MODULATION OF THE CRISPR ROADBLOCK
20250011769 ยท 2025-01-09
Inventors
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N15/111
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12N2320/52
CHEMISTRY; METALLURGY
International classification
Abstract
Provided are modified guide RNAs (gRNAs) for use with CRISPR Cas proteins. A modified guide RNA comprises at its 5 or 3end at least 5 nucleotides that comprise an inverted repeat sequence having a segment targeted to a spacer sequence in DNA. The inverted repeat sequence is configured so that it can concurrently be hybridized to the spacer sequence and to the complementary strand of the DNA comprising the spacer sequence when in the presence of the DNA and the Cas protein. The modified gRNA influences the Cas protein interaction with DNA.
Claims
1. A modified guide RNA for use with a CRISPR Cas protein, the modified guide RNA comprising at its 5 or 3 end at least 5 nucleotides that comprise an inverted repeat sequence having a segment targeted to a spacer sequence in DNA, and wherein the inverted repeat sequence is configured so that it can concurrently be hybridized to the spacer sequence and to the complementary strand of the DNA comprising the spacer sequence when in the presence of the DNA and the Cas protein.
2. The modified guide RNA of claim 1, wherein the inverted repeat comprises 5, 6, or 7 nucleotides.
3. The modified guide RNA of claim 1, wherein the CRISPR Cas protein comprises a Cas9 protein or a dCas9 protein.
4. The modified guide RNA of claim 1, wherein the at least 5 nucleotides are at the 5 end of the modified guide RNA.
5. A ribonucleoprotein comprising a CRISPR Cas protein and a modified guide RNA according to claim 1.
6. A method comprising introducing into cells a modified guide RNA comprising at its 5 or 3 end at least 5 nucleotides that comprise an inverted repeat sequence having a segment targeted to a spacer sequence in DNA, and wherein the inverted repeat sequence is configured so that it can concurrently be hybridized to the spacer sequence and to the complementary strand of the DNA comprising the spacer sequence, and a CRISPR Cas protein that is functional with the guide RNA, such that a complex comprising the guide RNA, the DNA and the Cas protein forms within the cell.
7. The method of claim 6, wherein the inverted repeat comprises 5, 6, or 7 nucleotides.
8. The method of claim 7, wherein the complex is associated with the DNA for a period of time that is longer than a period that time relative to a complex comprising the Cas protein and an unmodified guide RNA targeting the same spacer.
9. The method of claim 8, wherein the DNA comprises a protospacer adjacent motif (PAM) that is at the 5 end of the spacer sequence.
10. The method of claim 6, wherein the CRISPR Cas protein comprises a Cas9 protein or a dCas9 protein.
11. The method of claim 10, wherein the guide RNA and the CRISPR Cas protein are administered to the cells as a ribonucleoprotein complex.
12. The method of claim 11, wherein the cells are eukaryotic cells.
13. The method of claim 12, wherein the Cas protein comprises a nuclear localization signal.
14. A expression vector encoding a guide RNA of claim 1.
15. A cDNA corresponding to a guide RNA of claim 1.
16. A complex comprising a double stranded DNA molecule and a modified guide RNA comprising at its 5 end or 3 end at least 5 nucleotides that comprise an inverted repeat sequence having a segment targeted to a spacer sequence in the double stranded DNA molecule, and wherein the inverted repeat sequence is concurrently hybridized to the spacer sequence and to the complementary strand of the double stranded DNA, and a CRISPR Cas protein that is functional with the modified guide RNA.
17. The double stranded DNA molecule of claim 16, wherein the CRISPR Cas protein is a Cas9 protein or a dCas9 protein.
18. The double stranded DNA molecule of claim 16, wherein the segment at the 5 end of the guide RNA comprises 5, 6, or 7 nucleotides.
19. The double stranded DNA complex of claim 18, wherein the complex is present within a cell.
20. The double stranded DNA complex of claim 19, wherein the cell comprises a eukaryotic cell.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0010]
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
DETAILED DESCRIPTION
[0026] Unless defined otherwise herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains.
[0027] Unless specified to the contrary, it is intended that every maximum numerical limitation given throughout this description includes every lower numerical limitation, as if such lower numerical limitations were expressly written herein. Every minimum numerical limitation given throughout this specification will include every higher numerical limitation, as if such higher numerical limitations were expressly written herein. Every numerical range given throughout this specification will include every narrower numerical range that falls within such broader numerical range, as if such narrower numerical ranges were all expressly written herein.
[0028] As used in the specification and the appended claims, the singular forms a and and the include plural referents unless the context clearly dictates otherwise. Ranges may be expressed herein as from about one particular value, and/or to about another particular value. When such a range is expressed, another embodiment includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by the use of the antecedent about it will be understood that the particular value forms another embodiment. The term about in relation to a numerical value is optional and means for example +/10%.
[0029] The amino acid or polynucleotide sequence as the case may be associated with each GenBank or other database accession number of this disclosure is incorporated herein by reference as presented in the database on the effective filing date of this application or patent.
[0030] The disclosure provides modified gRNAs that are functional with a Cas protein. By functional it is meant that the gRNA is capable of targeting the Cas protein to a DNA target comprising a sequence that is complementary to a spacer sequence in the gRNA.
[0031] The disclosure includes all modified gRNAs in the form as described herein, i.e., a gRNA comprising an appended inverted repeat sequence. The inverted repeat sequence comprises at least 5 nucleotides. In embodiments, the inverted repeat sequence comprises or consists of 5, 6, or 7 nucleotides, although longer or shorter inverted repeat sequences may be included. The term repeat in the described inverted repeat sequence does not mean a repeat sequence in a CRISPR array. A nucleotide that is not part of the inverted repeat sequence may be present between the inverted repeat and the spacer sequence. Any modified gRNA described herein may be a single guide RNA such that includes trans-activating CRISPR RNA (tracrRNA) and a crRNA. In embodiments, the tracrRNA and the crRNA may be separate molecules.
[0032] The inverted repeat sequence is configured so that it can concurrently be hybridized to a sequence in a double stranded DNA molecule and to the complementary strand of the DNA, when in the presence of the DNA and a Cas protein. The term double stranded DNA as used herein a DNA bubble.
[0033] The disclosure includes all complexes that comprise the gRNA, a Cas protein, and DNA as described in the Examples and illustrated in the figures. The disclosure includes such complexes in a cell-free environment, in associate with viral DNA, in individual cells, including prokaryotic and eukaryotic cells in culture, and within cells in multi-cellular organisms, including but not necessarily limited to fungi, plants, and animals. The described compositions and methods may be used, and delivered to cells if desired, for research, diagnostic, prophylactic, and therapeutic purposes.
