Method for precisely preparing circular RNA with anabaena intron self-cleaving ribozyme
12203120 ยท 2025-01-21
Assignee
Inventors
- Ming Liu (Guangzhou, CN)
- Maolei ZHANG (Guangzhou, CN)
- Yesheng WANG (Guangzhou, CN)
- Qiujie CAI (Guangzhou, CN)
- Wanjun ZHANG (Guangzhou, CN)
- Xiaodan MA (Guangzhou, CN)
Cpc classification
C12N15/111
CHEMISTRY; METALLURGY
C12N15/64
CHEMISTRY; METALLURGY
C12N15/72
CHEMISTRY; METALLURGY
International classification
C12N15/11
CHEMISTRY; METALLURGY
C12N15/64
CHEMISTRY; METALLURGY
C12N15/72
CHEMISTRY; METALLURGY
Abstract
The present invention relates to the technical field of nucleic acids, and in particular, to a method for precisely preparing a circular RNA with an Anabaena intron self-cleaving ribozyme. By redesigning a target nucleic acid sequence of a linear RNA, selecting a site suitable for precise cleavage by the intron self-cleaving ribozyme, and removing exon sequences from the Anabaena intron self-cleaving ribozyme, precise cyclization of RNAs after in vitro transcription is achieved. The method provided by the present invention solves the problem in the prior art that linear RNAs cannot be precisely cyclized during the process of generating circular RNAs in vitro, and provides an ideal in vitro preparation method for circular RNA applications.
Claims
1. A method for precisely preparing a circular RNA with an Anabaena variabillis intron self-cleaving ribozyme, comprising: S1: analyzing a secondary structure of the Anabaena variabillis intron self-cleaving ribozyme, and screening out sequences in upstream and downstream exons that are closely related to the activity of the self-cleaving ribozyme; S2: selecting an artificial sequence containing the sequences screened out in the step S1, inverting original upstream and downstream intron sequences of the Anabaena variabillis, and then replacing an original exon sequence in the Anabaena variabillis intron self-cleaving ribozyme with the artificial sequence to form an Anabaena variabillis intron self-cleaving frame for preparing the circular RNA; S3: adding an 18-base reverse complementary sequence to each of the upstream and downstream of the Anabaena variabillis intron self-cleaving frame sequence obtained in the step S2, and then adding a T7 transcription promoter to both sides of the sequence and a restriction endonuclease cleavage site to both ends of the sequence to form a total linear RNA sequence, and finally introducing the total linear RNA sequence into a pUC19 skeleton vector to prepare a plasmid; S4: digesting the plasmid obtained in the step S3 with an endonuclease EcoRI to obtain a linearized plasmid, performing purification, obtaining a transcribed linear RNA through in vitro transcription and DNA template digestion, and performing purification again to obtain a purified transcribed linear RNA; and S5: cyclizing the purified transcribed linear RNA obtained in the step S4 in vitro and performing purification to obtain a purified cyclized RNA, and further performing tolerance testing and circular RNA cyclization interface verification to obtain the circular RNA, wherein the artificial sequence described in the step S2 is shown as SEQ ID NO. 2; the sequence of the prepared Anabaena variabillis intron self-cleaving frame is shown as SEQ ID NO. 3; the upstream 18-base sequence described in the step S3 is shown as SEQ ID NO. 4, and the downstream 18-base sequence is shown as SEQ ID NO. 5; the sequence of the T7 transcription promoter is shown as SEQ ID NO. 6; and the total linear RNA sequence is shown as SEQ ID NO. 7.
2. The method according to claim 1, wherein the Anabaena variabillis intron self-cleaving ribozyme in the step S1 is shown in SEQ ID NO. 1.
3. The method according to claim 1, wherein the upstream and downstream restriction endonuclease cleavage sites in the step S3 are a BamHI restriction endonuclease cleavage site and an EcoRI restriction endonuclease cleavage site, respectively.
4. The method according to claim 1, wherein the linearized plasmid in the step S4 is obtained as follows: construct a digestion system of 200 L containing 20 g of plasmids, 20 L of 10Buffer, 10 L of the endonuclease EcoRI, and DEPC-H.sub.2O complementing to 200 L, and then allow the digestion system to react at 37 C. for 2 h, and finally store the obtained linearized plasmid at 4 C.
