Inorganic porous support and method for producing nucleic acid using same
12162765 ยท 2024-12-10
Assignee
Inventors
- Syusaku Hara (Niihama, JP)
- Masaki KITAHARA (Chuo-ku, JP)
- TAKASHI HARA (Osaka, JP)
- Takashi Arimura (Tsukuba, JP)
Cpc classification
B01J35/60
PERFORMING OPERATIONS; TRANSPORTING
B01J2229/32
PERFORMING OPERATIONS; TRANSPORTING
B01J31/069
PERFORMING OPERATIONS; TRANSPORTING
C01B39/00
CHEMISTRY; METALLURGY
C01B39/46
CHEMISTRY; METALLURGY
C03C23/00
CHEMISTRY; METALLURGY
International classification
Abstract
An inorganic porous carrier that can be used to increase the purity of nucleic acid in a production thereof, and that comprises a linker of formula (1), wherein a Survival Bone Rate (SBR) value is 5.0% or more. In the formula (1), a bond * represents a linkage of an inorganic porous substance to the oxygen atom of a silanol group; n is an integer of 1 etc.; R represents independently of each other an alkyl group containing 3 to 10 carbon atoms which may have a substituent such as an alkoxy group etc.; and L represents a single bond; an alkylene group of 1 to 20 carbon atoms; or an alkylene group containing 2 to 20 carbon atoms which contains CH.sub.2-Q-CH.sub.2 group wherein any group Q selected from a group consisting of O etc. is inserted into at least one of CH.sub.2CH.sub.2 group constituting the alkylene group. ##STR00001##
Claims
1. An inorganic porous carrier comprising a linker represented by the following formula (1), wherein a Survival Bone Rate (SBR) value of an inorganic porous substance is at least 5.0% and the most frequent value, which is a mode diameter, of the inorganic porous substance is from 0.04 m to 1 m, ##STR00017## wherein a bond marked with * represents a linkage of the inorganic porous substance to the oxygen atom of a silanol group; n is an integer of 1, 2 or 3; R represents independently of each other an alkyl group comprising 3 to 10 carbon atoms optionally having a substituent selected from the group consisting of an alkoxy group and a fluorine atom; a phenyl group optionally having a substituent selected from the group consisting of an alkyl group, an alkoxy group, and a fluorine atom; a hydroxyl group; or an alkoxy group comprising 1 to 4 carbon atom; and L represents a single bond; an alkylene group comprising 1 to 20 carbon atoms; or an alkylene group comprising 2 to 20 carbon atoms which contains CH.sub.2-Q-CH.sub.2 group wherein any group Q selected from the group consisting of O, NH, NHCO and NHCONH is inserted into at least one of CH.sub.2CH.sub.2 group constituting the alkylene group; provided that a carbon atom of the methylene group bound to the group Q does not bind to another group Q at the same time.
2. The inorganic porous carrier according to claim 1, wherein the inorganic porous substance has at least 97% as a ratio of the sum of a total length of all through holes relative to the sum of a total length of all pores within a range of an analysis area of about 4 m2.5 m1 m as a continuous slice image of the inorganic porous substance.
3. The inorganic porous carrier according to claim 1, wherein the inorganic porous substance has at least 80% as Output I ratio on From (OIR) value which is obtained when an analysis is conducted on about 1.0 m as a thickness of a continuous slice image of the inorganic porous substance using a quantitative analysis software TRI/3D-BON-FCS64 under the condition where an analysis parameter is made PathL, Max=6.0PathL, number of search paths=50000, and number of output paths=50000.
4. The inorganic porous carrier according to claim 1, wherein a specific surface area per volume of the inorganic porous substance is from 0.1 m.sup.2/mL to 100 m.sup.2/mL.
5. The inorganic porous carrier according to claim 1, wherein a pore volume per volume of the inorganic porous substance is from 0.05 mL/mL to 0.6 mL/mL.
6. The inorganic porous carrier according to claim 1, wherein a porosity of the inorganic porous substance is at least 50%.
7. The inorganic porous carrier according to claim 1, wherein a particle diameter, which is a median diameter, of the inorganic porous substance is from 1 m to 1000 m.
8. The inorganic porous carrier according to claim 1, wherein the inorganic porous substance is silica, silica gel, zeolite, or glass.
9. An inorganic porous carrier comprising a linker represented by the following formula (2), wherein a Survival Bone Rate (SBR) value of an inorganic porous substance is at least 5.0%, ##STR00018## wherein a bond marked with * represents a linkage of the inorganic porous substance to the oxygen atom of a silanol group; n is an integer of 1, 2 or 3; R represents independently of each other an alkyl group comprising 3 to 10 carbon atoms optionally having a substituent selected from the group consisting of an alkoxy group and a fluorine atom; a phenyl group optionally having a substituent selected from the group consisting of an alkyl group, an alkoxy group, and a fluorine atom; a hydroxyl group; or an alkoxy group comprising 1 to 4 carbon atom; L represents a single bond; an alkylene group comprising 1 to 20 carbon atoms; or an alkylene group comprising 2 to 20 carbon atoms which contains CH.sub.2-Q-CH.sub.2 group wherein any group Q selected from the group consisting of O, NH, NHCO, and NHCONH is inserted into at least one CH.sub.2CH.sub.2 group constituting the alkylene group; provided that a carbon atom of the methylene group bound to the group Q doses not bind to another group Q at the same time; R.sub.b represents a nucleotide or a nucleotide in which a reactive group is protected or deprotected; and L.sub.1 represents a divalent group bound to an oxygen atom of a primary or a secondary hydroxy group as R.sub.b.
10. The inorganic porous carrier according to claim 9, wherein a support density of the linker is from 0.1 mol/m.sup.2 to 5.0 mol/m.sup.2 relative to a specific surface area per mass of the inorganic porous substance.
11. The inorganic porous carrier according to claim 9, wherein L.sup.1 in the formula (2) is a succinyl linker or a universal linker.
12. A method for preparing a nucleic acid which is carried out by using the inorganic porous carrier of claim 9, wherein R.sub.b in the formula (2) represents a nucleoside or nucleotide in which a hydroxyl group as a reactive group is protected, the method comprising: (A) deprotecting a protecting group of the hydroxyl group at the 5position of the nucleoside; (B) subjecting the hydroxyl group at the 5position of the nucleoside produced in (A) to a condensation reaction with an amidite compound having a second nucleoside base to produce a phosphite; (C) oxidizing the phosphite produced in (B) to produce a nucleotide; and (D) deprotecting a protecting group of a hydroxyl group at the 5position of the nucleotide produced in (C).
13. The method according to claim 12, further comprising: (B) subjecting the product produced in (D) to a condensation reaction with an amidite compound having a nucleoside base to produce a phosphite; (C) oxidizing the phosphite produced in (B) to produce an oligonucleotide; and (D) deprotecting a protecting group of a hydroxyl group at the 5position in an end of an oligonucleotide strand produced in (C).
14. The method according to claim 13, further comprising (E) repeating (B), (C) and (D) m times, wherein m is an integer of 1 or more, to react the number of m of amidite compounds, and then cleaving an elongated nucleic acid.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
MODE FOR CARRYING OUT THE INVENTION
(3) As used herein, when a certain numerical range is referred to as A to B or A-B, it means a range represented by from A or more to B or less unless otherwise stated.
(4) (Inorganic Porous Carrier)
(5) The inorganic porous carrier of the first aspect of the present invention is explained.
(6) <Inorganic Porous Substance>
(7) The inorganic porous substance constituting the inorganic porous carrier of the present embodiment has a Survival Bone Rate (SBR) value is 5.0% or more.
(8) The inorganic porous substance has typically a silanol group that can support a silane coupling agent. As a typical examples of the inorganic porous substance, silica, silica gel, zeolite, glass, or quartz is exemplified, preferably silica, silica gel, zeolite or glass is exemplified. These compounds may be used as a commercially available product, or may be used as one obtained by preparing according to the below-mentioned synthesis method.
(9) [Method for Preparing Inorganic Porous Substance Containing Silanol Group]
(10) Examples of the method for preparing the inorganic porous substance containing the silanol group include a dry method and a wet method. Specific examples of the former include a combustion method and an arc method, and specific examples of the latter include synthesis methods such as a precipitation method, a sol-gel method, and a hydrothermal synthesis method (Reference: TOSOH Research & Technology Review Vol. 45 (2001)).
(11) The preparation of such an inorganic porous substance is carried out by, for example, using silicate, alkoxysilane, chlorosilanes or the like as raw materials according to the synthesis method as described above using a solvent and a template.
(12) The preparation of the inorganic porous substance can be carried out, for example, according to any one of the following methods: 1. a method of precipitating silica, and then removing a solvent contained in a framework of the silica; 2. a method of precipitating a solid after mixing silica with dissimilar metal other than silica such as aluminum, boron, or the like, and then phase-separating the resulting mixture into a silica component and a component other than silica, and removing the component other than silica; 3. a method of precipitating silica after mixing silica with an ammonium salt or a polymer as a template agent, and then removing the template agent; and 4. a method of aggregating a precipitated silica. A combination of two or more of the above methods may be used.
(13) The methods of removing the solvent or the template agent in the above methods 1 and 3 may include drying, supercritical extraction, sintering or the like.
(14) As silica which is aggregated by the method 4, silica, silica gel, zeolite, glass or quartz, or two or more thereof may be used.
(15) The zeolite is a substance containing silicon and oxygen as an element composed of the framework of the zeolite, and may be a crystalline silica whose framework is substantially composed of silicon and oxygen, and may be a crystalline metallosilicate and so on further containing other elements as a constitute element for the framework.
(16) In the case of metallosilicate and so on, examples of the elements that may be existed as the element other than silicon and oxygen include anyone kind of the followings selected from Be, B, Al, Ti, V, Cr, Fe, Co, Ni, Cu, Zn, Ga, Ge, Zr, Nb, Sb, La, Hf or Bi, and as needed, two or more kinds of these elements may be contained.
(17) Also, the atomic ratio of silicon against existing elements other than silicon and oxygen is preferably 5 or more, and further preferably 500 or more.
(18) The above-mentioned zeolite may be synthesized by a hydration synthesis reaction of a mixture containing silicon compound, water and quaternary ammonium hydroxide.
(19) Examples of the above-mentioned silicon compound include amorphous silica; alkaline silicate such as sodium silicate and potassium silicate; tetraalkyl orthosilicate such as tetramethyl orthosilicate, tetraethyl orthosilicate, tetrapropyl orthosilicate, and tetrabutyl orthosilicate, and as needed, two or more kinds of these compounds can be used.
