Hinge area and use of same in constructing car skeleton

Abstract

Provided in the present invention are an improved hinge area and the use of same in constructing CAR skeleton. The amino acid sequence of the improved hinge area is as shown in SEQ ID NO.1 or SEQ ID NO.2 or SEQ ID NO.3, and the hinge area can prolong the survival of CAR-T cells in vivo and/or improve the capability of CAR-T cells to infiltrate tumors.

Claims

1. A chimeric antigen receptor, comprising a hinge region consisting of the amino acid sequence of SEQ ID NO:3, antigen recognition region, transmembrane region and intracellular signal region; wherein the antigen recognition region is able to recognize antigen expressed by tumor cells, wherein the antigen is PSCA.

2. The chimeric antigen receptor according to claim 1, wherein comprising single chain antibody of anti-human PSCA antigen, provided in the amino acid sequence as shown in SEQ ID NO:6 or SEQ ID NO:7 or SEQ ID NO: 26 or SEQ ID NO:27.

3. The chimeric antigen receptor according to claim 2, wherein the transmembrane region is CD28TM or CD8TM, the amino acid sequence of the CD28TM is shown in SEQ ID NO:8, the amino acid sequence of the CD8TM is shown in SEQ ID NO:9, the intracellular signal region is CD28 and/or CD137 and/or CD3, the amino acid sequence of the CD28 is shown in SEQ ID NO:10, the amino acid sequence of the CD137 is shown in SEQ ID NO:11, the amino acid sequence of the CD3 is shown in SEQ ID NO:12.

4. The chimeric antigen receptor according to claim 1, wherein the amino acid sequence of the chimeric antigen receptor is shown in SEQ ID NO: 28 or SEQ ID NO:29 or SEQ ID NO:30.

5. A vector expressing the chimeric antigen receptor according to claim 1.

6. The vector according to claim 5, wherein the vector is lentivirus expression vector, retrovirus expression vector, adenovirus expression vector, adenoassociated virus expression vector, DNA vector, RNA vector or plasmid.

7. A cell infected by the vector according to claim 5, wherein the cell is T cell or NK cell or DC cell.

Description

BRIEF DESCRIPTION OF DRAWINGS

(1) FIG. 1 shows CAR structure diagram of different hinge regions and their composition.

(2) FIG. 2 shows different hinge sequences, including SEQ ID NO: 1 (7H), SEQ ID NO:2 (G4HH2H3mt), SEQ ID NO:3 (8H (dc)), SEQ ID NO:4 (G4HH2H3) and SEQ ID NO:5 (8H).

(3) FIG. 3 shows CAR expression rate of different hinge region combinations.

(4) FIG. 4 shows CAR average fluorescence intensity detection of CAR-T cells with different hinge region combinations.

(5) FIG. 5 shows CAR expression stability detection of CAR-T cells with different hinge region combinations.

(6) FIG. 6 shows long-term proliferation of CAR-T cells with different hinge region combinations.

(7) FIG. 7 shows the killing rate of CAR-T cells in vitro with different hinge region combinations.

(8) FIG. 8 shows a comparison of the killing effect of CAR-T cells with different hinge region combinations in vivo.

(9) FIG. 9 shows result of tumor weight after CAR-T cells killing in vivo, the CAR-T cells with different hinge region.

(10) FIG. 10 shows study on the survival of CAR-T cell in vivo and tumor infiltration capability of different hinge region combinations.

EMBODIMENTS

(11) The provided embodiments are intended to better describe the present invention, and not to limit the contents of the present invention to the embodiments. Accordingly, when a skilled artisan makes nonessential improvements and adjustments to the technical solution of the above invention, such improvements and adjustments shall still fall within the protection scope of the present invention.

