Engineered strain for producing allulose and derivatives thereof, method for construction therefor and use thereof
12203105 ยท 2025-01-21
Assignee
Inventors
- Yuanxia SUN (Tianjin, CN)
- Jiangang YANG (Tianjin, CN)
- Yunjie Li (Tianjin, CN)
- Yueming ZHU (Tianjin, CN)
- Chun YOU (Tianjin, CN)
- Yanhe MA (Tianjin, CN)
Cpc classification
C12N9/1205
CHEMISTRY; METALLURGY
C12P19/24
CHEMISTRY; METALLURGY
C12N9/92
CHEMISTRY; METALLURGY
C12N9/12
CHEMISTRY; METALLURGY
International classification
C12N9/12
CHEMISTRY; METALLURGY
C12N9/92
CHEMISTRY; METALLURGY
Abstract
Recombinant strains are obtained for the production of allulose, allose, and allitol by regulating intracellular glucose metabolism, reducing the enzyme activity of fructose 6-phosphate kinase, and enhancing the enzyme activities of glucokinase and glucose-6-phosphate isomerase, allulose 6-phosphate 3-epimerase, allulose 6-phosphate phosphatase, fructose permease and fructokinase, and optionally enhancing the enzyme activities of ribose 5-phosphate isomerase, allose 6-phosphate phosphatase, ribitol dehydrogenase, glycerol permease, glycerol dehydrogenase, and dihydroxyacetone kinase. A method for producing allulose and allose is an extracellular multienzyme cascade method. Multienzyme cascade catalysis and fermentation are coupled to improve the conversion rate of starch sugar or sucrose to the synthesized allulose.
Claims
1. A method for construction of engineered strains for producing allose, comprising: enhancing enzyme activities of allulose 6-phosphate 3-epimerase, ribose-5-phosphate isomerase, and allulose 6-phosphate phosphatase in a host cell by introducing genes of allulose 6-phosphate 3-epimerase, ribose-5-phosphate isomerase, and allulose 6-phosphate phosphatase into the host cell; and reducing enzyme activity of fructose 6-phosphate kinase in the host cell by using molecular genetic manipulation, wherein said molecular genetic manipulation is gene knockout or introducing a weak promoter into the host cell.
2. The method of claim 1, wherein said engineered strains are obtained by genetic modification of the host cell of bacteria selected from Corynebacterium glutamate, Escherichia coli, Bacillus subtilis, lactic acid bacteria, and Saccharomyces cerevisiae.
3. The method of claim 1, further comprising enhancing enzyme activities of glucokinase and glucose 6-phosphate isomerase in the host cell by increasing expression strength of the glucokinase and glucose-6-phosphate isomerase genes by introducing into the host cell a strong promoter or using an expression plasmid, or integrating the glucokinase and glucose-6-phosphate isomerase genes with higher enzyme activities from other species by using chromosomal integration.
4. The method of claim 1, further comprising enhancing enzyme activities of fructose permease and fructokinase in the host cell by increasing expression level of fructose permease and fructokinase genes in the host cell by using a strong promoter, chromosomal integration, or an expression plasmid.
5. The method of claim 1, further comprising enhancing enzyme activities of glycerol permease, glycerol dehydrogenase and dihydroxyacetone kinase in the host cell by increasing expression level of glycerol permease, glycerol dehydrogenase, and dihydroxyacetone kinase genes in the host cell by using a strong promoter, chromosomal integration, or an expression plasmid.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
EXAMPLES
(6) The present disclosure will be further illustrated in detail below in combination with the examples.
(7) The percentage concentrations mentioned in the present disclosure and examples, unless otherwise specified, are the weight/weight percentage concentrations (W/W, in g/100 g), the weight/volume percentage concentrations (W/V, in g/100 mL), or the volume/volume percentage concentrations (V/V, in mL/100 mL).
(8) The methods used in the following examples are all conventional methods unless otherwise specified. Specific steps can be seen in Molecular Cloning: A Laboratory Manual (Sambrook, J., Russell, David W., Molecular Cloning: A Laboratory Manual, 3rd edition, 2001, NY, Cold Spring Harbor).
(9) Materials or reagents with the same names used in the examples are the same unless otherwise specified. The vectors pEC-XK99E (Kirchner O and Tauch A. 2003, Tools for genetic engineering in the amino acid-producing bacterium Corynebacterium glutamicum. J. Biotechnol. 104:287-299), pXMJ19 (Jakoby, M.; Ngouoto-Nkili, C.-E.; Burkovski, A. Construction and application of new Corynebacterium glutamicum vectors. Biotechnol. Tech. 1999, 13, 437-441), pK18mobsacB (Schfer A, Tauch A, Jager W, Kalinowski J, Thierbach G, Puhler A. 1994. SmAllulose mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene 145:69-73) used are those reported and published. Glucose, fructose, sucrose, brain heart infusion powder, sorbitol, yeast extract, peptone, maltodextrin, kanamycin, chloramphenicol and other drugs used are all purchased from Aladdin Reagent Co. Ltd. The primers used are synthesized by Jiangsu Jinweizhi Biotechnology Co., Ltd. Allulose, allose and allitol standards used are purchased from Sigma-Aldrich Co., Ltd. (China).
(10) Accesses to obtain various biomaterials described in the examples are only for providing experiment materials acquisition, in order to satisfy specific disclosure, but should not be a limitation on the sources of the biomaterials when implementing the present disclosure. In fact, the sources of the used biomaterials are extensive, and any biomaterial that can be obtained without violating laws and moral ethics can be replaced based on indications in the examples.
