COMPOSITIONS AND METHODS FOR BREWING SOUR BEER

20240400954 ยท 2024-12-05

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to the unexpected discovery of a new strain of yeast, dubbed GY7B, which is related to, but genetically and phenotypically distinct from, Lachancea thermotolerans. The invention provides methods of brewing sour beer using GY7B, wherein the methods do not require use of lactic acid or lactic acid producing bacteria.

    Claims

    1-36. (canceled)

    37. A kit comprising a yeast strain from the genus Lachancea able to produce a yeast-fermented beverage with a low pH and a sour taste without the use of lactic acid producing bacteria, wherein the yeast strain does not grow on lactose; and instructional materials comprising instructions for producing a yeast-fermented beverage using the yeast strain.

    38. The kit of claim 37, wherein the kit further comprises one or more items or ingredients selected from the group consisting of: prepared wort solution; dry malt extract; one or more grains selected from the group consisting of barley, wheat, corn, rye, rice, oats, sorghum, millet, buckwheat, quinoa, and teff; at least one additional yeast strain selected from the group consisting of Saccharomyces cerevisiae, Saccharomyces pastoriamis, Saccharomyces paradoxus, Saccharomyces eubayamus, Saccharomyces ludwigii, Aureobasidium pullulans, Cyberlindnera saturmis, Hansensiaspora uvarum, Hansenisaspora guilliermondii, Hansensiaspora osmophila, Hansensiasporavineae, Hansemila anomala, Issatchenkia occidentalis, Issatchenkia orientalis, Pichia kluyveri, Pichia caribbica, Pichia fermentans, Pichia kudriavzevii, Pichia Membranifaciens, Rhodotorula mucilaginosa, Torulaspora delbrueckii, Candida colliculosa, Candida shehatae, Candida tropicalis, Candida ethanolica, Candida krusei, Candida magnolia, Candida milleri, Clavispora lusitaniae, Wickerhamomyces subpelliculosus, Wickerhamomyces anomalus, Zygosaccharomyces rouxii, Zygosaccharomyces bailii, Zygosaccharomyces fermentati, Zygosaccharomycesflorentinis, Kluyveromyces lactis, Kluyveromyces marxiamis, Lachancea thermotolerans, Brettanomyces bruxellensis, Brettanomyces anomalus, Brettanomyces custersiamis, Brettanomyces naardenensis, Brettanomyces namus, Dekkera bruxellensis, and Dekkera anomala; one or more varieties of hops; conditioned brewing water; and one or more sugar adjuncts.

    39. The kit of claim 37, wherein the yeast strain is able to produce a yeast-fermented beverage with a pH of about 4.2 to about 3.3 without the use of lactic acid producing bacteria.

    40. The kit of claim 37, wherein the yeast-fermented beverage is beer.

    41. The kit of claim 37, wherein the yeast strain, when used to ferment a wort according to the instructional materials, is able to reduce the pH of the wort to about 3.5 in about 5 days without the use of acid producing bacteria.

    42. The kit of claim 37, wherein the yeast produces a yeast-fermented beverage with a pH of about 4.2 to about 3.3 when used according to the instructional materials.

    43. The kit of claim 37, wherein the instructional materials instruct to ferment a wort with the yeast strain in the absence of any acid producing bacteria.

    44. The kit of claim 37, wherein the instructional materials instruct to ferment a wort with the yeast strain in the absence of any lactic acid producing bacteria.

    45. The kit of claim 37, wherein the instructional materials instruct to ferment a wort with the yeast strain in the absence of bacteria belonging to genera Lactobacillus or Pediococcus.

    46. The kit of claim 37, wherein the instructional materials instruct to ferment a wort comprising malt derived from one or more grains selected from the group consisting of barley, wheat, corn, rye, rice, oats, sorghum, millet, buckwheat, quinoa, and teff, with the yeast strain.

    47. The kit of claim 37, wherein the instructional materials instruct to ferment a wort with the yeast in the presence of at least one additional yeast strain selected from the group consisting of Saccharomyces cerevisiae, Saccharomyces pastorianus, Saccharomyces paradoxus, Saccharomyces eubayanus, Saccharomyces ludwigii, Aureobasidium pullulans, Cyberlindnera saturnus, Hansensiaspora uvarum, Hansensiaspora guilliermondii, Hansensiaspora osmophila, Hansensiasporavineae, Hansenula anomala, Issatchenkia occidentalis, Issatchenkia orientalis, Pichia kluyveri, Pichia caribbica, Pichia fermentans, Pichia kudriavzevii, Pichia Membranifaciens, Rhodotorula mucilaginosa, Torulaspora delbrueckii, Candida colliculosa, Candida shehatae, Candida tropicalis, Candida ethanolica, Candida krusei, Candida magnolia, Candida milleri, Clavispora lusitaniae, Wickerhamomyces subpelliculosus, Wickerhamomyces anomalus, Zygosaccharomyces rouxii, Zygosaccharomyces bailii, Zygosaccharomyces fermentati, Zygosaccharomycesflorentinus, Kluyveromyces lactis, Kluyveromyces marxiamis, Lachancea thermotolerans, Brettanomyces bruxellensis, Brettanomyces anomalus, Brettanomyces custersianus, Brettanomyces naardenensis, Brettanomyces nanus, Dekkera bruxellesis, and Dekkera anomala.

    48. The kit of claim 47, wherein the wort further comprises a hops.

    49. The kit of claim 48, wherein the hops comprises at least one selected from the group consisting of Ahtanum, Amarillo, Apollo, Cascade, Centennial, Chinook, Citra, Cluster, Columbus, Crystal, Eroica, Galena, Glacier, Greenburg, Horizon, Liberty, Millenium, Mount Hood, Mount Rainier, Newport, Nugget, Palisade, Santiam, Simcoe, Sterling, Summit, Tomahawk, Ultra, Vanguard, Warrior, Willamette, Zeus, Admiral, Brewer's Gold, Bullion, Challenger, First Gold, Fuggles, Goldings, Herald, Northdown, Northern Brewer, Phoenix, Pilot, Pioneer, Progress, Target, Whitbread Golding Variety (WGV), Hallertau, Hersbrucker, Saaz, Tettnang, Spalt, Feux-Coeur Francais, Galaxy, Green Bullet, Motueka, Nelson Sauvin, Pacific Gem, Pacific Jade, Pacifica, Pride of Ringwood, Riwaka, Southern Cross, Lublin, Magnum, Perle, Polnischer Lublin, Saphir, Satus, Select, Strisselspalt, Styrian Goldings, Tardif de Bourgogne, Tradition, Bravo, Calypso, Chelan, Comet, El Dorado, San Juan Ruby Red, Satus, Sonnet Golding, Super Galena, Tillicum, Bramling Cross, Pilgrim, Hallertauer Herkules, Hallertauer Magnum, Hallertauer Taurus, Merkur, Opal, Smaragd, Halleratau Aroma, Kohatu, Rakau, Stella, Sticklebract, Summer Saaz, Super Alpha, Super Pride, Topaz, Wai-iti, Bor, Junga, Marynka, Premiant, Sladek, Styrian Atlas, Styrian Aurora, Styrian Bobek, Styrian Celeia, Sybilla, and Sorachi Ace.

    50. The kit of claim 37, wherein the instructional materials instruct not to use lactic acid while producing a yeast-fermented beverage.

    51. The kit of claim 37, wherein the instructional materials instruct not to add lactic acid to a wort, before, during, or after fermentation.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0025] The following detailed description of specific embodiments of the invention will be better understood when read in conjunction with the appended drawings. For the purpose of illustrating the invention, the drawings illustrate specific embodiments. It should be understood, however, that the invention is not limited to the precise arrangements and instrumentalities of the embodiments shown in the drawings.

    [0026] FIGS. 1A-1C are a non-limiting illustrative diagram outlining the methods used to select, isolate and characterize yeast strains of potential interest. Yeast strains of potential interest can be selected at step 102 where collected yeast strains are cultured with wort containing antibiotics and assessed for CO.sub.2 production, wort density reduction, and tolerance for high dissolved sugar concentrations.