[0034] The gRNAs of this disclosure include inverted repeat sequences as appended nucleotides at their at a 5 or 3 end ends. An inverted repeat comprises a segment of a gRNA targeted to a spacer sequence in the first strand (canonical Cas effector target strand) of DNA in a double stranded DNA molecule, and a sequence that is targeted to a sequence in the complementary, e.g., a second strand of the double stranded DNA. The inverted repeat sequence is thus configured so that it can concurrently be hybridized to the spacer sequence and to the complementary strand of the DNA when in the presence of the DNA and the Cas protein. A non-limiting illustration of this configuration is shown in
[0035] Embodiments of the disclosure are illustrated using dCas9 and dCas12a. The amino sequence of both of these proteins are known in the art. The demonstration using nuclease dead Cas proteins is expected to be extendable to nuclease active Cas proteins that recognize a DNA target in a gRNA-directed manner. Thus, the disclosure is expected to be suitable for use with any Cas enzyme that is a class I or class II CRISPR enzyme, including all types of Cas proteins encompassed by class I and class II CRISPR systems, including but not limited to Cas3/cascade, Cas9, Cas12 and Cas14 systems.
[0036] Certain aspects of the disclosure are illustrated using regions that are proximal and distal to the PAM sequence. The meaning of proximal and distal PAM will be evident to those skilled in the art from the Examples and Figures, such as those illustrating a PAM distal and PAM collision with an RNAP, such as in
[0037] The disclosure includes using the described Cas proteins and gRNAs for any purpose, non-limiting examples of which include increasing stability of the R-loop, increasing the dwell time of a Cas protein on a DNA substrate, impeding translocation of a motor protein along DNA, and enhancing gene editing, such as by enhancing DNA cleavage, DNA transposition, insertion of a repair template by recombination, correction of single nucleotide mutations or indels, and degradation of DNA, such as by a Cas3 protein.
[0038] In one embodiment, the disclosure comprises determining a DNA spacer sequence for targeting with a described modified gRNA in one of more cells, optionally determining a PAM that is linked to the spacer sequence, designing a modified gRNA comprising an inverted repeat sequence that is capable of concurrently hybridizing to the spacer sequence and to the complementary strand of the DNA comprising the spacer sequence, and delivering the modified gRNA and a Cas protein to the cell, whereby the Cas protein binds to a sequence of the DNA comprising the spacer sequence, and wherein one or more properties of the bound Cas protein are different relative to the properties of the same Cas protein targeting the same spacer, but used with an unmodified gRNA. In embodiments, the DNA spacer sequence is unique to a set of cells within a population of cells. As such, the described modified gRNA and Cas protein can selectively target only a subset of the cells with a larger cell population. Larger populations can include but are not necessarily limited to mixed bacteria populations, and normal and abnormal cells, such as normal cells and cancer cells.
[0039] Methods for delivering the described Cas proteins and gRNAs to cells, whether in vitro or in vivo can be adapted from known CRISPR delivery systems. In embodiments, the Cas protein and/or the gRNA can be delivered as mRNA or DNA polynucleotides that encode Cas protein and/or the gRNA. It is considered that administering a DNA or RNA encoding any component described herein is also a method of delivering a component to an individual or one or more cells.
[0040] Methods of delivering DNA and RNAs encoding proteins and gRNAs are known in the art and can be adapted to deliver the described Cas protein and gRNAs, given the benefit of the present disclosure. In embodiments, one or more expression vectors are used and comprise viral vectors. Thus, in embodiments, a viral expression vector is used. Viral expression vectors may be used as naked polynucleotides, or may comprise any of viral particles, including but not limited to defective interfering particles or other replication defective viral constructs, and virus-like particles. In embodiments, the expression vector comprises a modified viral polynucleotide, such as from an adenovirus, a herpesvirus, or a retrovirus. In embodiments, a recombinant adeno-associated virus (AAV) vector may be used. In certain embodiments, the expression vector is a self-complementary adeno-associated virus (scAAV). Expression vectors encoding the described modified gRNAs are included in the disclosure, as are cDNAs that correspond to the modified gRNAs. In embodiments, the described Cas protein and the gRNA is introduced into a cell in the form of a ribonucleoprotein.
[0041] In embodiments, an effective amount of a gRNA and a Cas protein is administered to cells or an individual in need thereof. An effective amount can be determined by those skilled in the art when taking account the rationale for selecting the target sequence, and a disease or disorder or other characteristic that is correlated with the presence of the target sequence.
[0042] In embodiments, the modified gRNA may comprise modified nucleotides to, for example, provide resistance to RNA nucleases. In embodiments, the Cas protein may be modified. For example, for use with eukaryotes, the Cas protein may be modified to comprise a nuclear localization signal. In embodiments, the modified gRNA may be used in conjunction with an endogenously expressed Cas protein. In embodiments, the Cas protein may be provided as a component of a fusion protein. The fusion protein may enhance one or more properties of a described CRISPR system, such as improving bioavailability, increasing half-life, enhancing DNA editing, enhancing dwell time of the Cas enzyme on the DNA, and the like.
[0043] The following Examples are intended to illustrate but not limit the disclosure.
Example 1
R-Loop of a dCas Complex Bound to DNA
[0044] To investigate the structural features that may underlie the polar barrier of a bound dCas, we first mapped protein-nucleic acid interactions of a bound dCas via a high-resolution DNA unzipping mapper technique.sup.11-14 (
[0045] Using the unzipping mapper, we compared the force signatures of both a dCas9 and dCas12a, two of the most prevalent Cas proteins (
[0046] When unzipped from the PAM-distal side, both dCas complexes showed a force drop below the naked DNA baseline followed by a force rise above the baseline. The force drop is consistent with the presence of the gRNA/DNA hybrid, which prevents DNA base pairing, creates a DNA bubble, and thus reduces the unzipping force. Note that due to thermal DNA breathing fluctuations, the unzipping fork detects the DNA bubble downstream.sup.15, leading to an earlier force drop. The force drop indicates a lack of strong interactions between the dCas protein and DNA prior to the bubble. For dCas9, the subsequent force rise was detected within the gRNA/DNA hybrid region, indicating strong interactions between dCas9 and DNA in that region. For dCas12a, two types of traces were detected (middle panel of
[0047] Interestingly, these force features bear a remarkable resemblance to those of an E. coli transcription elongation complex (TEC), which the DNA unzipping mapper method previously characterized.sup.24-26 For ease of direct comparison of data with dCas complexes, we re-mapped the TEC under the same experimental conditions as for the dCas complexes (
Example 2
Mechanism of dCas Roadblock Polarity
[0048] The unzipping mapper data (
Example 3
A Bound dCas is a Highly Asymmetric Roadblock
[0049] We developed a single-molecule assay using the DNA unzipping mapper that quantitatively measures the ability of RNAP to transcribe through a bound dCas from either the PAM-distal side or PAM-proximal side. In this assay (
[0050] Unzipping traces taken after the NTP chase fell into several categories due to asynchronization of the RNAP population as a result of the stochastic nature of RNAP motion (
[0051] These traces show very different transcription behaviors between the PAM-distal and PAM-proximal collisions and demonstrate that a bound dCas is a polar barrier to transcription. To accurately determine transcription read-though from each side of a bound dCas, we carried out several control experiments to obtain the probability of a template initially not having a bound RNAP or dCas protein (Supplementary Table 1) and the probabilities of spontaneous dissociation of RNAP or dCas (
[0052] Using this method, we found that transcription read-through of a bound dCas9 showed an efficiency of 43% when RNAP approached dCas9 from the PAM-distal side and was undetectable from the PAM-proximal side (
[0053] When RNAP encountered a bound dCas but could not read through it, RNAP likely backtracked.sup.24,32-34., where RNAP reverse translocates along DNA with its catalytic site disengaged from the 3-end of the RNA, rendering transcription inactive.sup.35,36. E. coli GreB is a transcription elongation factor that is known to rescue backtracked complexes.sup.37-39. GreB can stimulate the intrinsic cleavage activities of RNAP, leading to the removal of the 3-end of the RNA and alignment of the newly generated RNA 3-end with the catalytic site, reactivating transcription. We thus conducted transcription assays in the presence of 1 M GreB. When RNAP encountered dCas from the PAM-distal side, the transcription read-through efficiency increased significantly, from 43% to 70% for dCas9 and from 47% to 73% for dCas12a. Interestingly, when RNAP encountered dCas from the PAM-proximal side, the read-through efficiency remained essentially zero for both dCas9 and dCas12a. Our bulk transcription assays show a similar effect of GreB on the polarity of transcription read-through (
[0054] This shows that backtracking was likely the main cause of RNAP stalling at a dCas roadblock from the PAM-distal side. While transcription through a bound dCas from the PAM-distal side is facilitated by GreB, transcription through dCas from the PAM-proximal side encounters a nearly insurmountable obstacle and cannot be rescued by GreB. Thus, in the presence of GreB, a bound dCas becomes an even more highly asymmetric and polar barrier to transcription. This ultimately results from a bound dCas complex having an unprotected DNA bubble that can be rezipped and collapsed by RNAP.