(11) The examples are implemented based on the technical solutions of the present disclosure, and the detailed embodiments and specific operation processes are given. The examples will aid in understanding the present disclosure, but the protection scope of the present disclosure is not limited to the following examples. It should be understood by those skilled in the art that modifications or substitutions in details and forms of the technical solutions of the present disclosure may be made without departing from the spirit and scope of the present disclosure, but these modifications or substitutions all fall within the protection scope of the present disclosure.
Example 1 Construction of Recombinant Corynebacterium glutamicum Strain Allulose1
(12) 1. Construction of Recombinant Expression Vector pEC-P6PE-P6PP
(13) The allulose 6-phosphate 3-epimerase (P6PE) gene (SEQ ID No: 1) and the allulose 6-phosphate phosphatase (P6PP) gene (SEQ ID No: 2) derived from Escherichia coli according to the KEGG database were used to design Primer1, Primer2, Primer3 and Primer4. The corresponding sequences were obtained by PCR amplification. The gene P6PE and the expression vector pEC-XK99E (Kirchner O and Tauch A. 2003, tools for genetic engineering in the amino acid producing bacterium Corynebacterium glutamicum. J. biotechnology. 104:287-299) were digested with the restriction enzymes EcoRI and SmaI at the same time, and ligated together to obtain the recombinant plasmid pEC-P6PE. The gene P6PP and the expression vector pEC-P6PE were further digested with the restriction enzymes XbaI and PstI, and ligated together to obtain the recombinant expression vector pEC-P6PE-P6PP. The primer sequences are as follows:
(14) TABLE-US-00001 Primer1SEQIDNO:15: taccggaattcatgaaaatctccccctcgttaatg Primer2SEQIDNO:16: gatcccccgggttatgctgtttttgcatgaggct Primer3SEQIDNO:17: gatggtctagaaaaggaggacaaccatgtcaaccccgcgtcagattct Primer4SEQIDNO:18: gacaactgcagttaaccgagaaggtcttttgcggt
2. Obtaining Recombinant Corynebacterium glutamicum Strain Allulose1
(15) The recombinant expression vector pEC-P6PE-P6PP was electroconverted into wild-type Corynebacterium glutamicum ATCC13032 to obtain recombinant strain Allulose1.
(16) The specific process is as follows:
(17) 2.1 Preparation of electrocompetent cells of Corynebacterium glutamicum ATCC13032 (100 OL), specifically including the following steps: (1) The strains were taken out at 80 C. and streak-inoculated in Corynebacterium glutamicum, and then placed at 30 C. for cultivation. (2) Single colonies were selected and dropped into a test tube containing 5 mL of brain heart infusion powder medium (51 g/L brain heart infusion powder, 91 g/L sorbitol), and cultured at 200 rpm and 30 C. overnight. (3) 1 mL of the above bacterial solution was taken and put into 100 mL of BHIS culture solution in a 500 mL shake flask, and cultured at 200 rpm and 30 C. The OD values were measured until an OD600 of 1.3-1.5 was reached. It took about 2-4 h. (4) Under sterile conditions, the bacterial solution was transferred to two 50 mL centrifuge tubes pre-cooled with ice. After balanced, the tubes were centrifuged for 20 min at 6000 rpm. The supernatants were discarded. (5) Cells were suspended in 10 mL of aqueous solution containing 10% (v/v) glycerol. The glycerol solutions were replenished to 20 mL, and centrifuged at 6000 rpm for 20 min after the tubes were balanced. The supernatants were discarded. Step (5) was repeated three times. (6) The tubes were inverted over filter papers to absorb the excess liquid. 1-mL 10% glycerol is added to the tubes to suspend the cells, and then the solution was transferred into another tubes. (7) The solutions were aliquoted in portions of 100 l in 10 sterile aliquots, and stored at 80 C.
(18) 2.2 Conversion of the recombinant expression vector pEC-P6PE-P6PP into Corynebacterium glutamicum ATCC 13032, specifically including the following steps: (1) 2 mL brain heart infusion powder medium and 2 mL sorbitol were poured into a large sterile tube and heated in a 46 C. water bath. (2) The competent Corynebacterium glutamate cells were thawed on ice. (3) 8-12 L plasmid was added to the competent cells (about 100 L). The mixture was mixed by pipetting up and down, then sucked up and added to an electrode cup (previously stored in anhydrous ethanol, and dried on a filter paper before use). The electrode cup was given an electric shock of 1800V, and taken out quickly after the sound. The large pipette was adjusted to about 800 L. The mixture was mixed with pre-warmed BHIS by pipetting up and down, then sucked up and added to a large sterile tube in a 46 C. water bath for 6 min. (4) The sterile tube was placed in a shaker at 30 C. for 45-60 min. (5) The sterile tube was placed in a centrifuge at 30 C. at 4200 rpm for 6 min. (6) The bacterial solution was coated in a solid brain heart powder medium containing kanamycin (25 g/mL), and placed in an incubator at 30 C. for 36 hours.
(19) 2.3 The positive colonies growing on the kanamycin resistant plate were selected and verified by colony PCR using Primer1 and Primer4. 1381 BP DNA fragments obtained by PCR amplification were positive clones.
(20) 2.4 The correct strain confirmed by PCR was stored, which was the recombinant strain allulose1 containing allulose 6-phosphate 3-epimerase P6PE gene and allulose 6-phosphate phosphatase P6PP gene.