    [0027] FIGS. 2A-2B are graphs reporting pH (FIG. 2A) and apparent extract (FIG. 2B) of fermentation trials of 10% light dry malt extract (DME) unhoped wort using Saccharomyces cerevisiae (Belle Saison strain; Lallemand), a newly discovered yeast strain GY7B, and a mixture of both strains. The wort was incubated at 20 C. and inoculated with 110.sup.6 yeast cells per milliliter per degree Plato. The GY7B strain demonstrated greater acidification and a greater longevity than the Saccharomyces cerevisiae or the mixed strain samples. As demonstrated in FIG. 2B, GY7B does not ferment as quickly as the Saccharomyces cerevisiae strain used in this trial. Without being limited to any one theory, it is possible that the lack of acidification observed in co-fermentation between GY7B and Saccharomyces cerevisiae is due to the faster fermentation abilities of traditional ale yeast strains that outcompetes GY7B's ability to create lactic acid.

    [0028] FIG. 2C is a graph reporting pH and apparent extract of a brewer's wort using Saccharomyces cerevisiae (American Ale II strain; Wyeast 1272), GY7B, and Lachancea thermotolerans; type strain NRRL Y-8284. GY7B fermented faster than L. thermotolerans but slower than S. cerevisiae. GY7B exhibited rapid souring during fermentation, reaching pH 3.5 in 4 days.

    [0029] FIGS. 3A-3B are images comparing the morphology of GY7B (FIG. 3A) and standard Lachancea thermotolerans; NRRL Y-8284 (FIG. 3B) yeast. Cultures were grown in yeast extract peptone dextrose (YPD) agar for 72 hours at 25 C. and visualized under differential interference microscopy. Utilizing ImageJ, the average length of GY7B=4.60.607 m and Y8284=6.90.934 m.

    [0030] FIGS. 4A-4B are graphs showing the effect of pH on growth rates for GY7B (FIG. 4A) and standard Lachancea thermotolerans; NRRL Y-8284 (FIG. 4B) yeast over time. GY7B exhibited greater tolerance for low pH than L. thermotolerans.

    [0031] FIGS. 5A-5B are graphs showing effect of ethanol concentration on growth rates for GY7B (FIG. 5A) and Lachancea thermotolerans NRRL Y8284 (FIG. 5B) yeast over time. GY7B exhibited greater tolerance for high ethanol concentrations than L. thermotolerans.

    [0032] FIG. 6 is an image comparing the flocculation characteristics of GY7B and standard Lachancea thermotolerans; NRLL Y-8284. GY7B is highly flocculant while L. thermotolerans is not.

    DETAILED DESCRIPTION OF THE INVENTION

    [0033] The present invention relates to the unexpected discovery of a new strain of yeast, dubbed GY7B, which is related to, but genetically and phenotypically distinct from, Lachancea thermotolerans. The invention provides methods of brewing a yeast-fermented beverage, such as but not limited to sour beer, using GY7B, wherein the methods do not require use of lactic acid and/or LAB. The methods of the invention can produce a wort with a pH of about 3.5 after fermenting for 5 days in the presence of GY7B, while methods known in the art using bacteria can take months to reach the same pH. In certain embodiments, the methods of the invention are performed without addition of lactic acid, or equivalents thereof, to the compositions contemplated within the invention. In other embodiments, within the methods of the invention, lactic acid, or any equivalents thereof, is not added during fermentation. In yet other embodiments, within the methods of the invention, lactic acid, or any equivalents thereof, is not added after fermentation. In yet other embodiments, the yeast contemplated within the invention is typically not of the Lachancea thermotolerans species.

    Definitions

    [0034] As used herein, each of the following terms has the meaning associated with it in this section.

    [0035] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, exemplary methods and materials are described.

    [0036] Generally, the nomenclature used herein and the laboratory procedures in yeast culturing and beer brewing are those well-known and commonly employed in the art.

    [0037] As used herein, the articles a and an refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, an element means one element or more than one element.

    [0038] As used herein, the term about is understood by persons of ordinary skill in the art and varies to some extent on the context in which it is used. As used herein when referring to a measurable value such as an amount, a temporal duration, and the like, the term about is meant to encompass variations of 20% or 10%, more preferably 5%, even more preferably 1%, and still more preferably 0.1% from the specified value, as such variations are appropriate to perform the disclosed methods.

    [0039] As used herein, in certain embodiments the term GY7B may be referred to as the yeast deposited with the ATCC under Accession Number PTA-125167 on Jul. 19, 2018. In other embodiments, the GY7B yeast strain is characterized for having the nucleotide sequence of SEQ ID NO: 8 within the ITS region. In yet other embodiments, the GY7B yeast strain is characterized for having the nucleotide sequence of SEQ ID NO: 9 within the actin1 gene. In yet other embodiments, the GY7B yeast strain is characterized for having the nucleotide sequence of SEQ ID NO: 8 within the ITS region and the nucleotide sequence of SEQ ID NO: 9 within the actin1 gene.

    [0040] Instructional material, as that term is used herein, includes a publication, a recording, a diagram, or any other medium of expression that can be used to communicate the usefulness of the composition and/or compound of the invention in a kit. The instructional material of the kit may, for example, be affixed to a container that contains the compound and/or composition of the invention or be shipped together with a container that contains the compound and/or composition. Alternatively, the instructional material may be shipped separately from the container with the intention that the recipient uses the instructional material and the compound cooperatively. Delivery of the instructional material may be, for example, by physical delivery of the publication or other medium of expression communicating the usefulness of the kit, or may alternatively be achieved by electronic transmission, for example by means of a computer, such as by electronic mail, or download from a website.

    [0041] As used herein, the term low pH in a fermented beverage indicates that the pH of the beverage is higher than or equal to about 2.5, and lower than or equal to about 4.5. The upper limit of low pH can be lower than or equal to about 4.5, lower than or equal to about 4.4, lower than or equal to about 4.3, lower than or equal to about 4.2, lower than or equal to about 4.1, and/or lower than or equal to about 4.0. The lower limit of the pH can be set as higher than or equal to about 2.5, higher than or equal to about 2.6, higher than or equal to about 2.7, higher than or equal to about 2.8, higher than or equal to about 2.9, higher than or equal to about 3.0, higher than or equal to about 3.1, higher than or equal to about 3.2, higher than or equal to about 3.3, higher than or equal to about 3.4, and/or higher than or equal to about 3.5. Any numerical ranges having the upper limits and the lower limits as shown elsewhere herein can be adopted. For example, the pH of the beverage can be in ranges of about 2.7 or higher, and about 4.5 or lower; about 2.7 or higher, and about 4.2 or lower; about 2.7 or higher, and about 4.0 or lower; about 3.0 or higher, and about 4.5 or lower; about 3.0 or higher, and about 4.2 or lower; about 3.1 or higher, and about 4.2 or lower; about 3.2 or higher, and about 4.2 or lower; about 3.3 or higher, and about 4.2 or lower; about 3.0 or higher, and about 4.0 or lower; about 3.5 or higher, and about 4.5 or lower; about 3.5 or higher, and about 4.2 or lower; and/or about 3.5 or higher, and about 4.0 or lower. In certain embodiments, the pH is about 2.5. In other embodiments, the pH is about 2.6. In yet other embodiments, the pH is about 2.7. In yet other embodiments, the pH is about 2.8. In yet other embodiments, the pH is about 2.9. In yet other embodiments, the pH is about 3.0. In yet other embodiments, the pH is about 3.1. In yet other embodiments, the pH is about 3.2. In yet other embodiments, the pH is about 3.3. In yet other embodiments, the pH is about 3.4. In yet other embodiments, the pH is about 3.5. In yet other embodiments, the pH is about 3.6. In yet other embodiments, the pH is about 3.7. In yet other embodiments, the pH is about 3.8. In yet other embodiments, the pH is about 3.9. In yet other embodiments, the pH is about 4.0. In yet other embodiments, the pH is about 4.1. In yet other embodiments, the pH is about 4.2. In yet other embodiments, the pH is about 4.3. In yet other embodiments, the pH is about 4.4. In yet other embodiments, the pH is about 4.5.