Example 4
A DNA Translocase Exhibits the Same Polarity
[0055] An important prediction of the hypothesized mechanism is that a bound dCas should be a polar barrier not just to RNAP, but to any DNA translocase capable of rezipping downstream DNA. To test this possibility, we required a translocase to approach a bound dCas from a defined direction. E. coli Mfd met this requirement as it interacts with a TEC stalled at a defined location, making it possible to control the position and orientation of translocation.sup.26,40-42. In the presence of ATP, Mfd can bind to the stalled TEC and forward translocate to disrupt the TEC, before processively continuing translocation in the same direction as the disrupted TEC.
[0056] Using this method of loading Mfd onto DNA, we found that in 85% of traces that initially contained a TEC, Mfd remained associated with DNA and translocated processively along DNA over a long distance at a rate of 2.2 bp/s (
[0057] To examine whether Mfd experiences a bound dCas as a polar barrier, we performed experiments similar to those presented in
[0058]
[0059] We classified the traces into different categories to determine Mfd move-through efficiency when Mfd encountered dCas9 or dCas12a from either the PAM-distal side or the PAM-proximal side (
[0060] We also noted that when encountering a dCas from the PAM-distal side, Mfd showed a lower move-through efficiency than RNAP. We attribute this to the difference in the stability of two motor proteins when working against a strong roadblock. While RNAP can remain stably bound to the substrate, thus allowing for multiple attempts to overcome the barrier, Mfd may tend to dissociate when working against a strong roadblock.sup.26, reducing its opportunity to continue to work against the barrier.
Example 5
Modulation of Transcription Roadblock Read-Through
[0061] The described data also support strategies to modulate dCas roadblock polarity to transcription For example, transcription read-through from the PAM-distal side of a dCas complex relies on disruption of the R-loop and collapse of the DNA bubble, which depend on gRNA interactions with DNA. Thus, if a gRNA can be modified to increase (decrease) the stability of the R-loop, then transcription read-through may be down-(up-) regulated.
[0062] To increase the stability of the R-loop of a bound dCas9, we extended the 5 end of the original gRNA with an inverted repeat sequence (
[0063] We examined how such a modified gRNA impacted dCas9 binding to DNA by unzipping through the bound dCas9 using the unzipping mapper.
[0064] We have also determined how dCas9 containing such a modified gRNA modulates transcription read-through by repeating the assays outlined in
[0065] To determine whether transcription read-through from the PAM-distal side of a bound dCas9 can also be up-regulated, we introduced a 3-nt mismatch to the gRNA at its 5-end (
[0066] Collectively, these results clearly show that transcription read-through from the PAM-distal side of dCas9 can be considerably impacted via gRNA modifications. This finding also serves as strong evidence for R-loop disruption and DNA bubble collapse as a mechanism of transcription read-through.
Example 6
Modulation of Transcription Roadblock Removal
[0067] The preceding examples characterized the polarity of the dCas roadblock to transcription read-though, which requires the removal of the roadblock by RNAP, followed by transcription through the dCas binding site. An alternative characterization of the roadblock polarity is the efficiency of transcription roadblock removal, which requires the removal of the roadblock by RNAP but does not require RNAP to read through the dCas binding site.
[0068] Roadblock removal includes transcription read-through and an additional scenario where RNAP collided with and removed the dCas, but then became stalled. To examine this, we focused on transcription data with an RNAP force signature near the expected dCas9 binding site, corresponding to stalled RNAP after collision with dCas9 (
[0069] For PAM-proximal collisions, all traces showed both a bound RNAP and dCas9 (
[0070] For PAM-distal collisions, the traces fall into two distinct categories. Just as with the PAM-proximal collisions, one category of traces shows both a bound RNAP and dCas9 (
[0071] The overall roadblock removal efficiency, considering both the collision traces and read-through traces, shows that dCas9 removal is also polar (
Discussion of Examples
[0072] Using the CRISPRi system, this disclosure presents high-resolution structural features of dCas-DNA interactions, elucidates the nature of dCas removal by motor proteins, and details the highly tunable nature of dCas removal through modifications of the gRNA.
[0073] The disclosure provides a mechanistic explanation for the roadblock polarity that dCas presents to transcription in CRISPRi (
[0074] We also show that GreB can significantly facilitate RNAP read-through when RNAP encounters a bound dCas from the PAM-distal side, but has no detectable effect on read-through when RNAP encounters a bound dCas from the PAM-proximal side, demonstrating that dCas is a highly asymmetric and polar barrier to transcription.
[0075] In addition to CRISPRi, dCas complexes have also been used to hinder replication. In contrast to transcription, this hindrance was not found to be polar.sup.9,10. The described mechanism allows for both the presence of polarity for transcription and the absence of polarity for replication. In order for RNAP to read through a dCas roadblock from the PAM-distal side, RNAP must rezip the DNA downstream to collapse the R-loop of the dCas complex, and thus the ability to rezip is important for read-through. In contrast, a replisome relies on its helicase to unzip DNA to strand separate, and therefore, cannot rezip to collapse the R-loop of a bound dCas complex. To our knowledge, this is the first mechanistic explanation of these apparently disparate findings of dCas roadblock polarity for transcription and replication.
[0076] Beyond CRISPRi, dCas proteins are used in a host of other cellular applications. For example, they can be fused to other proteins to direct them to specific loci. The disclosure includes inverted repeat modifications of gRNA sequences to increase the overall stability of dCas9.
[0077] Besides engineered dCas proteins, naturally occurring Cas proteins without any inherent nuclease activity are known to direct DNA transposition. In these transposon-associated CRISPR-Cas systems, Cas binding is followed by recruitment of multiple other enzymes that then direct transposition. These systems have been repurposed for gene editing.sup.48-50. The stability of bound Cas complexes in these systems is expected to be governed by the same mechanism described in this disclosure, and as such the disclosure includes modulation of this stability to improve the efficiency of transposition and gene editing.