Embodiment 1 Hinge Region Modification

(12) Use the G4HH2H3 hinge region derived from IgG4FC sequence as a template. The hinge region was modified by means of site-directed mutation. 8H (dc) is a modified sequence obtained by deleting the cysteines at positions 29 and 46 in the commonly used hinge region 8H sequence. 7H and DH are the hinge region sequences derived from human CD7 and human IgD, respectively. The modification results are shown in FIG. 1 and FIG. 2. G4HH2H3mt is a modified sequence obtained by the G4HH2H3 mutation at the positions 15-17 and 79, and deletion at the position 18. G4HH3 is a sequence of deleting H2 segment. G4Hinge is obtained by deleting the H2H3 segment sequence. 8H (dc) is a modified sequence obtained by deleting the cysteines at positions 29 and 46 in the commonly used hinge region 8H sequence.

Embodiment 2 Construction of Chimeric Antigen Receptor Viruses with Different Hinge Regions

(13) In order to verify the effect of hinge regions of different structures on the survival of CAR-T in vivo and tumor infiltration, take PSCA-targeted CAR-T as an example. Design CARs with 8 different hinge structures as shown in FIG. 1.

(14) 1. Synthesis of PSCA-Targeted Chimeric Antigen Receptor Gene Sequence Containing the Above Designed Hinge Sequence.

(15) Synthesis of CAR structures containing leader peptide (also called signal peptide, LP) and anti-human PSCA antigen single-chain antibody, 8 different hinge regions, CD28 transmembrane region (abbreviated as TM), and CD28, CD137 and CD3 intracellular signal regions.

(16) 2. Construction of Lentivirus Vector Expressing Chimeric Antigen Receptor.

(17) Design the following primers and synthesize them by biotechnology companies. The specific primers are as follows: Primer 1 (SEQ ID NO:22): 5-atcgctagcatggccctgccagtgaccgcc-3, NheI restriction enzyme site is underlined. Primer 2 (SEQ ID NO:23): 5-ccaggtcgacttagcgagggggcagggcctg-3, SalI restriction enzyme site is underlined.

(18) Then use the sequences shown above as primers, and each of the chimeric antigen receptor sequences synthesized above as a template for PCR amplification. Sample addition of the reaction system is performed according to KODFX NEO DNA polymerase (purchased from Toyobo company) instruction manual. After the amplification product is identified, the DNA fragment is recovered with a recovery kit (Promega company). For the specific method, see the instructions. The chimeric antigen receptor is recovered, and the DNA recovered fragment is sent to the biotechnology company for sequencing.

(19) The cloned gene sequence encoding the chimeric antigen receptor is double-digested with restriction enzyme NheI and SalI (purchased from Thermo Company), and the lentivirus expression vector pCDH-CAG (purchased from addgene Plasmid) is digested with restriction enzyme NheI and SalI. The enzyme digestion reaction is performed according to the instructions. The digested products are separated by agarose gel electrophoresis, and the DNA fragments are recovered using the agarose gel DNA fragment recovery kit, and then the target fragments and the vector fragments are ligated by T4 ligase (purchased from Promega) to obtain the lentivirus vector expressing chimeric antigen receptor, named Lv-hinge. The lentivirus vector is transformed into Escherichia coli TOP10 and pick up monoclonal to culture for 12 hours, and plasmids are extracted with a plasmid extraction kit (Invitrogen company). See the instructions for specific methods.

(20) Construct 8 lentivirus vectors as above method, respectively. scFv-8H hinge-CD28TM-CD28-CD137-CD3Z, scFv-8H (dc) hinge-CD28TM-CD28-CD137-CD3Z, scFv-7H hinge-CD28TM-CD28-CD137-CD3Z, scFv-DH hinge-CD28TM-CD28-CD137-CD3Z, scFv-G4HH2H3 hinge-CD28TM-CD28-CD137-CD3Z, scFv-G4HH2H3mt hinge-CD28TM-CD28-CD137-CD3Z, scFv-G4HH3 hinge-CD28TM-CD28-CD137-CD3Z, scFv-G4Hinge-CD28TM-CD28-CD137-CD3Z.
3. Lentivirus Packaging

(21) In this embodiment, the lentivirus package uses calcium phosphate method. For specific steps, see the Molecular Cloning Experiment Guide (Third Edition, J. Sambrook et al.).