    [0042] As used herein, the term mash is understood to mean a mix of milled grains and water used in brewing and distilling processes to produce wort. Typically malted grains are heated in order to breakdown the starch in the grains into simple sugars, which can then be fermented in order to produce alcohol.

    [0043] As used herein, the Plato scale or Plato gravity scale refers to the empirically derived hydrometer scale used to measure the density of beer wort in terms of percentage of extract by weight. The terms degrees Plato or Plato or P are units of measurement on the Plato scale.

    [0044] As used herein, the term sour in a fermented beverage refers to an acid, bitter, and/or sharp taste in the palate caused by the beverage. In certain embodiments, the sour taste is associated with the low pH of the fermented beverage.

    [0045] As used herein, the term wort is understood to mean the liquid extracted from the mashing process during a brewing or distilling process. Wort contains the sugars extracted from the malted grains which will be fermented by the brewing yeast in order to produce alcohol.

    [0046] Throughout this disclosure, various aspects of the invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible sub-ranges as well as individual numerical values within that range and, when appropriate, partial integers of the numerical values within ranges. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed sub-ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.

    [0047] The following abbreviations are used herein: BLAST, Basic local alignment search tool; DME, dry malt extract; IBU, International Bittering Units; LAB, lactic acid bacteria; nt, nucleotide; OD, Optical Density; PCR, polymerase chain reaction; P/S, Penicillin/Streptomycin; YPD, yeast extract peptone dextrose.

    Compositions

    [0048] The invention provides a yeast strain able to produce a yeast-fermented beverage with a low pH and a sour taste without the use of lactic acid producing bacteria. In other embodiments, the yeast strain is able to produce a yeast-fermented beverage with a pH of about 4.2 to about 3.3 without the use of lactic acid producing bacteria. In yet other embodiments, the yeast strain is able to reduce the pH of word to about 3.5 in about 5 days without the use of acid producing bacteria. In yet other embodiments, the yeast strain belongs to the genus Lachancea. In yet other embodiments, the yeast strain is GY7B (deposited with the ATCC under Accession Number PTA-125167 on Jul. 19, 2018). In yet other embodiments, the yeast strain comprises the nucleotide sequence of SEQ ID NO: 8 within the ITS region. In yet other embodiments, the yeast strain comprises the nucleotide sequence of SEQ ID NO: 9 within the actin1 gene. In yet other embodiments, the yeast strain comprises the nucleotide sequence of SEQ ID NO: 8 within the ITS region and the nucleotide sequence of SEQ ID NO: 9 within the actin1 gene.

    [0049] In certain embodiments, the yeast strain of the invention is part of a composition. In other embodiments, the composition is compatible with fermentation processes. In yet other embodiments, the composition further comprises at least one additional yeast selected from the group consisting of Saccharomyces, Lachancea, and Brettanomyces. In yet other embodiments, the composition further comprises a Saccharomyces yeast. In yet other embodiments, the composition further comprises a distinct Lachancea yeast. In yet other embodiments, the composition further comprises a Brettanomyces yeast.

    Methods

    [0050] In one aspect, the present invention provides a method of producing a yeast fermented beverage with a low pH and sour taste without the use of lactic acid producing bacteria.

    [0051] In certain embodiments, the invention provides a method of producing a yeast-fermented beverage. In other embodiments, the method comprises fermenting a wort in the presence of a yeast strain able to produce a yeast-fermented beverage with a low pH and a sour taste without the use of lactic acid producing bacteria. In certain embodiments, the yeast-fermented beverage is beer.

    [0052] In certain embodiments, the method does not comprise use of lactic acid, or any equivalent thereof. In other embodiments, lactic acid, or any equivalent thereof, is not added to the wort, before, during, or after fermentation.

    [0053] In certain embodiments, the yeast strain is able to produce a yeast-fermented beverage with a pH of about 4.2 to about 3.3 without the use of lactic acid producing bacteria. In other embodiments, the yeast strain is able to reduce the pH of wort to about 3.5 in about 5 days without the use of acid producing bacteria. In yet other embodiments, the yeast strain belongs to the genus Lachancea. In yet other embodiments, the yeast strain is GY7B (deposited with the ATCC under Accession Number PTA-125167 on Jul. 19, 2018). In yet other embodiments, the yeast strain comprises the nucleotide sequence of SEQ ID NO: 8 within the ITS region. In yet other embodiments, the yeast strain comprises the nucleotide sequence of SEQ ID NO: 9 within the actin1 gene. In yet other embodiments, the yeast strain comprises the nucleotide sequence of SEQ ID NO: 8 within the ITS region and the nucleotide sequence of SEQ ID NO: 9 within the actin1 gene.

    [0054] In certain embodiments, the method produces a yeast-fermented beverage with a pH of about 4.2 to about 3.3. In other embodiments, the wort is fermented in the absence of any acid producing bacteria. In yet other embodiments, the wort is fermented in the absence of any lactic acid producing bacteria. In yet other embodiments, the wort is fermented in the absence of bacteria belonging to genera Lactobacillus or Pediococcus. In yet other embodiments, the wort comprises malt derived from one or more grains selected from the group consisting of barley, wheat, corn, rye, rice, oats, sorghum, millet, buckwheat, quinoa, and teff. In yet other embodiments, the wort further comprises hops. In yet other embodiments, the wort is fermented in the presence of at least one additional yeast strain selected from the group consisting of Saccharomyces cerevisiae, Saccharomyces pastorianus, Saccharomyces paradoxus, Saccharomyces eubayanus, Saccharomyces ludwigii, Aureobasidium pullulans, Cyberlindnera saturnus, Hansensiaspora uvarum, Hansensiaspora guilliermondii, Hansensiaspora osmophila, Hansensiasporavineae, Hansenula anomala, Issatchenkia occidentalis, Issatchenkia orientalis, Pichia kluyveri, Pichia caribbica, Pichia fermentans, Pichia kudriavzevii, Pichia Membranifaciens, Rhodotorula mucilaginosa, Torulaspora delbrueckii, Candida colliculosa, Candida shehatae, Candida tropicalis, Candida ethanolica, Candida krusei, Candida magnolia, Candida milleri, Clavispora lusitaniae, Wickerhamomyces subpelliculosus, Wickerhamomyces anomalus, Zygosaccharomyces rouxii, Zygosaccharomyces bailii, Zygosaccharomyces fermentati, Zygosaccharomycesflorentinus, Kluyveromyces lactis, Kluyveromyces marxianus, Lachancea thermotolerans, Brettanomyces bruxellensis, Brettanomyces anomalus, Brettanomyces custersianus, Brettanomyces naardenensis, Brettanomyces nanus, Dekkera bruxellensis, and Dekkera anomala.

    [0055] In certain embodiments, the hops is at least one selected from the group consisting of Ahtanum, Amarillo, Apollo, Cascade, Centennial, Chinook, Citra, Cluster, Columbus, Crystal, Eroica, Galena, Glacier, Greenburg, Horizon, Liberty, Millenium, Mount Hood, Mount Rainier, Newport, Nugget, Palisade, Santiam, Simcoe, Sterling, Summit, Tomahawk, Ultra, Vanguard, Warrior, Willamette, Zeus, Admiral, Brewer's Gold, Bullion, Challenger, First Gold, Fuggles, Goldings, Herald, Northdown, Northern Brewer, Phoenix, Pilot, Pioneer, Progress, Target, Whitbread Golding Variety (WGV), Hallertau, Hersbrucker, Saaz, Tettnang, Spalt, Feux-Coeur Francais, Galaxy, Green Bullet, Motucka, Nelson Sauvin, Pacific Gem, Pacific Jade, Pacifica, Pride of Ringwood, Riwaka, Southern Cross, Lublin, Magnum, Perle, Polnischer Lublin, Saphir, Satus, Select, Strisselspalt, Styrian Goldings, Tardif de Bourgogne, Tradition, Bravo, Calypso, Chelan, Comet, El Dorado, San Juan Ruby Red, Satus, Sonnet Golding, Super Galena, Tillicum, Bramling Cross, Pilgrim. Hallertauer Herkules, Hallertauer Magnum, Hallertauer Taurus, Merkur, Opal, Smaragd, Halleratau Aroma, Kohatu, Rakau, Stella, Sticklebract, Summer Saaz, Super Alpha, Super Pride, Topaz, Wai-iti, Bor, Junga, Marynka, Premiant, Sladek, Styrian Atlas, Styrian Aurora, Styrian Bobek, Styrian Celeia, Sybilla, and Sorachi Acc.