[0078] While the present disclosure provides representative embodiments using dCas proteins, the disclosure encompasses other DNA editing proteins. For example, when insertions/deletions are created via non-homologous end joining (NHEJ), gene editing may be enhanced by removal of post-cleavage Cas9 via transcription machinery, which exposes a double-strand break for repair by NHEJ.sup.51. However, this removal may not be desirable if the goal is to utilize homology-directed repair (HDR) to perform precise edits. Cas9 removal may contribute to the observed high probability of the NHEJ pathway selected over the HDR pathway.sup.51,52. Cas nuclease removal can also likely be modulated using the same strategy of gRNA modifications as we herein. Thus, the disclosure includes modulation of Cas9 removal to provide improved control over the partition between the HDR and NHEJ pathways.
[0079] This disclosure provides in part a mechanistic explanation of dCas roadblock polarity and demonstrates the importance of R-loop stability. Without intending to be bound by any particular theory the disclosure indicates two avenues that impact Cas binding-stability of the R-loop and access to the R-loop. The disclosure includes optimizing and customizing Cas binding using modifications to the gRNA to alter the gRNA/DNA interactions and modulation of protein-DNA interactions to regulate R-loop accessibility. Understanding Cas binding stability also provides a framework to impact the efficiencies of CRISPR applications.
[0080] Supplementary Table 1. Trace categories for assaying transcription read-through of a bound dCas protein. This tables shows the detailed trace category classification for RNAP approaching a bound dCas9 complexed with an unmodified RNA from two representative sample chambers, one for PAM-distal and one for PAM-proximal. These fractions (top) are used to compute various probabilities (bottom).
TABLE-US-00001 Category dCas9 PAM Distal dCas9 PAM Proximal Before Chase F.sub.A20, dCas.sub.
[0081] Supplementary Table 2. gRNAs used in this disclosure. Custom Cas9 sgRNAs were purchased from Sigma-Aldrich. Cas12a gRNAs were made by in vitro transcription as described in the Examples. Mismatch and inverted repeat nucleotides are in bold, as indicated.
TABLE-US-00002 gRNA SEQIDNO: RNAsequence(5->3) Cas9unmodifiedgRNA 1 GCGCGUAUCAUCCCUUACCG+80bp(crRNA+tracrRNA) Cas93-ntmismatch 2 CGCCGUAUCAUCCCUUACCG+80bp(crRNA+tracrRNA) gRNA 3 CGCGCUGCGCGUAUCAUCCCUUACCG+80bp(crRNA+ Cas95-ntinverted 4 tracrRNA)ACGCGCUGCGCGUAUCAUCCCUUACCG+80bp repeatgRNA (crRNA+tracrRNA) Cas96-ntinverted 5 UACGCGCUGCGCGUAUCAUCCCUUACCG+80bp(crRNA+ repeatgRNA tracrRNA) Cas97-ntinverted 6 AUAUUGGCGCGUAUCAUCCCUUACCG+80bp(crRNA+ repeatgRNA tracrRNA) Cas96-ntnon complementarygRNA Cas12aunmodifiedgRNA 7 GGUAAUUUCUACUCUUGUAGAUGCCAUUCCCUACUAUGCGCG
[0082] References for the foregoing text. The reference listings are not an indication that any reference is material to patentability. [0083] 1. Jinek, M. et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816-821 (2012). [0084] 2. Cong, L. et al. Multiplex Genome Engineering Using CRISPR/Cas Systems. Science 339, 819 (2013). [0085] 3. Jiang, Y. et al. Multigene Editing in the Escherichia coli Genome via the CRISPR-Cas9 System. (2015). [0086] 4. Biot-Pelletier, D. & Martin, V. J. J. Seamless site-directed mutagenesis of the Saccharomyces cerevisiae genome using CRISPR-Cas9. Vol. 10 (BioMed Central Ltd., 2016). [0087] 5. Sternberg, S. H., Redding, S., Jinek, M., Greene, E. C. & Doudna, J. A. DNA interrogation by the CRISPR RNA-guided endonuclease Cas9. Nature 507, 62-67 (2014). [0088] 6. Qi, L. S. et al. Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression. Cell 152, 1173-1183 (2013). [0089] 7. Bikard, D. et al. Programmable repression and activation of bacterial gene expression using an engineered CRISPR-Cas system. Nucleic Acids Research 41, 7429-7437 (2013). [0090] 8. Schilling, C., Koffas, M. A. G., Sieber, V. & Schmid, J. Novel Prokaryotic CRISPR-Cas12a-Based Tool for Programmable Transcriptional Activation and Repression. ACS Synthetic Biology 9, 3353-3363 (2021). [0091] 9. Schauer, G. D. et al. Replisome bypass of a protein-based R-loop block by Pif1. Proceedings of the National Academy of Sciences 117, 30354-30361 (2020). [0092] 10. Whinn, K. S. et al. Nuclease dead Cas9 is a programmable roadblock for DNA replication. Scientific reports 9, 1-9 (2019). [0093] 11. Koch, S. J., Shundrovsky, A., Jantzen, B. C. & Wang, M. D. Probing Protein-DNA Interactions by Unzipping a Single DNA Double Helix. Biophysical Journal 83, 1098-1105 (2002). [0094] 12. Koch. S. J. & Wang, M. D. Dynamic force spectroscopy of protein-DNA interactions by unzipping DNA. Physical Review Letters 91 (2003). [0095] 13. Shundrovsky, A., Smith, C. L., Lis, J. T., Peterson, C. L. & Wang, M. D. Probing SWI/SNF remodeling of the nucleosome by unzipping single DNA molecules. Nature Structural & Molecular Biology 13, 549-554 (2006). [0096] 14. Hall. M. A. et al. High-resolution dynamic mapping of histone-DNA interactions in a nucleosome. Nature Structural & Molecular Biology 16, 124-129 (2009). [0097] 15. Killian, J. L., Ye, F. & Wang, M. D. Optical Tweezers: A Force to Be Reckoned With. Cell 175, 1445-1448 (2018). [0098] 16. Dagdas, Y. S., Chen, J. S., Sternberg, S. H., Doudna, J. A. & Yildiz, A. A conformational checkpoint between DNA binding and cleavage by CRISPR-Cas9. Science Advances 3 (2017). [0099] 17. Zhang, L. et al. Conformational Dynamics and Cleavage Sites of Cas12a Are Modulated by Complementarity between crRNA and DNA. iScience 19, 492-503 (2019). [0100] 18. Zhang, Q. et al. The post-PAM interaction of RNA-guided spCas9 with DNA dictates its target binding and dissociation. Science Advances 5, 1-11 (2019). [0101] 19. Szczelkun, M. D. et al. Direct observation of R-loop formation by single RNA-guided Cas9 and Cascade effector complexes. Proceedings of the National Academy