(22) 4. Lentivirus Purification

(23) The virus supernatant is collected in a 50 ml centrifuge tube, filtrated by centrifugation, and the filtrate is centrifuged at 3000 r/min for 10 min and moved to a new 50 ml centrifuge tube; according to the amount of virus supernatant, add PEG6000 with a mass fraction of 50% and 4M NaCl respectively, and then use medical saline to adjust the final concentration of PEG6000 to 8.5% and the final concentration of NaCl to 0.3M. After the adjustment, store it in the refrigerator at 4 C., then centrifuge at 4 C. and discard the supernatant. The virus is resuspended in 200 l DMEM medium, and divided into 1.5 ml EP tubes, each tube with 40 l, and stored at 80 C. for future use.

(24) 5. Lentivirus Titer Determination

(25) Step 1: Viruses Infect 293T Cells

(26) Plate 293T cells before infection, take 1 l of the purified virus, dilute it 10 times with medical saline, then add 1 l of Polybrene solution to the cells inside each well, and then add the virus to 293T cells respectively. 24 hours after infection, change the solution with 10% FBS (wt) DMEM medium; 72 hours after infection, centrifuge at 1000 r/min for 5 min to collect the cells, and extract the genome.

(27) Step 2: Extract Genome

(28) The genomic extraction kit QIAamp DNA Blood Mini Kit is purchased from Qiagen Corporation (Product No. 511004), and operate according to the kit instructions.

(29) Step 3: Determination of Virus Titer by qRT-PCR

(30) Reaction system: Premix Ex Taq II (2) 10 l, Upstream primer (GAG up) 1 l, Downstream primer (GAG dn) 1 l, extracted genome 1 l, RNase-Free dH.sub.2O 7 l, at least 3 replicate wells for each sample and standard solution. Then perform the amplification according to the following procedures: pre-denaturation at 95 C. for 30 s, denaturation at 95 C. for 5 s, annealing at 60 C. for 30 s, and extension at 72 C. for 30 s. After the reaction, analyze data with analysis software, and calculate virus titer based on a standard curve.

Embodiment 3 Detection of the Capability of CAR to Transfect T Lymphocytes

(31) 1 Isolation of Human Peripheral Blood Mononuclear Cells

(32) Collect about 60 ml of peripheral blood with blood collection tube, dispense the blood into 50 ml centrifuge tube, add 7.5 ml of hydroxyethyl starch to dilute; settle naturally at room temperature (18-25 C.) for about 30 min and collect the upper plasma. After centrifuging the collected upper plasma, resuspend it with physiological saline, add it to lymphocyte separation solution at a volume ratio of 1:1, and then conduct gradient centrifugation.

(33) After the centrifugation, the centrifuge tube is divided into: the first layer: plasma layer; the second layer: annular milky white lymphocyte layer; the third layer: transparent separation layer; the fourth layer: red blood cell layer. Take the second layer, annular milky white lymphocyte layer, wash it twice with normal saline, centrifuge for 5 min, resuspend the cells with normal saline, add RPMI 1640 complete medium containing 10% FBS and culture, to obtain human peripheral blood mononuclear cells.

(34) 2 Lentivirus Vectors Infect T Lymphocytes

(35) Freshly prepared mononuclear cells PBMC are cultured in RPMI 1640 complete medium containing 10% fetal bovine serum, and PBMC activation is performed on the first day; lentivirus infection is performed on the third day. Add 5MOI corresponding lentivirus vector, and use uninfected T lymphocytes as blank control, replace the medium with RPMI1640 complete medium containing 500 IU/ml recombinant human IL-2 after 24 hours, and continue to culture for 10-20 days. Obtain CAR-T cells expressing the chimeric antigen receptor including antigen recognition region, hinge region, transmembrane region and intracellular signal region, named after the modified hinge region, named as: PSCA-CAR-G4HH2H3, PSCA-CAR-G4HH2H3mt, PSCA-CAR-G4HH3, PSCA-CAR-G4Hinge, PSCA-CAR-7H, PSCA-CAR-8H, PSCA-CAR-8H (dc) and PSCA-CAR-DH. In order to facilitate labeling when drawing, the above-mentioned CAR-T cells are abbreviated as G4HH2H3, G4HH2H3mt, G4HH3, G4Hinge, 7H, 8H, 8H (dc) and DH in subsequent embodiment and drawings of the specification.