(20) Examples of the above-mentioned quaternary ammonium hydroxide preferably include tetraalkyl ammonium hydroxide. Examples of the tetraalkyl ammonium hydroxide include for example, tetramethyl ammonium hydroxide, tetraethyl ammonium hydroxide, n-propyl trimethyl ammonium hydroxide, tetra-n-propyl ammonium hydroxide, tetra-n-butyl ammonium hydroxide, triethyl methyl ammonium hydroxide, tri-n-propyl methyl ammonium hydroxide, and tri-n-butyl methyl ammonium hydroxide, or two or more kinds of these compounds.
(21) The molar ratio of water relative to silicon in the mixture of the hydration synthesis is within a range of 5 to 100, more preferably 10 to 60.
(22) The molar ratio of the quaternary ammonium ion relative to silicon in the mixture is preferably 0.1 to 0.6, and more preferably 0.2 to 0.5.
(23) The molar ratio of the hydroxide ion relative to silicon in the mixture to be subjected to a hydration synthesis is adjusted to usually 0.1 to 0.6, preferably 0.2 to 0.5. As the molar ratio of the hydroxide ion relative to the silicon in the mixture is higher, the primary particle diameter of the obtained zeolite has a tendency to become small.
(24) The molar ratio of potassium relative to the silicon in the mixture is adjusted to preferably 0 to 0.1, more preferably 0.04 to 0.1. The molar ratio of potassium relative to the silicon in the mixture can be adjusted appropriately, for example, by adjusting a used amount of the silicon compound, or adjusting the content of each rough material, particularly, potassium compound which may be contained as impure material in the quaternary ammonium hydroxide.
(25) When the mixture is subjected to a hydration synthesis reaction, the temperature of the hydration synthesis is preferably 80 to 160 C., more preferably 100 to 140 C. The duration of the hydration synthesis is preferably 1 to 200 hours, more preferably 12 to 72 hours. The pressure of the hydration synthesis is preferably within a range of 0.1 to 1.0 MPa as an absolute pressure, more preferably 0.11 to 0.50 MPa.
(26) The method for hydration synthesis is not particularly limited, and, for example, can be carried out by enclosing the above-mentioned mixture into a reactor such as autoclave and then subjecting the resulting mixture to the reaction in a sealed state under the above-mentioned temperature condition while stirring.
(27) The inorganic porous substance which is obtained by any one of the method of 1. to 4. in the above-mentioned preparation for inorganic porous substance or two or more thereof in combination is preferably in a form of particles, and may be formed into a spherical shape, or may be formed into a massive shape or a crushed shape, whereas, when they are used as carriers, the spherical shape or the crushed shape is preferable from the viewpoint of filling into a column for nucleic acid synthesis. The molding method is not particularly limited, but a spray drying method or an emulsion method may be used.
(28) The above-mentioned Survival Bone Rate (SBR) value can be calculated by analyzing the continuous slice images of the inorganic porous substance which was obtained by a focused ion beam scanning electron microscopy (FIB-SEM) using a three-dimensional quantitative analysis software.
(29) <<Obtaining of Continuous Slice Images>>
(30) The continuous slice images of the inorganic porous substance can be obtained using a FIB-SEM. The obtaining of the continuous slice images using a FIB-SEM can be conducted according to a publicly known method. Specific examples of the method include the following method.
(31) Firstly, a hardening resin such as an epoxy resin is impregnated to an interior of inorganic porous substance to fill a void part of inorganic porous substance, and thereafter, the above-mentioned resin is hardened to create a resin embedded sample. Next, the above-mentioned resin embedded sample is cut, and the cutting surface is processed by a PtPd vapor deposition or a carbon vapor deposition and the like to produce the sample for observation by FIB-SEM. The above-mentioned samples for observation by FIB-SEM is sliced at a prescribed intervals by a FIB processing to obtain a SEM image of cross section, and the processing procedures thereof are repeated to obtain a predetermined number of the SEM image of cross section. In such s manner, the continuous slice images of the inorganic porous substance can be obtained.
(32) The interval of the FIB processing may be 5 nm as a thickness, for example. The acceleration voltage of the SEM observation may be 2.1 kV, for example. The FIB-SEM may use any products of each company without any particular limitations, and includes, for example, HELIOS 600 manufactured by FEI Company.
(33) The obtained continuous slice images may be performed appropriately a position correction using an appropriate image analysis software (for example, manufactured by visualization science Group; Avizo ver. 6.0).
(34) Thereafter, after a trimming process and a noise processing are performed appropriately using a quantitative analysis software, a two-gradation processing of the continuous slice images are performed to identify the inorganic carrier part and the void part, and a binarized slice images are obtained. Examples of the quantitative analysis software include TRI/3D-BON-FCS64. When the TRI/3D-BON-FCS64 is used, a trimming processing is performed by a trimming function thereof to a size of about 4 m2.5 m1 m degree. Also, for example, a 3D 33 median filter can be applied to remove fine noise. Further, a two-gradation processing of images is performed by Auto-LW one image processing loop function, and an inorganic carrier part and a void part which are composed of a porous layer are identified, and in order to remove the isolated structural part and isolated void part, for example, the identified inorganic carrier part and the identified void part respectively may be deleted the parts of 5 voxel or less thereof. Thereafter, the void parts is made white of 256 gradations to obtain a binarized continuous slice images.
(35) <<(a) SBR>>
(36) The continuous slice images of inorganic porous substance are analyzing by an appropriate quantitative analysis software to obtain a value of Survival Bone Rate (SBR).
(37) The SBR represents in general a parameter showing a ratio of residual trabecula relative to osteoporosis, which is calculated by deeming a trabecula part to be a flow path where a current flows.
(38) As used herein, the term of SBR of inorganic porous substance represents a SBR which can be calculated by deeming a pore network structure in inorganic porous substance to be a flow path where a current flows.
(39) SBR can be calculated by, for example, performing a continuous hole analysis (3D-VNET) using TRI/3D-BON-FCS64 as a quantitative analysis software. The calculation of SBR using TRI/3D-BON-FCS64 can be conducted as follows.
(40) Firstly, in a continuous hole measurement, NodeStrut intermediate file output is performed to creative an intermediate file. At that time, a target data is made a binarized void part, the CT data is made a peripheral one (1) pixel (six-faced box) of trimmed area, and a target area is made an inverted CT data (contents parts of box). Next, in a detailed flow path analysis, the created intermediate file is designated, the first page of Z direction of the continuous slice images is made a face at the begging of the flow: From, and the last page thereof is made of the last face: To, and the flow analysis can be performed to calculate the SBR. A volume resistivity p in the flow analysis is made 1.0. Specific examples of the analytical method by the same software include the method described below in Examples.
(41) SBR is a value being an indicator as an easy of flow of flow path, and it means that as the SBR value is larger, the network structure has smoother flow structure. Specifically, an internal resistance is calculated from a cross section area S and a length L of a continuous hole obtained by image analysis of the continuous slice images (said holes represent a part where a plurality of pores are communicated to form one flow path), and an voltage 1V is supposed to be applied between From-To, a current in each continuous hole is calculated. An equivalent resistance of whole pores in analysis area is calculated from the calculated sum of the total current and the applied voltage V. It means that as this equivalent resistance value is smaller, the network structure has smoother flow structure. Further, when an equivalent resistance of the pore network is made RE, an equivalent cross-sectional area is made SE, and a distance between From-To is made LE, it can be expressed by RE=LE/SE. As the equivalent cross-sectional value is larger, the equivalent resistance value is smaller. The SBR represents a value which is obtained by dividing this equivalent cross-sectional area by an area of From face as a standard, which makes an indicator showing how degree of the equivalent cross-sectional area relative to an input area the network has, that is, how degree of ease of flow the network has.
(42) The inorganic porous substance is characterized by 5.0% or more as the SBR value. The SBR value is preferably 6.0% or more. The upper value of the SBR is not particularly limited, and is more preferably 8.0% or more. Examples of the preferred range of SBR is within a range of 5.0% or more to 8.0% or less, more preferably 6.0% or more to 8.0% or less.
(43) <<Other Conditions>>
(44) The inorganic porous substance used in the inorganic porous carrier according to the present embodiment has preferably 97% or more as a ratio of the sum of total length of all through holes relative to the sum of total length of all pores in the analysis area range of about 4 m2.5 m1 m of analysis area as the continuous slice images of inorganic porous substance. Also, the inorganic porous substance has preferably 80% or more as Output I ratio on From (OIR) value which is obtained when an analysis is conducted on the about 1.0 m as a thickness of continuous slice image of the above-mentioned inorganic porous substance using a quantitative analysis software TRI/3D-BON-FCS64 under the condition where an analysis parameter is made PathL. Max=6.0PathL, number of search paths=50000, and number of output paths=50000.
(45) <<(b) Ratio of Sum of Total Length of all Through Holes Relative to Sum of Total Length of all Pores>>
(46) The continuous slice images of inorganic porous substance can be analyzed by an appropriate quantitative analysis software to calculate the ratio of sum of total length of all through holes relative to sum of total length of all pores.
(47) Here the term of Sum of total length of all pores represents a sum of total length of all pores which are existed in entire of inorganic porous substance, or a sum of total length of all pores which are existed in analytical area analyzed by a quantitative analysis software.
(48) The term of through holes represents a pore in which a terminus is not a dead-end. The term of length of through holes represents a length of one through holes, and the term of sum of total length of all through holes represents a sum of total length of all through holes which are existed in entire of inorganic porous substance, or a sum of total length of all through holes which are existed in analytical area analyzed by a quantitative analysis software.
(49) The analysis by a quantitative analysis software can be conducted, for example, as follows.
(50) Firstly, a trimming process and a noise process is performed appropriately by a quantitative analysis software on the continuous slice images of the inorganic porous substance as obtained above, and thereafter, the continuous slice images is performed by a two-gradation processing to identify an inorganic carrier part and a void part. Next, a thinning processing is performed on the identified void part, and a junction point of three or more of networks or a network having different width is made a branch point of pores (see
(51) Accordingly, a sum of total length of all pores is defined to be the above-mentioned (Sum of total distance of the intervals between all branch points, the intervals between all analysis area termini, and the intervals between all branch pointanalysis area terminus+Sum of total length of all terminal pores). Also a ratio of sum of total length of all terminal pores relative to the sum of total length of all pores can be defined to be (Sum of length of all terminal pores/Sum of length of all pores). Accordingly, a ratio of a sum of total length of all through holes relative a sum of total length of all pores can be calculated as (1a ratio of a sum of total length of all terminal pores relative to a sum of total length of all pores).
(52) Examples of a quantitative analysis software capable of analyzing the analysis as described above include TRI/3D-BON-FCS64 (manufactured by Ratoc System Engineering Co., Ltd.). In TRI/3D-BON-FCS64, a structural analysis of continuous slice images is conducted by a cancellous bone measurement of bone measurement as an analysis function of the software under a condition where MIL effective length r1=0.5, NdNd effective length r2=1.5, and NdTm effective length r3=2.0 to calculate a ratio of the sum of total length of all terminal pores relative to the sum of total length of all pores. Specific examples of the analytical method by the same software include the method described below in Examples.
