Non-invasive method and kit for capturing and isolating fetal cells from mother

12163127 ยท 2024-12-10

    Inventors

    Cpc classification

    International classification

    Abstract

    Provided are a promoter of a gene specifically expressed in fetal trophoblast cells and a gene specifically expressed in fetal nucleated red blood cell-specific expression gene, as well as a recombinant herpes simplex virus type I obtained by replacing the wild type promoter of the genomic ICP of the recombinant herpes simplex virus type I with the aforesaid promoter and preparation and use thereof. Also provided are a diagnostic kit for prenatal screening and use thereof, as well as a method for isolating fetal cells from a maternal blood sample in pregnancy.

    Claims

    1. A recombinant herpes simplex virus type I, wherein the virus has a pathogenicity-related ICP34.5 gene fragment removed, has the ICP wild type promoter of the viral genome replaced with a promoter of a gene specifically expressed in fetal trophoblast cells or a gene specifically expressed in fetal nucleated red blood cells, and has a marker for tracing the recombinant herpes simplex virus type I inserted into the virus.

    2. The recombinant herpes simplex virus type I according to claim 1, wherein the promoter of the gene specifically expressed in fetal trophoblast cells is a promoter selected from any one of SEQ ID NO: 1 to SEQ ID NO: 20, and the promoter of the gene specifically expressed in the fetal nucleated red blood cells is a promoter selected from any one of SEQ ID NO: 21 to SEQ ID NO: 23.

    3. The recombinant herpes simplex virus type I according to claim 1, wherein the recombinant herpes simplex virus type I has a fluorescent protein expression cassette inserted at the position where the ICP34.5 gene is removed.

    4. A diagnostic kit for prenatal screening during pregnancy, wherein the kit comprises is the recombinant herpes simplex virus type I according to claim 1.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    (1) FIG. 1 shows the construction of a pICP4delGFP plasmid; the construction of a recombinant herpes simplex virus type I with ICP4 gene removed (oHSV1-d4GFP); the construction of a pcDNA3-NHN-Np-ICP4 plasmid; and the construction of a recombinant herpes simplex virus type I 17+NpICP4 that replaces the ICP4 gene wild type promoter.

    (2) FIG. 2 illustrates the preparation of a pH2d34.5GFP plasmid.

    (3) FIG. 3 illustrates the preparation process of a stable cell line BHK-ICP4.

    (4) FIG. 4 shows the construction of a recombinant herpes simplex virus type I 17+NpICP4d34.5GFP, with ICP34.5 gene removed.

    (5) FIG. 5 is a schematic diagram of genetic recombination.

    (6) FIG. 6 illustrates an identification picture of gel electrophoresis of STR amplification.

    (7) FIG. 7 illustrates a schematic diagram of STR sequencing analysis.

    (8) FIGS. 8a-8h illustrate flow cytometry results for the isolation of fetal cells using a kit of the present invention comprising a promoter sequence of the present invention.

    DETAILED DESCRIPTION OF THE EMBODIMENTS

    (9) After the embryo develops into morula, the morula is further developed, cells begin to differentiate, and the smaller cells that accumulate at one end of the embryo are trophoblast cells, which will develop into fetal membrane and placenta at a later stage. Therefore, in general, taking a small amount of trophoblast cells during genetic diagnosis of a fetus does not affect the development of the fetus, but belongs to an invasive screening method. Fetal nucleated red blood cells are stably present in the peripheral blood of pregnant women and are cells of the fetal circulatory system, fetal erythroid cells develop earlier than leukocytic cells in early pregnancy, and the fetal nucleated red blood cells entering the maternal peripheral blood are more than other types of fetal cells in early pregnancy. The fetal trophoblast cells and fetal nucleated red blood cells have the same genome as the developing embryo and fetus; capturing and isolating the fetal trophoblast cells or fetal nucleated red blood cells and extracting chromosomes and DNA from these cells can be adopted for the screening of fetal hereditary diseases. In addition, the detection time can be earlier and the detection can be less invasive.

    (10) The herpes simplex virus type I (HSV-I) is a double-stranded DNA virus, with a host profile including a large number of mammals and birds, which does not integrate into the host genomic chromosomes after entering the host cells, is easy to manipulate and has a great capacity to package exogenous genes, and into which an exogenous gene up to 50 kb long can be inserted. The ICP34.5 gene of the herpes simplex virus type I is a pathogenic gene, and the product thereof renders the endogenous antiviral interferon system of the host ineffective and thus exerts a pathogenic effect.

    (11) Various fluorescent protein expression cassettes available in the art can be inserted into the recombinant herpes simplex virus type I of the present invention. The fluorescent protein expression cassette is preferably selected from the group consisting of a green fluorescent protein expression cassette, a cyan fluorescent protein expression cassette, a red fluorescent protein expression cassette, and a yellow fluorescent protein expression cassette. The green fluorescent protein expression cassette is most preferred. The color of the fluorescent protein (green, cyan, red, yellow, etc.) is determined by which known wavelength range of the visible spectrum the fluorescent emission light thereof falls into. The cyan (blue) fluorescent protein is formed by mutating the tyrosine residue at position 66 of the green fluorescent protein to histidine. This transition causes the blue emission light to have a maximum wavelength of 450 nm, and after mutation to tryptophan, the peak of the fluorescence can be 480 nm. The red fluorescent protein can be derived from corals, jellyfish and anemones (e.g., Discosomastriata). The peak of the fluorescence emission spectrum of the red fluorescent protein DsRed from Discosomastriata is 583 nm and the main peak of the excitation spectrum is 558 nm, and other minor peaks are around 500 nm. The yellow fluorescent protein can obtain a dipole moment of the stable chromophore in an excited state by mutating threonine at position 203 of the green fluorescent protein to tryptophan, thereby increasing the wavelengths of both the excitation light and the emitted light by 20 nm. The enhanced yellow fluorescent protein (EYFP) is one of the most widely used and brightest fluorescent proteins available. The fluorescence emitted by the fluorescent protein can be quantitatively or qualitatively detected by conventional detection means and instruments such as a fluorescence microscopy or a flow cytometry.