(36) 1) During the culture process, the virus-infected T cells cultured to 10 days are centrifuged to discard the supernatant to collect the cells, resuspend the cells with a PBS solution containing a volume fraction of 1% fetal bovine serum, and adjust the cell density to 110.sup.6 cells/ml. Sub-package the collected cells and detect the positive rate of Protein-L by flow cytometry. The test result indicates the positive rate of different CAR combinations expressed on T lymphocytes on the 10.sup.th day of culture. Simultaneous analysis of MFI (average fluorescence intensity) by flow cytometry to obtain the results of CAR average fluorescence intensity.

(37) Results are shown in FIG. 3 and FIG. 4. The results of FIG. 3 show that the positive rate of modified hinge structure G4HH2H3mt, G4HH3, G4Hinge, 7H and DH combined CAR expression on the T cell surface is not much different from the conventional hinge G4HH2H3 or 8H combined CAR. FIG. 4 shows the average fluorescence intensity of CAR expression on the surface of CAR-T cells with different hinge structures. Among them, CARs with G4HH2H3, G4HH2H3mt, 7H or 8H (dc) structure can be highly expressed on the surface of T cells and have higher surface average fluorescence intensity, which indicates that CAR molecules are expressed more on the cell surface, and the surface average fluorescence intensity of the CARs with G4HH3, G4Hinge or DH structure are lower.

(38) In summary, there is no significant difference as to the positive rates of CARs with G4HH2H3mt, G4HH3, G4Hinge, 7H and 8H (dc) hinge structures expression on the surface of T cells, but CARs with G4HH2H3mt, 7H and 8H (dc) structures have higher surface average fluorescence intensity and are more sensitive to antigens, and the CAR-T data required to achieve the expected killing effect will also be lower.

(39) 2) Detection of CAR expression of different hinge structure combinations on the 5.sup.th, 10.sup.th, and 14.sup.th days after infection and acquisition of CAR-T cells by the method of step 1), and detection of the stability of CAR expression after long-term culturing.

(40) Results are shown in FIG. 5: the long-term expression of CAR is tested and found that, when the modified structure is compared with the unmodified structure G4HH2H3 and 8H, the CAR expression stability of the DH hinge structure is poor. The positive rate of CAR decreased significantly after the 5.sup.th day and decreased even more significantly with the extension of culture time. The CAR stability of the remaining modified hinge structures and the unmodified hinge combination have no significant difference, among which, 8H (dc) has higher CAR expression, and long-term expression is also relatively more stable.

Embodiment 4 Detection of Long-Term Proliferation Capability of CAR-T Cells

(41) Detection of proliferation of the infected PSCA-CAR-T cells under normal culture conditions; CAR-T cells obtained in the embodiment 3 are cultured for 10 days using the method in Step 2 of the embodiment 3. PSCA antigen coated 24-well plate for overnight at 4 C., CAR-T cells are plated with 110.sup.6/well on the PSCA antigen coated 24-well plate to observe the survival time of CAR-T cells after antigen stimulation. On the 3.sup.rd, 6.sup.th, 9.sup.th, and 12.sup.th days after stimulation, count the number of CAR-T cells with a cell counter and calculate CAR-T cells proliferation multiples. Results are shown in FIG. 6.

(42) Based on the experience of in vivo experiments, antigen stimulation is performed once every 7 days. The results of FIG. 6 showed that the CAR-T cells no longer proliferated after the third stimulation of the antigen, so the experiment is terminated after the 15.sup.th day, after the third stimulation. Calculate the CAR-T long-term proliferation multiples and the survival time of long-term proliferation response of CAR-T cells.