Example 2 Construction of Recombinant Corynebacterium glutamicum Strain Allulose3
(21) 1. Construction of Integrating Vector pK18mobsacB-Pfk
(22) The upstream sequences (SEQ ID No: 13) and downstream sequences (SEQ ID No: 14) of the fructose 6-phosphate kinase gene derived from Corynebacterium glutamicum according to the KEGG database were used to design Primer5, Primer6, Primer7 and Primer8. Primer5 and Primer6 were amplified by PCR to obtain the corresponding upstream sequences of pfk gene. Primer7 and Primer8 were amplified by PCR to obtain the corresponding downstream sequences of pfk gene. The fused PCR fragment pfk-pfk composed of the upstream and downstream sequences was obtained by fusion PCR. The fusion fragment of pfk-pfk and vector pK18mobsacB (Schfer A, Tauch A, Jager W, Kalinowski J, Thierbach G, Puhler A. 1994. SmAllulose mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene 145:69-73) were further digested with the restriction enzymes EcoRI and HindIII, and ligated together to obtain the recombinant plasmid pK18mobsacB-pfk. The specific primer sequences are as follows:
(23) TABLE-US-00002 Primer5SEQIDNO:19: accggaattcatgattttggtttccttctgcga Primer6SEQIDNO:20: ttcgaatggaacttccttcaagctggctgtgcggacgattcct Primer7SEQIDNO:21: aggaatcgtccgcacagccagcttgaaggaagttccattcgaacg Primer8SEQIDNO:22: actcaagcttgttaagacgcagctgaccagtg
2. Obtaining a Fructose 6-Phosphate Kinase Gene Knockout Recombinant Strain Allulose2
(24) 2.1 Electro-competent Corynebacterium glutamicum ATCC13032 cells were prepared, and the gene knockout vector pK18mobsacB-pfk was electroconverted into electro-competent Corynebacterium glutamicum ATCC13032 cells.
(25) 2.2 The positive colonies growing on a kanamycin resistant plate were selected, and streaked on a LB plate containing 10% sucrose, cultured for 24 h at 30 C. The purpose of this step is to screen kanamycin deletion clones based on sucrose-induced lethality.
(26) 2.3 Several colonies were selected from the LB sucrose plate, and verified by colony PCR using Primer5 and Primer8. 1822 DNA fragments obtained by PCR amplification were positive clones.
(27) 2.4 The correct strain confirmed by PCR was stored, which was the recombinant Corynebacterium glutamicum strain without fructose 6-phosphate kinase activity, named as Allulose2.
(28) 3. Obtaining Recombinant Corynebacterium glutamicum Strain Allulose3
(29) The recombinant expression vector pEC-P6PE-P6PP bearing the allulose 6-phosphate 3-epimerase and allulose 6-phosphate phosphatase genes were electroconverted into the recombinant strain Allulose2 to obtain a recombinant strain Allulose3. The specific process refers to the process of electrotransformation in Example 1.
Example 3 Construction of Recombinant Corynebacterium glutamicum Strain Allulose4
(30) 1. Construction of Recombinant Expression Vector pXMJ19-GlK-PGI
(31) The glucokinase gene Glk (SEQ ID No: 4) and glucose 6-phosphate isomerase gene PGI (SEQ ID No: 5) derived from Corynebacterium glutamicum according to the KEGG database were used to design Primer9, Primer10, Primer11 and Primer12. The glucokinase gene Glk and glucose 6-phosphate isomerase gene PGI were amplified by PCR using Corynebacterium glutamicum genome as a template. The gene PGI and the expression vector pXMJ19 (Jakoby, M.; Ngouoto-Nkili, C.-E.; Burkovski, A. Construction and application of new Corynebacterium glutamicum vectors. Biotechnol. Tech. 1999, 13, 437-441) were digested with the restriction enzymes HindIII and PstI at the same time, and ligated together using T4 ligase to obtain the expression vector pXMJ19-PGI. The gene Glk and the expression vector pXMJ19-PGI were further digested with the restriction enzymes PstI and XbaI at the same time to obtain the recombinant expression vector pXMJ19-GIK-PGI. The specific primer sequences are as follows:
(32) TABLE-US-00003 Primer9SEQIDNO:23: cactcaagcttatgggatccatggcggacatttcgaccac Primer10SEQIDNO:24: gacaactgcagctacctatttgcgcggtaccact Primer11SEQIDNO:25: gacaactgcagaaaggaggacaaccatgccacaaaaaccggccagtt Primer12SEQIDNO:26: gatggtctagattagttggcttccactacagagc
2. Obtaining a Recombinant Corynebacterium glutamicum Strain Allulose4
(33) The recombinant expression vector pXMJ19-GIK-PGI was electroconverted into the recombinant strain Allulose3 to obtain a recombinant strain Allulose4. The specific process refers to the process of electrotransformation in Example 1.
Example 4 Construction of Recombinant Corynebacterium glutamicum Strain Allulose5
(34) 1. Construction of Recombinant Expression Vector pEC-P6PE-P6PP-FK-GIF
(35) Nucleotide sequence of a tuf promoter derived from Corynebacterium glutamicum, the fructose permease gene Glf (SEQ ID NO:6) derived from Zymomonas mobilis, and the fructokinase gene Frk (SEQ ID NO:7) derived from Enterococcus faecalis according to the NCBI database were used to design Primer13, Primer14, Primer15, Primer16, Primer17 and Primer18. Fragments of the tuf promoter, the fructose permease gene Glf and the fructokinase gene Frk were obtained by PCR amplification. The fusion fragment of tuf-glf-frk was obtained by using the fusion PCR strategy and using the above three fragments as a template, and constructed into the recombinant expression plasmid pEC-P6PE-P6PP by enzyme digestion and ligation to obtain the recombinant expression plasmid pEC-P6PE-P6PP-FK-GLF.