    (12) The recombinant herpes simplex virus type I obtained by the present invention can be preserved by a conventional method. For example, for short-term preservation, the virus can be directly stored or suspended in 50% glycerin saline and placed in a refrigerator at 30 C. For long-term preservation, the following can be adopted: (1) A low temperature flash freezing method, in which the virus suspension is added with inactivated animal serum or other protein protectants, preferably with additional dimethyl sulfoxide (e.g., 5% to 10%), followed by flash freezing and preservation at 70 C. or 196 C. A tissue material containing the virus may be directly cryopreserved, and may also be first immersed in 50% glycerol buffered saline and then cryopreserved (at 70 C. or 196 C.). (2) A freeze-drying method, in which the frozen virus suspension is dehydrated under vacuum. Usually, a low-temperature dehydration method is used, and excess water vapor, which has not been condensed in the condenser, is removed by a desiccant or condensation method. Common desiccants include phosphorus pentoxide, calcium sulfate, calcium chloride and silica gel. When the virus is freeze-dried, a defatted milk, an inactivated normal animal serum, a saturated sucrose solution or the like is generally used as a protective agent. During vacuum drying, the virus suspension is mixed with 5-10 times the amount of the protective agent, the resulting mixture is dispensed in ampoules, with a content of 0.2-0.5 ml for each, and the ampoules are immediately frozen in pre-cooled 30 C. to 40 C. alcohol for 1-2 hours, then quickly placed in a dryer with desiccants and immediately evacuated and dried. After sufficient drying, the dryer is opened to take out the ampoules of dried strain, which are evacuated to make them vacuum and sealed on the flame. Such freeze-dried strains can generally be preserved in a 4 C. refrigerator for several years to more than a decade. Thus, the dry powder of the recombinant type II herpes simplex virus of the present invention can be obtained.

    EXAMPLES

    (13) Material Sources:

    (14) 1. Herpes simplex virus type I 17+(also known as herpes simplex virus type I 17) strain, which has a Latin name of Herpes Simplex Virus type I, is commercially available from the UK Health Protection Agency Culture Collections (HPA). The whole genome sequence of the herpes simplex virus type I 17+ is known (Genbank No. NC_001806). 2. Plasmid pSP37 was purchased from Promega; plasmid pcDNA3 was purchased from Invitrogen; and pcDNA3.1-eGFP was purchased from YRGENE. 3. As shown in FIG. 3, a BHK-ICP4 cell line was prepared by: (1) treating the pcDNA3-NHN-Np-ICP4 plasmid shown in FIG. 1 with EcoRI/XhoI to obtain an ICP4 gene expression cassette, and inserting the ICP4 gene expression cassette into an EcoRI/XhoI site of the pcDNA3 plasmid to obtain a pcDNA3-CMV-ICP4 plasmid; and (2) transfecting the BHK cells with the pcDNA3-CMV-ICP4 plasmid as obtained above to generate, by screening, a stable cell line BHK-ICP4. 4. All of the nucleotide sequences used in the present invention were synthesized by Shanghai Biotech.

    Example 1

    (15) This example relates to the preparation of the recombinant herpes simplex virus type I of the present invention.

    (16) Purification of DNA of the Wild Type Herpes Simplex Virus Type I 17+ Virus

    (17) The wild type 17+ virus was grown with BHK cells, and the viral DNA of the wild type herpes simplex virus type I 17+ was purified using a DNAzol genomic DNA isolation kit (Helena Biosciences Cat. No. DN127200).

    (18) The BHK cells were grown in a 175 cm.sup.2 culture flask, and the culture solution was DMEM containing 10% fetal bovine serum and 1% penicillin-streptomycin. The culture conditions were 37 C. and 5% carbon dioxide. When the cells grew to 90% confluency, the wild type herpes simplex virus type I 17+ virus was inoculated. Incubation continued for 24-48 hours, and when more than 90% of the cells showed cytopathy, the culture solution was removed and 10 ml of DNAzol was added. Pipetting was performed for 5 times with a 10 ml pipette, a cell lysing solution was transferred to a 50 ml Falcon tube, 5 ml of 100% ethanol was added, and the tube was gently shaken in an orbital motion to allow the viral DNA to fully precipitate. The DNA was picked into another tube with a pipette tip, washed with 70% ethanol and then picked into a small centrifuge tube with a pipette tip. The residual ethanol was removed by pipetting, and the DNA was dissolved in 1 ml of sterilized water, aliquoted and stored at 20 C. before use.

    (19) Construction of a pICP4del-eGFP Plasmid

    (20) Constructing a pICP4del-eGFP plasmid: inserting the ICP4 US FLR (ICP4 upstream repeat) fragment treated with SaII and the ICP4 DS FLR (ICP4 downstream repeat) fragment treated with SalI/HindIII into EcoRV/HindIII site of the pSP73 plasmid purchased from Promega to obtain a pICP4del plasmid; from the pcDNA3.1-eGFP plasmid, cleaving a CMV-eGFP fragment with EcoRI/XhoI, inserting the CMV-eGFP gene expression cassette into the EcoRV site of the pICP4del plasmid to obtain a pICP4del-eGFP plasmid.

