAC/gp160/Gag) or mono-recombinant viruses like the virus BAC gp120 which expresses uniquely soluble gp120 and the virus BACGag which expresses uniquely the polyprotein Pr55Gag (BACGag) were analysed by Western blot with an antibody anti-gp120, Panel A (goat polyclonal antibodies directed against gp120 of HIV1, reference Ab21179, Abcam) or an antibody anti-Gag, Panel B (Anti-p55+p24+p17, Reference Ab63917, Abcam).
(171) As is shown in
Example 17: Use of BacMid2-Gal for the Production of Galactosylated Antibodies
(172) A terminal N-galactosylation being a characteristic of glycosylation of Asn297 situated in the constant domain of the IgG (
(173) BacMid2-Gal was used like BacMid2 described previously (Examples 4 and 6) for the generation in a single step of a double recombinant baculovirus (
(174) Insertion of Transgenes Encoding the Heavy and Light Chains of an Antibody.
(175) 1. Principle of the Generation of Recombinant Baculoviruses.
(176) DNAc encoding the variable regions VH and VL of the antibodies of interest were inserted into specific baculovirus transfer vectors (pVT) of the heavy and light chains of the antibodies, pVT/gp37-H (for cloning the variable region of the heavy chain) (
(177) 2. Construction of a Recombinant Virus Expressing a Galactosylated Antibody.
(178) Recombinant viruses expressing the same antibodies were produced from BacMid2 and BacMid2-Gal. The antibodies produced after infection of Sf9 cells with the recombinant virus derived from BacMid2 serves as control since they have an insect glycosylation, that is to say glycan motifs of paucimannosidic type and to a lesser proportion of oligomannosidic type (
(179) The fragments of DNAc encoding the variable regions of the heavy and light chains of the antibodies of interest were cloned in the respective transfer vectors (pVT/gp37-H and pVT/PH-L). In the course of this cloning, the complete genes encoding the 2 chains of antibodies are reconstituted (
(180) The Sf9 cells were transfected by lipofection with the loaded pVT/gp37-H and pVT/PH-L and DNA of Bacmid2-Gal or BacMid2 (
(181) Several baculoviral clones were selected, amplified and their genome extracted to be analysed by Southern blot. The genes encoding the heavy and light chains inserted into the baculoviral genome were also amplified by PCR then sequenced. Production and purification of the recombinant antibodies.
(182) Sf9 cells suited to the growth in serum free medium were infected at a level of 3 PFU/cell. After 3 days of infection, the culture supernatant was collected and deposited on a Protein A Sepharose column (GE-Healthcare). The quality of the antibodies was verified after migration in polyacrylamide gel and silver staining. Analysis of glycosylation by lectin blot.
(183) Principle of lectin blot: lectins are molecules that attach themselves specifically on glycan motifs. It is thus very simple to demonstrate the presence of a particular glycan bound to a protein after electrophoresis in polyacrylamide gel, transfer onto a nitrocellulose membrane and incubation of the membrane with a biotin conjugated lectin (example biotinylated lectin RCA.sub.120, reference B1085, Vector Laboratories) or with digoxigenin (example the lectins of the DIG Glycan Differentiation Kit, reference 11210238001, Roche). The presence of lectins is then detected indirectly thanks to an antibody directed against biotin or the digoxigenin itself peroxidase conjugated or with alkaline phosphatase. The presence of these enzymes is then detected thanks to their enzymatic activity which will generate either a brown red precipitate for peroxidase or a blue coloration for alkaline phosphatase. Experimentation
(184) The production of antibodies was controlled by Western blot. The proteins were separated by electrophoresis on a polyacrylamide gel at 10% in the presence of SDS and 2-mercaptoethanol then transferred onto a nitrocellulose membrane (Protran 0.45 m NC, GE Healthcare). The transfer of the proteins was verified after ponceau red staining. The membrane was incubated with (
(185) Analysis by lectin blot (
(186) 3. Results
(187) Human (
(188) These experiments clearly demonstrate that the BacGal virus is capable of complementing Sf9 cells to be able to produce galactosylated glycoproteins.
Example 18: Use of BacMid-Sia3
(189) 1. Construction of a Recombinant Baculovirus Expressing its Alpha 2,3 Sialylated Glycoprotein Envelope Gp64.
(190) The activity of BacSia3 was controlled using as model protein the surface glycoprotein of the virus, gp64. Glycoprotein gp64 is the major glycoprotein of the baculovirus, it is involved in all the first steps of infection. It is located on the surface of the virus. It has been shown that this glycoprotein is capable of being galactosylated and sialylated (Jarvis et al. 1995). To do so, a recombinant virus was obtained by homologous recombination between BacMidSia3 and the empty transfer vectors pVTPH and pVT/gp37. The presence of 2,3 sialyl motifs was demonstrated thanks to a lectin blot carried out with lectin di-CBM40 described in the article (Ribeiro et al., 2016). Generation and cloning of the recombinant baculoviruses.