(36) TABLE-US-00004 Primer13SEQIDNO:27: gatggtctagatggccgttaccctgcgaatgt Primer14SEQIDNO:28: agtacccagatttttccattcattgtatgtcctcctggacttcgtg Primer15SEQIDNO:29: cacgaagtccaggaggacatacaatgaatggaaaaatctgggtact Primer16SEQIDNO:30: accctgactactttcagaactcattcacagcgagcgctgaagatcgt Primer17SEQIDNO:31: acgatcttcagcgctcgctgtgaaaaggaggacaaccatgagttctgaa agtagtcagggt Primer18SEQIDNO:32: ctacttctgggagcgccacatctcct
2. Obtaining a Recombinant Corynebacterium glutamicum Strain Allulose5
(37) The recombinant expression vector pEC-P6PE-P6PP-FK-GIF were electroconverted into the fructose 6-phosphate kinase gene knockout Allulose2 to obtain a recombinant strain Allulose5. The specific process refers to the process of electrotransformation in Example 1.
Example 5 Construction of Recombinant Corynebacterium glutamicum Strain Allulose6
(38) 1. Construction of Recombinant Expression Vector pXMJ19-GlK-PGI-GlpF-DhaD-DhaK
(39) Nucleotide sequence of a tuf promoter derived from Corynebacterium glutamicum, the glycerol permease gene GlpF (SEQ ID NO:8) derived from Escherichia coli, and the glycerol dehydrogenase gene DhaD (SEQ ID NO:9) derived from Klebsiella pneumoniae, and the dihydroxyacetone kinase gene DhaK (SEQ ID NO:10) according to the NCBI database were used to design Primer19, Primer20, Primer21, Primer22, Primer23 and Primer24. The RBS site sequence (AAAGGAGGACAACC) was included in Primer21 and Primer23, and the SmaI and XbaI digestion sites were included in Primer19 and Primer24. The specific primer sequences are as follows:
(40) TABLE-US-00005 Primer19SEQIDNO:33: gatggtctagaaaaggaggacaaccatgagtcaaacatcaaccttgaaa g Primer20SEQIDNO:34: gagattgaataacttttagcatatctatatctccttattacagcgaagc tttttgt Primer21SEQIDNO:35: acaaaaagcttcgctgtaataaggagatatagatatgctaaaagttatt caatctc Primer22SEQIDNO:36: tggttaaaaaagaattgagacatggttgtcctcctttttaacgcgccag ccactgctgtc Primer23SEQIDNO:37: gacagcagtggctggcgcgttaaaaaggaggacaaccatgtctcaattc ttttttaacca Primer24SEQIDNO:38: tcccccgggtctagattagcccagctcactctccgc
(41) Using Escherichia coli MG1655 genomic DNA as a template, the glycerol permease gene was amplified by PCR using Primer19 and Primer20, the glycerol dehydrogenase gene was amplified by PCR using Primer21 and Primer22, and the dihydroxyacetone kinase gene was amplified by PCR using Primer23 and Primer24. The fusion fragment of glpF-rhaD-yqaB was obtained by using the fusion PCR method. The fusion gene fragment and vector pXMJ19-GIK-PGI were digested with the restriction enzymes SmaI and XbaI at the same time, and ligated together using T4 ligase to obtain the recombinant plasmid pXMJ19-GlK-PGI-glpF-DhaD-DhaK.
(42) 2. Obtaining a Recombinant Corynebacterium glutamicum Strain Allulose6
(43) The recombinant expression vector pXMJ19-GlK-PGI-GlpF-DhaD-DhaK and pEC-P6PE-P6PP-FK-GIF were electroconverted into the recombinant strain Allulose2 at the same time to obtain a recombinant strain Allulose6. The specific process refers to the process of electrotransformation in Example 1.
Example 6 Use of Recombinant Corynebacterium glutamicum Strains Allulose1, Allulose3 and Allulose4 in Producing Allulose
(44) A1. Recombinant Corynebacterium glutamicum Strain Allulose1 Used to Ferment Glucose to Synthesize Allulose
(45) 100 mL BHI medium (brain heart infusion powder 37 g/L, kanamycin 25 ng/ml) was selected. A final concentration of 2% glucose (weight/volume (w/v, unit g/100 mL) percentage concentration) was added. The recombinant Corynebacterium glutamicum strain Allulose1 was cultured at 30 C. and 200 rmp for 12-24 h. and the inoculation amount of the strain was 2%. After fermentation, the sample was centrifuged at 14000 rmp for 20 min and filtered with a 0.22 m microporous membrane. The filtrate was analyzed by HPLC. HPLC analysis was performed under the following conditions: the instrument was Agilent HPLC 1200, the analytical column was Sugar-Pak, the mobile phase was ultrapure water, the flow rate was 0.4 mL/min, the column temperature was 80 C., the detector was differential refraction index detector, and the sample volume was 10 L.
(46) A2. Recombinant Corynebacterium glutamicum Strain Allulose3 Used to Ferment Glucose to Synthesize Allulose
(47) The cultivation method of recombinant strain Allulose3 was the same as that of A1 in the example. A final concentration of 2% glucose (weight/volume (w/v, unit g/100 mL) percentage concentration) was added to the culture medium. The inoculation amount of the strain was 2%. The sample was cultured for 24-48 h. The final sample after fermentation was detected by HPLC.