    [0056] The invention further provides use of a yeast strain contemplated herein, and/or a kit contemplated herein, to produce a beer with a low pH and a sour taste. In certain embodiments, the beer is produced without the use of lactic acid producing bacteria. In other embodiments, the beer is produced without the use of lactic acid. In yet other embodiments, the beer has a pH of about 4.2 to about 3.3.

    [0057] In certain embodiments, the method comprises fermenting wort in the presence of GY7B yeast. In certain embodiments, the method produces the sour tasting yeast fermented beverage faster than known methods that use lactic acid producing bacteria.

    [0058] In certain embodiments, the yeast fermented beverage is a beer. In other embodiments, beer is a sour beer similar in style to a beer selected from the group consisting of lambic, geuze (gueuze), saison, farmhouse, framboise, krick, Berliner weisse, Flanders red ale, oud bruin, gose and American wild ale.

    [0059] In certain embodiments, the GY7B yeast reduces the pH of wort to about 3.5 in about 5 days without the use of acid producing bacteria. In other embodiments, the GY7B yeast is more tolerant to low pH than common brewers yeasts known in the art, such as but not limited to Saccharomyces cerevisiae and Lachancea thermotolerans. In other embodiments, the GY7B yeast thrives in environments as low as pH 3. In yet other embodiments, the GY7B yeast produces a beer with a pH of about 4.2 to about 3.3.

    [0060] In certain embodiments, the GY7B yeast tolerates alcohol concentrations up to about 10% vol/vol alcohol.

    [0061] The process of brewing beer is well known to the skilled person and may be outlined in the following non-limiting way. Malt can be prepared from dried, germinated cereal grains (mainly barley or wheat) and grounded into a grist that may contain unmalted adjuncts. The grist can be mashed (mixed with water and steeped) to allow enzymes in the malt to convert the starch into sugars. The grain particles and adjuncts can be separated from the liquid wort in a process called lautering. The malt making and mashing steps can be skipped by adding water to malt extract. After addition of hops and/or other ingredients such as herbs and sugars, the wort can be boiled (hops may also be added after boiling), cooled and aerated. The wort can then be moved to a fermentation tank and fermented by the addition of a brewer's yeast. The primary fermentation, lasting typically 5 to 10 days, may be followed by a secondary fermentation step using a further brewer's yeast. After fermentation the fresh beer or green beer, can be conditioned, optionally filtrated and carbonated.

    [0062] Hops are added to the wort to balance the sweetness of the malt with bitterness and impart onto the beer desirable flavors and aromas. Several varieties exist, including but not limited, to Ahtanum, Amarillo, Apollo, Cascade, Centennial, Chinook, Citra, Cluster, Columbus, Crystal, Eroica, Galena, Glacier, Greenburg, Horizon, Liberty, Millenium, Mount Hood, Mount Rainier, Newport, Nugget, Palisade, Santiam, Simcoe, Sterling, Summit, Tomahawk, Ultra, Vanguard, Warrior, Willamette, Zeus, Admiral, Brewer's Gold, Bullion, Challenger, First Gold, Fuggles, Goldings, Herald, Northdown, Northern Brewer, Phoenix, Pilot, Pioneer, Progress, Target, Whitbread Golding Variety (WGV), Hallertau, Hersbrucker, Saaz, Tettnang, Spalt, Feux-Coeur Francais, Galaxy, Green Bullet, Motucka, Nelson Sauvin, Pacific Gem, Pacific Jade, Pacifica, Pride of Ringwood, Riwaka, Southern Cross, Lublin, Magnum, Perle, Polnischer Lublin, Saphir, Satus, Select, Strisselspalt, Styrian Goldings, Tardif de Bourgogne, and Tradition. Further varieties exist, including but not limited to, Bravo, Calypso, Chelan, Comet, El Dorado, San Juan Ruby Red, Satus, Sonnet Golding, Super Galena, Tillicum, Bramling Cross, Pilgrim, Hallertauer Herkules, Hallertauer Magnum, Hallertauer Taurus, Merkur, Opal, Smaragd, Halleratau Aroma, Kohatu, Rakau, Stella, Sticklebract, Summer Saaz, Super Alpha, Super Pride, Topaz, Wai-iti, Bor, Junga, Marynka, Premiant, Sladek, Styrian Atlas, Styrian Aurora, Styrian Bobek, Styrian Celeia, Sybilla, and Sorachi Acc.

    [0063] In certain embodiments, the yeast fermented beverage is produced by fermenting wort derived from a mash comprising one or more grains selected from the group consisting of barley, wheat, corn, rye, rice, oats, sorghum, millet, buckwheat, quinoa, teff, dry malt extract, and liquid malt extract. In certain embodiments, the yeast fermented beverage may contain additional fermentable sugar as provided by adjuncts such as, but not limited to purified sugars or syrups. In certain embodiments, the mash comprises malted grains. In certain embodiments, the method further comprises the addition of flowers of the hop plant (hops), Humulus lupulus, to the wort. In certain embodiments, the hops are added to the wort before addition of the GY7B yeast. In certain embodiments, the hops are added to the fermenting beer after addition of the GY7B yeast.

    [0064] In certain embodiments, the method comprises fermenting wort in the presence of GY7B yeast alone or in the presence of at least one additional yeast strain selected from the group consisting of Saccharomyces cerevisiae, Saccharomyces pastorianus, Saccharomyces paradoxus, Saccharomyces eubayanus,Saccharomyces ludwigii, Aureobasidium pullulans, Cyberlindnera saturnus Hansensiaspora uvarum Hansensiaspora guilliermondii, Hansensiaspora osmophila, Hansensiasporavineae, Hansenula anomala, Issatchenkia occidentalis, Issatchenkia orientalis, Pichia kluyveri, Pichia caribbica, Pichia fermentans, Pichia kudriavzevii, Pichia Membranifaciens, Rhodotorula mucilaginosa, Torulaspora delbrueckii, Candida colliculosa, Candida shehatae, Candida tropicalis, Candida ethanolica, Candida krusei, Candida magnolia, Candida milleri, Clavispora lusitaniae Wickerhamomyces subpelliculosus, Wickerhamomyces anomalus, Zygosaccharomyces rouxii, Zygosaccharomyces bailii, Zygosaccharomyces fermentati, Zygosaccharomycesflorentinus, Kluyveromyces lactis, Kluyveromyces marxianus, Lachancea thermotolerans, Brettanomyces bruxellensis, Brettanomyces anomalus, Brettanomyces custersianus, Brettanomyces naardenensis, Brettanomyces nanus, Dekkera bruxellensis and Dekkera anomala.

    [0065] In certain embodiments, the starting gravity of the wort is from about 6 P to about 25 P. In other embodiments, the starting gravity of the wort is about 10 P to about 16 P.

    [0066] In certain embodiments, the concentration of GY7B in the wort is about 110.sup.6 cells/mL to about 210.sup.7 cells/ml.

    [0067] In certain embodiments, the wort is fermented at a temperature of about 9 C. to about 30 C. In other embodiments, the wort is fermented at about 20 C.

    [0068] In certain embodiments, the method requires minimal, or no, filtering. GY7B demonstrates high flocculation and rapidly settles to the bottom of the fermenting vessel, easing separation. In certain embodiments, the method facilitates flocculation of additional yeast strains during co-fermentation.

    [0069] In certain embodiments, the method further comprises pasteurization. In other embodiments, the fermented wort is pasteurized at 15-30 Pasteurization Units.

    [0070] In certain embodiments, the GY7B is added to the fermenter. In other embodiments, GY7B is added to the mash. In other embodiments, GY7B is added to a secondary fermentation or maturation vessel such as a fermenter, barrel, foeder, bright tank, keg, cask, can, or bottle.