5. The method according to claim 1, wherein the in vitro cyclization of the linear RNA in the step S5 is achieved as follows: construct a cyclization system of 400 L containing GTPs with a final concentration of 0.2 mM, linear RNAs with a final concentration of 28 g/L, 40 L of 10buffer, and DEPC-H.sub.2O; mix the cyclization system uniformly and allow it to react at 42 C. or 55 C. for 6 h; finally store the obtained circular RNA at 4 C.
6. A circular RNA obtained by the method according to claim 1.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
DETAILED DESCRIPTION OF THE EMBODIMENTS
(8) The present invention is further explained below with reference to embodiments, but it should be noted that the following embodiments are only used to explain the present invention rather than to limit the present invention, and all technical solutions identical or similar to the present invention fall within the protection scope of the present invention. Where no specific techniques or conditions are noted in the embodiments, operations are performed according to conventional technical methods and content of instrument specifications in the art; and where no manufacturers are noted for reagents or instruments used herein, they are all conventional commercially available products.
Embodiment: A Method for Precisely Preparing a Circular RNA with an Anabaena Intron Self-Cleaving Ribozyme
(9) S1: a secondary structure of the Anabaena intron self-cleaving ribozyme was analyzed using nucleic acid secondary structure analysis software RNAfold, and sequences in upstream and downstream exons that are closely related to the activity of the self-cleaving ribozyme were screened out;
(10) The Anabaena intron self-cleaving ribozyme has a sequence with the GenBank accession number of AY768517 and shown as SEQ ID NO. 1; the total length of the sequence is 313 bases; the bases 1-26 constitute an upstream exon sequence, the bases 27-142 constitute an upstream intron sequence, the bases 143-144 constitute an spacer sequence, the bases 145-275 constitute a downstream intron sequence, and the bases 276-313 constitute a downstream exon sequence; the structure of the Anabaena intron self-cleaving ribozyme was analyzed as follows with nucleic acid secondary structure analysis software RNAfold (
(11) S2: an artificial sequence containing the sequences screened out in the step S1 was selected, original upstream and downstream intron sequences of the Anabaena were inverted, and then an original exon sequence in the Anabaena intron self-cleaving ribozyme was replaced with the artificial sequence to form an Anabaena intron self-cleaving frame for precisely preparing the circular RNA:
(12) An artificial sequence-246 nt (SEQ ID NO.2) was selected as a case to test the cyclization effect of the Anabaena intron self-cleaving ribozyme on the target molecule. Based on the analysis of the secondary structure of the Anabaena intron self-cleaving ribozyme, the principle proposed by the present invention is that the first start base of the target molecule used for cyclization is A and the last three bases are CUU as a preferred base sequence.
(13) The original upstream and downstream intron sequences of the Anabaena were inverted, and then an original exon sequence in the Anabaena intron self-cleaving ribozyme was replaced with the artificial sequence-246 nt to form an Anabaena intron self-cleaving frame (SEQ ID NO. 3) for precisely preparing the circular RNA, which is designated sequence-3 as follows: in the sequence-3, the bases 1-131 constitute the downstream intron of the original sequence of the Anabaena, the bases 132-377 constitute the artificially inserted test sequence (artificial sequence-246 nt), and the bases 388-493 constitute the upstream intron sequence of the original sequence of the Anabaena.
(14) S3: adding an 18-base reverse complementary sequence to each of the upstream and downstream of the Anabaena intron self-cleaving frame sequence obtained in the step S2, and then adding a T7 transcription promoter to both sides of the sequence and a restriction endonuclease cleavage site to both ends of the sequence to form a total linear RNA sequence, and finally introducing the total linear RNA sequence into a pUC19 skeleton vector to prepare a plasmid;
(15) Based on the sequence-3, to make the upstream and downstream introns of the Anabaena closer to each other, an 18-base reverse complementary sequence (SEQ ID NO. 4-5) was added to each of the upstream and downstream, and then a T7 transcription promoter (SEQ ID NO. 6) was added to both sides of the sequence and a restriction endonuclease cleavage site (BamHI and EcoRI) were added to both ends of the sequence to form a plasmid template sequence transcribed by the artificial sequence-246 nt in vitro, which was designated sequence-4 (SEQ ID NO. 7) and obtained by the method of whole gene chemosynthesis entrusted to be carried out by GUANGZHOU IGE BIOTECHNOLOGY LTD., and then the fragment was introduced into a pUC19 skeleton vector through the two endonuclease cleavage sites BamHI and EcoRI.