(53) The inorganic porous substance have preferably 97% or more as the ratio of the sum of total length of all through holes relative to the sum of total length of all pores within a range of analysis area of about 4 m2.5 m1 m as a continuous slice images of the above-mentioned inorganic porous substance. The fact that the above ratio is large means that the flow path of the pore in the inorganic porous substance is less interrupted. The above ratio is preferably 98% or more, more preferably 98.5% or more, and further preferably 99% or more.
(54) <<(c) OIR>>
(55) The above-mentioned continuous slice images as obtained above of inorganic porous substance is analyzed by a quantitative analysis software TRI/3D-BON-FCS64 to calculate the value of Output I ratio on From (OIR).
(56) The OIR represents a value representing how ratio of a current is flown from From to To, in the case where when a pore network of the inorganic porous substance is deemed to be a flow path where a current flows, and the first page of Z direction of the continuous slice images is made a face at the begging of the flow: From, and the last page thereof is made of the last face: To.
(57) The OIR can be calculated by performing a continuous hole analysis (3D-VNET), for example, using TRI/3D-BON-FCS64 as a quantitative analysis software. The calculation of the OIR using TRI/3D-BON-FCS64 can be conducted as follows.
(58) Firstly, using an intermediate file which is created by a similar method to a creation of the intermediate file in the above-mentioned SBR calculation, the OIR between FROM to TO in a thickness direction of the continuous slice images by an analysis of all paths of continuous holes is calculated. In the analysis method, an analysis parameters is set a condition where PathL. Max=6.0PathL, and the number of search paths=50000, and the number of output paths=500000. Specific examples of the analytical method by the same software include the method described below in Examples.
(59) The OIR represents an indicator showing how degree of the current input from From can flow to a To face without running away to a side of face, that is, an ease of flowing linearly. As the OIR is larger, the network structure has a smoother flow structure.
(60) The inorganic porous substance has preferably 80% or more as the OIR value relative to about 1 m thickness of a continuous slice images of inorganic porous substance. The above OIR value is preferably 85% or more, and more preferably 95% or more.
(61) The inorganic porous substance has preferably in addition to (a) 5.0% or more as the SBR value, (b) 97% or more as a ratio of the sum of total length of all through holes relative to the sum of total length of all pores within a range of analysis area of about 4 m2.5 m1 m as a continuous slice images of the above-mentioned inorganic porous substance. Also, the inorganic porous substance has preferably in addition to (a) 5.0% or more as the SBR value, (c) 80% or more as Output I ratio on From (OIR) value which is obtained when an analysis is conducted on the about 1.0 m as a thickness of continuous slice image of the above-mentioned inorganic porous substance using a quantitative analysis software TRI/3D-BON-FCS64 under the condition where an analysis parameter is made PathL. Max=6.0PathL, number of search paths=50000, and number of output paths=50000. In particular, the inorganic porous substance meets preferably the above-mentioned (a) and (b) requirements, and more preferably all of (a) to (c) requirements.
(62) In the inorganic porous substance, other properties such as shape and particle size is not limited particularly, and the equivalent property to those of inorganic porous substance used in a nucleic acid synthesis can be usually adopted.
(63) [Mercury Intrusion Method]
(64) A pore diameter of an inorganic porous substance can be determined as follows.
(65) Firstly, a container containing a sample is evacuated in vacuum, and the container is filled with mercury. A mercury has a high surface tension, and a mercury does not infiltrate into a pore of surface of the sample in situ (normal pressure), however, as a pressure applies to mercury and a pressure is increased gradually, a mercury is infiltrating gradually into a pore from a pore having a large diameter to a pore having a small pore. By measuring a press-fitting amount of mercury into a pore while a pressure is being increased continuously, a curve of mercury press-fitting curve is obtained from a correlation between a pressure applied to mercury and a press-fitting amount of mercury.
(66) Here assuming that a shape of a pore is a cylindrical, when a pressure applied to a mercury is expressed as P, its pore size (pore diameter) is expressed as D, a surface tension of mercury is expressed as , a contact angle between a mercury and a sample is expressed as , a pore size (pore diameter) is expressed as the following equation (A).
D=4cos /P(A)
(67) In general, a surface tension of mercury: uses a value of 0.48 to 0.49 N/m, and a contact angle uses 130 to 140.
(68) Since and are both a constant value, a correlation between a pressure applied to mercury: P and a pore diameter: D. By measuring an infiltrate volume of mercury at that moment, a pore volume can be calculated. That is, since there is correlation between the pressure applied to mercury: P and the pore diameter infiltrated by mercury: D, a pore distribution curve, which indicates a correlation between a size and a volume with respect to a pore diameter of the sample, can be obtained based on a curve of mercury press-fitting curve.
(69) Here an approximate measurement limit of the pore diameter by a mercury intrusion method is set to be about 0.004 m or less as a lower limit and about 200 m as an upper limit. A measurement by a mercury intrusion method can be carried out with a device such as a mercury porosimeter. Specific examples of the mercury porosimeter include AutoPoreIV9520 (manufactured by Micromeritics).
(70) The inorganic porous substance according to this embodiment has a most frequent value (a mode diameter) of a pore size of 0.04 m to 1 m, preferably 0.04 m to 0.5 m, more preferably 0.04 m to 0.3 m in a pore distribution determined by a mercury intrusion method.
(71) When the mode diameter is the lower limit value or more which is included within the above range, a steric hindrance between oligonucleic acids in a pore is unlikely to occur during the nucleic acid elongation reaction, the elongation reaction can easily proceed stably to achieve the target chain length. Whilst, when the mode diameter is the upper limit value or less which is included within the above range, that is, 1 m or less, it is easy to keep the surface area as a carrier which is sufficient for obtaining oligonucleic acid.
(72) The mode diameter represents a pore size determined from a value of X-axis at a peak top in the pore size distribution obtained by the mercury intrusion method (a graph in which the X-axis is a value of the pore size and the Y-axis is a value obtained by differentiating the pore volume by the pore size).
(73) A size of the inorganic porous substance is not particularly limited, but from the viewpoint of column filling efficiency in the solid-phase synthesis of nucleic acid, and liquid feeding rate in a column filling, and the like, a particle size (median diameter, the same shall apply hereinafter) which is measured by a laser diffraction method (scattering method) is preferably within a range of 1 to 1000 m, more preferably 5 to 500 m, and further more preferably 10 to 300 m.
(74) The pore volume of the inorganic porous substance of the present embodiment is not particularly limited. Generally, in order to improve the productivity of nucleic acid per column, it is preferable that the pore volume per volume of the inorganic porous substance (mL/mL) is high regardless of the strand length of the nucleic acid. The pore volume per volume of the inorganic porous substance is preferably within a range of 0.05 to 0.6 mL/mL, and more preferably 0.05 to 0.5 mL/mL.
(75) The pore volume per volume of the inorganic porous substance is determined by multiplying the bulk density (g/mL), which is measured by the mercury intrusion method, by the cumulative pore volume (VA) (mL/g) of pore having a pore size within a range of 0.04 m to 1 m.
(76) The specific surface area per volume of the inorganic porous substance as described above is not particularly limited. In order to improve a productivity of nucleic acid per column, it is preferable that the specific surface area per volume of the inorganic porous substance is large regardless of the strand length of the nucleic acid. Specifically, the specific surface area per volume of the inorganic porous substance is preferably within a range of 0.1 to 100 m.sup.2/mL, more preferably 1 to 50 m.sup.2/mL, and further more preferably 3 to 20 m.sup.2/mL.
(77) The surface area per volume of the inorganic porous substance is determined by multiplying the bulk density (g/mL), which is measured by the mercury intrusion method, by the specific surface area per mass of the inorganic porous substance (m.sup.2/g), which is measured by N.sub.2 adsorption/desorption isotherm measurement. Here, as the specific surface area per mass as described above, a value obtained from an average gradient in a range of as =1.7 to 2.1 according to a method such as a s-plot method is used.
(78) The porosity of the inorganic porous substance is not particularly limited, and in general, in order to improve the productivity of nucleic acid per column, it is preferable that the porosity is high regardless of the strand length of the nucleic acid. The porosity is determined by the mercury intrusion method, and it is preferably 50% or more, and more preferably 70% or more.
(79) The porosity herein is calculated based on the pore volume of pore having a pore size within a range of 0.004 to 200 m, which is a range measured by the mercury intrusion method. That is, it is determined by multiplying the cumulative pore volume (mL/g) of pore having a pore size within the range of 0.004 m to 200 m by the bulk density (g/mL).
(80) The inorganic porous carrier of the present embodiment contains a linker represented by the following general formula (1):
(81) ##STR00004##
[wherein, a bond marked with represents a linkage of an inorganic porous substance to the oxygen atom of a silanol group; n is an integer of 1, 2 or 3; R represents independently of each other an alkyl group containing 3 to 10 carbon atoms which may optionally have a substituent selected from an alkoxy group and a fluorine atom; a phenyl group which may optionally have a substituent selected from an alkyl group, an alkoxy group, and a fluorine atom; a hydroxyl group; or an alkoxy group containing 1 to 4 carbon atom; and L represents a single bond; an alkylene group of 1 to 20 carbon atoms; or an alkylene group containing 2 to 20 carbon atoms which contains CH.sub.2-Q-CH.sub.2 group wherein any group Q selected from a group consisting of O, NH, NHCO and NHCONH is inserted into at least one of CH.sub.2CH.sub.2 group constituting the alkylene group; providing that a carbon atom of the methylene group bound to the group Q does not bind to another group Q at the same time].
(82) In the formula (1), the alkyl group in each of R may be any of a linear alkyl group, a branched alkyl group or a cyclic alkyl group, and preferably a branched alkyl group so as to improve the yield easily. The alkyl group in each of R.sup.1 and R.sup.2 contains 3 to 10 carbon atoms, preferably 3 to 6 carbon atoms, and more preferably 3 or 4 carbon atoms.
(83) Examples of the alkyl group in each of R include a linear alkyl group such as n-propyl group, n-butyl group, n-hexyl group and n-octyl group; a branched alkyl group such as isopropyl group, isobutyl group, sec-butyl group, tert-butyl group, 2-ethylhexyl group and 3,7-dimethyloctyl group; and a cyclic alkyl group such as cyclopropyl group and cyclohexyl group.
(84) The substituent which may be optionally substituted on the alkyl group represented by each of R is an alkoxy group or a fluorine atom. Examples of the alkoxy group include an alkoxy group containing 1 to 3 carbon atoms.