of Sciences of the United States of America 111, 9798-9803 (2014). [0102] 20. Cofsky, J. C. et al. CRISPR-Cas 12a exploits R-loop asymmetry to form double-strand breaks. eLife 9, e55143 (2020). [0103] 21. Jinek, M. et al. Structures of Cas9 Endonucleases Reveal RNA-Mediated Conformational Activation. Science 343, 1247997 (2014). [0104] 22. Swarts, D. C., van der Oost, J. & Jinek, M. Structural Basis for Guide RNA Processing and Seed-Dependent DNA Targeting by CRISPR-Cas12a. Molecular cell 66, 221-233.e4 (2017). [0105] 23. Huai, C. et al. Structural insights into DNA cleavage activation of CRISPR-Cas9 system. Nature Communications 8, 1375 (2017). [0106] 24. Jin, J. et al. Synergistic action of RNA polymerases in overcoming the nucleosomal barrier. Nature Structural & Molecular Biology 17, 745-752 (2010). [0107] 25. Inman, J. T. et al. DNA Y Structure: A Versatile, Multidimensional Single Molecule Assay. Nano Letters 14, 6475-6480 (2014). [0108] 26. Le, T. T. et al. Mfd Dynamically Regulates Transcription via a Release and Catch-Up Mechanism. Cell 172, 344-357.e15 (2018). [0109] 27. Park, J.-S. & Roberts, J. W. Role of DNA bubble rewinding in enzymatic transcription termination. Proceedings of the National Academy of Sciences of the United States of America 103, 4870 (2006). [0110] 28. Komissarova, N., Becker, J., Solter, S., Kireeva, M. & Kashlev, M. Shortening of RNA: DNA hybrid in the elongation complex of RNA polymerase is a prerequisite for transcription termination. Molecular Cell 10, 1151-1162 (2002). [0111] 29. Park, J.-S., Marr, M. T. & Roberts, J. W. E. coli transcription repair coupling factor (Mfd protein) rescues arrested complexes by promoting forward translocation. Cell 109, 757-767 (2002). [0112] 30. Miao, C., Zhao, H., Qian, L. & Lou, C. Systematically investigating the key features of the DNase deactivated Cpf1 for tunable transcription regulation in prokaryotic cells. Synthetic and Systems Biotechnology 4. 1-9 (2019). [0113] 31. Clarke, R. et al. Enhanced Bacterial Immunity and Mammalian Genome Editing via RNA-Polymerase-Mediated Dislodging of Cas9 from Double-Strand DNA Breaks. Molecular Cell 71. 42-55.e8 (2018). [0114] 32. Epshtein, V., Toulme, F., Rahmouni, A. R., Borukhov, S. & Nudler, E. Transcription through the roadblocks: the role of RNA polymerase cooperation. The EMBO journal 22, 4719-4727 (2003). [0115] 33. Ma, J., Bai, L. & Wang, M. D. Transcription under torsion. Science 340, 1580-3 (2013). [0116] 34. Kotlajich, M. V. et al. Bridged filaments of histone-like nucleoid structuring protein pause RNA polymerase and aid termination in bacteria. Elife 4 (2015). [0117] 35. Nudler, E., Mustaev, A., Lukhtanov. E. & Goldfarb, A. The RNA-DNA hybrid maintains the register of transcription by preventing backtracking of RNA polymerase. Cell 89, 33-41 (1997). [0118] 36. Komissarova, N. & Kashlev, M. Transcriptional arrest: Escherichia coli RNA polymerase translocates backward, leaving the 3 end of the RNA intact and extruded. Proceedings of the National Academy of Sciences 94, 1755 (1997). [0119] 37. Marr, M. T. & Roberts, J. W. Function of transcription cleavage factors GreA and GreB at a regulatory pause site. Mol Cell 6, 1275-85 (2000). [0120] 38. Stepanova, E., Wang, M., Severinov, K. & Borukhov, S. Early transcriptional arrest at Escherichia coli rpIN and ompX promoters. J Biol Chem 284, 35702-13 (2009). [0121] 39. Strobel, E. J. & Roberts, J. W. Regulation of promoter-proximal transcription elongation: enhanced DNA scrunching drives lambdaQ antiterminator-dependent escape from a sigma70-dependent pause. Nucleic Acids Res 42, 5097-108 (2014). [0122] 40. Howan, K. et al. Initiation of transcription-coupled repair characterized at single-molecule resolution. Nature 490, 431-434 (2012). [0123] 41. Portman, J. R., Brouwer, G. M., Bollins, J., Savery, N. J. & Strick, T. R. Cotranscriptional R-loop formation by Mfd involves topological partitioning of DNA. Proceedings of the National Academy of Sciences 118, e2019630118-e2019630118 (2021). [0124] 42. Le, T. T. & Wang, M. D. Molecular Highways-Navigating Collisions of DNA Motor Proteins. Journal of Molecular Biology 430, 4513-4524 (2018). [0125] 43. Haines, N. M., Kim, Y. I., Smith, A. J. & Savery, N. J. Stalled transcription complexes promote DNA repair at a distance. Proc Natl Acad Sci USA 111, 4037-42 (2014). [0126] 44. Graves, E. T. et al. A dynamic DNA-repair complex observed by correlative single-molecule nanomanipulation and fluorescence. Nat Struct Mol Biol 22, 452-7 (2015). [0127] 45. Ho, H. N., van Oijen, A. M. & Ghodke, H. The transcription-repair coupling factor Mfd associates with RNA polymerase in the absence of exogenous damage. Nature Communications 9, 1570 (2018). [0128] 46. Ma, H. H. et al. Multiplexed labeling of genomic loci with dCas9 and engineered sgRNAs using CRISPRainbow. Nature Biotechnology 34, 528-530 (2016). [0129] 47. Myers, S. A. et al. Discovery of proteins associated with a predefined genomic locus via dCas9-APEX-mediated proximity labeling. Nature Methods 15, 437-+ (2018). [0130] 48. Peters, J. E., Makarova, K. S., Shmakov, S. & Koonin, E. V. Recruitment of CRISPR-Cas systems by Tn7-like transposons. Proc Natl Acad Sci USA 114, E7358-E7366 (2017). [0131] 49. Klompe, S. E., Vo, P. L. H., Halpin-Healy, T. S. & Sternberg, S. H. Transposon-encoded CRISPR-Cas systems direct RNA-guided DNA integration. Nature 571, 219-225 (2019). [0132] 50. Petassi, M. T., Hsieh, S. C. & Peters, J. E. Guide RNA Categorization Enables Target Site Choice in Tn7-CRISPR-Cas Transposons. Cell 183, 1757-1771 e18 (2020). [0133] 51. Richardson, C. D., Ray, G. J., DeWitt, M. A., Curie, G. L. & Com, J. E. Enhancing homology-directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA. Nature Biotechnology 34, 339-344 (2016). [0134] 52. Yeh, C. D., Richardson, C. D. & Corn, J. E. Advances in genome editing through control of DNA repair pathways. Nature Cell Biology 21, 1468-1478 (2019).