(43) Results are shown in FIG. 6. CAR-T cells with G4HH2H3, G4HH2H3mt, 8H, 7H, and 8H (dc) hinge combination proliferate relatively faster in the long term and CAR-T cells have stronger survivability in vitro. CAR-T cells with DH, G4Hinge, and G4HH3 have poor long-term proliferation capability.

(44) In summary, CAR-T cells with G4HH2H3, G4HH2H3mt, 7H, 8H, and 8H (dc) hinge combination proliferate relatively faster, and CAR-T cells have stronger survivability in vitro.

Embodiment 5 Effects on the Capability of CAR-T Cells to Eliminate Tumor Cells

(45) The killing capability of CAR-T with different hinge structures on target cells is measured by ACEA xCELLigence RTCA MP instrument, and the experimental procedure is carried out according to the instrument manual.

(46) The target cells (PSCA-expressing tumor cells) are plated with 2-510.sup.4/well in 96-well plate equipped with the instrument on the first day, the tumor cells attached to the bottom of the well are recorded every 15 minutes using the resistance index as the data. After 24 hours, the corresponding CAR-T cells are plated in each well according to the pre-designed efficiency-target ratio, and the resistance index is recorded every 15 minutes after the CAR-T cells are plated, and the resistance index is used to determine the proliferation or death of the adherent target cells. The formula used for analyzing the resistance index analysis result: CAR-T cell killing rate=baseline resistance index-real-time resistance index.

(47) HeLa and RT4 are tumor cell lines with high expression of PSCA, T24 are negative control cells without PSCA expression.

(48) Results are shown in FIG. 7, G4HH2H3, G4HH2H3mt, 8H, and 8H (dc) have better killing capability, and do not kill negative cells, and accordingly have strong specificity.

(49) Subsequently, CAR-T cells containing G4HH2H3, G4HH2H3mt, 8H, 7H and 8H (dc) hinge structures are used for in vivo experimental verification.

Embodiment 6 Verification of Anti-Tumor Effects of CAR-T Cells in Animal Models

(50) Establishment of a mouse xenograft model of human PSCA positive tumor cell line to verify the antitumor effect of T lymphocytes in animal model, wherein the T lymphocytes express chimeric antigen receptor targeting PSCA.

(51) In vivo verification, the mouse used is NOD.Cg-PrkdcscidII2rgtm1Sug/JicCrl, abbreviated as NOG mouse, which is bred by Mamoru Ito of Japan Institute of Experimental Animals (CIEA) and is the most common strain used in CAR-T in vivo related tumorigenesis experiments in the world. The tumorigenesis target cells used in the in vivo verification is Hela (abbreviated as Hela-luc), a PSCA-positive cell line stably expressing firefly luciferase, which is used in the previous in vitro verification.

(52) The previous in vitro experiments found that the modified hinge G4HH2H3, G4HH2H3mt, 7H, 8H and 8H (dc) structures have better killing and in vitro survivability, therefore, in animal experiments, the 5 types of CAR-T cells (including the commonly used CAR-T cells with G4HH2H3 and 8H hinges) are used to measure the capability to kill tumors in mice. The therapeutically injected effector cells are CAR-T cells containing G4HH2H3mt, G4HH2H3, 7H, 8H (dc) and 8H hinge structures, and the control is saline group, non-infected PBMC cells.

(53) Inject effector CAR-T cells into tail vein after tumorigenesis, at 510.sup.5 cells/mouse. After injection of the CAR T cells, images are taken every 7 days by PerkinElmer's IVS in vivo imaging system to show tumor growth. During the period, observe and record the survival of the mice every day. Results are shown in FIG. 8: CAR-T cells containing G4HH2H3mt, 7H, 8H (dc) and 8H hinges have good killing effect on tumor cells in vivo. After the mice are killed at the end of the experiment, the tumor tissues are removed and weighed, and the results are statistically analyzed, as shown in FIG. 9: mice treated with CAR-T cells containing G4HH2H3mt, 7H, and 8H (dc) hinges have lighter tumor weight, especially mice treated with CAR-T cells containing 7H and 8H (dc) hinge combination have been basically free of tumor.