    (21) Construction of a Recombinant Herpes Simplex Virus Type I with the ICP4 Gene Removed (oHSV1-d4GFP)

    (22) Preparing the required solutions and cells: 1) viral DNA of the wild type herpes simplex virus type I 17+, 1 mg/ml, prepared with a DNAzol kit (ibid); 2) pICP4del-eGFP plasmid, 1 mg/ml; 3) Hepes transfection buffer, 140 mM NaCl, 5 mM KCl, 0.75 mM Na.sub.2HPO.sub.4, 5.5 mM D-glucose, 20 mM Hepes, pH7.05; 4) 2M CaCl.sub.2); 5) BHK cells grown at a confluency of 80-90% on a six-well culture plate; 6) 1.6% carboxymethyl cellulose (CMC), autoclaved at 121 C. for 20 minutes.
    Procedures: 1) taking two sterile eppendorf tubes and adding 400 l of Hepes transfection buffer to one of them; 2) adding, in the other eppendorf tube, 31 l of 2M CaCl.sub.2), 20 l of wild type herpes simplex virus type I 17+ viral DNA and 8 l of pICP4del-eGFP plasmid DNA, which were gently and homogenously mixed and slowly added to 400 l of the Hepes transfection buffer by pipetting; 3) after gently and homogenously mixing them, allowing the resulting mixture to rest at room temperature for 40 minutes; 4) after the 40 minutes, removing the culture solution of BHK cells grown to 80-90% confluency in a six-well culture plate, and slowly adding the transfection buffer of the above step 2) to the culture plate, each well corresponding to one transfection mixture, followed by incubation in a 5% CO.sub.2 and 37 C. incubator for 30 minutes; 5) after the 30 minutes, adding 1 ml of the cell culture solution into each well, and then putting the cell culture plate back into the 37 C. incubator for 5-hour incubation; 6) preparing a 20% DMSO solution with the Hepes buffer and placing the solution on ice; 7) after 5 hours, removing all the culture solution from the culture plate and washing the cells twice with 1 ml of a fresh culture solution; 8) adding 1 ml of the 20% DMSO solution to each well and leaving it at room temperature for 90 seconds; 9) removing the 20% DMSO solution quickly and carefully washing the cells twice with the fresh culture solution; 10) adding 2 ml of the fresh cell culture solution to each well, followed by incubation in a 37 C. and 5% CO.sub.2 incubator, wherein viral plaques could be observed after 48 hours, the culture plates were frozen in a 70 C. refrigerator once, and after thawing, the cells and the culture solution were harvested; and 11) culturing BHK-ICP4 cells with a six-well culture plate, when the cells reached 70% confluency, removing the culture solution by pipetting and adding 1 ml of a serum-free culture solution to each well, then adding 0.1 or 10 l of the harvest solution to each well and covering it with 2 ml of CMC (a complete culture solution (2:5)), after two days of growth, picking virus plaque with green fluorescence, which should be the 17+ recombinant virus (oHSV1-d4GFP) with the ICP4 gene removed, by a 20 l pipette under a microscope, purifying the recombinant virus by 5 rounds of plaque selection, and then culturing the virus by the method described above to prepare and extract oHSV1-d4GFP virus genomic DNA.
    Acquisition of a Promoter of a Gene Specifically Expressed in Fetal Trophoblast Cells (20 Specific Genes) or Nucleated Red Blood Cells (3 Specific Genes)

    (23) A list of fetus-specific genes was obtained by gene expression profile chips, and, specifically, the gene expression profiles of fetal cells and maternal cells were compared to screen for genes specifically expressed in the fetal cells. Screening was performed to acquire genes specifically expressed in the fetal trophoblast cells (20 specific genes) and genes specifically expressed in the fetal nucleated red blood cells (3 specific genes).

    (24) The promoter sequences of the specifically expressed genes were obtained by querying from the National Center for Biotechnology Information (NCBI) (see the attached table for the promoter sequences), two single-stranded DNAs of the positive-sense and antisense strands with NruI/HindIII sites were respectively obtained by base syntheses, and the single-stranded DNAs were annealed to form double-stranded DNA.

    (25) Annealing (50 l reaction volume) system and reaction conditions: 50 Mol forward primer 50 Mol reverse primer 30 mM Tris-HCl (pH9.2) 95 C. for 5 minutes, 70 C. for 10 minutes, gradually cooling to room temperature.

    (26) The promoters thus obtained are shown in Table 3 below:

    (27) TABLE-US-00003 TABLE 3 Corresponding Promoter Name SEQ ID NO. Promoter Source ANGPT2 SEQ ID NO: 1 trophoblast cell gene AIF1L SEQ ID NO: 2 trophoblast cell gene CRH SEQ ID NO: 3 trophoblast cell gene CYP19A1 SEQ ID NO: 4 trophoblast cell gene FBLN1 SEQ ID NO: 5 trophoblast cell gene GH2 SEQ ID NO: 6 trophoblast cell gene GULP1 SEQ ID NO: 7 trophoblast cell gene H19 SEQ ID NO: 8 trophoblast cell gene HSD3B1 SEQ ID NO: 9 trophoblast cell gene IGF2 SEQ ID NO: 10 trophoblast cell gene INSL4 SEQ ID NO: 11 trophoblast cell gene LGALS13 SEQ ID NO: 12 trophoblast cell gene MUC15 SEQ ID NO: 13 trophoblast cell gene PAEP SEQ ID NO: 14 trophoblast cell gene PKIB SEQ ID NO: 15 trophoblast cell gene PSG1 SEQ ID NO: 16 trophoblast cell gene PSG3 SEQ ID NO: 17 trophoblast cell gene PSG8 SEQ ID NO: 18 trophoblast cell gene SPTLC3 SEQ ID NO: 19 trophoblast cell gene TUSC3 SEQ ID NO: 20 trophoblast cell gene HBG1 SEQ ID NO: 21 nucleated red blood cell gene HBG2 SEQ ID NO: 22 nucleated red blood cell gene HBE1 SEQ ID NO: 23 nucleated red blood cell gene
    Construction of a Recombinant Herpes Simplex Virus Type I 17+NpICP4 with the ICP4 Gene Wild Type Promoter Replaced (1) PCR amplification of the ICP4 gene

    (28) The DNA of the wild type herpes simplex virus type I 17+ virus was purified, and the ICP4 gene was amplified by three-stage PCR. The PCR primer sequences used are shown in Table 4 below:

    (29) TABLE-US-00004 TABLE4 ICP4-1.sup.st ForwardPrimer1 ttttttgaattc.sup.147105atggcgtcggagaacaagcagcgcc.sup.147129 ReversePrimer2 .sup.148279tggagccaccccatggcctccgcgt.sup.148255 ICP4-2.sup.nd ForwardPrimer3 .sup.148205cgacgccgcgcagcagtacgccctg.sup.148229 ReversePrimer4 .sup.149739cggcgggggcgggcccggcgcaccg.sup.149715 ICP4-3.sup.rd ForwardPrimer5 .sup.149675cctcatgtttgacccgcgggccctg.sup.149699 ReversePrimer6 ttttttctcgag.sup.151001ttacagcaccccgtccccctcgaac.sup.150977

    (30) During PCR (50 l reaction volume) amplifications of both upstream and downstream FLRs, the following reaction condition was used: 20 ng wild type viral DNA 30 mM Tris-HCl (pH 9.2) 10 mM magnesium sulfate 15 mM sodium chloride 100 M dNTPs 50 Mol forward primer 50 Mol reverse primer 1 U (enzyme reaction unit) Taq DNA polymerase Amplification was carried out for 35 cycles, and the temperature and duration of each cycle were: 95 C., 60 seconds; 62 C., 20 seconds; 72 C., 120 seconds.

    (31) The ICP4-1.sup.st, ICP4-2.sup.nd and ICP4-3.sup.rd obtained by the above amplification were separately inserted into the EcoRV site of the pSP73 plasmid to obtain pSP73-ICP4-1.sup.st, pSP73-ICP4-2.sup.nd and pSP73-ICP4-3.sup.rd plasmids, respectively. (2) Construction of pICP4del-Np-ICP4 plasmids 1) inserting the double-stranded DNA of the promoter of the fetal trophoblast cell (20 specific genes)- or nucleated red blood cell (3 specific genes)-specifically expressed gene into NruI/HindIII site of the pcDNA3-NHN, respectively, to form a series of plasmids, collectively referred to as pcDNA3-NHN-Np; 2) treating the pSP73-ICP4-1.sup.st plasmid with EcoRI/BsrGI to obtain an ICP4-1.sup.st sequence, the pSP73-ICP4-2.sup.nd plasmid with BsrGI/PvuI to obtain an ICP4-2.sup.nd sequence and the pSP73-ICP4-3.sup.rd plasmid with PvuI/XhoI to obtain an ICP4-3.sup.rd sequence; 3) after linking the ICP4-1.sup.st, ICP4-2.sup.nd and ICP4-3.sup.rd gene sequences obtained in step 2), inserting them into the EcoRI/XhoI site of the pcDNA3-NHN-Np plasmid, to obtain a pcDNA3-NHN-Np-ICP4 plasmid, in which the promoter of a fetal trophoblast cell-specifically expressed gene (20 specific genes) or the promoter of a fetal nucleated red blood cell-specifically expressed gene (3 specific genes) was separately linked to the ICP4 gene; 4) treating the pcDNA3-NHN-Np-ICP4 plasmid obtained in step 3) with PmeI/HpaI to obtain an Np-ICP4 gene expression cassette, and inserting the Np-ICP4 gene expression cassette into the SaII/BE site of the pICP4del plasmid to obtain a pICP4del-Np-ICP4 plasmid, wherein all plasmids were confirmed by sequencing analysis to avoid mutations. (3) Preparation of BHK-ICP4 cells at 80-90% confluency with a six-well culture plate. The above oHSV1-d4GFP viral DNA and the pICP4del-Np-ICP4 plasmid DNA were co-transfected into the BHK-ICP4 cells. By homologous recombination, the oHSV1-d4GFP fluorescent protein expression cassette was homologously recombined with the ICP4 gene expression cassette linked to the promoter of a fetal trophoblast cell-specifically expressed gene (20 specific genes) or the promoter of a nucleated red blood cell-specifically expressed gene (3 specific genes), respectively, on the pcDNA3-NHN-Np-ICP4 plasmid, and plaque of the recombinant virus produced no fluorescence. The recombinant virus could be purified by selecting a plaque without green fluorescence. The recombinant virus (17+NpICP4) was cultured for proliferation to finally obtain a solution of 10.sup.10 pfu recombinant virus, and the solvent was a DMEM medium.
    Construction of a Recombinant Herpes Simplex Virus Type I 17+NpICP4d34.5GFP with the ICP34.5 Gene Removed 1) Constructing plasmid pH2dI34.5-GFP containing an upstream flanking region sequence and a downstream flanking region sequence of the ICP34.5 gene