(85) The substituent which may be optionally substituted on the phenyl group represented by each of R is an alkyl group, an alkoxy group, or a fluorine atom. Examples of the alkyl group include an alkyl group containing 1 to 5 carbon atoms. Examples of the alkoxy group include an alkoxy group containing 1 to 3 carbon atoms.
(86) In the case where n is 1 in the formula (1), a plural of R may be identical to or different from each other, and preferably identical to each other from the viewpoint of synthesis (for example, convenience and efficiency).
(87) In the above-mentioned formula (1), an alkoxy group as R represents an alkoxy group containing 1 to 4 carbon atoms, preferably an alkoxy group containing 1 to 3 carbon atoms, and more preferably a methoxy group or an ethoxy group.
(88) In the formula (1), the alkylene group in L may be any of a linear alkylene group or a branched alkylene group, and preferably a linear alkylene group so as to improve the yield easily. The alkylene group in L contains 1 to 20 carbon atoms, preferably 1 to 10 carbon atoms, and more preferably 1 to 6 carbon atoms.
(89) Also an alkylene group as L may represent an alkylene group containing 2 to 20 carbon atoms which contains CH.sub.2-Q-CH.sub.2 group wherein any group Q selected from a group consisting of O, NH, NHCO and NHCONH is inserted into at least one of CH.sub.2CH.sub.2 group constituting the alkylene group.
(90) With the proviso that in this embodiment, in the linker represented by the above-mentioned general formula (1), a carbon atom of the methylene group bound to the group Q does not bond to another group Q at the same time.
(91) As examples of the inorganic porous carrier, for example, any one of the following linkers represented by formulae (1-1), (1-2) or (1-3) or a plural forms selected from these linkers are exemplified.
(92) ##STR00005##
(93) In the above-mentioned formula (1-1), (1-2) and (1-3), *, R and L have the same meanings as those of *, R and L as described in the above-mentioned formula (3).
(94) The inorganic porous carrier of the present embodiment can be prepared, for example, by a method of treating a surface of the inorganic porous substance with a silane coupling agent represented by the following general formula (3).
(95) ##STR00006##
[wherein, n is an integer of 1, 2 or 3; R represents independently of each other an alkyl group containing 3 to 10 carbon atoms which may optionally have a substituent selected from an alkoxy group and a fluorine atom; a phenyl group which may optionally have a substituent selected from an alkyl group, an alkoxy group, and a fluorine atom; a hydroxyl group; or an alkoxy group containing 1 to 4 carbon atom; R.sup.1 represents independently of each other a hydrogen atom or al alkyl group; L represents a single bond; an alkylene group of 1 to 20 carbon atoms; or an alkylene group containing 2 to 20 carbon atoms which contains CH.sub.2-Q-CH.sub.2 group wherein any group Q selected from a group consisting of O, NH, NHCO and NHCONH is inserted into at least one of CH.sub.2CH.sub.2 group constituting the alkylene group; providing that a carbon atom of the methylene group bound to the group Q does not bind to another group Q at the same time].
(96) In the above-mentioned formula (3), R and L have the same meanings as those of R and L as described in the above-mentioned formula (1).
(97) In the above-mentioned formula (3), the alkyl group as R1 represents preferably an alkyl group containing 1 to 3 carbon atoms, and more preferably a methyl group or an ethyl group.
(98) The preparation of the inorganic porous carrier containing the linker represented by the general formula (1) is carried out, for example, by a method of mixing the inorganic porous substance with a certain silane coupling agent and a solvent, and then removing the solvent. In this case, the certain silane coupling agent is covalently bound to a silanol group on the surface of the inorganic porous substance by the mixing to form an inorganic porous carrier supporting the linker represented by the general formula (1).
(99) Examples of the solvent as described above include acetonitrile, toluene, anisole, 2-heptanone, propyleneglycol monomethyl ether acetate, N,N-dimethylformamide, tetrahydrofuran, pentane, hexane, heptane, xylene, mesitylene, dichloromethane, chlorobenzene, water and the like, or a mixture of two or more thereof, and preferably include toluene.
(100) The above-mentioned inorganic porous substance and solvent are preferably used after being dehydrated from the viewpoint of suppressing a polymerization of the silane coupling agent as itself and facilitating the reaction of the silane coupling agent with the surface of the inorganic porous substance. The dehydration method is not particularly limited, but examples thereof include a method of heating the inorganic porous substance under reduced pressure; and a method of dispersing the inorganic porous substance in the solvent and then distilling off the solvent under normal pressure or reduced pressure to conduct an azeotrope dehydration.
(101) When the inorganic porous substance is mixed with the silane coupling agent and the solvent, the mixture is usually heated to near the boiling point of the solvent to facilitate the reaction, but the temperature is not limited thereto, and the mixture may be mixed at room temperature, or in a state where it is cooled to room temperature or less.
(102) The reaction of the inorganic porous substance with the silane coupling agent is usually carried out for about 1 to 12 hours, but in the case that the silane coupling agent containing an amino group is used, since the silane coupling agent as itself has a catalytic effect of facilitating the reaction, the reaction may be carried out for about a several minutes.
(103) An amount of the silane coupling agent to be added is usually an amount in which a support density of the linker is within a range of 0.1 to 5.0 mol/m.sup.2, and preferably 0.5 to 2.0 mol/m.sup.2, relative to the specific surface area per mass of the inorganic porous substance, which is determined by N.sub.2 adsorption/desorption measurement.
(104) The silanol group which is not used in the reaction with the silane coupling agent, if needed, may be capped with a functional group which is inert to the nucleic acid synthesis, for example, trimethylsilyl group.
(105) As described above, the surface of the inorganic porous substance can be treated with a certain silane coupling agent to produce the inorganic porous carrier which is modified with an aminosilyl group.
(106) The silane coupling agent represented by the above general formula (3) can be prepared through the reaction route as shown below (synthetic route 1, synthetic route 2, or synthetic route 3).
(107) ##STR00007##
Details of Synthetic Route 1 (Compound 1.fwdarw.Compound 2.fwdarw.Compound 3.fwdarw.Compound 6):
(108) For example, when compound 1 is trichlorosilane, the compound 1 is reacted with an organolithium compound or an organomagnesium compound corresponding to R (nucleophilic substitution reaction) to obtain compound 2 (Step 1). Then, the compound 2 is reacted with R.sup.1OH (for example, methanol, ethanol, propanol, etc.) in the presence of a base, or is reacted with an alcoholate such as R.sup.1ONa or water (R.sup.1: hydrogen) to obtain silane compound 3 (Step 2). Then, the compound 3 is subjected to a hydrosilylation reaction with an amine compound or a halogen compound containing a terminal olefin (for example, allylamine or 6-chloro-1-hexene) in the presence of a platinum catalyst to synthesize silane compound 6 (Step 3). Alternatively, when compound 1 is an alkoxysilane (for example, trimethoxysilane, triethoxysilane, etc.), substituents (R) may be introduced into the compound 1 by a nucleophilic substitution reaction according to the same reaction as described above, and then the resulting compound may be subjected to the hydrosilylation reaction to synthesize the silane compound 6.
(109) Details of Synthetic Route 2 (Compound 1.fwdarw.Compound 5.fwdarw.Compound 7.fwdarw.Compound 6):
(110) For example, when compound 1 is trichlorosilane, the compound 1 is subjected to a hydrosilylation reaction with a compound 4 (wherein Y represents a halogen atom, and m is an integer of 1 to 18) in the presence of a platinum catalyst, and accordingly a strand providing a spacer is attached thereto to obtain compound 5. Then, the substituents (R) are introduced thereto by a nucleophilic substitution reaction according to the above similar reaction to obtain compound 7. Then, the compound 7 is reacted with R.sup.1OH (for example, methanol, ethanol, propanol, etc.) in the presence of a base, or is reacted with an alcoholate such as R.sup.1ONa or water (R.sup.1: hydrogen) to obtain the silane compound 6 (Lg: R.sup.1O group).
(111) The introduction of R.sup.1O group (methoxy group, ethoxy group, propoxy group, etc.) can be carried out by a method of adding methanol, ethanol, propanol, or the like as the reagent to a solution containing the compound 2 (Lg: halogen atom) or the compound 4 (Lg: halogen atom); or a method of adding the compound 2 or the compound 6 dropwise to the corresponding alcohol or a solution containing the corresponding alcohol.
(112) Details of Synthetic Route 3 (Synthetic Route for Compound 6.fwdarw.Silane Coupling Agent):
(113) In the above-mentioned synthetic route 1 and synthetic route 2, the silane compound 6 which contains a functional group Y (an amino group or a halogen atom) may be obtained.
(114) When the functional group Y is an amino group, various silane coupling agents can be prepared by a method of carbamoylation, amidation or ureidation of the amino group of the silane compound 6.
(115) When the functional group Y is a halogen atom, the silane compound 6 is reacted with an ammonia or a primary amine compound, and accordingly the halogen atom is eliminated, and an amino group or an imino group (NH) is introduced thereto or an ether bond is introduced thereto, to obtain various silane coupling agent.
(116) It is preferable to use a reaction solvent in any of the above-mentioned reactions. The reaction solvent is preferably an organic solvent such as pentane, hexane, heptane, toluene, tetrahydrofuran, or the like, or a mixture of two or more thereof.
(117) The silane compound is usually purified by distillation under normal pressure or reduced pressure conditions. The obtained silane coupling agent is purified by, for example, liquid separation, distillation, or column chromatography.
(118) (Method for Preparing Nucleic Acid)
(119) In the method for preparing nucleic acid of the present embodiment, the nucleic acid can be synthesized with the above-mentioned inorganic porous carrier according to a publicly known method. Particularly, the preparation of nucleic acid is preferably carried out according to the phosphoramidite method. The nucleic acid synthesis method according to the phosphoramidite method is described below.
(120) [Preparation of Solid-Phase Carrier]
(121) A solid-phase carrier refers to a carrier wherein a nucleoside, or nucleotide in which a reactive group is protected or deprotected is bound to the amino group (NH.sub.2) contained in the above-mentioned inorganic porous carrier through a divalent group.
(122) In this embodiment, an inorganic porous carrier that comprises a linker represented by general formula (2) wherein a Survival Bone Rate (SBR) value is 5.0% or more can be used as a solid-phase carrier.
(123) ##STR00008##
[wherein a bond marked with represents a linkage of an inorganic porous substance to the oxygen atom of a silanol group; n is an integer of 1, 2 or 3; R represents independently of each other an alkyl group containing 3 to 10 carbon atoms which may optionally have a substituent selected from an alkoxy group and a fluorine atom; a phenyl group which may optionally have a substituent selected from an alkyl group, an alkoxy group, and a fluorine atom; a hydroxyl group; or an alkoxy group containing 1 to 4 carbon atom; L represents a single bond; an alkylene group containing 1 to 20 carbon atoms; or an alkylene group containing 2 to 20 carbon atoms which contains CH.sub.2-Q-CH.sub.2 group wherein any group Q selected from the group consisting of O, NH, NHCO, and NHCONH is inserted into at least one CH.sub.2CH.sub.2 group constituting the alkylene group; providing that a carbon atom of the methylene group bound to the group Q doses not bind to another group Q at the same time; R.sub.b represents a nucleotide or a nucleotide in which a reactive group is protected or deprotected; and L.sub.1 represents a divalent group bound to an oxygen atom of a primary or a secondary hydroxy group as R.sub.b.].