Methods
Protein Purification
[0135] E. coli RNAP was purified using tagged purification 26,53,54 Briefly, RNAP was expressed at low levels in 5a-competent E. coli (Invitrogen, 18265-017) transformed with the plasmid pKA1 in Superbroth (25 g/L Tryptone (Sigma, T2559), 15 g/L yeast extract (Sigma, Y1626), 5 g/L NaCl (Sigma, S3014)) with 100 g/mL ampicillin (Sigma, A0166) for 4 hours until A600 nm reached 2.1. Cells were induced with IPTG (RPI, 156000-50) to a final concentration of 1 mM for 4 hours. Cells were lysed and sonicated on ice in small aliquots (<20 mL). with a macro tip on a Branson Sonifier 250 with 60% duty cycle. Sonicated cells were centrifuged to pellet cell debris and the pellet was discarded. To precipitate nucleic acids and their bound proteins out of solution, cleared 5% (w/v) polyethyleneimine (PEI) pH 7.9 (made from 50% stock; Sigma, P3143) was slowly added to the supernatant to a final concentration of 0.4% (w/v). The DNA with bound RNAP was pelleted from the solution, washed five times with a buffer containing 350 mM NaCl (J. T. Baker, 4058-01), and RNAP was eluted from the PEI and DNA with a buffer containing 1 M NaCl. The eluted RNAP was purified to homogeneity with chromatography using three columns: a HiPrep Heparin FF 16/10 column (GE Healthcare, 28-9365-49), a HiPrep 26/60 Sephacryl S-300 HR column (GE Healthcare, 17-1196-01), and a QIAGEN Ni-NTA Superflow column (Qiagen, 30410). Fractions that contained holo-RNAP were pooled, concentrated, and dialyzed into RNAP storage buffer (50 mM Tris-HCl pH 8.0 (J. T. Baker, 4103-01 & 4109-01), 100 mM NaCl, 1 mM EDTA (Invitrogen, 15508-013) 50% (v/v) glycerol (J. T. Baker, 4043-00), and 1 mM DTT (Invitrogen, 15508-013)) and ultimately stored at 20 C.
[0136] E. coli greB was purified using tagged purification.sup.54. Briefly, Plasmid pES3, encoding GreB-6His in pET-28b (+) (4), was transformed into BL21 (DE3) (Invitrogen, 44-0049) cells for protein overexpression. Cells were grown at 37 C. in Luria Broth (LB) (Affymetrix, 75854) with 50 g/ml of added Kanamycin (Sigma, K0254) at 37 C. until the OD600 nm was between 0.6-0.8, induction was then carried out with 1 mM IPTG (Roche, 10724815001). After 3 hrs at 37 C., cells were harvested by centrifugation and stored at 80 C. To purify GreB, cells were thawed on ice and re-suspended in GreB Lysis Buffer (50 mM Tris-HCl (Fisher, BP154 & BP153) pH 6.9, 500 mM NaCl (Fisher, BP358), and 5% v/v glycerol (Fisher, BP229),) using lysozyme (300 g/ml) (Sigma, 10837059001) EDTA-free protease-inhibitor cocktail (Roche, 11873580001). The cells were placed on ice for 1 hour and then briefly sonicated for more complete lysis. The extract was centrifuged (24,000 g, 20 min at 4 C.) and twice passed through a 0.45-m filter. An Ni-NTA agarose (Invitrogen, R90115) column was used for GreB isolation and GreB Lysis Buffer with 200 mM imidazole was used for elution. The eluate was then run on a Superdex 200 column (Cytivia, 28990944) with Elution Buffer (10 mM Tris-HCl pH 8.0, 500 mM NaCl, 1 mM DTT, 1 mM EDTA, and 5% v/v glycerol). Dialysis was performed into GreB storage buffer (10 mM Tris-HCl pH 8.0, 200 mM NaCl, 1 mM DTT, 1 mM EDTA, and 50% v/v glycerol), and stored at 80 C. after a flash freeze n liquid nitrogen.
[0137] E. coli Mfd was purified using tagged purification.sup.55. Briefly, a pET plasmid was used to overexpress Eco Mfd with its N-terminus His6-tagged. This plasmid was transformed via heat shock at 42 C. for 40 seconds into Rosetta (DE3) pLysS cells (Novagen, 70956-M). 1 mM isopropyl -D-1-thiogalactopyranoside (IPTG) (Goldbio, I2481C) was added to cells (O. D. 0.67) for 4 hours at 30 C. to induce protein expression. For harvesting, cells were centrifuged and pellets were resuspended in a lysis buffer (50 mM Tris (MP, 103133), pH 8.0, 500 mM NaCl (Fisher, S271-500), 15 mM imidazole (MP, 02102033CF), 10% (v/v) glycerol (Fisher, BP2294), 2 mM -mercaptoethanol (-ME) (Sigma, M6250), 1 mM PMSF (Sigma, P7626), and protease inhibitor cocktail (complete, EDTA-free; Roche, COEDTAF-RO) and subsequently lysed on a french press. Lysate was flown over a Ni.sup.2+-charged Hitrap IMAC column (Cytiva, 17524802) and eluted over the course of a 0-200 mM imidazole gradient. Post-nickel column dialysis was performed in a buffer containing 20 mM Tris, pH 8.0, 100 mM NaCl, 10% (v/v) glycerol, 5 mM EDTA (Sigma, E5134), and 10 mM -ME, and the dialyzed sample was loaded onto a Hitrap Heparin column (Cytiva, 28-9893-35). Elution was performed over the course of a 100 mM 2 M NaCl gradient, and the resulting sample was further purified on a HiLoad 16/600 Superdex200 size exclusion chromatography column (Cytiva, 29-9893-35) in a buffer containing 20 mM Tris, pH 8.0, 500 mM NaCl, and 10 mM DTT (Goldbio, DTT10). Glycerol was added to the purified Mfd to reach a final concentration of 20% (v/v), sample was flash frozen in liquid N.sub.2, and finally stored at 80 C.
gRNA Preparation
[0138] Cas9 sgRNAs were custom synthesized by Sigma Aldrich, and purified by 8% denaturing Urea polyacrylamide gel electrophoresis (Urea-PAGE) similar to previous descriptions.sup.16,56 Cas12a gRNA was prepared by cloning the Cas12a gRNA sequence.sup.57 (Supplementary Table. 2) into a pUC19 plasmid, containing a T7 promoter and a downstream HDV ribozyme sequence.sup.58, by site directed mutagenesis. T7 transcription (IVT) templates were generated from the cloned plasmids via PCR with Q5 DNA polymerase (NEB, M0491). In vitro transcription was performed for each template by incubation with T7 RNAP (NEB, M0251) at 37 C. for 3 hours, followed by incubation at 65 C. for 20 min to promote ribozyme cleavage and leave a 3 cyclic phosphate. Products were dephosphorylated with T4 PNK (NEB, M0201) and purified by urea-PAGE.
Single-Molecule DNA Unzipping Templates
[0139] Single-molecule DNA unzipping templates were generated from a pRL574 plasmid, which contains a T7A1 promoter. The PAM-Distal Cas9 template was identified in pRL574, 309 bp from the +20. To generate templates for the remaining three templates (Cas9 PAM-proximal, Cas12a PAM-Proximal, and Cas12a PAM-Distal), a 60 bp region of pRL574 was modified via site directed mutagenesis using a protocol from NEB and Q5 DNA polymerase. For each template, we substituted a 63 or 64 bp DNA segment at 290 bp from the +20 for Cas9 or both Cas12a templates, respectively. The substituted DNA segment contained the relevant target sequence and PAM as well as 20 bp of conserved flanking DNA on either side.