    (32) The upstream and downstream flanking region sequences (Flanking Region, FLR for short) of the ICP34.5 gene were PCR-amplified by taking the full-length viral DNA obtained in step A as a template and using primers shown in Table 2. The PCR primer sequences used are shown in Table 5 below:

    (33) TABLE-US-00005 TABLE5 Amplificationofthe Forward AAATCAGCTG.sup.124356CGGTGAAGGTCGTCGTCAGAG.sup.124376 upstreamflanking Primer regionsequenceof Reverse AAATTCTAGA.sup.125661GCCGGCTTCCCGGTATGGTAA.sup.125641 theICP34.5gene Primer Amplificationofthe Forward AAATGATATC.sup.126943CAGCCCGGGCCGTGTTGCGGG.sup.126963 downstreamflanking Primer regionsequenceof Reverse AAATAGATCT.sup.127640CTCTGACCTGAGTGCAGGTTA.sup.127620 theICP34.5gene Primer

    (34) During PCR (50 l reaction volume) amplifications of both upstream and downstream FLRs, the following reaction condition was used: 20 ng wild type viral DNA 30 mM Tris-HCl (pH 9.2) 10 mM magnesium sulfate 15 mM sodium chloride 100 M dNTPs 50 Mol forward primer 50 Mol reverse primer 1 U (enzyme reaction unit) Taq DNA polymerase Amplification was carried out for 35 cycles, and the temperature and duration of each cycle were: 95 C., 60 seconds; 62 C., 20 seconds; 72 C., 120 seconds.

    (35) First, the PCR product of the upstream FLR was inserted into the PvuII/XbaI site of the pSP72 plasmid to obtain pSP72H2d34.5US. The PCR product of the downstream FLR was inserted into the EcoRV/BglII site of the pSP72H2d34.5US to obtain pH2d34.5 containing upstream and downstream flanking region sequences of the ICP34.5 gene. At last, the GFP expression cassette under the control of a CMV IE promoter was inserted into the EcoRV site of the pH2d34.5 to obtain pH2d34.5-GFP. All plasmids were confirmed by sequencing analysis to be free of mutations. 2) Constructing a recombinant herpes simplex virus type I 17+NpICP4d34.5GFP with the ICP34.5 gene removed

    (36) BHK-ICP4 cells at 80-90% confluency were prepared using a six-well culture plate. The above 17+NpICP4 viral DNA and the pH2d34.5-GFP plasmid DNA were co-transfected into the BHK-ICP4 cells, and by homologous recombination, the GFP expression cassette replaced the ICP34.5 gene, and the plaque of the recombinant virus had a green fluorescence. After 5 rounds of plaque purification, the recombinant virus (17+NpICP4d34.5GFP) could be purified by selecting a green fluorescent plaque. The recombinant virus (17+NpICP4d34.5GFP) was cultured for proliferation to finally obtain a solution of 10.sup.10 pfu of recombinant virus, and the solvent was a DMEM medium.

    (37) The 23 viruses constructed are shown in Table 6 below:

    (38) TABLE-US-00006 Promoter Name Corresponding VirusName ANGPT2 ANGPT2p-HSVGFP AIF1L AIF1L p-HSVGFP CRH CRH p-HSVGFP CYP19A1 CYP19A1p-HSVGFP FBLN1 FBLN1p-HSVGFP GH2 GH2p-HSVGFP GULP1 GULP1p-HSVGFP H19 H19p-HSVGFP HSD3B1 HSD3B1p-HSVGFP IGF2 IGF2p-HSVGFP INSL4 INSL4p-HSVGFP LGALS13 LGALS13p-HSVGFP MUC15 MUC15p-HSVGFP PAEP PAEP p-HSVGFP PKIB PKIB p-HSVGFP PSG1 PSG1p-HSVGFP PSG3 PSG3p-HSVGFP PSG8 PSG8p-HSVGFP SPTLC3 SPTLC3p-HSVGFP TUSC3 TUSC3p-HSVGFP HBG1 HBG1p-HSVGFP HBG2 HBG2p-HSVGFP HBE1 HBE1p-HSVGFP

    Example 2

    (39) This example describes a method for specifically capturing and isolating rare fetal cells.

    (40) The 10.sup.10 pfu recombinant virus solution prepared in Example 1 was centrifuged at 2000 rpm for 10 minutes, the supernatant DMEM culture medium was discarded, and the virus was suspended in an RPMI-1640 medium to obtain a virus suspension with a virus titer of 110.sup.7 cfu.

    (41) The virus suspension having a virus titer of 110.sup.7 cfu as prepared above was combined with a red blood cell lysing solution having a pH of 7 and a phosphate buffer having a pH of 7.3 to constitute the diagnostic kit for fetal cell capture and isolation as used in the following Examples 3 and 6, wherein the red blood cell lysing solution consisted of 0.15 M ammonium chloride, 10 nM potassium hydrogencarbonate and 1 nM ethylenediaminetetraacetic acid.

    (42) The virus suspension having a virus titer of 110.sup.7 cfu as prepared above was combined with Ficoll-Urografin has a specific density of 1.0770.001 kg/m.sup.3 and a phosphate buffer having a pH of 7.3 to constitute the kit for fetal cell capture and isolation as used in Example 4.