(124) In the formula (2), R and L are described in the same manner as the description of R and L in the formula (1).
(125) In the formula (2), the divalent group L.sub.1 bound to the imino group (NH) preferably contains a succinyl group as a functional group.
(126) Examples of the divalent group L.sub.1 typically include a succinyl linker, a universal linker, and a linking group which is composed of a universal linker and a group linking an imino group (NH) in the formula (2) to the universal linker.
(127) The universal linker contains a functional group (typically, a hydroxyl group) which can form a phosphite with the hydroxyl group of the nucleotide that provides a starting point of nucleic acid synthesis, and a functional group which can bond to an amino group at the end of linker represented by the formula (1), and further contains an adjacent protected functional group (for example, a protected amino group, a protected hydroxyl group, or a protected thiol group) in the same molecule, which can nucleophilically attack a phosphorus atom of phosphoric acid under the conditions for cleaving the synthesized nucleic acid.
(128) More specifically, examples of the divalent group L.sub.1 include a linking group represented by the following formula L.sub.10, and a linking group represented by the following formula L.sub.11.
(129) ##STR00009##
(130) Here, in each of the formulae L.sub.10 and L.sub.11, the bond marked with represents a bond to the imino group (NH) in the formula (2). The bond marked with # represents a bond to an oxygen atom of a primary or secondary hydroxyl group of R.sub.b in the above formula (2).
(131) In the formula L.sub.11, Z.sub.1 represents a protected amino group, a protected hydroxyl group, or a protected thiol group. The oxygen atom and Z.sub.1 which are bound to Z represent groups which are adjacent to each other (for example, they exist in vicinal position, and carbon atoms of Z that are attached thereto are directly bound to each other). L.sub.12 represents a group which links the imino group (NH) to the universal linker (for example, represented by CO(CH.sub.2).sub.2CO&; and the bond marked with & represents a bond to Z).
(132) When the universal linker is used, even though the 3end of the nucleic acid to be synthesized becomes any kinds of nucleoside or nucleotide, the nucleoside phosphoramidide providing the 3end can be reacted and introduced in the same manner as the method of elongating the nucleic acid according to the usual nucleic acid automatic synthesis. Examples of such a universal linker include the compounds described in the following references, but are not limited thereto: Reference: A. P. Guzaev, and M. Manoharan, J AmChem Soc, 2003, 125, 2380-2381. Reference: R. K. Kumar, A. P. Guzaev, C. Rentel, and V. T. Ravikumar, Tetrahedron, 2006, 62, 4528.
(133) In the formula (2), it is preferable for R.sub.b that the hydroxyl group at the 5position of the nucleoside, which provides the starting point of the nucleic acid elongation reaction, is protected with a trityl-based protecting group (for example, 4,4-dimethoxytrityl (DMTr) group, etc.).
(134) Similarly, when the universal linker is used, it is preferable that the hydroxyl group, which provides the starting point of the nucleic acid elongation reaction, is protected with a trityl-based protecting group (for example, 4,4-dimethoxytrityl (DMTr) group, etc.).
(135) The solid-phase carrier containing the linker represented by the formula (2) is typically prepared by a condensation reaction of the inorganic porous carrier containing the linker represented by the general formula (1) with the compound (R.sub.b-L.sub.10-W). This L.sub.10 represents a linking group represented by the above-mentioned formula L.sub.10. W represents a reactive functional group (for example, a hydroxyl group).
(136) When the nucleoside linker is used, the nucleoside linker corresponding to the base at the 3end is selected depending on the sequence of RNA to be synthesized. Examples of the nucleoside linker include a nucleoside linker containing a succinyl group as a functional group to be reacted with an amino group (NH.sub.2).
(137) Examples of the nucleoside linker containing a succinyl group are shown below.
(138) In the following formulae, each of marks * represents a bond to the imino group (NH) in the above-mentioned formula (2). TBDMS refers to a tert-butyldimethylsilyl group. Ac refers to an acetyl group.
(139) ##STR00010##
(140) The condensation reaction as described above is carried out by mixing the inorganic porous carrier, the compound (R.sub.b-L.sub.10-W), the condensing agent and an appropriate solvent, and usually shaking the mixture at room temperature or heating the mixture to facilitate the condensation reaction. The condensation reaction may also be carried out by allowing the mixture to stand without shaking and with stirring.
(141) As the condensing agent for the condensation reaction, any condensing agent to be usually used for an amide condensation can be used. Specific examples of the condensing agent include N,N-dicyclohexylcarbodiimide (DCC), N,N-diisopropylcarbodiimide (DIC), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDAC), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC), 1-[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate (HATU), 1-[bis(dimethylamino)methylene]-1H-1,2,3-benzotriazolium 3-oxide hexafluorophosphate (HBTU), 1-[bis(dimethylamino)methylene)]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxide tetrafluoroborate (TATU), 1-[bis(dimethylamino)methylene]-1H-1,2,3-benzotriazolium 3-oxide tetrafluoroborate (TBTU), (1-cyano-2-ethoxy-2-oxoethylideneaminooxy)dimethylaminomorpholinocarbenium hexafluorophosphate (COMU), O-[(ethoxycarbonyl)cyanomethyleneamino]-N,N,N,N-tetramethyluronium hexafluorophosphate (TOTU) and the like, or a mixture of two or more thereof. Additives such as N,N-dimethyl-4-aminopyridine (DMAP) and N,N-diisopropylethylamine may be added.
(142) The solid-phase carrier after the completion of the condensation reaction is filtered by filtration with a solvent, and collected. Examples of the solvent for filtration include acetonitrile and the like. Capping treatment to the unreacted amino group may be carried out. Examples of the capping treatment agent to be used include acetic anhydride (for example, acetic anhydride-tetrahydrofuran solution) and phenoxyacetic anhydride (for example, phenoxyacetic anhydride/N-methylimidazole solution). The success or failure of capping can be confirmed by a ninhydrin test. When a nucleoside linker or universal linker having a protecting group such as 4,4-dimethoxytrityl (DMTr) group is used, the quantification of the reacted nucleoside can be carried out by cleaving the DMTr group with an acid and then measuring an absorbance thereof.
(143) The amount of (R.sub.b-L.sub.1) supported is usually within a range of 0.1 to 5.0 mol/m.sup.2, and preferably 0.5 to 2.0 mol/m.sup.2, relative to the specific surface area per mass of the inorganic porous substance, which is determined by N.sub.2 adsorption/desorption measurement.
(144) The solid-phase carrier of the present embodiment is preferable as a substrate for a solid-phase synthesis of nucleic acid (DNA and RNA). Further, the solid-phase carrier of the present embodiment is particularly suitable for the synthesis of RNA, which has been considered to have a problem in stability as compared with DNA.
(145) Hereinafter, the solid-phase synthesis of RNA is illustrated as an example of the preparation method, and the method for preparing nucleic acid is described with reference to a reaction route shown below (condensation reaction, oxidation, and deprotection).
(146) Here, relative to the reaction route illustrated below, an example in which a nucleoside is used as R.sub.b in the formula (2) is shown.
(147) ##STR00011##
(148) In the chemical formula shown in the above reaction route, R.sup.6 represents a base; Tr represents a protecting group; and X represents H, OH or OR.sup.7 (wherein, R.sup.7 represents a protecting group).
(149) The base (R.sup.6) constituting the nucleoside of the solid-phase carrier (Sp-Nu) containing the linker represented by the general formula (2) and the nucleoside of the amidite monomer (Am-1) is usually a nucleic acid, and typically a naturally-occurring base which is composed of RNA, however, may be a non-naturally-occurring base in some cases. Examples of such the non-naturally-occurring base include modified analogs of the naturally-occurring base or non-naturally-occurring base.
(150) Examples of the base represented by R.sup.6 include purine bases such as adenine, isoguanine, xanthine, hypoxanthine and guanine; and pyrimidine bases such as cytosine, uracil and thymine; and the like.
(151) Examples of the base represented by R.sup.6 further include amino derivatives such as 2-aminoadenine, 2-aminopurine, and 2,6-diaminopurine; alkyl derivatives such as 5-methyluracil, 5-methylcytosine, 7-methylguanine, 6-methylpurine, 2-propylpurine; 5-halouracil and 5-halocytosine; 5-propynyluracil and 5-propynylcytosine; 6-azauracil, 6-azacytosine and 6-azathymine; 5-uracil (pseudouracil), 4-thiouracil, 5-(2-aminopropyl)uracil, and 5-aminoallyluracil; 8-substituted purines, for example, 8-halogenated, aminated, thiolated, thioalkylated or hydroxylated purine, or other 8-substituted purine; 5-substituted pyrimidines, for example, 5-trifluoromethylated pyrimidine, or other 5-substituted pyrimidine; 6-azapyrimidine; N-2, N-6 or O-6 substituted purines (including 2-aminopropyladenine); dihydrouracil; 3-deaza-5-azacytosine; 7-deazaadenine; N6-methyl adenine, N6,N6-dimethyladenine; 5-amino-allyl-uracil; N3-methyluracil; substituted 1,2,4-triazole; 2-pyridinone; 5-nitroindole; 3-nitropyrrole; 5-methoxyuracil; uracil-5-oxyacetic acid; 5-methoxycarbonylmethyluracil; 2-thiouracil, 5-methyl-2-thiouracil; 5-methoxycarbonylmethyl-2-thiouracil; 5-methylaminomethyl-2-thiouracil, 3-(3-amino-3-carboxypropyl)uracil; 3-methylcytosine; N4-acetylcytosine; 2-thiocytosine; N6-methyladenine; N6-isopentyladenine; 2-methylthio-N6-isopentenyladenine; N-methylguanine; O-alkylated bases, or the like; and a mixture of two or more thereof.
(152) Further, examples of purine compounds and pyrimidine compounds include those disclosed in each of U.S. Pat. No. 3,687,808; Concise Encyclopedia Of Polymer Science And Engineering, pp. 858-859, edited by Kroschwitz J. I., John Wiley & Sons, 1990; and Englisch et al., Angewandte Chemie, International Edition, 1991, vol. 30, p. 613.