Embodiment 7 Study on the Survival and Tumor Infiltration Capability of CAR-T Cells In Vivo

(54) Use RT-PCR to detect CAR gene copies in tumor issue to detect the survival capability of CAR-T cells in vivo and the tumor infiltration capability of CAR-T cells in vivo.

(55) 1. Design Primers

(56) TABLE-US-00009 BBZ-HF: (SEQIDNO:35) CAGAAGAAGAAGAAGGAGGATGTG; BBZ-HR: (SEQIDNO:36) TACTCCTCTCTTCGTCCTAGATTG.
2. Extract RNA from Tumor Issue

(57) Firstly, add liquid nitrogen to the mortar, then cut the tumor tissue into small pieces and grind them into powder in liquid nitrogen. Use a spatula pre-cooled with liquid nitrogen to take an appropriate amount of tissue powder and add it to the EP tube containing Trizol solution and mix sufficiently well. Place at room temperature for 5 min, then add 200 ml of chloroform, cover the EP tube tightly and shake vigorously for 15 s. Centrifuge it and take the upper water phase into a new EP tube, add 500 ml of isopropanol, mix gently by inverting. Centrifuge it at room temperature for 10 min. Discard the supernatant carefully, add 1 ml of 75% ethanol, vortex to mix, centrifuge it and repeat the operation once. Discard the supernatant and dry at room temperature or vacuum for 5 to 10 minutes. Dissolve RNA in 30 ml DEPC treated water, store in 70% ethanol and store at 70 C.

(58) 3. RT-PCR

(59) Perform RT-PCR, the reaction system is as follow:

(60) Reaction system: Forward primer (10 M) 0.5, Reverse primer (10 M) 0.5 l, 2SYBR Premix Ex Taq II 10 l, Template 1 l, Extracted genome 1 l, RNase-Free dH.sub.2O 7 l, at least 3 replicate wells for each sample and standard solution. Then perform amplification according to the following procedure: 95 C. for 2 min, 95 C. for 15 s, 60 C. for 1 min, 40 cycles. After the reaction, analyze the data with analysis software. The analysis results are shown in Table 3 and FIG. 10.

(61) Table 3 shows the detected CAR copies of tumor tissues treated with CAR T cells of different structures, and FIG. 10 is a graph drawn according to the results of Table 3. The results show that 7H, G4HH2H3mt and 8H (dc) as hinge areas can significantly enhance the capability of CAR-T to infiltrate the tumors.

(62) TABLE-US-00010 TABLE 3 45 days after the reinfusion of the CAR-T cells, the survival time of CAR-T with different hinge structures in vivo Copies Group Copies/ug Mean 7H 25334.120 10407.800 7653.580 34199.720 24571.460 23548.740 20952.570 G4HH2 13892.010 10027.970 24928.830 20763.770 20069.680 17936.452 H3mt G4HH2 39.210 285.580 92.580 39.540 44.040 19.290 86.707 H3 control T 25.750 18.240 35.970 10.430 347.070 8.550 74.335 8H 14989.200 8645.350 2296.620 8370.480 2344.560 4683.690 6888.317 8H(dc) 36473.150 34065.390 52071.950 36012.530 34429.970 38610.598 Saline 46.690 20.460 367.280 53.200 35.050 104.536

(63) Lastly, it should be clarified that the above embodiments are just to elaborate the technical solution of the present invention and are not to limit the same. While the present invention has been described in details with reference to the preferred embodiments, it should be further appreciated by the person skilled in the art that modifications and equivalent replacements of the technical solution of the present invention do not fall out of the objective and scope of the technical solution of the present invention, and should be covered within the claims of the present invention.