    (43) The virus suspension having a virus titer of 110.sup.7 cfu as prepared above was separately assembled into the kit for fetal cell capture and isolation as used in Example 5.

    Example 3

    (44) This example aims to describe the effectiveness and sensitivity of the diagnostic kit for fetal cell capture and isolation of the present invention.

    (45) Materials and Method:

    (46) 1) taking 5 ml of peripheral blood from a pregnant women in 8 weeks of pregnancy with an EDTA anticoagulation tube, and adding 45 ml of a red blood cell lysing solution, followed by incubation at room temperature for 10 minutes; 2) after the red blood cells are lysed, performing centrifugation (800 g, 10 minutes); 3) removing the supernatant, and re-suspending a cell pellet in 10 ml of a phosphate buffer (PBS) with a pH of 7.3, followed by centrifugation (800 g, 10 minutes); 4) removing the supernatant, and re-suspending a cell pellet in 2 ml RPMI-1640; 5) mixing 2 ml of the cells obtained in step 4) with 0.1 ml of a suspension of the recombinant herpes simplex virus type I (PSG3 type) (10.sup.6 Pfu/ml) of the present invention, and adding the resulting mixture to wells of a six-well culture plate; 6) incubating the culture plate in an incubator containing 5% CO.sub.2 at 37 C.; 7) after 24 hours, collecting the cells, and pipetting the cells into a centrifuge tube, followed by centrifugation (500 g, 5 minutes); 8) discarding the supernatant, and adding 3 ml of PBS in each centrifuge tube for gently washing the cells, followed by centrifugation (500 g, 5 minutes); 9) removing the supernatant, re-suspending cell pellet in 0.4 ml of PBS, and adding 100 l of APC-CD45 antibody (an APC-labeled antibody against leukocyte surface marker CD45), followed by incubation at room temperature for 30 minutes in the dark; 10) after the 30 minutes, gently washing each centrifuge tube with 4 ml of PBS, followed by centrifugation (500 g, 5 minutes); 11) after the centrifugation is completed, discarding the supernatant, adding PBS for re-suspending, and sorting CD45/GFP+ cells by flow cytometry; 12) performing STR-identification on the cells obtained by sorting; (1) injecting the CD45/GFP+ cells obtained by flow sorting into an EP tube containing 10 L of a lysis buffer, and adding 1 l of proteinase K to each EP tube, with an incubation in 56 C. water bath for 2 hours and in 80 C. water bath for 20 minutes, quickly placing on ice and instantaneously away from the EP tube:
    preparing a pre-amplification mixture under an ultra-clean laminar flow cabinet based on the number (n) of reactions: pre-amplification buffer*: 20 Ln pre-amplification enzyme*: 1.5 Ln total: 21.5 Ln
    preparing a pre-amplification buffer: 10 ThermoPol buffer: 2 L dNTPs (2.5 mM/each): 4 L MgSO.sub.4 (100 mM): 0.5 L MA-G primer (15 M): 1 L MA-T primer (15 M): 1 L nucleic acid-free water: 11.5 L usage amount: 20 L/reaction
    pre-amplification enzyme: Bst DNA polymerase (8 U/L): 0.8 L Deep Vent (exo-)(2 U/L): 0.7 L usage amount: 1.5 L/reaction (2) in the ultra-clean laminar flow cabinet, adding 20 L of the pre-amplification mixture to each 10 L of a cell lysis sample and transferring the mixture to a 200 L PCR tube; (3) performing incubation in a PCR instrument; (4) preparing an amplification mixture outside the ultra-clean laminar flow cabinet based on the reaction number (n): amplification buffer*: 30 Ln amplification enzyme*: 0.8 Ln total: 30.8 Ln
    preparing an amplification buffer: 10 ThermoPol buffer: 3 L dNTPs (2.5 mM/each): 4 L MgSO.sub.4 (100 mM): 1 L MA primer (15 M): 2 L nucleic acid-free water: 20 L usage amount: 30 L/reaction
    amplification enzyme: Deep Vent (exo-) (2 U/L) usage amount: 0.8 L/reaction (5) taking out a pre-amplification product from the PCR instrument, briefly centrifuging the product, and adding 30 L of an amplification mixture to each tube, followed by mixing homogenously; (6) performing incubation in the PCR instrument; (7) taking out an amplification product from the PCR instrument, briefly centrifuging the product, purifying the product with a PCR purification kit, and measuring the concentration of the product by Nanodrop; 13) performing individual identification of the amplified CFC genomic DNA:

    (47) At present, there are 12 short tandem repeat (STR) sites for individual identification. Taking the amplified CFC genomic DNA and the corresponding maternal genomic DNA as templates, 12 common PCR amplification reactions were carried out using primers of the 12 STR sites. Each reaction system was 20 L, including 40-50 ng of the DNA template, 1 L of the primer (10 mM), 2 L of dNTPs (2.5 mM/each), and 0.1 L of rTaq enzyme (5 U/L). The STR genes and primer sequences are shown in Table 7 below:

    (48) TABLE-US-00007 TABLE7 Fluores- Site LabeledPrimer cence Tube UnlabeledPrimer CSF1PO AACCTGAGTCTGCCAAGGACTAGC 5FAM B TTCCACACACCACTGGCCATCTTC D135317 ACAGAAGTCTGGGATGTGGA 5FAM B GCCCAAAAGACAGACAGAA D18S51 GAGCCATGTTCATGCCACTG 5HEX C CAAACCCGACTACCAGCAAC D16S539 GTTTGTGTGTGCATCTGTAAGCATGTATC 5HEX A GGGGGTCTAAGAGCTTGTAAAAAG D21S11 TGTATTAGTCAATGTTCTCCAGAGAC 5FAM A ATATGTGAGTCAATTCCCCAAG D5S818 AGCCACAGTTTACAACATTTGTATCT 5FAM A GGTGATTTTCCTCTTTGGTATCC D7S820 ATGTTGGTCAGGCTGACTATG 5FAM C GATTCCACATTTATCCTCATTGAC D8S1179 ACCAAATTGTGTTCATGAGTATAGTTTC 5HEX B ATTGCAACTTATATGTATTTTTGTATTTCATG FGA GGCTGCAGGGCATAACATTA 5FAM C ATTCTATGACTTTGCGCTTCAGGA TPOX CGCTCAAACGTGAGGTTG 5FAM B GCACAGAACAGGCACTTAGG THO1 GTGATTCCCATTGGCCTGTTC 5FAM C ATTCCTGTGGGCTGAAAAGCTC Amelogenin CCCTGGGCTCTGTAAAGAATAGTG 5FAM A ATCAGAGCTTAAACTGGGAAGGTG

    (49) The incubation conditions in the PCR instrument are shown in Table 8 below:

    (50) TABLE-US-00008 TABLE 8 Number of Cycles Temperature Time 1 94 C. 2 minutes 40 94 C. 30 seconds 60 C. 30 minutes 72 C. 1 minute 1 72 C. 5 minutes 1 4 C. holding 14) taking 5 L of each amplification product for mixing, and sending the mixed amplification products to the sequencing company for gene sequencing, wherein the results are shown in Table 9 below:

    (51) TABLE-US-00009 TABLE 9 Sample Number AME D5S D21S D16S D13S TPOX CSF D8S THO1 D7S FGA D18S female parent 43 104 115/136 223/227 289/293 124 177 228 302 168 281/307 240 347 CFC43k 104 115/136 223/227 293 124 177 228 302/314 168 281/307 236/240 347/355 female parent 44 104 136/140 223/227 281/288 124 172 224 306 168/176 232 281/285 343/355 CFC44k 104 136/140 223/227 282/289 124 172/178 223 282/306 168/176 232/240 282/285 340/352 female parent 48 104 127/145 226/231 281/289 185/188 223/227 270/274 306/310 168/176 223/227 281/292 350/352 CFC48k 104 226/230 281 184/188 274 306 168/176 227 281/292 352

    (52) The results showed that the cells obtained by sorting had the same characteristic sequences as the mother's, and, meanwhile, also contained specific sequences different from the mother's, which proved that the obtained cells were fetal cells.

    Example 4

    (53) 1) Adding 10 ml of Ficoll-Urografin with a specific density of 1.0770.001 kg/m.sup.3 in a 50 ml centrifuge tube; 2) taking 5 ml of heparin anti-coagulated venous blood for thorough and mixing homogenously with an equal volume of PBS having a pH value of 7.3, and slowly superimposing the resulting mixture along the tube wall on the stratified liquid surface by a dropper, with a clear interface remained, followed by horizontal centrifugation at 1000 g20 minutes; 3) after the centrifugation, three layers existing within the tube, wherein the upper layer is serum and PBS solution, the lower layer is mainly red blood cells and granulocytes, and the middle layer is mononuclear cells (including lymphocytes, monocytes and tumor cells); 4) pipetting the mononuclear cell layer and placing in a new centrifuge tube, adding a 6-fold volume of PBS having a pH value of 7.3, centrifuging at 800 g10 minutes, washing the cells twice with PBS, and then re-suspending the cells in 0.4 ml of RPMI1640; 5) mixing 2 ml of the cells obtained in step 4) with 0.1 ml of a recombinant herpes simplex virus type I (PSG3 type) suspension (10.sup.6 Pfu/ml) of the present invention, and adding the resulting mixture to wells of a six-well culture plate; 6) incubating the culture plate in a 37 C. incubator containing 5% CO.sub.2; 7) after 24 hours, collecting the cells, and pipetting the cells into a centrifuge tube, followed by centrifugation (500 g, 5 minutes); 8) discarding the supernatant, and adding 3 ml of PBS in each centrifuge tube for gently washing the cells, followed by centrifugation (500 g, 5 minutes); 9) removing the supernatant, re-suspending the cell pellet in 0.4 ml of PBS, and adding 100 l of an APC-CD45 antibody (an APC-labeled antibody against leukocyte surface marker CD45), followed by incubation at room temperature for 30 minutes in the dark; 10) after 30 minutes, gently washing each centrifuge tube with 4 ml of PBS, followed by centrifugation (500 g, 5 minutes); 11) after the centrifugation is completed, discarding the supernatant, adding PBS for re-suspending, and sorting CD45/GFP+ cells by flow cytometry; 12) performing STR-identification to the cells obtained by sorting (the same as steps 12-14 of Example 3).

    (54) The results are shown in Table 10 below:

    (55) TABLE-US-00010 TABLE 10 Sample Number AME D5S D21S D16S D13S TPOX CSF D8S THO1 D7S FGA D18S female parent 34 104 130/132 223/227 285/293 176/188 223/231 270 310/318 168 223/236 338/346 352 CFC34K 104 130 227 285/293 176 223 270/274 318 168 338 352 female parent 35 104 127/132 223 287/300 185 219/223 278/281 314 175 227/236 281/285 342/370 CFC35K 104 132 223 227/285 185/188 223 270/278 175 236 285/296 370 female parent 36 104 127/140 222 281/289 176/196 231/236 270/281 306/310 164/179 235 285/315 346/362 CFC36K 104 132/140 223/227 281 176 270/281 310 179 235/240 285/315 346

    (56) The results showed that the cells obtained by sorting had the same characteristic sequences as the mother's, and, meanwhile, also contained specific sequences different from the mother's, which proved that the obtained cells were fetal cells.