(153) Examples of the amidite monomer (Am-1) preferably include TBDMS amidite (TBDMS RNA Amidites, product name, ChemGenes Corporation), ACE amidite, TOM amidite, CEE amidite, CEM amidite, TEM amidite (Reviews by Chakhmakhcheva: Protective Groups in the Chemical Synthesis of Oligoribonucleotides, Russian Journal of Bioorganic Chemistry, 2013, Vol. 39, No. 1, pp. 1-21), and EMM amidite (as described in WO2013/027843 A1), or the like, in which the protecting group R.sup.7 in the compound represented by the following chemical formula (Am-1) is tert-butyldimethylsilyl (TBDMS) group, bis(2-acetoxy)methyl (ACE) group, (triisopropylsilyloxy)methyl (TOM) group, (2-cyanoethoxy)ethyl (CEE) group, (2-cyanoethoxy)methyl (CEM) group, para-tolylsulfonylethoxymethyl (TEM) group, (2-cyanoethoxy)methoxymethyl (EMM) group, or the like.
(154) ##STR00012##
[wherein, R.sup.7 represents a protecting group of the hydroxyl group; and R.sup.6 represents a protected nucleobase.]
(155) The solid-phase carrier of the present embodiment may also be used to incorporate a divalent group other than a nucleoside and nucleotide into a nucleic acid sequence. For example, an amidite having a proline framework (for example, Amidite P as described later) can be incorporated into a nucleic acid sequence according to the amidite method (see the same method as the method of Example A4 of WO2012/017919 A1). Further, the amidite represented by each of the following structural formulae (Am-11), (Am-12) and (Am-13) (see Examples A1 to A3 of WO2013/103146 A1) may also be used.
(156) ##STR00013##
[wherein, iPr represents an isopropyl group, DMTr represents a 4,4-dimethoxytrityl group, and Tfa represents a trifluoroacetyl group.]
[Solid-Phase Synthesis of RNA]
(157) The solid-phase carrier (Sp-Nu) containing the linker represented by the general formula (2) is deprotected (-Tr) to obtain the solid-phase carrier (Am-2). Then, the amidite monomer (Am-1) and the solid-phase carrier (Am-2) are subjected to a condensation reaction to obtain a reaction product (Am-3). Then, the reaction product (Am-3) is oxidized to obtain the product (Am-4). Then, the product (Am-4) is deprotected (-Tr) to obtain the product (Am-5). Then, the amidite monomer (Am-1) and the product (Am-5) are further subjected to a condensation reaction to elongate the phosphodiester bond.
(158) As described above, the hydroxyl group of the 5position at the end of the elongated oligonucleotide strand is repeatedly subjected to a series of cycle including deprotection, condensation reaction and oxidation as many times as necessary so as to provide a desired sequence, and then the resulting product can be cleaved from the solid-phase carrier to produce a nucleic acid molecule having a desired sequence.
(159) More specifically, a nucleic acid is prepared according to a preparation method comprising the following steps: step (A): a step of deprotecting the protecting group of the hydroxyl group at the 5position of the nucleoside using the inorganic porous carrier wherein R.sub.b in the general formula (2) represents a nucleoside or nucleotide in which a hydroxyl group as a reactive group is protected; step (B): a condensation step of subjecting the hydroxyl group at the 5position of the nucleoside produced in the step (A) to a condensation reaction with an amidite compound having a second nucleoside base to produce a phosphite; step (C): an oxidation step of oxidizing the phosphite produced in the step (B) to produce a nucleotide; and step (D): a step of deprotecting the protecting group of the hydroxyl group at the 5position of the nucleotide produced in the step (C).
(160) The preparation method comprising the above-mentioned steps (A) to (D) may optionally comprise the following steps: step (B): a step of further subjecting the product produced in the step (D) to a condensation reaction with an amidite compound having a nucleoside base to be introduced in next time to produce a phosphite; step (C): a step of oxidizing the phosphite produced in the step (B) to produce an oligonucleotide; step (D): a step of deprotecting the protecting group of the hydroxyl group at the 5position in the end of the oligonucleotide strand produced in the step (C); and step (E): a step of carrying out a series of steps consisting of the above step (B), step (C) and step (D) repeatedly m times (wherein m is an integer of 1 or more) to react the number of m of amidite compounds (nucleic acid elongation reaction), and then cleaving an elongated nucleic acid.
(161) The nucleic acid elongation reaction of the present embodiment can be carried out according to the procedure of a general phosphoramidite method.
(162) The nucleic acid elongation reaction herein refers to a reaction in which a nucleic acid strand, particularly RNA strand, is elongated by sequentially binding nucleotides through a phosphodiester bond. The nucleic acid elongation reaction may be carried out by means of an automatic nucleic acid synthesizer or the like that employs the phosphoramidite method.
(163) In the deprotection step, the protecting group of the hydroxyl group at the 5position in the end of the RNA strand supported on the solid-phase carrier is deprotected. As a general protecting group, a trityl-based protecting group (typically, a DMTr group) is used. The deprotection can be carried out with an acid. Examples of the acid for deprotection include trifluoroacetic acid, trichloroacetic acid, dichloroacetic acid, trifluoromethanesulfonic acid, methanesulfonic acid, hydrochloric acid, acetic acid, p-toluenesulfonic acid.
(164) In the condensation step, the nucleoside phosphoramidite is bound to the hydroxyl group at the 5position in the end of the RNA strand which is deprotected by the above-mentioned deprotection step so as to produce the phosphite. As the nucleoside phosphoramidite, a nucleoside phosphoramidite in which the hydroxyl group at the 5position is protected with a protecting group (for example, DMTr group) is used.
(165) Further, the condensation step can be carried out with an activator which activates the nucleoside phosphoramidite. Examples of the activator include 5-benzylthio-1H-tetrazole (BTT), 1H-tetrazole, 4,5-dicyanoimidazole (DCI), 5-ethylthio-1H-tetrazole (ETT), N-methylbenzimidazolium triflate (N-MeBIT), benzimidazolium triflate (BIT), N-phenylimidazolium triflate (N-PhIMT), imidazolium triflate (IMT), 5-nitrobenzimidazolium triflate (NBT), 1-hydroxybenzotriazole (HOBT), 5-(bis-3,5-trifluoromethylphenyl)-1H-tetrazole (Activator-42), and the like, or a mixture of two or more thereof.
(166) After the condensation step, an unreacted hydroxyl group at the 5position may be capped as needed. The capping can be carried out with a publicly known capping solution such as acetic anhydride-tetrahydrofuran solution, phenoxyacetic acid/N-methylimidazole solution, and the like, or a mixture of two or more thereof.
(167) The oxidation step refers to a step of oxidizing the phosphite formed by the condensation step. The oxidation step can be carried out with an oxidizing agent. Examples of the oxidizing agent include iodine, m-chloroperbenzoic acid, tert-butylhydroperoxide, 2-butanoneperoxide, bis(trimethylsilyl)peroxide, 1,1-dihydroperoxycyclododecane, hydrogen peroxide, and the like, or a mixture of two or more thereof.
(168) The oxidation step may be carried out after the capping operation as described above, or conversely, the capping operation may be carried out after the oxidation step, and accordingly an order of them is not limited thereto.
(169) After the oxidation step, the method returns to the deprotection step, and the above-mentioned steps including condensation reaction, oxidation and deprotection can be repeated depending on a nucleotide sequence of RNA to be synthesized so as to synthesize RNA having a desired sequence.
(170) After the synthesis of the RNA strand having the desired sequence is completed, the RNA strand is cleaved from the solid-phase carrier by ammonia, amines, or the like, and collected.
(171) Examples of the amines as describe above include methylamine, ethylamine, isopropylamine, ethylenediamine, diethylamine, triethylamine, and the like, or a mixture of two or more thereof.
(172) When the universal linker is used, after the completion of the synthesis of RNA strand, the RNA strand is cleaved from the solid-phase carrier by ammonia, amines, or the like, and the universal linker is eliminated with a nucleophile. Once the elimination is completed, the 3position of a terminal nucleotide is changed to a hydroxyl group, and the phosphate is bound to the universal linker to form a cyclic phosphodiester. The collected RNA may be purified by a publicly known method, as needed.
(173) In the inorganic porous carrier according to the present embodiment as described above, the inorganic porous substance having the particular pore network structure, that is, that is, the inorganic porous substance fulfilling with at least one of the above (a) to (c) requirements is adopted. Such a carrier has less ratio of the terminal pore having a dead-end of terminus, and accordingly, has a structure wherein raw materials used in a nucleic acid elongation reaction is easy to be supplied to a whole network. Accordingly, a discontinuation of the nucleic acid elongation reaction due to not supply of raw materials into a pore can be suppressed, and the ratio capable of processing the nucleic acid elongation reaction to a desired chain length can be thus raised. Accordingly, according to the materials for nucleic acid synthesis of the present embodiment, the ratio of the RNA having the desired strand is raised, and even though a long-stranded RNA (such as RNA having 40 mer or more) is synthesized, a RNA having high purity can be obtained.
(174) In addition, when the inorganic porous carrier of the present embodiment is applied to the nucleic acid synthesis, highly pure RNA can be obtained, even if long-stranded RNA of 40-mer or more is synthesized. The upper limit of the strand length of the RNA strand is not particularly limited, and may be, for example, 200 mer or less or 150 mer or less.
(175) The purity of RNA herein refers to a percentage (%) at which the nucleic acid having the target strand length is obtained. It is determined based on an area percentage (that is, a percentage of measured area) or a 10% width of a main peak in a chromatogram obtained by liquid chromatography.
EXAMPLES
(176) Hereinafter, the present invention is described in more detail with reference to Examples, however, the present invention should not be limited to these examples.
(177) <Preparation of Inorganic Porous Substance>
(178) Each of SP (1) to SP (6) as described below was used as the inorganic porous substance. In each of the inorganic porous substances SP (1) to SP (6), the pore size (mode diameter; m), the particle size (median diameter; m), the Survival Bone Rate (SBR), Output I ratio on From (OIR), and the ratio of the sum of total length of all through holes relative to the sum of total length of all pores, the pore volume per volume (mL/mL), the specific surface area per volume (m.sup.2/mL), and the porosity (%) were determined. The results are shown in Table 1.
(179) The SBR, the OIR, and the ratio of the sum of total length of all through holes relative to the sum of total length of all pores were calculated by FIB-SEM.
(180) The pore size (mode diameter; m), the pore volume per volume (mL/mL), and the porosity (%) were determined respectively by a mercury intrusion method. The particle size (m) was determined based on the median diameter measured by laser diffraction (scattering type). The specific surface area per volume (m.sup.2/mL) was determined by multiplying the bulk density (g/mL), which was measured by the mercury intrusion method, by the specific surface area per mass the inorganic porous substance (m.sup.2/g), which was measured by N.sub.2 adsorption/desorption isotherm measurement.