(48) A3. Recombinant Corynebacterium glutamicum Strain Allulose4 Used to Ferment Glucose to Synthesize Allulose
(49) The cultivation method of recombinant strain Allulose4 was the same as that of A1 in the example. A final concentration of 2% glucose (weight/volume (w/v, unit g/100 mL) percentage concentration) was added to the culture medium. The inoculation amount of the strain was 2%. The sample was cultured for 24-48 h. The final sample after fermentation was detected by HPLC.
(50) The results of fermentation showed that after 48 hours, the recombinant strain Allulose1 could ferment glucose to synthesize 1.8 g/L allulose. The recombinant strain Allulose3 could ferment glucose to synthesize 10.6 g/L allulose, and compared with the recombinant strain Allulose1, the yield of allulose increased nearly 6 times. The recombinant strain Allulose4 could ferment glucose to synthesize 14.8 g/L allulose, and compared with the recombinant strain Allulose3, the yield of allulose increased nearly 30%. The results are shown in
Example 7 Use of Recombinant Corynebacterium glutamicum Strain Allulose5 in Producing Allulose
(51) 1. Recombinant Corynebacterium glutamicum Strain Allulose5 Used to Ferment Glucose to Synthesize Allulose
(52) The cultivation method of recombinant strain Allulose5 was the same as that of A1 in Example 6. A final concentration of 2% glucose (weight/volume (w/v, unit g/100 mL) percentage concentration) was added to the culture medium. The inoculation amount of the strain was 2%. The sample was cultured for 48 h. The final sample after fermentation was detected by HPLC.
(53) 2. Recombinant Corynebacterium glutamicum Strain Allulose5 Used to Ferment Fructose to Synthesize Allulose
(54) The cultivation method of recombinant strain Allulose5 was the same as that of recombinant strain Allulose1 in Example 6. A final concentration of 2% fructose (weight/volume (w/v, unit g/100 mL) percentage concentration) was added to the culture medium. The inoculation amount of the strain was 2%. The sample was cultured for 48 h. The final sample after fermentation was detected by HPLC.
(55) 3. Recombinant Corynebacterium glutamicum Strain Allulose5 Used to Ferment Sucrose to Synthesize Allulose
(56) The cultivation method of recombinant strain Allulose5 was the same as that of recombinant strain Allulose1 in Example 6. A final concentration of 2% sucrose (weight/volume (w/v, unit g/100 mL) percentage concentration) was added to the culture medium. The inoculation amount of the strain was 2%. The sample was cultured for 48 h. The final sample after fermentation was detected by HPLC.
(57) The results of fermentation showed that after 48 hours, the recombinant strain Allulose5 could ferment glucose to synthesize 12.8 g/L allulose, ferment fructose to synthesize 13.6 g/L allulose, and ferment sucrose to synthesize 11.6 g/L allulose. The results are shown in
Example 8 Use of Recombinant Corynebacterium glutamicum Strain Allulose6 in Producing Allulose
(58) 1. Recombinant Corynebacterium glutamicum Strain Allulose6 Used to Ferment Glucose to Synthesize Allulose
(59) The cultivation method of recombinant strain Allulose6 was the same as that of recombinant strain Allulose1 in Example 6. A final concentration of 2% sucrose (weight/volume (w/v, unit g/100 mL) percentage concentration) was added to the culture medium. The inoculation amount of the strain was 2%. The sample was cultured for 48 h. The final sample after fermentation was detected by HPLC.
(60) 2. Recombinant Corynebacterium glutamicum Strain Allulose6 Used to Ferment Fructose to Synthesize Allulose
(61) The cultivation method of recombinant strain Allulose6 was the same as that of recombinant strain Allulose1 in Example 6. A final concentration of 2% fructose (weight/volume (w/v, unit g/100 mL) percentage concentration) was added to the culture medium. The inoculation amount of the strain was 2%. The sample was cultured for 48 h. The final sample after fermentation was detected by HPLC.
(62) 3. Recombinant Corynebacterium glutamicum Strain Allulose6 Used to Ferment Sucrose to Synthesize Allulose
(63) The cultivation method of recombinant strain Allulose6 was the same as that of recombinant strain Allulose1 in Example 6. A final concentration of 2% sucrose (weight/volume (w/v, unit g/100 mL) percentage concentration) was added to the culture medium. The inoculation amount of the strain was 2%. The sample was cultured for 48 h. The final sample after fermentation was detected by HPLC.
(64) 4. Recombinant Corynebacterium glutamicum Strain Allulose6 Used to Ferment Glycerol to Synthesize Allulose
(65) The cultivation method of recombinant strain Allulose6 was the same as that of recombinant strain Allulose1 in Example 6. A final concentration of 2% glycerol (weight/volume (w/v, unit g/100 mL) percentage concentration) was added to the culture medium. The inoculation amount of the strain was 2%. The sample was cultured for 48 h. The final sample after fermentation was detected by HPLC.