(191) The Sf9 cells were transfected by lipofection with empty pVTPH and pVT/gp37 and DNA of Bacmid2 (control) or BacMid-Sia3 obtained in example 12 and according to the principle of
(192) The lectin used in this example was biotinylated di-CBM40. The protocol that was used is similar to that which is described in example 17. After saturation, the membrane was incubated with diCBM40-Biotinylated lectin diluted 1/200 (5.7 g/ml) in TBS-T or with SNA-Dig lectin (Roche, Kit DIG Glycan Differentiation Kit) diluted 1/1000 in TBS-T. The revelation of the membranes was carried out as described in example 17. The presence of gp64 was controlled by Western blot in the presence of an anti-gp64 antibody (monoclonal mice antibodies AcV5 reference SC65499, Santa Cruz Biotechnology).
(193) 2. Results
(194) As shown in
(195)
(196) These experiments clearly demonstrate that the virus BACSia3 is capable of complementing Sf9 cells to be able to produce 2,3 sialylated glycoproteins.
Example 19: Use of BacMid-Sia6
(197) 1. Construction of a Recombinant Baculovirus Expressing a Recombinant Alpha 2,6 Sialylated Protein.
(198) The activity of BacSia6 was controlled using as model protein Glycoprotein G Vesicular Stomatitis virus, VSVg, the protein X and glycoprotein gp64 of the baculovirus. Generation and cloning of the recombinant baculoviruses.
(199) The DNAc fragment encoding the protein of interest was cloned in pVTPH according to the general principle described in
(200) The proteins were produced as described in example 18. Analysis of glycosylation by lectin blot.
(201) The presence of recombinant proteins was controlled by Western blot. After transfer of the proteins, the nitrocellulose membranes were incubated in the presence of different specific antibodies, anti-VSVg (mice monoclonal antibodies peroxidase conjugated, reference A5977, Sigma), anti-gp64 (mice monoclonal antibodies AcV5 reference SC65499, Santa Cruz Biotechnology). Revelation was carried out either directly as described in example 16 when the antibody is directly peroxidase conjugated or after incubation with a secondary antibody peroxidase conjugated (rabbit anti-mouse IgG serum peroxidase conjugated, reference A9044). The peroxidase was revealed by chemiluminescence with the ECL SuperSignal West Pico Chemiluminescent Substrate system (reference 34077, Thermo Scientific).
(202) The lectin that was used in this example was SNA (Sambucus nigra agglutinin) which recognises 2,6 bound sialic acids. SNA was revealed as described in example 17.
(203) 2. Results
(204) a. Glycosylation of Protein X Expressed by the Recombinant Baculovirus Generated from BacSia6
(205) As shown by Western lot,
(206) Analysis by lectin Blot,
(207) b. Glycosylation of VSVg Expressed by the Recombinant Baculovirus Generated from BacSia6.
(208) VSVg being a membranal protein, we analysed the pellets of the infected cells. As shown in
(209) Conversely, analysis by lectin blot with SNA (revelation protocol described in example 17) showed an intense marking of protein VSVg uniquely when it is expressed from the baculovirus derived from BacSia6 (
(210) c. Glycosylation of Gp64 of the Recombinant Baculovirus Generated from BacSia6.
(211) We also verified that the recombinant virus expressing sialylated VSVg (see above) was also bearing a sialylated gp64. To do so, the baculoviruses secreted in the culture supernatant were sedimented (35,000 rpm for 60 minutes, Beckman Optima LE-80K centrifuge, TI-70-1 rotor) then taken up by a lysis buffer to be analysed by Western blot then lectin blot. As previously, fetuin was used as positive marker for SNA (
(212)
(213) These experiments clearly demonstrate that the BacSia6 virus is capable of complementing Sf9 cells to be able produce 2,6 sialylated glycoproteins.
Example 20: BacMid Sia6-II Virus
(214) We analysed the genome of BacMidSia6II by Southern blot to control its genomic organisation.
(215) As shown in
Example 21: Use of BacMid Sia3/6
(216) 1. Construction of a Recombinant Baculovirus Expressing a Recombinant Alpha 2,3 and Alpha 2,6 Sialylated Protein.
(217) The activity of BacSia3-6 was controlled using as model protein the surface glycoprotein of the virus, gp64. To do so, a recombinant virus was obtained by homologous recombination between BacMidSia3/6 and the empty transfer vectors pVTPH and pVT/gp37. The presence of 2,3 sialyl- and 2,6 sialyl-motifs was analysed by lectin blot carried out in the presence of lectin di-CBM40 which recognises 2,3 sialic acids and to a lesser extent 2,6 bound sialic acids and SNA which only recognises 2,6 bound sialic acids and not those which are a2,3 bound. Generation and cloning of recombinant baculoviruses.