    Example 5

    (57) 1) dropping the cervical smear containing the cells on a glass slide in the middle; 2) mixing the cell suspension obtained in step 4) with 0.02 ml of the recombinant herpes simplex virus type I (PSG3 type) suspension (10.sup.6 Pfu/ml) of the present invention; 3) incubating the culture plate in a 37 C. incubator containing 5% CO.sub.2; 4) after 24 hours, detecting green fluorescent fetal cells with a fluorescence microscope; 5) collecting fluorescent cells, and performing STR-identification on the cells obtained by sorting; 6) performing STR-identification on the cells obtained by sorting (the same as steps 12-14 of Example 3).

    (58) The results are shown in Table 11 below:

    (59) TABLE-US-00011 TABLE 11 Sample Number AME D5S D21S D16S D13S TPOX CSF D8S THO1 D7S FGA D18S female parent 50 104 132/135 223/227 281/285 178/185/189 215/232 281 314/318 168/176 236 285/311 339/347 CFC50k 104 132/140 227/235 293 173 228/240 270 310/318 168/176 232/240 282/289 349/355 HBGHL father 104 132/135 223/227 281/285 178/189 215/232 281 314/318 168/176 236 285/311 339/347 HBGHL mother 104 132/140 227/235 293 173 228/240 270 310/318 168/176 232/240 282/289 349/355 CFC 104 132 223/227 293 173 270/281 310/318 168/176 232/236 349 Sample Number AME D5S D21S D16S D13S TPOX CSF D8S THO1 D7S FGA D18S

    (60) The results showed that the cells obtained by sorting had the same characteristic sequences as the mother's, and, meanwhile, also contained specific sequences different from the mother's, which proved that the obtained cells were fetal cells.

    Example 6

    (61) The peripheral blood of a pregnant woman was treated as in Example 2, and the virus suspension having a virus titer of 110.sup.7 cfu as prepared was combined with a red blood cell lysing solution having a pH of 7 and a phosphate buffer having a pH of 7.3 to constitute a diagnostic kit for fetal cell capture and isolation, wherein the red blood cell lysing solution consisted of 0.15 M ammonium chloride, 10 nM potassium hydrogencarbonate and 1 nM ethylenediaminetetraacetic acid. Fetal cell captures were performed with different viral vectors, respectively. The results are shown in FIGS. 8a-8h and Table 12 below:

    (62) TABLE-US-00012 TABLE 12 Vector Virus Type (corresponding promoter name) Result Description ANGPT2p-HSVGFP The blue dot in the P3 gate shows the captured fetal cells, the number of which is 6. AIF1L p-HSVGFP The blue dot in the P3 gate shows the captured fetal cell, the number of which is 1. CRH p-HSVGFP The blue dot in the P3 gate shows the captured fetal cells, the number of which is 2. CYP19A1p-HSVGFP The blue dot in the P3 gate shows the captured fetal cell, the number of which is 1. FBLN1p-HSVGFP The blue dot in the P3 gate shows the captured fetal cell, the number of which is 1. GH2p-HSVGFP The blue dot in the P3 gate shows the captured fetal cells, the number of which is 5. GULP1p-HSVGFP The blue dot in the P3 gate shows the captured fetal cell, the number of which is 1. H19p-HSVGFP The blue dot in the P3 gate shows the captured fetal cells, the number of which is 3. HSD3B1p-HSVGFP The blue dot in the P3 gate shows the captured fetal cells, the number of which is 2. IGF2p-HSVGFP The blue dot in the P3 gate shows the captured fetal cells, the number of which is 7. INSL4p-HSVGFP The blue dot in the P3 gate shows the captured fetal cells, the number of which is 8. LGALS13p-HSVGFP The blue dot in the P3 gate shows the captured fetal cell, the number of which is 1. MUC15p-HSVGFP The blue dot in the P3 gate shows the captured fetal cells, the number of which is 3. PAEP p-HSVGFP The blue dot in the P3 gate shows the captured fetal cell, the number of which is 1. PKIB p-HSVGFP The blue dot in the P3 gate shows the captured fetal cells, the number of which is 3. PSG1p-HSVGFP The blue dot in the P3 gate shows the captured fetal cells, the number of which is 2. PSG3p-HSVGFP The blue dot in the P3 gate shows the captured fetal cells, the number of which is 4. PSG8p-HSVGFP The blue dot in the P3 gate shows the captured fetal cells, the number of which is 3. SPTLC3p-HSVGFP The blue dot in the P3 gate shows the captured fetal cells, the number of which is 2. TUSC3p-HSVGFP The blue dot in the P3 gate shows the captured fetal cells, the number of which is 3. HBG1p-HSVGFP The blue dot in the P3 gate shows the captured fetal cells, the number of which is 2. HBG2p-HSVGFP The blue dot in the P3 gate shows the captured fetal cell, the number of which is 1. HBE1p-HSVGFP The blue dot in the P3 gate shows the captured fetal cells, the number of which is 12.

    (63) As can be seen, the recombinant viruses constructed using the promoters of the present invention could all accomplish the purpose of capturing fetal cells.