(66) The results of fermentation showed that after 48 hours, the recombinant strain Allulose6 could ferment glucose to synthesize 12.1 g/L allulose, ferment fructose to synthesize 12.6 g/L allulose, ferment sucrose to synthesize 10.8 g/L allulose, and ferment glycerol to synthesize 3.4 g/L allulose. The results are shown in
Example 9 Construction of Recombinant Corynebacterium glutamicum Strains Allose1, Allose2, Allose3 and Allose4
(67) 1. Construction of Recombinant Expression Vector pEC-P6PE-RpiB-P6PP
(68) The allulose 6-phosphate 3-epimerase (P6PE) gene (SEQ ID No: 1), the allulose 6-phosphate phosphatase (P6PP) gene (SEQ ID No: 2), and the ribose-5-phosphate isomerase (RpiB) gene (SEQ ID No: 11) derived from Escherichia coli according to the KEGG database were used to design Primer25, Primer26, Primer27, Primer28, Primer29 and Primer30. The corresponding sequences were obtained by PCR amplification. The fusion fragment of P6PE-RpiB-P6PP consisting of the genes P6PE, RpiB and P6PP was obtained by using the fusion PCR method. The fusion fragment and the expression vector pEC-XK99E were digested with the restriction enzymes EcoRI and PstI at the same time, and ligated together to obtain the recombinant plasmid pEC-P6PE-RpiB-P6PP. The primer sequences are as follows:
(69) TABLE-US-00006 Primer25SEQIDNO:39: taccggaattcatgaaaatctccccctcgttaatg Primer26SEQIDNO:40: gaatctgacgcggggttgacatggttgtcctcctttttatgctgttttt gcatgag Primer27SEQIDNO:41: ctcatgcaaaaacagcataaaaaggaggacaaccatgtcaaccccgcgt cagattc Primer28SEQIDNO:42: atcacagccaaatgcaatctttttcatggttgtcctcctttttaaccga gaaggtcttttg Primer29SEQIDNO:43: caaaagaccttctcggttaaaaaggaggacaaccatgaaaaagattgca tttggctgtgat Primer30SEQIDNO:44: gacaactgcagttaaccgagaaggtcttttgcggt
2. Obtaining a Recombinant Corynebacterium glutamicum Strain Allose1
(70) The recombinant expression vector pEC-P6PE-RpiB-P6PP bearing the allulose 6-phosphate 3-epimerase, allulose 6-phosphate phosphatase and ribose-5-phosphate isomerase genes were electroconverted into wild-type Corynebacterium glutamicum ATCC13032 to obtain a recombinant strain Allose1.
(71) 3. Obtaining a Recombinant Corynebacterium glutamicum Strain Allose2
(72) The recombinant expression vector pEC-P6PE-RpiB-P6PP bearing the allulose 6-phosphate 3-epimerase, allulose 6-phosphate phosphatase and ribose-5-phosphate isomerase genes were electroconverted into the fructose 6-phosphate kinase gene knockout strain Allulose2 to obtain a recombinant strain Allose2.
(73) 4. Obtaining a Recombinant Corynebacterium glutamicum Strain Allose3
(74) The recombinant expression vector pEC-P6PE-RpiB-P6PP bearing the allulose 6-phosphate 3-epimerase, allulose 6-phosphate phosphatase and ribose-5-phosphate isomerase genes and the expression vector pXMJ19-GIK-PGI bearing the glucokinase (Glk) and glucose 6-phosphate isomerase (PGI) genes were converted into the fructose 6-phosphate kinase gene knockout strain Allulose2 to obtain a recombinant strain Allose3.
(75) 5. Obtaining a Recombinant Corynebacterium glutamicum Strain Allose4
(76) The recombinant expression vector pEC-P6PE-RpiB-P6PP bearing the allulose 6-phosphate 3-epimerase, allulose 6-phosphate phosphatase and ribose-5-phosphate isomerase genes and the expression vector pXMJ19-GlK-PGI-GlpF-DhaD-DhaK bearing the glucokinase (Glk), glucose 6-phosphate isomerase (PGI), glycerol permease (GlpF), glycerol dehydrogenase (DhaD) and dihydroxyacetone kinase Dhak (DhaK) genes were converted into the fructose 6-phosphate kinase gene knockout strain Allulose2 described in example 2 to obtain a recombinant strain Allose4.
Example 10 Use of Recombinant Corynebacterium glutamicum Strains Allose1, Allose2, Allose3 and Allose4 in Producing Allose
(77) 1. Recombinant Corynebacterium glutamicum Strain Allose1 Used to Ferment Glucose to Synthesize Allose
(78) The cultivation method of recombinant strain Allose1 was the same as that of recombinant strain Allulose1 in Example 6. A final concentration of 2% glucose (weight/volume (w/v, unit g/100 mL) percentage concentration) was added to the culture medium. The inoculation amount of the strain was 2%. The sample was cultured for 48 h. The final sample after fermentation was detected by HPLC.
(79) 2. Recombinant Corynebacterium glutamicum Strain Allose2 Used to Ferment Glucose to Synthesize Allose
(80) The cultivation method of recombinant strain Allose2 was the same as that of recombinant strain Allulose1 in Example 6. A final concentration of 2% glucose (weight/volume (w/v, unit g/100 mL) percentage concentration) was added to the culture medium. The inoculation amount of the strain was 2%. The sample was cultured for 48 h. The final sample after fermentation was detected by HPLC.
(81) 3. Recombinant Corynebacterium glutamicum Strain Allose3 Used to Ferment Glucose to Synthesize Allose
(82) The cultivation method of recombinant strain Allose3 was the same as that of recombinant strain Allulose1 in Example 6. A final concentration of 2% glucose (weight/volume (w/v, unit g/100 mL) percentage concentration) was added to the culture medium. The inoculation amount of the strain was 2%. The sample was cultured for 48 h. The final sample after fermentation was detected by HPLC.