(181) Inorganic Porous Substance SP (1):
(182) A molded zeolite substance was obtained in the same manner as in Example 1 described in JP 5875843 B2. The resulting molded zeolite substance was suspended in a solvent of acetonitrile to prepare a suspension. Then, the suspension was sieved with a JIS sieve having an opening size of 125 m and successively with a JIS sieve having an opening size of 38 m. Then, the powdery solid remaining on the sieve having an opening size of 38 m was dried by air at room temperature to prepare the inorganic porous substance SP (1) as a white powdery solid.
(183) Inorganic Porous Substance SP (2):
(184) In a stainless steel autoclave with a capacity of 1.5 L, tetraethyl orthosilicate [Si(OC.sub.2H.sub.5).sub.4] 155 g, 40% by mass tetra-n-propylammonium hydroxide aqueous solution 136 g, potassium hydroxide (purity 85%) 0.3 g and water 162 g were placed, and the mixture was vigorously stirred at room temperature for 120 minutes. The molar ratios of water, tetra-n-propylammonium ion, hydroxide ion and potassium ion to silicon in the obtained mixed solution were 18, 0.36, 0.38 and 0.048, respectively. The mixed solution was stirred at 105 C. for 48 hours at a rotation speed of 300 rpm, and subjected to a hydrothermal synthesis reaction. The resulting reaction mixture was filtered, and washed repeatedly with pure water until the pH of the filtrate was made 9.0 or less. The obtained wet cake was dried at 110 C., and then pulverized in a mortar. The obtained pulverized substance was sieved with a sieve having an opening size of 2.36 mm and successively a sieve having an opening size of 1.00 mm. The obtained substance was sintered in a tubular furnace at 530 C. for 1 hour under nitrogen flow, and then further sintered at 530 C. for 1 hour under flow of a mixed gas of nitrogen and air [nitrogen:air (volume ratio)=9:1] to obtain a white sintered substance.
(185) Next, 10 g of the sintered substance as obtained above was put in a petri dish, and stood in a two-liter separable flask containing 100 mL of water, and the separable flask was closed with a lid. Then, the separable flask was placed in a constant temperature water bath at 80 C. for 5 hours. The separable flask was taken out, and allowed to cool to 20 C. The resulting solid 8 g was placed in an autoclave, and a mixed solution 222 g of 7.5% by mass ammonium nitrate aqueous solution 88 g and 25% by mass ammonia aqueous solution 134 g was added thereto, and the mixture was stirred at 90 C. for 1 hour, and then the solid was separated by filtration. The solid was further treated with the mixed solution of the ammonium nitrate aqueous solution and the ammonia aqueous solution prepared in the same manner as described above repeatedly twice, and then washed with water, and dried. Finally, the obtained white solid was pulverized in a mortar, and sieved with sieves having an opening size of 106 m and successively an opening size of 38 m to obtain the inorganic porous substance SP (2).
(186) Inorganic Porous Substance SP (3):
(187) As the inorganic porous substance SP (3), a commercially available spherical silica gel powder (trade name: M.S.GEL, produced by AGC Si-Tech Co., Ltd.) was used.
(188) Inorganic Porous Substance SP (4):
(189) A porous silica was prepared by referring to a preparation method of a double pore porous substance in Example 1 described in JP 2010-120780 A1.
(190) Ethylene-propylene-glycol brock co-polymer (Product name: Pluronic P123, manufactured by BASF Co. Ltd.) 5.5 g was dissolved in 0.01 M aqueous acetic acid solution 40 mL, and then urea 2.5 g was dissolved thereto. To the aqueous solution was added tetraethoxysilane 25 mL, and the mixture was stirred for 1 hour to obtain a solution. The resulting solution was left to stand at 60 C. for 24 hours to obtain a gel, and the gel was washed with methanol-water. The obtained gel was dried at 60 C., and calcined at 250 C. for 10 hours to an inorganic porous substance (4) as a porous silica powder.
(191) Inorganic Porous Substance SP (5):
(192) A calcined zeolite substance was obtained in the same manner as in Example 1 described in JP 5875843B2. Then, 10 g of the resulting calcined substance was put in a petri dish, and stood in a two-liter separable flask containing 100 mL of water, and the separable flask was closed with a lid. Then, the separable flask was placed in a constant temperature water bath at 80 C., and left to stand for 24 hours. The separable flask was taken out, and allowed to cool to 20 C. The resulting solid 8 g was placed in an autoclave, and a mixed solution 222 g of 7.5% by mass ammonium nitrate aqueous solution 88 g and 25% by mass ammonia aqueous solution 134 g was added thereto, and the mixture was stirred at 90 C. for 1 hour, and then the solid was separated by filtration. The solid was further treated with the mixed solution of the ammonium nitrate aqueous solution and the ammonia aqueous solution prepared in the same manner as described above repeatedly nine times, and then washed with water, and dried to obtain the inorganic porous substance SP (5).
(193) [Image Analysis Method of Pore]
(194) (Obtaining of Continuous Slice Images by FIB-SEM)
(195) An image analysis of a pore was performed on the inorganic porous substances SP (1) to (5) using FIB-SEM. An epoxy resin was impregnated into an interior of each of the inorganic porous substance SP, and after filling a void part of the inorganic solid carrier, the epoxy resin was hardened, and the carrier was cut such that a cross section of each inorganic porous substance SP can be observed, and a PtPd vapor deposition was conducted to the cutting surface, and the sample for FIB-SEM observation was created.
(196) Using the FIB-SEM (manufactured by FEI company; HELIOS600), the cutting face was performed by a FIB processing, and a processed face from which a porous structure of interior of the inorganic solid carrier can be observed was created. A SEM observation (Reflected electron image) at an acceleration voltage; 2.1 kV was conducted on the processed face of obtained porous layer. The scale of the above SEM observation was 5 nm/pix.
(197) After the above SEM observation, a newly processed face was created by FIB processing at a thickness of 5 nm in the depth direction of the sample, and the SEM observation (Reflected electron image) was conducted on the newly-processed face. Similarly, further newly-processed face was created by FIB processing at a thickness of 5 nm from the newly-processed face, and the SEM observation (Reflected electron image) was conducted on the further newly-processed face. The FIB processing at interval at a thickness of 5 nm, and the SEM observation of the processed face were repeated in such a manner, and the continuous slice images of the interior porous structure of each of the inorganic porous substances SP were obtained.
(198) Using an image analysis software (manufactured by visualization sciences Group; Avizo ver. 6.0), a position correction was conducted, and the continuous slice images after the correction were obtained. The scale was 5 nm/pix as X, Y or Z axis.
(199) (Three-Dimensional Quantitative Analysis by Quantitative Analysis Software)
(200) A three-dimensional quantitative analysis was conducted on the continuous slice images obtained above using a quantitative analysis software TRI/3D-BON-FCS64 (manufactured by Ratoc System Engineering Co., Ltd.) to calculate a pore size and the number of branches.
(201) In the three-dimensional quantitative analysis, firstly, the continuous slice images were opened on the TRI/3D-BON-FCS64, and was trimmed in a size of about 4 m2.5 m1 m by a trimming function, and a 3D 33 median filter was applied to remove a fine noise. Next, a two-gradation processing of images was performed by Auto-LW one image processing loop function, and an inorganic carrier part and a void part which were composed of a porous layer were identified. In order to remove the isolated structural part and isolated void part, the identified inorganic carrier part and the identified void part respectively were deleted the parts of 5 voxel or less thereof. After removing noise, the void parts was made white of 256 gradations to obtain a binarized continuous slice images. The structural analysis of the binarized continuous slice images in which the inorganic carrier part and the void part were identified was conducted by a cancellous bone measurement of bone measurement as an analysis function of the software under a condition where MIL effective length r1=0.5, NdNd effective length r2=1.5, and NdTm effective length r3=2.0 to calculate a ratio of length of terminal pore relative to the sum of total length of all pores. The ratio of the length of terminal pore relative to the sum of total length of all pores represents a parameter which can be calculated by the above-mentioned three-dimensional quantitative analysis using the quantitative analysis software. The points where the voids were branched as shown in
(202) (Calculation of Ratio of Sum of Total Length of all Through Holes Relative to Sum of Total Length of all Pores)
(203) The terminal pore was defined to be an interval between a branch point and a terminus of pore (Dead-point: Terminus point), and an interval between mutual terminus point), and the length (LENGTH) was made a terminal pore length (see
(204) (Calculation of SBR and OIR)
(205) As an option of the above quantitative analysis software, a continuous hole analysis (3D-VNET) was performed to calculate a Survival Bone Rate (SBR) and Output I ration on From (OIR).
(206) The analysis of the above-described pore size is intent to calculate a size of the respective pore, and on the other hand, the continuous hole analysis represents an option function for determining quantitatively how these pores are communicated, that is, an ease of flow by deeming the network structure of pore to be an electric circuit.
(207) Firstly, a NodeStrut intermediate file output was conducted by a continuous hole measurement to creative an intermediate file. At that time, a target data was made a binarized void part, the CT data was made a peripheral one (1) pixel (six-faced box) of trimmed area, and a target area was made an inverted CT data (contents parts of box). Next, in a detailed flow path analysis, the created intermediate file was designated, the first page of Z direction of the continuous slice images was made a face at the begging of the flow: From, and the last page thereof is made of the last face: To, and the flow analysis were performed to calculate Survival Bone Rate (SBR) as an indicator for ease of flow. A volume resistivity in the flow analysis was made 1.0. Further, the analysis of all paths of the continuous hole was performed, which can be calculated an Output I ratio on From (OIR) representing how ratio of the current was flown from From to To. The analysis parameters were made PathL. Max=6.0PathL, number of search paths=50000, and number of output paths=50000.
(208) The SBR represents a parameter showing a ratio of residual trabecula relative to osteoporosis, and when a trabecula part is deemed to be a flow path where a current flows, as the SBR value is larger, the network structure has smoother flow structure. Specifically, an internal resistance is calculated from a cross-sectional S and a length L of a continuous hole obtained by image analysis of the continuous slice images (said holes represent a part where a plurality of pores are communicated to form one flow path), and an voltage 1V is supposed to be applied between From-To, and a current in a continuous hole is calculated. The equivalent resistance in the analysis area is calculated from the sum of the calculated current and the applied voltage V. It means that as this equivalent resistance value is smaller, the network structure has smoother flow structure.
(209) Further, when an equivalent resistance of the pore network is made RE, an equivalent cross-sectional area is made SE, and a distance between From-To is made LE, it can be expressed by RE=LE/SE. As the equivalent cross-sectional value is larger, the equivalent resistance value is smaller. The SBR represents a value which is obtained by dividing this equivalent cross-sectional area by an area of From face as a standard, which makes an indicator showing how degree of the equivalent cross-sectional area relative to an input area the network has, that is, how degree of ease of flow the network has.