[0140] Four DNA unzipping segments were amplified by PCR, digested with DraIII (NEB, R3510) leaving a ssDNA overhang (TAG), and purified by 0.8% agarose gel electrophoresis These templates were used as transcription templates, and for PAM-distal dCas and upstream RNAP mapping. Two additional reversed unzipping segments were used for PAM-proximal dCas and downstream PTC mapping and generated by PCR and digested with AlwNI (NEB, R0514). These DNA segments were then each ligated to a pair of dsDNA arms containing a CTA overhang at their junction.sup.25,26. Both DNA arms were amplified by PCR from pBR322 (NEB, N3033) and digested by BamHI. One arm was end-labeled with biotinand the other with digoxigenin through separate Klenow reactions with biotin-14-dATP (Invitrogen, 19524016) and digoxigenin-11-dUTP (Roche, 11093088910), respectively. Each arm was digested with BsmBi-V2 (NEB, R0739S), ligated to an annealed adapter oligo, and gel purified. Finally, the arms were annealed to each other at an equimolar ratio to create y-arm adapters suitable for ligation of an unzipping segment.
Protein Complex Formation for Single-Molecule Experiments
[0141] Paused transcription complex (PTC) was formed in bulk on an unzipping template which contained a promoter in the unzipping segment. The complex was paused at the A20 position via nucleotide depletion.sup.24,26 Briefly, 10 nM DNA template was mixed with 50 nM RNAP in the presence of 250 M ApU (Dharmacon, custom synthesis), 50 M GTP (Roche, 11140957001), ATP (Roche, 11140965001) and CTP (Roche, 11140922001), 1 U/l of Superase-in (Invitrogen, AM2694) in transcription buffer (TB, 25 mM Tris-Cl (Fisher, BP154 & BP153) pH 8, 100 mM KCl (P333), 4 mM MgCl.sub.2 (Invitrogen, AM9530G), 1 mM DTT (Invitrogen, 15508-013), 3% glycerol (Fisher, BP229), 150 g/ml AcBSA (Invitrogen, AM2614). For high resolution TEC mapping experiments, the mixture also contained 1 mM 3-deoxy-UTP (Trilink, N-3005).sup.59 which paused the complex at U21. For all experiments, the mixture was incubated at 37 C. for 30 min and then briefly placed on ice. The mixture was quickly diluted 1:100 and immediately introduced into a prepared sample chamber. To form dCas-gRNA complex. 50 nM Cas9-sgRNA or 100 nM Cas12a-gRNA was denatured in RNA storage solution (Invitrogen, AM7001) at 80 C. for 1.5 min and then placed on ice. 75 nM Sp-dCas9 (NEB, M0652) or 300 nM As-dCas12a (IDT, off catalog) along with 1TB was then added. The mixture was incubated at 37 C. for 10 min and then placed on ice until introduction into a prepared sample chamber. dCas-gRNA complex was later introduced into a single molecule sample chamber to allow dCas binding to DNA as described below.
Single-Molecule Experimental Procedures
[0142] For all unzipping assays, DNA tethers were formed in a sample chamber consisting of a cleaned glass coverslip as previously described.sup.24-26. Anti-digoxigenin (Vector Labs, MB-7000) in TB at 16.7 g/ml was introduced into the chamber, allowed to incubate for 10 minutes at RT, and replaced with 65 l TB with 10 mg/ml casein (Sigma, C8654). After 10 min at RT, 5 pM DNA template was introduced, allowed to incubate for 5 min at RT, and later replaced with 90 l TB. Finally, 0.5 pM of 489 nm streptavidin coated polystyrene beads in TB with 1 mg/ml casein was introduced and incubated for 10 min and RT. The buffer was replaced with 80 l TB. This resulted in DNA templates tethered between the surface of a coverslip via a dioxygenin (dig) and anti-dig connection and a 489 nm bead via a biotin and streptavidin connection (
[0143] dCas-DNA complexes were formed on DNA tethers by introducing 75 l of prepared dCas-gRNA complexes (25 pM dCas9-sgRNA or 200 pM dCas12a-sgRNA) and incubating for 10 min before replacing the chamber buffer with 90 l of TB. For inverted repeat gRNAs, 37.5 pM dCas9-sgRNA was introduced. For 3-bp mismatched guides, 50 pM was introduced to ensure a high fraction of bound dCas9 (>90%).
[0144] For roadblock assays, PTCs and dCas-DNA complexes were formed as described using the appropriate unzipping template for the selected dCas target (Supplementary Table 2). Free dCas proteins were removed by flushing the sample chamber with 90 l of TB. Subsequently, occupancy of each bound protein was assessed via unzipping 40 tethers. For transcription resumption, 75 l of TB buffer supplemented with 1 mM NTP each (UTP; Roche, 11140949001), and 1 mM MgCl.sub.2 was introduced into the sample chamber. The transcription reaction was chased for 135 s before being quenched by introducing 120 ul of TB with 4 mM Mg.sup.2+ into the chamber. For Mfd translocase experiments, 75 ul of 166 nM Mfd with 2 mM ATP and 4 mM Mg.sup.2+ in TB was introduced into the sample chamber. After 480 s, the reaction was quenched by introducing 75 l of TB with 1 mM ATPyS (Sigma-Aldrich, A1388) and 5 mM Mg.sup.2+. After quenching, the bound proteins were assayed by unzipping 60 or 80 tethers for transcription or translocation reactions, respectively.
Optical Trapping Measurements
[0145] We used a surface based optical trap setup.sup.60 (
[0146] The force peak position of a protein bound to DNA was identified as the location of a vertical force rise that deviated from the theoretical force versus number of base-pairs unzipped. Subsequent to transcription reactions, some force peaks near the RNAP showed a small but distinct tether shortening event. This was attributed to the nascent transcript partially annealing to the exposed single stranded DNA. For traces that had this detectable shift, this slight shortening was corrected for in the location of the dCas9 peak.
[0147] All optical trapping measurements were performed in a temperature-controlled room at 23.3 C. However, the temperature increased slightly to an estimated 25 C. owing to local laser trap heating.sup.62. All reactions were also carried out at the room temperature of 23.3 C.
Calculation of Transcription Read-Through of the Single-Molecule Experiments
[0148] To accurately quantify the rate of dCas read-through by a translocase, we need to take into account of the following considerations: (1) the initial state of the traces might vary slightly from sample chamber to sample chamber, (2) proteins initially bound to DNA might dissociate through a non-collision mechanism, and (3) some translocases were inactive or could not reach the collision site. Therefore, to calculate read-through rate after these considerations, we have used conditional probabilities to determine how each category of traces changed after chasing.