    Kits

    [0071] The invention provides a kit comprising at least one yeast strain contemplated herein and one or more items or ingredients suitable to produce a yeast-fermented beverage. The invention further provides a kit comprising yeast strain GY7B (deposited with the ATCC under Accession Number PTA-125167 on Jul. 19, 2018), and one or more items or ingredients suitable to produce a yeast-fermented beverage. The invention further provides a kit comprising a yeast strain from the genus Lachancea, wherein the yeast strain comprises the nucleotide sequence of SEQ ID NO: 8 within the ITS region and/or the nucleotide sequence of SEQ ID NO: 9 within the actin1 gene, and one or more items or ingredients suitable to produce a yeast-fermented beverage.

    [0072] In certain embodiments, the kit further comprises instructional materials comprising instructions for producing a yeast-fermented beverage using the yeast strain contemplated.

    [0073] In certain embodiments, the yeast-fermented beverage is beer.

    [0074] In certain embodiments, the one or more items or ingredients comprise at least one item selected from the group consisting of: prepared wort solution; dry malt extract; one or more grains selected from the group consisting of barley, wheat, corn, rye, rice, oats, sorghum, millet, buckwheat, quinoa, and teff; at least one additional yeast strain selected from the group consisting of Saccharomyces cerevisiae, Saccharomyces pastorianus, Saccharomyces paradoxus, Saccharomyces eubayanus, Saccharomyces ludwigii, Aureobasidium pullulans, Cyberlindnera saturnus, Hansensiaspora uvarum, Hansenisaspora guilliermondii, Hansensiaspora osmophila, Hansensiasporavineae, Hansenula anomala, Issatchenkia occidentalis, Issatchenkia orientalis, Pichia kluyveri, Pichia caribbica, Pichia fermentans, Pichia kudriavzevii, Pichia Membranifaciens, Rhodotorula mucilaginosa, Torulaspora delbrueckii, Candida colliculosa, Candida shehatae, Candida tropicalis, Candida ethanolica, Candida krusei, Candida magnolia, Candida milleri, Clavispora lusitaniae, Wickerhamomyces subpelliculosus, Wickerhamomyces anomalus, Zygosaccharomyces rouxii, Zygosaccharomyces bailii, Zygosaccharomyces fermentati, Zygosaccharomycesflorentinus, Kluyveromyces lactis, Kluyveromyces marxianus, Lachancea thermotolerans, Brettanomyces bruxellensis, Brettanomyces anomalus, Brettanomyces custersianus, Brettanomyces naardenensis, Brettanomyces nanus, Dekkera bruxellensis, and Dekkera anomala; one or more varieties of hops; conditioned brewing water; and one or more sugar adjuncts. Illustrative examples of hops contemplated are described elsewhere herein.

    [0075] The invention further provides kits comprising GY7B and items and ingredients necessary to brew beer.

    [0076] In certain embodiments, the kit comprises packaged GY7B. In other embodiments, the kit comprises dried GY7B in the form of a powder. In other embodiments, the kit comprises GY7B in a vacuum sealed container. In other embodiments, the kit comprises GY7B from a fresh propagation or a post-fermentation slurry in a vented container.

    [0077] In certain embodiments, the kit further comprises one or more items necessary for performing the methods of the invention selected from the group consisting of one or more vessels adapted and configured for wort fermentation, one or more thermometers, one or more hydrometers, one or more vessels adapted and configured for wort boiling, one or more vessels adapted and configured for pasteurization, one or more vessels adapted and configured for beer storage, one more vessels adapted and configured for aging of beer. In other embodiments, the kit further comprises one or more items selected from the group consisting of compressed CO.sub.2 tanks, compressed N.sub.2 tanks, gas regulators, tubing, and pressure gauges.

    [0078] In certain embodiments, the kit further comprises at least one additional ingredient necessary for performing the methods of the invention selected from the group consisting of prepared wort solution, dry or liquid malt extract, one or more grains selected from the group consisting of barley, wheat, corn, rye, rice, oats, sorghum, millet, buckwheat, quinoa, and teff, at least one additional yeast strain selected from the group consisting of Saccharomyces cerevisiae, Saccharomyces pastorianus, Saccharomyces paradoxus, Saccharomyces eubayanus, Saccharomyces ludwigii, Aureobasidium pullulans, Cyberlindnera saturnus Hansensiaspora uvarum Hansensiaspora guilliermondii, Hansensiaspora osmophila, Hansensiasporavineae, Hansenula anomala, Issatchenkia occidentalis, Issatchenkia orientalis, Pichia kluyveri, Pichia caribbica, Pichia fermentans, Pichia kudriavzevii, Pichia Membranifaciens, Rhodotorula mucilaginosa, Torulaspora delbrueckii, Candida colliculosa, Candida shehatae, Candida tropicalis, Candida ethanolica, Candida krusei, Candida magnolia, Candida milleri, Clavispora lusitaniae Wickerhamomyces subpelliculosus, Wickerhamomyces anomalus, Zygosaccharomyces rouxii, Zygosaccharomyces bailii, Zygosaccharomyces fermentati, Zygosaccharomycesflorentinus, Kluyveromyces lactis, Kluyveromyces marxianus, Lachancea thermotolerans, Brettanomyces bruxellensis, Brettanomyces anomalus, Brettanomyces custersianus, Brettanomyces naardenensis, Brettanomyces nanus, Dekkera bruxellensis, and Dekkera anomala, one or more varieties of hops, conditioned brewing water, and one or more sugar adjuncts.

    [0079] In certain embodiments, the kit further comprises instructional materials containing instructions for performing the methods of the invention. In certain embodiments, the instructional materials provide information pertaining to brewing beer with GY7B using the items and ingredients of the kit of the invention.

    [0080] An exemplary yeast strain of the invention is the GY7B yeast strain. Under the terms of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purpose of Patent Procedure, deposit of the yeast strain was made with the American Type Culture Collection (ATCC) of Rockville, Md., USA.

    [0081] Applicant's assignee, University of the Sciences, represents that the ATCC is a depository afforded permanence of the deposit and ready accessibility thereto by the public if a patent is granted. All restrictions on the availability to the public of the material so deposited will be irrevocably removed upon granting of a patent. The material will be readily available during the pendency of the patent application to one determined by the Commissioner to be entitled thereto under 37 C.F.R. 1.14 and 35 U.S.C. 122. The deposited material will be maintained with all the care necessary to keep it viable and uncontaminated for a period of at least five years after the most recent request for the furnishing of a sample of the deposited material, and in any case, for a period of at least thirty (30) years after the date of the deposit or for the enforceable life of the patent, whichever period is longer. Applicants' assignee acknowledges its duty to replace the deposit should the depository be unable to furnish a sample when requested due to the condition of the deposit.

    [0082] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, numerous equivalents to the specific procedures, embodiments, claims, and examples described herein. Such equivalents were considered to be within the scope of this invention and covered by the claims appended hereto. For example, it should be understood, that modifications in reaction conditions, including but not limited to reaction times, reaction size/volume, and experimental reagents, with art-recognized alternatives and using no more than routine experimentation, are within the scope of the present application.

    [0083] It is to be understood that, wherever values and ranges are provided herein, the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, all values and ranges encompassed by these values and ranges are meant to be encompassed within the scope of the present invention. Moreover, all values that fall within these ranges, as well as the upper or lower limits of a range of values, are also contemplated by the present application. The description of a range should be considered to have specifically disclosed all the possible sub-ranges as well as individual numerical values within that range and, when appropriate, partial integers of the numerical values within ranges. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed sub-ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.

    [0084] The following examples further illustrate aspects of the present invention. However, they are in no way a limitation of the teachings or disclosure of the present invention as set forth herein.

    EXAMPLES

    [0085] The invention is now described with reference to the following Examples. These Examples are provided for the purpose of illustration only, and the invention is not limited to these Examples, but rather encompasses all variations that are evident as a result of the teachings provided herein.