(218) Sf9 cells were transfected by lipofection with empty pVTPH and pVT/gp37 and DNA of Bacmid2 (control) or BacMid-Sia3/6 obtained in example 15. After 7 days of infection at 28 C., the viruses secreted in the culture supernatant were cloned by the phage plaque assay technique. Four viral clones were selected, amplified and their genome extracted to be analysed by Southern blot. The gene inserted in the viral genome was amplified by PCR then sequenced. Production of recombinant proteins
(219) The proteins were produced as described in example 17. Analysis of glycosylation by lectin blot
(220) The analysis protocols were identical to those described in Examples 20, 21 and 22.
(221) 2. Results
(222) The gp64 produced by the GalSia3-6 virus is the only one which is recognised both by SNA (
(223) These experiments clearly demonstrate that the BacSia3-6 virus is capable of complementing Sf9 cells to be able to produce a2,3 and a2,6 sialylated glycoproteins.
REFERENCES
Patents
(224) WO 01/12829 WO 2013/005194
BIBLIOGRAPHIC REFERENCES
(225) Palmberger D, Wilson I B, Berger I, Grabherr R, Rendic D. SweetBac: a new approach for the production of mammalianised glycoproteins in insect cells. PLoS One. 2012; 7(4):e34226. Chang G D, Chen C J, Lin C Y, Chen H C, Chen H. Improvement of glycosylation in insect cells with mammalian glycosyltransferases. J Biotechnol. 2003 Apr. 10; 102(1):61-71. Possee R D, Hitchman R B, Richards K S, Mann S G, Siaterli E, Nixon C P, Irving H, Assenberg R, Alderton D, Owens R J, King L A. Generation of baculovirus vectors for the high-throughput production of proteins in insect cells. Biotechnol Bioeng. 2008 Dec. 15; 101(6):1115-22. Tan J, D'Agostaro A F, Bendiak B, Reck F, Sarkar M, Squire J A, Leong P, Schachter H. The human UDP-N-acetylglucosamine: alpha-6-D-mannoside-beta-1,2-N-acetylglucosaminyltransferase II gene (MGAT2). Cloning of genomic DNA, localization to chromosome 14q21, expression in insect cells and purification of the recombinant protein. Eur J Biochem. 1995 Jul. 15; 231(2):317-28. D'Agostaro G, Bendiak B, Tropak M. Cloning of cDNA encoding the membrane-bound form of bovine beta 1,4-galactosyltransferase. Eur J Biochem. 1989 Jul. 15; 183(1):211-7. Mnster A K, Eckhardt M, Potvin B, Mhlenhoff M, Stanley P, Gerardy-Schahn R. Mammalian cytidine 5-monophosphate N-acetylneuraminic acid synthetase: a nuclear protein with evolutionarily conserved structural motifs. Proc Natl Acad Sci USA. 1998 Aug. 4; 95(16):9140-5. Lawrence S M, Huddleston K A, Pitts L R, Nguyen N, Lee Y C, Vann W F, Coleman T A, Betenbaugh M J. Cloning and expression of the human N-acetylneuraminic acid phosphate synthase gene with 2-keto-3-deoxy-D-glycero-D-galacto-nononic acid biosynthetic ability. J Biol Chem. 2000 Jun. 9; 275(23):17869-77. Kitagawa H, Paulson J C. Cloning of a novel alpha 2,3-sialyltransferase that sialylates glycoprotein and glycolipid carbohydrate groups. J Biol Chem. 1994 Jan. 14; 269(2):1394-401. Grundmann U, Nerlich C, Rein T, Zettimeissl G. Complete cDNA sequence encoding human beta-galactoside alpha-2,6-sialyltransferase. Nucleic Acids Res. 1990 Feb. 11; 18(3):667. Cieplik M, Klenk H D, Garten W. Identification and characterization of Spodoptera frugiperda furin: a thermostable subtilisin-like endopeptidase. Biol Chem. 1998 December; 379(12):1433-40. Juliant S, Lvque M, Crutti P, Ozil A, Choblet S, Violet M L, Slomianny M C, Harduin-Lepers A, Crutti M. Engineering the baculovirus genome to produce galactosylated antibodies in lepidopteran cells. Methods Mol Biol. 2013; 988:59-77. Jarvis D L, Finn E E. Biochemical analysis of the N-glycosylation pathway in baculovirus-infected lepidopteran insect cells. Virology. 1995 Oct. 1; 212(2):500-11. Ribeiro J P, Pau W, Pifferi C, Renaudet O, Varrot A, Mahal L K, Imberty A. Characterization of a high-affinity sialic acid-specific CBM40 from Clostridium perfringens and engineering of a divalent form. Biochem J. 2016 Jul. 15; 473(14):2109-18