[0149] Before chasing, we have classified traces into one of four fractions. For a given sample chamber, the fraction of PTC at A20 and a dCas (F.sub.A20,dCas i) was always the dominating fraction, representing typically 90% of traces, and was measured for each sample chamber. The remaining traces were categorized at PTC only, dCas only, or neither, with fractions denoted as F.sub.A20 only i, F.sub.acas only i, and F.sub.Nak i, respectively. These three minor fractions also contributed to various final observed fractions and their contributions must be accounted for (
[0150] Additionally, we found that a small, but significant, fraction of the TEC and bound dCas9 dissociated during the course of the experiment in the absence of any translocase activity. We accounted for this by including the probability of TEC and dCas dissociating through a non-collision mechanism as P.sub.RNAP_diss and P.sub.acas diss, respectively (
[0151] After chasing, traces were categorized into one of seven fractions. Traces that showed a TEC that had not yet reached the bound dCas were classified as either with a dCas (F.sub.TEC_up,dCas_f) and without dCas (F.sub.TEC_up_only_f). We classified a trace with a TEC that has not reached dCas as those with a detected TEC force peak >60 bp upstream from the dCas target site. Traces with a TEC <60 bp upstream from dCas site and with a dCas present were categorized as having had a dCas-RNAP collision (F.sub.Coll f). Traces with a TEC <60 bp upstream from the dCas site but without a dCas detected were categorized as RNAP having removed dCas but then being unable to read-through (F.sub.acas rem_f). Lastly, we also categorized traces with a TEC downstream of the dCas binding site without dCas being present (F.sub.TEC_dn_f), traces with no bound proteins (F.sub.Nak f), or traces which consisted of dCas only with no TEC detected (F.sub.acas_f)
[0152] Due to the heterogeneities in the TEC population and bound dCas, not all TEC complexes would encounter a bound dCas. We refer to the probability that an RNAP initially escaped the A20 translocated toward, and reached a bound dCas, as the probability of being collision competent, P.sub.Coll_comp. We can determine this probability from probability of TEC being collision incompetent, that is, the probability that a TEC was present at A20 or upstream of the dCas, given RNAP did not dissociate through a non-collision mechanism. P.sub.Coll_comp can be calculated as:
[0153] To determine the probability that a TEC was able to read-through a dCas, given that the TEC was collision competent and neither protein dissociated due to a non-collision mechanism, we start with the post-chase naked DNA (F.sub.Nak f) and RNAP downstream (F.sub.TEC_dn f) traces, and then take into account other pathways that also contributed to those two final observations. This gives the following equation for P.sub.Read-through
[0154] Similarly we can find the probability that a TEC will remove the dCas from the DNA by also including the fraction of traces where TEC was found to have removed dCas but was not able to read-though (F.sub.acas rem_f). This results in the following equation for P.sub.Removal:
[0155] For the Mfd collision assays of
[0156] Bulk transcription assays Bulk transcription assays were done using P-32 labelled RNA, separated by Urea-PAGE gel electrophoresis.sup.26,53,63. Four 5-biotinylated DNA templates, each containing the T7A1 promoter and a dCas binding site, were amplified from the pRL574 variants using Taq Polymerase (NEB, M0273). The templates were bound to streptavidin coated magnetic beads (NEB, S1420) at a concentration of 100 nM and mixed by rotation for 12 hours at 4 C. Paused transcription complexes (PTCs) were made in a similar fashion as noted above for single-molecule assays by combining 20 nM bead-bound DNA, 100 nM RNAP, 50 M CTP, 50 M ATP, 30 uCi of a-32P GTP (Perkin-Elmer, BLU006H250UC), 250 M ApU, and 1 U/l Superase-in and incubating for 30 min at 37 C. PTCs were then immediately washed three times with TB. A magnetic tube rack was used to pull down PTCs, and the pellet was washed and resuspended in TB. dCas-gRNA complexes were formed similarly to single-molecule assays, added to the washed PTCs (40 nM for dCas9, 250 nM for dCas12a), and incubated at 37 C. for 10 min. Resulting PTCs and dCas complexes were then washed with TB as before to remove free dCas-gRNA. Finally, TECs primed for collision with bound dCas-gRNA were chased by adding 1 mM NTPs with or without 1 M GreB in TB with 5 mM MgCl.sub.2 for 135 s. The reaction was quenched and transcripts were released from TECs by adding 1RNA loading dye (NEB, B0363) and 25 mM EDTA (MP, 194822). Magnetic beads were pulled down using a magnetic rack. The supernatant containing the transcript was removed, heated to 95 C. for 10 min, and then immediately loaded onto a 20 cm 6% urea-PAGE gel pre-run to 55 C. using a Protean Xi Cell (Bio-Rad). The gel was dried using a Model 583 gel dryer (Bio-Rad), exposed to a phosphor screen (FujiFilm) for 12 hours, and scanned on a Typhoon 700 Imager (Cytiva). Images were linearized using ImageJ, and lane profiles were analyzed using Matlab.
Method ExamplesOnly References
[0157] 53. Adelman, K. et al. Single molecule analysis of RNA polymerase elongation reveals uniform kinetic behavior. Proceedings of the National Academy of Sciences 99, 13538-13543 (2002). [0158] 54. Ma, J. et al. Transcription factor regulation of RNA polymerase's torque generation capacity. Proceedings of the National Academy of Sciences 116, 2583 (2019). [0159] 55. Kang. J. Y. et al. Structural basis of transcription arrest by coliphage HK022 nun in an Escherichia coli rna polymerase elongation complex. eLife 6, 1-20 (2017). [0160] 56. Jiang, F., Zhou, K., Ma, L., Gressel, S. & Doudna, J. A. A Cas9-guide RNA complex preorganized for target DNA recognition. Science 348, 1477-1481 (2015). [0161] 57. Yamano, T. et al. Crystal Structure of Cpf1 in Complex with Guide RNA and Target DNA. Cell 165, 949-962 (2016). [0162] 58. Battaglia, R. A., Price, I. R. & Ke, A. Structural basis for guanidine sensing by the ykkC family of riboswitches. RNA (New York. N.Y.) 23, 578-585 (2017). [0163] 59. Kang. J. Y. et al. Structural basis for transcription complex disruption by the Mfd translocase. eLife 10 (2021). [0164] 60. Brower-Toland, B. D. et al. Mechanical disruption of individual nucleosomes reveals a reversible multistage release of DNA. Proceedings of the National Academy of Sciences 99, 1960-1965 (2002). [0165] 61. Li, M. & Wang, M. D. Unzipping Single DNA Molecules to Study Nucleosome Structure and Dynamics. Nucleosomes, Histones & Chromatin, Pt B 513, 29-58 (2012). [0166] 62. Peterman, E. J., Gittes, F. & Schmidt, C. F. Laser-induced heating in optical traps. Biophys J 84, 1308-16 (2003). [0167] 63. Adelman, K. et al. Molecular mechanism of transcription inhibition by peptide antibiotic microcin J25. Molecular Cell 14, 753-762 (2004). [0168] 64. Anders, C., Niewoehner, O., Duerst, A. & Jinek, M. Structural basis of PAM-dependent target DNA recognition by the Cas9 endonuclease. Nature 513, 569-573 (2014). [0169] 65. Swarts, D. C. & Jinek, M. Mechanistic Insights into the cisand trans-Acting DNase Activities of Cas 12a. Molecular Cell 73, 589-600.e4 (2019). [0170] 66. Wang, D. et al. Discontinuous movements of DNA and RNA in RNA polymerase accompany formation of a paused transcription complex. Cell 81, 341-350 (1995).