    Materials and Methods

    Sample Collection Methods

    [0086] Samples for wild yeast isolation were collected using aseptic technique in the field. Samples were then inoculated directly in a 10% DME (BREISS) solution containing Penicillin/Streptomycin (P/S) (GIBCO). After two weeks, samples were plated on YPD containing P/S and cultured at 25 C. for 48 hours. Individual colonies were selected for further propagation on YPD P/S plates under the same culture conditions. Purity of colonies was validated by uniformity in morphology, at which point colonies were maintained on YPD plates without antibiotics. Glycerol stocks were created by picking a colony and culturing in YPD broth at 25 C., 180rpm for 48 hours. Then cultures were then incubated at 4 C. for another 48 hours. Finally, the yeast were resuspended in fresh YPD with 15% glycerol and frozen in cryovials at 80 C. All experiments were run with yeast freshly propagated from glycerol stocks.

    Test Ferment Wort Formulation

    [0087] Test fermentations were either performed in 10% DME, unhoped media, referred to as laboratory wort or in wort prepared in the University of the Sciences pilot brewery. For 10% DME laboratory wort, 100 g of DME was dissolved in 1 L of distilled water, boiled for 15 minutes, and cooled to room temperature. 10 P wort was prepared in the USciences pilot brewery using 100% 2-row pale malt (BREISS). It was milled and mashed on a SABCO BrewMagic using distilled water at 65 C. for 60 min. After vorlauf, continuous fly sparging was performed with 75 C. distilled water acidified to pH6.0 with food-grade lactic acid (SPECTRUM chemicals). The wort was boiled for 60 minutes, with a 60 minute bittering addition of 007: The Golden Hop (Yakima Valley Hops) to yield 10IBU of bitterness. Whirlfloc (LD CARLSON) was added with 15 min remaining in the boil as per the manufacturer's instructions. The yeast supplement Servomyces (WHITE LABS) was added with 10 min remaining in the boil as per the manufacturer's instructions. After the boil, the wort was brought into a whirlpool and allowed to settle for 15 min before chilling to room temperature with the SABCO Chill Wizard. All wort was bottled, autoclaved and stored at 4 C. before use.

    Yeast Culture Plates

    [0088] YPD agar (2% glucose, 2% peptone, 1% yeast extract, and 1.5% agar) was supplemented with a 1:100 dilution of P/S as needed. All reagents were from Research Products International.

    Yeast Strains

    [0089] The following strains were used for comparison to GY7B: Wyeast American Ale II, Saccharomyces cerevisiae (Wy1272); Lallemand Belle Saison, Saccharomyces cerevisiae; NRRL Y-8284/CBS 6340.sup.T, Lachancea thermotolerans

    PCR for Yeast Identification

    [0090] For yeast identification, fresh yeast cultures grown at 25-30 C. for <48 hours on YPD were used. Crude DNA extraction was performed by selecting a small yeast colony and transferring to 0.2% SDS followed by incubation at 90 C. for 4 minutes. The lysed yeast were then diluted 1:10 in nuclease-free water. This dilution was further diluted 1:40 into the PCR reaction. PCR was performed with Phusion High-fidelity PCR kit (NEW ENGLAND BIOLABS) as per the manufacturer's instructions on an EPPENDORF Mastercycler. The D1/D2 domain of the 26S rDNA region was amplified using the primers NL1 (SEQ ID NO: 1: 5-GCATATCAATAAGCGGAGGAAAAG-3) and NL4 (SEQ ID NO: 2:

    [0091] 5-GGTCCGTGTTTCAAGACGG-3). Amplification was performed for 36 cycles with denaturation at 98 C. for 10 sec, annealing at 52 C. for 20sec, and extension at 72 C. for 20 sec. The ITS region of the rDNA was amplified using primers ITS1 (SEQ ID NO: 3:

    [0092] 5-TCCGTAGGTGAACCTGCGG-3) and ITF4 (SEQ ID NO: 4:

    [0093] 5-TCCTCCGCTTATTGATATGC-3). Amplification was performed using 34 cycles with denaturation at 98 C. for 10 sec, annealing at 50 C. for 20 sec with a 0.2 C. increase each cycle, and extension at 72 C. for 20 sec. The actin1 gene was amplified using primers CA21 (SEQ ID NO: 5: 5-ATTGATAACGGTTCCGGTATGTG-3) and CA22R (SEQ ID NO: 6:

    [0094] 5-TCGTCGTATTCTTGCTTTGAGATCCAC-3). Amplification was performed using 20 cycles with denaturation at 98 C. for 10 sec, annealing at 60 C. for 30 sec with a 0.5 C. decrease each cycle, and extension at 72 C. for 30 sec followed by 15 cycles with denaturation at 98 C. for 10 sec, annealing at 50 C. for 30 sec, and extension at 72 C. for 30 sec.

    Gel Electrophoresis and Purification

    [0095] PCR reactions were resolved on a 1% agarose gel at 120 volts (BIO-RAD) and visualized with ethidium bromide under UV light. Bands were excised and purified using the GeneJet Gel Extraction kit (THERMO FISHER SCIENTIFIC) according to manufacturer's instructions.

    Sequencing Analysis Purified PCR DNA was prepared for Sanger sequencing by Genewiz according to their instructions. Each PCR product was sequenced with both the forward and the reverse primers used in the original PCR amplification. Returned sequences were validated for accuracy by aligning the forward and the reverse sequences with A Plasmid Editor (M. Wayne Davis). Any discrepancies were further resolved by visual analysis of the chromatogram. Any sequence lacking double coverage was discarded. Validated sequences were analyzed with Nucleotide BLAST (NCBI) using default parameters.

    Example 1: Methods of Collecting and Testing Wild Yeast Strains

    [0096] Referring to FIGS. 1A-1C, samples were collected from Woodlands Cemetery (4000 Woodland Ave, Philadelphia, PA 19104) from local flowering trees, as well as a local bee hive by swabbing (101) and inoculating in sterile wort (102). The samples were incubated without shaking at 25 C. for about 1 week. Sediment was gently re-suspended and plated onto YPD plates (103). Once visible colonies were present after 48-72 hr growth at 25 C., morphologically distinct colonies were sub-cultured to purity (104). The purified yeast strains were subject to PCR of the D1/D2 region to amplify the genetic material for analysis (105). The extracted DNA was separated through gel electrophoresis (106), sequenced (107), and analyzed using the Basic Local Alignment Search Tool (BLAST) to find genetic similarities (108). Table 1A lists all strains isolated and their source. Table 1B lists the similarity between the yeast isolate's D1/D2 sequence and the top BLAST hit. In addition, test ferments containing laboratory wort were inoculated with the isolated yeast and observed for a period of 7 days. Of the samples collected GY7B was the most robust fermenter as demonstrated by visible CO.sub.2 evolution in the sample tube.

    [0097] GY7B was isolated from a Cornecaea cornus (Dogwood tree) bud. BLAST analysis of the D1/D2 sequence returned a 100% match with 0 nt differences to Lachancea thermotolerans, indicating it is a wild strain related to L. thermotolerans.

    TABLE-US-00001 TABLE 1A Identification of Wild Yeast Strains by D1/D2 sequencing Sample ID Phylum Order Source GG1.1.1 Basidiomycota Filobasidiales Corvallis GG1.1.2 Ascomycota Sporidiales Corvallis GG1.1.4 Ascomycota Dothideales Corvallis GG1.1.5 Basidiomycota Tremellales Corvallis PF1.1.1 Ascomycota Dothideales Nyctaginaceae PF1.1.2 Ascomycota Dothideales Nyctaginaceae PF1.1.3 Basidiomycota Sporidiobolales Nyctaginaceae PF1.1.4 Ascomycota Sporidiales Nyctaginaceae RF1.1.1 Basidiomycota Tremellales Camellia japonica RB1.3.1 Basidiomycota Sporidiobolales Corvallis PF1.2.3 Ascomycota Dothideales Nyctaginaceae RF1.2.2 Basidiomycota Tremellales Camellia japonica PF1.2.2 Ascomycota Dothideales Nyctaginaceae PF1.2.1 Ascomycota Sporidiales Nyctaginaceae GG1.1.3 Basidiomycota Sporidiobolales Corvallis RB1.2.1 Ascomycota Saccharomycetales Corvallis GY7.1 Ascomycota Saccharomycetales Cornaceae cornus GY7.2 Ascomycota Saccharomycetales Cornaceae cornus GY4.1 Ascomycota Saccharomycetales Bee Hive GY6.1 Ascomycota Saccharomycetales Hedera GY9.1 Ascomycota Saccharomycetales Hedera