(210) Next, the sum of total current value of paths which communicate to To is calculated, which is divided by all current values in the analysis areas to obtain a OIR. That is, the OIR represents an indicator showing how degree of the input current can flow to a To face without running away to a side of face, that is, an ease of flowing linearly.
(211) [Measurement of Pore Distribution by Mercury Intrusion Method]
(212) With respect to the inorganic porous substance SP (5) to the inorganic porous substance SP (4), a pore distribution of about 0.004 to 200 m of pore size (value obtained by calculating differentially a pore volume by a pore size) was determined by mercury intrusion method.
(213) The above-mentioned measurement was used with AutoPoreIV9520 (manufactured by Micromeritics). As a pretreatment, a constant-temperature drying was carried out on the inorganic porous substance at 150 C. for 4 hours.
(214) The pore size was calculated by the following equation (A).
D=4cos /P(A)
(215) P: Pressure, D: Pore diameter, : Surface tension of mercury, : Contact angle between mercury and sample,
(216) In this measurement, the surface tension of mercury: was 0.48 N/m, and the contact angle between mercury and sample was 140.
(217) Most Frequent Value (Mode Diameter):
(218) The most frequent value of pore size was determined from a value of X-axis at a peak top in the pore size distribution obtained by the above-mentioned mercury intrusion method (a graph in which the X-axis is a value of the pore size and the Y-axis is a value obtained by differentiating the pore volume by the pore size).
(219) The porosity ratio (%) was calculated by multiplying the bulk density (g/mL) with the cumulative pore volume (mL/g) which is included within a range of 0.004 m to 200 m.
(220) <Silane Coupling Agent>
(221) As the silane coupling agent, the ingredient (C1) and ingredient (C2) as described below were used.
(222) Ingredient (C1):
(223) 3-Aminopropyldiisopropylethoxysilane which was commercially available was purchased and used.
(224) Ingredient (C2):
(225) 3-Aminopropyltriethoxysilane (TCI, CAS RN: 919-30-2, product code: A0439) was used.
(226) <Method for Preparing Inorganic Porous Substance>
(227) The inorganic porous carrier of each of examples was obtained by treating the surface of any one of the inorganic porous carriers SP (1) to SP (5) as produced above with any one of the ingredients (C1) to (C2) as the silane coupling agents.
Example 1
(228) The inorganic porous substance SP (1) 2.00 g was placed in a four-necked flask, and toluene 100 mL was added thereto. The ingredient (C1) 4.8 mg was further added thereto under stirring, and the mixture was stirred at room temperature for 3 hours. Then, the reaction solution was filtered, and washed with toluene, and then the residue was dried under reduced pressure to obtain the inorganic porous carrier of Example 1.
Example 2
(229) The inorganic porous carrier of Example 2 was obtained in the same manner as the preparation method of Example 1 except for that the inorganic porous substance SP (1) was replaced with the inorganic porous substance SP (2) (2.00 g) and the addition amount of the ingredient (C1) was changed to 6.8 mg.
Example 3
(230) The inorganic porous carrier of Example 3 was obtained in the same manner as the preparation method of Example 1 except for that the inorganic porous substance SP (1) was replaced with the inorganic porous substance SP (3) (1.00 g) and the addition amount of the ingredient (C1) was changed to 2.4 mg.
Example 4
(231) The inorganic porous carrier of Example 4 was obtained in the same manner as the preparation method of Example 1 except for that the inorganic porous substance SP (1) was replaced with the inorganic porous substance SP (5) (2.00 g) and the addition amount of the ingredient (C1) was changed to 6.8 mg.
Comparative Example 1
(232) The inorganic porous carrier of Comparative Example 1 was obtained in the same manner as the preparation method of Example 1 except for that the inorganic porous substance SP (1) was replaced with the inorganic porous substance SP (4) (2.42 g) and the ingredient (C1) was replaced with the ingredient (C2) (44.7 mg).
(233) <Preparation of Solid-Phase Carrier>
(234) U-succinate (5-O-dimethoxytrityl-2-O-tert-butyldimethylsilyl-3-O-succinyluridine) 25.1 mg, 1-[bis(dimethylamino)methylene]-1H-1,2,3-benzotriazolium 3-oxide hexafluorophosphate (HBTU) 12.5 mg, N,N-diisopropylethylamine 5.9 L and acetonitrile 2.7 mL were mixed, and the inorganic porous carrier 300.0 mg of each of Examples 1 to 10 and Comparative Examples 1 to 4 was added to the mixture.
(235) The mixture was left to stand at 25 C. for 18 hours, and then filtered, and the solid (residue) was washed with acetonitrile 10 mL. A solution 1 mL of acetic anhydride and 2,6-lutidine in THF (volume ratio of acetic anhydride/2,6-lutidine/THF: 1/1/8) and a solution 1 mL of N-methyl imidazole in THF (volume ratio of N-methyl imidazole/THF: 16/84) were added to the washed solid. The mixture was left to stand for 1 minute, and then filtered, and the solid was washed with acetonitrile 10 mL. The washed solid was dried under vacuum to obtain the solid-phase carrier in which the nucleoside was supported on the inorganic porous carrier.
(236) An aqueous 70% perchloric acid solution was diluted with methanol to prepare a solution of 30% perchloric acid/methanol. The solid-phase carrier 10 mg which supported the nucleoside, as prepared above, was placed in a measuring flask, and was diluted to 10 mL with the solution of 30% perchloric acid/methanol. The resulting solution was further diluted 10-fold with the solution of 30% perchloric acid/methanol, and then an absorbance thereof at 498 nm was measured, and the support density of nucleoside was calculated based on the following formula. The results are shown in Table 1.
(237)
<Solid-Phase Synthesis of Oligonucleic Acid>
(238) TABLE-US-00001 Sequence(A): (SEQIDNO:1,2) 5-GCAGAGUACACACAGCAUAUACC-P- GGUAUAUGCUGUGUGUACUCUGCUU-3 (49-mer). (SEQIDNO:1) GCAGAGUACACACAGCAUAUACC and (SEQIDNO:2) GGUAUAUGCUGUGUGUACUCUGCUU.
(239) In the above sequence (A), P represents a binding moiety separated with wavy lines in the following structure.
(240) ##STR00014##
(241) The oligonucleotide consisting of the sequence (A) or the sequence (B) was synthesized from the 3side to the 5side according to the phosphoramidite method by means of a nucleic acid synthesizer (trade name: NTS M-4-MX-E, produced by Nihon Techno Service Co., Ltd.) (See the reaction route (condensation reaction, oxidation, and deprotection as described above)).
(242) Each of solid-phase carriers as prepared above was used for the above solid-phase synthesis.
(243) As the amidite monomer, the adenosine EMM amidite (described in Example 4 of US2012/035246 A1), the cytidine EMM amidite (described in Example 3 of the same US patent literature), the guanosine EMM amidite (described in Example 5 of the same US patent literature), the uridine EMM amidite (described in Example 2 of the same US patent literature) and amidite P (described in WO2017/188042 A1) as shown below were used.
(244) ##STR00015## ##STR00016##
(245) Further, in the solid-phase synthesis, a solution of high-purity trichloroacetic acid in toluene was used as a deblocking solution, 5-benzylmercapto-1H-tetrazole was used as a condensing agent, an iodine solution was used as an oxidizing agent, and a phenoxyacetic acid solution and an N-methyl imidazole solution were used as a capping solution.
(246) The solid-phase carrier after the completion of synthesis was placed in a glass vial with a lid, and a solution of 28% NH.sub.4OH and EtOH at a ratio of 1:1 to 2:1 was added thereto. Then, the mixture was left to stand at 40 C. for 4 hours. The solution after the completion of reaction was filtered, and washed with water and EtOH successively. The resulting solution was dried to obtain a crude oligonucleotide having a protected group. Then, the crude oligonucleotide was deprotected by the treatment with tetra-n-butyl ammonium fluoride (TBAF) in the presence of nitromethane to obtain the crude product.
(247) [Measurement of Oligonucleic Acid Purity]
(248) The determination of the purity of oligonucleic acid was carried out by high performance liquid chromatography HPLC (wavelength 260 nm, column DNAPac PA100 4250 mm).
(249) The above-mentioned crude products were separated into each of ingredients by the above HPLC, and then the purity of oligonucleic acid was calculated from a percentage of area value of main product having a target strand length relative to the total area value of the obtained chromatogram. The results are shown in Table 1.
(250) TABLE-US-00002 TABLE 1 Inorganic Porous Carrier represented by General Pore Particle Formula (1) Size Size Inorganic Mode median Porous n = 1 diameter diameter SBR OIR Substance Substance R, R L (m) (m) (%) (%) Example SP(1) Zeolilte Isopropyl CH.sub.2 0.081 48 6.8 98.1 1 Group Example SP(2) Zeolite Isopropyl CH.sub.2 0.052 85 6.7 87.1 2 Group Example SP(3) Silica Isopropyl CH.sub.2 0.11 40 6.3 92.1 3 Gel Group Example SP(5) Zeolite Isopropyl CH.sub.2 0.11 48 6.3 97.5 4 Group Comparative SP(4) Silica Ethoxy CH.sub.2 0.13 49 4.9 74.7 Example Gel Group 1 Sum of total length of all Purity of through holes Oligonucleic relative to Sum Specific Acid of total Pore surface Carrier Chain Area length Volume Area Density Length normalization of all per per of of of pores Volume Volume Porosity Nucleoside Oligonucleic Main Peak (%) (m.sup.2/mL) (m.sup.2/mL) (%) (mol/m.sup.2) Acid (%) Example 99.7 0.29 8.4 69 0.65 49 mer 62.3 1 (RNA) Example 99.1 0.24 13.8 81 0.48 49 mer 56.7 2 (RNA) Example 98.8 0.38 5.8 81 0.71 49 mer 54.5 3 (RNA) Example 99.4 0.34 7.7 78 1.03 103 mer 68.7 4 (RNA) Comparative 96.2 0.26 57 77 0.33 49 mer 44.7 Example (RNA) 1
(251) According to the results shown in Table 1, it is possible to confirm that the purity of the oligonucleic acid is higher in the case of use of the solid-phase carriers of Examples 1 to 4 than in the case of use of the solid-phase carrier of Comparative Example 1.
(252) Accordingly, it is possible to conclude that the solid-phase carrier used in the present invention can further improve the purity in the preparation of nucleic acid.
INDUSTRIAL APPLICABILITY
(253) The present invention provides a method for preparing nucleic acid, which can improve the purity even in the synthesis of long-stranded nucleic acid. The nucleic acid obtained by the inorganic porous carrier and the preparation method using the same is useful as a raw material for pharmaceutical products.
SEQUENCE LISTING FREE TEXT
(254) SEQ ID NOs: 1 and 2 in the sequence listing represent the base sequences of oligonucleotides prepared according to the preparation method of the present invention.