(16) In the sequence-4, the bases 1-6 constitute the BamHI endonuclease cleavage site, the bases 7-26 constitute the T7 promoter sequence, the bases 27-44 constitute a paired sequence of the upstream 18 bases, the bases 45-175 constitute the downstream intron sequence of the Anabaena, the bases 176-421 constitutes the fragment of the artificially inserted sequence-246 nt, the bases 422-537 constitutes the downstream intron sequence of the Anabaena, the bases 538-555 constitutes a paired sequence of the downstream 18 bases, and the bases 556-561 constitutes the EcoRI endonuclease cleavage site sequence.
(17) S4: the plasmid obtained in the step S3 was digested with an endonuclease EcoRI to obtain a linearized plasmid, purification was performed, a transcribed linear RNA was obtained through in vitro transcription and DNA template digestion, and purification was performed again to obtain a purified transcribed linear RNA;
(18) As shown in Table 1 below, the plasmid was digested with the endonuclease EcoRI to obtain the linearized plasmid:
(19) TABLE-US-00004 TABLE 1 Linearized Plasmid Preparation System Component Usage amount Plasmid 20 g 10 Buffer 20 L Endonuclease EcoRI 10 L DEPC-H.sub.2O Up to 200 L
(20) The components were slightly blown, sucked, and mixed with a pipette to allow a reaction at 37 C. for 2 h and hold at 4 C.
(21) The product obtained after the digestion was purified by a phenol/chloroform method as follows: (1) 200 L of phenol/chloroform mixed solution (1:1) at pH 7-8 was added into 200 L of the sample for extraction, a mixture thereof was centrifuged at 13,000 g for 5 min, and the upper-layer solution (aqueous phase) was transferred to a new RNase-free EP tube; (2) chloroform with the same volume as the aqueous phase was added into the new RNase-free EP tube, extraction was performed twice, and the upper-layer aqueous phase was collected; (3) anhydrous ethanol with a volume two times that of the upper-layer aqueous phase was added into the collected upper-layer aqueous phase for uniform mixing, incubation was performed at 20 C. for more than 30 min, centrifugation was performed at 13,000 g, 4 C. for 10 min, the supernatant was discarded, and the precipitate was retained; (4) 500 L of 70% ethanol prepared with pre-cooled DEPC-H2O was added to the precipitate for uniform vortex mixing, centrifugation was performed at 13,000 g, 4 C. for 10 min, and the supernatant was discarded; (5) the cover was opened for drying for 2 min, and 30 L of DEPC-H2O was added for dissolution; and (6) the concentration and mass of the linearized plasmid were measured using NanoDrop, and the product was stored at 80 C.
(22) In vitro transcription process: the reaction system for in vitro transcription was prepared according to Table 2
(23) TABLE-US-00005 TABLE 2 Reaction System of In Vitro Transcription Component Usage amount 10 Reaction buffer 2 L 25 mM NTP 8 L 500 mM GMP 2 L RNA inhibitor (40 U/L) 1 L Pyrophosphatase, Inorganic(0.1 U/L) 0.4 L T7 RNA polymerase 2 L DN A template 1 L DEPC-H.sub.2O Up to 20 L
(24) The components were slightly blown, sucked, and mixed with a pipette to allow a reaction at 37 C. for 2 h and hold at 4 C.
(25) DNA Template Digestion
(26) After the transcription was completed, 2 L of RNase-free DNase was added to 20 L of the product and a mixture thereof was gently and uniformly mixed with a pipette to allow a reaction at 37 C. for 15 min.