    TABLE-US-00002 TABLE 1B Identification of Wild Yeast Strains by D1/D2 sequencing Sample ID Base Pairs Top BLAST Hit % ID nt diff. GG1.1.1 546 Filobasidium 100 0 elegans GG1.1.2 480 Rhodosporidium 99 1 fluviale GG1.1.4 554 Aureobasidium 99 1 pullulans GG1.1.5 546 Cryptococcus 100 0 magnus PF1.1.1 557 Aureobasidium 99 1 pullulans PF1.1.2 684 Aureobasidium 100 0 pullulans PF1.1.3 517 Sporidiobulus 100 0 ruineniae PF1.1.4 517 Rhodosporidium 100 0 babjevae RF1.1.1 530 Cryptococcus sp. 100 0 RB1.3.1 534 Rhodotorula sp. 100 0 PF1.2.3 511 Aureobasidium 100 0 pullulans RF1.2.2 529 Cryptococcus sp. 100 0 PF1.2.2 499 Aureobasidium 100 0 pullulans PF1.2.1 512 Rhodosporidium 100 0 babjevae GG1.1.3 526 Rhodotorula 100 0 hinnulea RB1.2.1 555 Candida 100 0 parapsilosis GY7.1 528 Hanseniaspora 99 2 uvarum GY7B 540 Lachancea 100 0 thermotolerans GY4.1 553 Pichia kudriavzevii 100 0 GY6.1 553 Pichia kudriavzevii 100 0 GY9.1 553 Pichia kudriavzevii 100 0

    Example 2: Fermentation Trials Using GY7B

    [0098] Once identified, isolated GY7B was tested for wort fermentation under controlled conditions. Laboratory wort was inoculated with 110.sup.6 yeast cells/ml/ P of Saccharomyces cerevisiae (strain Belle Saison from Lallemand), GY7B, or both strains each at 110.sup.6 yeast cells/ml/ P. The ferments were incubated at 20 C. for 5 days. The pH and apparent extract of the ferments were tracked daily using a pH meter and a densitometer, respectively. GY7B reduced the pH of the wort to about 3.5 after 5 days, while both the S. cerevisiae and mixed strain samples reduced the pH of the wort to only about 4.25 after 5 days (FIG. 2A).

    [0099] GY7B was found to be a slower fermenting yeast than S. cerevisiae, as both the S. cerevisiae and mixed strain samples demonstrated a faster decrease in P over 5 days than the GY7B sample (FIG. 2B). Without being limited to any particular theory, it is suspected that the lack of acidification observed in co-fermentation between GY7B and Saccharomyces cerevisiae is due to the faster fermentation abilities of S. cerevisiae which outcompetes GY7B's ability to create lactic acid. Optimization of cell inoculation rates during co-fermentation allows the timely production of sour beer via GY7B with the benefits of fermentation with a traditional ale strain.

    [0100] To further examine the fast acidifying properties of GY7B as compared to fermentation by brewer's yeast the fermentation of GY7B was compared to the L. thermotolarans type strain, NRRL Y-8284, and a traditional Saccharomyces cerevisiae ale strain, American Ale II, Wyeast 1272. Brewer's wort with an original gravity of 1.040 and a pH 5.25 was created at the University of the Sciences pilot brewery. Triplicate fermentations of 400 mL in Erlenmeyer flasks sealed with a fermentation airlock were inoculated with 110.sup.6 yeast cells/mL/ P. Apparent extract and pH were measured daily at the same time with the averages reported in FIG. 2C. The standard deviation is reported as error bars. As expected, S. cerevisiae rapidly ferments the wort to a final gravity of 1.003 in 4 days. The apparent extract of the wort fermented by L. thermotolerans is only 1.027 after 9 days of fermentation. GY7B ferments slowly but gradually reaching 1.011 apparent attenuation after 9 days. Fermentation was not yet complete after 9 days in this trial as final gravity with GY7B in other fermentations was observed to be about 1.001. Most importantly, the pH of these pilot fermentations indicated the rapid acidifying power of GY7B as the pH reached 3.5 after only 4 days. The pH of the S. cerevisiae beer reached 4.1 after 9 days of fermentation and L. thermotolerans only reached 4.4.

    [0101] These data demonstrate that that GY7B and the L. thermotolerans type strain NRRL Y-8284 are phenotypically distinct and that GY7B is capable of rapid sour fermentation of beer.

    Example 3: Morphological Comparison of Lachancea thermotolerans and GY7B

    [0102] To further illustrate the phenotypic differences between GY7B and L. thermotolerans cellular morphology was compared. Cultures of GY7B (FIG. 3A) or L. thermotolerans (FIG. 3B) were grown in yeast extract peptone dextrose (YPD) agar for 72 hours at 25 C. and visualized under differential interference microscopy. Utilizing the software ImageJ (NIH) to measure cell size, the length average of GY7b is 4.60.607 m and Y8284 is 6.90.934 m.

    Example 4: pH and Ethanol Tolerance of GY7B

    [0103] The pH and ethanol tolerance of GY7B and L. thermotolerans were evaluated by measuring growth at variable pH (FIG. 4A-5B) or ethanol percentages (v/v) (FIG. 5A-5B). Freshly cultured yeast were propagated in 5 mL of YPD, shaken at 180 rpm at 30 overnight. A spectrophotometer was used to measure the OD.sub.600 and the culture was diluted with fresh YPD to reach an OD.sub.600 of 0.1. For ethanol tolerance, each sample was spiked with 100% Ethanol to reach a final concentration of 0%, 4%, 6%, 8%, or 10% (v/v). For pH the YPD was acidified with Hydrochloric acid to cover a pH range from 3-7 which was then used to re-suspend yeast after centrifugation. 200 L of OD.sub.600=0.1 culture was placed in a well of a clear, round-bottom 96-well plate (Corning). A TECAN fluorimeter was used to read the OD.sub.600 every 5 minutes. Throughout the experiment the fluorimeter was held at 30 with 4 minutes of orbital shaking at 120 rpm and 1 minute of linear shaking at 270 rpm in between each read. All samples were done in triplicate with the average values reported. The standard deviation is displayed as error bars. GY7B is more acid tolerant and ethanol tolerant than L. thermotolerans. Both GY7B and L. thermotolerans can proliferate in up to 10% ethanol (v/v).

    Example 5: Genetic Sequencing of GY7B and Comparison to Lachancea thermotolerans

    [0104] To further examine genotypic differences between L. thermotolerans and GY7B, the sequences of the ITS region of the rDNA and the actin1 gene from GY7B were examined. Primers specific for each region were used in a PCR reaction. The sequences were resolved via gel electrophoresis. Amplicons were then excised, purified, and sent for sequencing. The resultant sequences were validated and analyzed with BLAST. L thermotolerans NRRL Y8284 and GY7B differ by 2 nt in the ITS region and 7 nt in the actin1 gene. The consensus sequences are listed below. Coupled with the extensive phenotypic differences between GY7B and the L. thermotolerans type strain, this evidence strongly suggests that GY7B is a novel species of the Lachancea genus.