(83) 4. Recombinant Corynebacterium glutamicum Strain Allose4 Used to Ferment Glycerol to Synthesize Allose
(84) The cultivation method of recombinant strain Allose4 was the same as that of recombinant strain Allulose1 in Example 6. A final concentration of 2% glycerol (weight/volume (w/v, unit g/100 mL) percentage concentration) was added to the culture medium. The inoculation amount of the strain was 2%. The sample was cultured for 48 h. The final sample after fermentation was detected by HPLC.
(85) The results of fermentation showed that after 48 hours, the recombinant strain Allose1 could ferment glucose to synthesize 1.0 g/L allose, the recombinant strain Allose2 could ferment glucose to synthesize 7.6 g/L allose. Comparing with the recombinant strain Allose1, the allose yield of Allose2 increased nearly 7.6 times. The recombinant strain Allose3 could ferment glucose to synthesize 9.2 g/L allose, and compared with the recombinant strain Allose2, the yield of allose increased nearly 26.3%. The recombinant strain Allose4 could ferment glycerol to synthesize 2.8 g/L allose.
Example 11 Construction of Recombinant Corynebacterium glutamicum Strains Allitol1, Allitol2, Allitol3 and Allitol4
(86) 1. Construction of Recombinant Expression Vector pEC-P6PE-P6PP-RDH
(87) The allulose 6-phosphate 3-epimerase (P6PE) gene (SEQ ID No: 1), the allulose 6-phosphate phosphatase (P6PP) gene (SEQ ID No: 2), and the ribitol dehydrogenase (RDH) gene (SEQ ID No: 12) derived from Escherichia coli according to the KEGG database were used to design Primer31, Primer32, Primer33, Primer34, Primer35 and Primer36. The corresponding sequences were obtained by PCR amplification. The fusion fragment of P6PE-P6PP-RDH consisting of the genes P6PE, P6PP and RDH was obtained by using the fusion PCR method. The fusion fragment and the expression vector pEC-XK99E were digested with the restriction enzymes EcoRI and PstI at the same time, and ligated together to obtain the recombinant plasmid pEC-P6PE-P6PP-RDH. The primer sequences are as follows:
(88) TABLE-US-00007 Primer31SEQIDNO:45: taccggaattcatgaaaatctccccctcgttaatg Primer32SEQIDNO:46: gaatctgacgcggggttgacatggttgtcctcctttttatgctgttttt gcatgag Primer33SEQIDNO:47: ctcatgcaaaaacagcataaaaaggaggacaaccatgaaaaagattgca tttggctgtgat Primer34SEQIDNO:48: caaaagaccttctcggttaaggttgtcctcctttttaaccgagaaggtc ttttg Primer35SEQIDNO:49: ccaaatgcaatctttttcataaaggaggacaaccatgaaccactctgtc tcctctat Primer36SEQIDNO:50: gacaactgcagtcagagatccacgctgttcggc
2. Obtaining a Recombinant Corynebacterium glutamicum Strain Allitol1
(89) The recombinant expression vector pEC-P6PE-P6PP-RDH bearing the allulose 6-phosphate 3-epimerase, allulose 6-phosphate phosphatase and ribitol dehydrogenase (RDH) genes were electroconverted into wild-type Corynebacterium glutamicum ATCC13032 to obtain a recombinant strain Allitol 1.
(90) 3. Obtaining a Recombinant Corynebacterium glutamicum Strain Allitol2
(91) The recombinant expression vector pEC-P6PE-P6PP-RDH bearing the allulose 6-phosphate 3-epimerase, allulose 6-phosphate phosphatase and ribitol dehydrogenase (RDH) genes were electroconverted into the fructose 6-phosphate kinase gene knockout strain Allulose2 to obtain a recombinant strain Allitol2.
(92) 4. Obtaining a Recombinant Corynebacterium glutamicum Strain Allitol3
(93) The recombinant expression vector pEC-P6PE-P6PP-RDH bearing the allulose 6-phosphate 3-epimerase, allulose 6-phosphate phosphatase and ribitol dehydrogenase (RDH) genes and the expression vector pXMJ19-GIK-PGI bearing the glucokinase (Glk) and glucose 6-phosphate isomerase (PGI) genes were converted into the fructose 6-phosphate kinase gene knockout strain Allulose2 to obtain a recombinant strain Allitol3.
(94) 5. Obtaining a Recombinant Corynebacterium glutamicum Strain Allitol4
(95) The recombinant expression vector pEC-P6PE-P6PP-RDH bearing the allulose 6-phosphate 3-epimerase, allulose 6-phosphate phosphatase and ribitol dehydrogenase (RDH) genes and the expression vector pXMJ19-GlK-PGI-GlpF-DhaD-DhaK bearing the glucokinase (Glk), glucose 6-phosphate isomerase (PGI), glycerol permease (GlpF), glycerol dehydrogenase (DhaD) and dihydroxyacetone kinase Dhak (DhaK) genes were converted into the fructose 6-phosphate kinase gene knockout strain Allulose2 to obtain a recombinant strain Allitol4.
Example 12 Use of Recombinant Corynebacterium glutamicum Strains Allitol1, Allitol2, Allitol3 and Allitol4 in Producing Allitol
(96) 1. Recombinant Corynebacterium glutamicum Strain Allitol1 Used to Ferment Glucose to Synthesize Allitol
(97) The cultivation method of recombinant strain Allitol1 was the same as that of recombinant strain Allulose1 in Example 6. A final concentration of 2% glucose (weight/volume (w/v, unit g/100 mL) percentage concentration) was added to the culture medium. The inoculation amount of the strain was 2%. The sample was cultured for 48 h. The final sample after fermentation was detected by HPLC.