(27) Then the transcribed linear RNA was purified again by the lithium chloride precipitation method as follows: (1) 30 L of RNase-free H2O and 25 L of LiCl (8M, RNase-free) were added to 20 L of the reaction mixture; (2) after uniform mixing, the mixture was placed at 20 C. for at least 30 min, centrifugation was performed at 13,000 g, 4 C. for 15 min, and the precipitate was collected; (3) 500 L of 70% ethanol pre-cooled with ice was added to wash the RNA precipitate; and (4) the RNA precipitate was dissolved with 20 L of RNase-free H2O, and the purified RNA solution was stored at 80 C.
(28) S5: the purified transcribed linear RNA obtained in the step S4 was cyclized in vitro and purification was performed to obtain a purified cyclized RNA, and then tolerance testing and circular RNA cyclization interface verification were further performed to obtain the circular RNA. The RNA cyclization reaction system was prepared according to Table 3.
(29) TABLE-US-00006 TABLE 3 Preparation of Linear RNA (that is, linear precursor RNA) Cyclization System Component Usage amount GTP Final concentration 0.2 mM Final concentration of linear 1, 2, 4, 8 g/L precursor RNA 10 Buffer 40 L DEPC-H.sub.2O Total system 400 L
(30) The above reaction solution was mixed uniformly to allow a reaction at 70 C. for 3 min first and then at 37 C., 42 C., and 55 C. respectively for 6 h, and finally stored at 4 C.
(31) The artificially designed target molecule was subjected to an in vitro cyclization reaction with the above reaction system and conditions through the Anabaena intron self-cleaving ribozyme, 0.5 L of the reaction product was taken, and the cyclization effect was detected through 2% agarose gel electrophoresis.
(32) In
(33) In
(34) Purification of circular RNA: the cyclized product was subjected to gel cutting and purification through agarose gel cutting for recovery with an agarose gel RNA recovery kit (ZYMO) according to the specification of the kit.
Test Example 1 Tolerance Testing of RNase R
(35) The configuration of the RNase R digestion reaction system is shown in Table 4:
(36) TABLE-US-00007 TABLE 4 RNase R Digestion Reaction System Component Usage amount 10 Buffer 2 L RNA 1 g RNase R 1 L DEPC-H.sub.2O Up to 20 L
(37) Here, the RNAs were circular RNAs and linear precursor RNAs respectively, which were digested with RNase R enzyme at 37 C. for 15 min and then subjected to 2% agarose gel electrophoresis. The detection result is shown in
Test Example 2 Circular RNA Cyclization Interface Verification
(38) The circular RNA obtained by purification was reversely transcribed into cDNA through a random primer, and PCR primers were designed to detect whether the cyclized product is correct. The PCR primers for identifying whether the cyclized product is correct are as follows: 246 nt-F:5 CTCCTTTTACCCCTACCATG3 (SEQ ID NO.8) and 246 nt-R:5GATATAGGGTCGAAGCCG3 (SEQ ID NO.9). The interface sequence (SEQ ID NO.11) of the cyclized RNA was amplified through PCR. The PCR amplification system is shown in Table 5. The PCR reaction process is as follows: initial denaturation at 95 C. for 5 min first, and then at 95 C. for 30 s, at 58 C. for 30 s, and at 72 C. for 30 sin order, 35 cycles in total, and storage at 4 C. Then, the PCR amplification product was sequenced by a sanger method. The sequencing peak map is shown in
(39) TABLE-US-00008 TABLE 5 PCR Amplification Reaction System Component Usage amount 2 Taq Master Mix 25 L 246nt-F (10 M) 2 L 246nt-R (10 M) 2 L cDNA 1 L DEPC-H.sub.2O Up to 50 L
(40) Finally, it should be noted that the above embodiments are only intended to exemplarily illustrate the principle, performance, and effect of the present invention but not intended to limit the present invention. Any person of ordinary skill in the art can modify or change the above embodiments without departing from the spirit and scope of the present invention. Therefore, all equivalent modifications or changes made by those of ordinary skill in the art without departing from the spirit and technical ideal disclosed by the present invention should still fall within the claims of the present invention.