    TABLE-US-00003 TABLE 2 Nucleotide differences between L. thermotolerans NRRL Y8284 and GY7B NCBI reference nt differences with Genetic Region sequence GY7B query D1/D2 XR_002432227.1 0 ITS KY104005.1 2 actin1 XM_002555799.1 7

    TABLE-US-00004 >GY7BD1D2:SEQIDNO.7: ACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGT GTCCGAGTTGTAATTTGAAGAAGCTACTTTGGGGCTAGTCCTTGTCTATG TTCCTTGGAACAGGACGTCATGGAGGGTGAGAATCCCGTATGGCGAGGAG TCTAGTCCTATGTAAAGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCA GCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGAC CGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGA GAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGAC ATGGTGTTTTGCGACCCTCGCTCCTTGTGGGTGGGGATCTCGCAGCTCAC TGGGCCAACATCAGTTTTGGCGGTAGGATAAATCTTTGGGAACGTGGCTT GTCTTCGGAGAAGCGTTATAGCCCAGGGGAATACTGCCAGCCGGGACTGA GGACTGCGACTTT >GY7BITS:SEQIDNO.8: GTTAGAGCAGCCGGGAAGTTCAGGAGCCTGCGCTTGATTGCGCGGCCGAT GATGCTTTCTGTTAACGACTGTCTCTCTACACACACACTGTGGAGTAATT TATTTTACAACGCTTCTTCTTTGGGCTTTACGGCCCAAGGGTTACAAACA CAAACAACTATTGTATTTTAAACATTGTCAATTATTTTTCATTTTAGAAA AAAAATATTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATG AAGAACGCAGCGAAATGCGATAAGTATTGTGAATTGCAGATATTCGTGAA TCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGGGGGCAT GCCTGTTTGAGCGTCATTTCCTTCTCAAACCCTCGGGTTTGGTAGTGAGT GGTACTCTTTCTGGGTTAACTTGAAAATGCTGGCCATCTGGCTGTTGCTG ACTGAGGTTTTAGTCCAGTCCGCTGATACTCTGCGTATTAGGTTTTACCA ACTCGTAGTGGCGTTAGTAGGCGTTTTAAAGGCTTTTACTGAAAGTACAG ACAGTCTGGCAAACAGTATTCATAAAGTTT >GY7Bactin1:SEQIDNO.9: GCTCAGTCCAAGAGAGGTATCTTGACCCTGCGTTACCCTATCGAGCACGG TATCGTCACCAACTGGGACGACATGGAGAAGATCTGGCATCACACCTTCT ACAACGAGCTGAGAGTGGCCCCAGAGGAGCACCCAGTCTTGTTGACCGAG GCCCCAATGAACCCTAAGTCCAACAGAGAGAAGATGACTCAGATCCTGTT CGAGACCTTCAACGTTCCAGCCTTCTACGTCTCCATCCAGGCCGTCTTAT CCCTGTACTCCTCTGGTAGAACCACCGGTATCGTCTTGGACTCCGGTGAC GGTGTTACTCACGTTGTGCCAATCTACGCCGGTTTCTCCTTGCCTCACGG TATCTTGAGAATCGACTTGGCTGGTAGAGACATGACCGACTACTTGATGA AGATCTTGAGTGAGCGTGGCTACTCTTTCTCCACAACCGCCGAGAGAGAA ATCGTGCGTGACATCAAGGAGAAGTTGTGTTACGTCGCCTTGGACTTCGA GCAAGAGATGCAGACCGCTGCCCAGTCCTCTGCCATTGAGAAGTCTTACG AGTTGCCTGACGGCCAAGTCATCACCATCGGTAACGAGAGATTCAGAGCC CCAGAGGCCCTGTTCCACCCAAGTCTGCTGGGTCTGGAAGCTGCTGGTAT CGACCAGACTGCTTACAACTCTATCATGAAGTGTGACGTCGACGTCCGTA AGGAGTTGTACGGTAATATCGTCATGTCTGGTGGTACCACCATGTTCCCA GGTATTGCCGAGAGAATGCAGAAGGAAATCACTGCTTTGGCTCCATCCTC CATGAAGGTGAAGATCATTGCCCCACCAGAGAGAAAGTACTCTGTCTGGA TCGGTGGTTCTA

    Example 6: Sugar Assimilation Assay

    [0105] Comparison of sugar assimilation between L. thermotolerans NRRL Y8284 and GY7B was performed using YT Microplates (BIOLOG). Freshly propagated yeast colonies on YPD agar were selected 48-72 hours after growth at 25-30 C. A single colony was inoculated into 15 mL of sterile water and was adjusted as needed to yield a % transmittance of 47% 2% as determined by spectrophotometer. 100 L was then placed in each of the 96 wells of the YT Microplate. The plate was incubated at 27 C. in a humidified chamber for about 3 days and the results were interpreted by visual inspection. To validate the results, each experiment was repeated twice by two independent analysts. Shown in Table 3 are the consensus results. An empty lane indicates no growth, a single (+) indicates weak growth, and a triple (+++) indicates strong growth. Table 3 is arranged according to the design of the YT Microplate. The first three rows, shown in bold, are oxidation tests that utilize a patented color change in response to yeast cell metabolism. The remaining wells are growth assimilation tests in which turbidity of the well is recorded. Table 3 demonstrates the metabolic and assimilation differences between GY7B and L. thermotolerans.

    TABLE-US-00005 TABLE 3 succinic acid mono- formic propionic succinic methyl l-aspartic l-glutamic d-gluconic water acetic acid acid acid acid ester acid acid l-proline acid dextrin inulin GY7B + ++ + + ++ + + ++ + ++ L. thermotolerans d-cellobiose gentiobiose maltose maltotriose d-melezitose d-melibiose palantinose d-raffinose stachyose sucrose d-trehalose turanose GY7B + + +++ + + +++ + + +++ +++ +++ L. thermotolerans + + + + + + + n-acetyl-d- glucosamine -d-glucose d-galactose d-psicose l-sorbose salicin d-mannitol d-sorbitol d-arabitol xylitol glycerol tween 80 GY7B +++ + + + + + + + L. thermotolerans + succinic acid l-malic mono-methyl bromo-succinic l-glutamic -amino-butyric -keto-glutaric 2-keto-d-gluconic d-gluconic water fumaric acid acid ester acid acid acid acid acid acid dextrin inulin GY7B ++ ++ + + + + ++ + + ++ ++ L. thermotolerans + + + + ++ ++ ++ ++ d-cellobiose gentiobiose maltose maltitriose d-melezitose d-melibiose palantinose d-raffinose stachyose sucrose d-trehalose turanose GY7B + + ++ ++ ++ ++ ++ ++ ++ + ++ ++ L. thermotolerans + + + + + + ++ + + + + + n-acetyl-d- -methyl- -methyl- glucosamine d-glucosamine -d-glucose d-galactose d-psicose l-rhamnose l-sorbose d-glucoside d-glucoside amygdalin arbutin salicin GY7B + + ++ ++ + +++ + ++ + ++ + L. thermotolerans + + + + + + + + + + maltitol d-mannitol d-sorbitol adonitol d-arabitol xylitol i-erythritol glycerol tween 80 l-arabinose d-arabinose d-ribose GY7B ++ ++ ++ ++ ++ + + + + ++ ++ +++ L. thermotolerans + ++ + + ++ ++ + + ++ ++ +++ succinic acid n-acetyl- mono-methyl l-glutamic d-glucuronic ester plus acid plus quinic acid acid plus dextrin -d lactose d-melibiose d-galatose m-inositol 1,2-proanediol acetoin d-xylose d-xylose d-xylose plus d-xylose d-xylose plus d-xylose plus-xylose plus d-xylose plus d-xylose plus d-xylose plus d-xylose plus d-xylose GY7B ++ +++ ++ ++ ++ ++ + + + + ++ L. thermotolerans ++ +++ + + + ++ + + + + + +

    Example 7: Flocculation

    [0106] To compare the flocculation ability of GY7B and L. thermotolerans a freshly grown colony on YPD agar was selected for propagation in 5 mL of laboratory wort. Each was cultured at 25 with no shaking for 7 days. Both tubes were then swirled simultaneously and consistently by hand to evaluate the impact on resuspension of the yeast pellet. L. thermotolerans exhibits low flocculation as demonstrated by its dispersed pellet and cloudy beer. GY7B is highly flocculant as demonstrated by its remaining pellet and clear beer (FIG. 6). The high flocculation ability of GY7B will greatly assist yeast removal after fermentation of beer, enabling more effective centrifugation, filtration, pasteurization or any other stabilizing/clarifying processes post-fermentation.

    [0107] The disclosures of each and every patent, patent application, and publication cited herein are hereby incorporated herein by reference in their entirety. While this invention has been disclosed with reference to specific embodiments, it is apparent that other embodiments and variations of this invention may be devised by others skilled in the art without departing from the true spirit and scope of the invention. The appended claims are intended to be construed to include all such embodiments and equivalent variations.