(98) 2. Recombinant Corynebacterium glutamicum Strain Allitol2 Used to Ferment Glucose to Synthesize Allitol
(99) The cultivation method of recombinant strain Allitol2 was the same as that of recombinant strain Allulose1 in Example 6. A final concentration of 2% glucose (weight/volume (w/v, unit g/100 mL) percentage concentration) was added to the culture medium. The inoculation amount of the strain was 2%. The sample was cultured for 48 h. The final sample after fermentation was detected by HPLC.
(100) 3. Recombinant Corynebacterium glutamicum Strain Allitol3 Used to Ferment Glucose to Synthesize Allitol
(101) The cultivation method of recombinant strain Allitol3 was the same as that of recombinant strain Allulose1 in Example 6. A final concentration of 2% glucose (weight/volume (w/v, unit g/100 mL) percentage concentration) was added to the culture medium. The inoculation amount of the strain was 2%. The sample was cultured for 48 h. The final sample after fermentation was detected by HPLC.
(102) 4. Recombinant Corynebacterium glutamicum Strain Allitol4 Used to Ferment Glycerol to Synthesize Allitol
(103) The cultivation method of recombinant strain Allitol4 was the same as that of recombinant strain Allulose1 in Example 6. A final concentration of 2% glycerol (weight/volume (w/v, unit g/100 mL) percentage concentration) was added to the culture medium. The inoculation amount of the strain was 2%. The sample was cultured for 48 h. The final sample after fermentation was detected by HPLC.
(104) The results of fermentation showed that after 48 hours, the recombinant strain Allitol1 could ferment glucose to synthesize 0.6 g/L allitol, the recombinant strain Allitol2 could ferment glucose to synthesize 5.3 g/L allitol, the recombinant strain Allitol3 could ferment glucose to synthesize 7.4 g/L allitol and compared with the recombinant strain Allitol2, the yield of allitol increased nearly 7.4 times. The recombinant strain Allitol4 could ferment glycerol to synthesize 2.1 g/L allitol.
Example 13 Conversion of Maltodextrin to Allulose by Extracellular Multienzyme Catalysis
(105) To establish an extracellular multienzyme system for converting maltodextrin into allulose. The key enzymes include: (1) glucan phosphorylase (EC: 2.4.1.1), which catalyzes the conversion of glucan to glucose 1-phosphate, (2) phosphoglucomutase (EC: 5.4.2.2), which catalyzes the conversion of glucose 1-phosphate to glucose 6-phosphate; (3) glucose phosphate isomerase (EC: 5.3.1.9), which catalyzes the conversion of glucose 6-phosphate to fructose 6-phosphate; (4) allulose 6-phosphate 3-epimerase (EC: 5.1.3.-), which catalyzes the conversion of fructose 6-phosphate to allulose 6-phosphate; (5) allulose 6-phosphate phosphatase, which catalyzes the dephosphorylation of allulose 6-phosphate to allulose; (6) isoamylase AI, which catalyzes maltodextrin to be a linear glycan; (7) glucan transferase (GT), which catalyzes the polymerization of maltose to produce maltotetraose or oligosaccharides with higher degree of polymerization.
(106) In the present disclosure, glucan phosphorylase was derived from Thermotoga maritima and the gene number on KEGG is TM1168; phosphoglucomutase was derived from Thermotoga maritima and the gene number on KEGG is TM0769; glucose phosphate isomerase was derived from Clostridium thermocellum and the gene number on KEGG is Cthe0217; allulose 6-phosphate 3-epimerase was derived from Escherichia coli and the gene number on KEGG is b4085 (SEQ ID NO: 1); allulose 6-phosphate phosphatase was derived from Escherichia coli and the gene number on KEGG is b1727 (SEQ ID NO:2); isoamylase was derived from Sulfolobus tokodaii and the gene number on KEGG is ST0928; glucan transferase was derived from Thermococcus litoralis, and the gene number on KEGG is OCC_10078. These genomic DNAs are available from ATCC official website (www.atcc.org). The seven genes were obtained from the corresponding genomic DNA by PCR using different primers and cloned into the pET21 vector by enzyme digestion and ligation, to obtain corresponding expression vectors: pET21-GP, pET21-PGM, pET21-PGI, pET21-P6PE, pET21-P6PP, pET21-AI and pET21-GT. These seven plasmids were converted into E. coli BL21 (DE3) (Invitrogen, Carlsbad, CA), and protein expression and purification were carried out, to obtain a multienzyme complex containing the above-mentioned enzymes.
(107) The reaction system was established as follows: 30 mM phosphoric acid buffer (pH 7.0), 5 mM magnesium chloride, 50 g/L maltodextrin, 10 U/mL glutan phosphorylase, 10 U/mL phosphoglucomutase, 10 U/mL glucose phosphate isomerase, 10 U/mL allulose 6-phosphate 3-epimerase, and 10 U/mL allulose 6-phosphate phosphatase, 10 U/mL isoamylase, and 10 U/mL glucan transferase were used to carry out the catalytic reaction at 37 C. for 24 hours, and the final reaction sample was detected by liquid chromatography.
(108) After the reaction, 25 g/L of allulose, and 10 g/L of residual glucose and fructose were obtained.
Example 14 Conversion of Sucrose to Allulose by Extracellular Multienzyme Catalysis
(109) To establish an extracellular multienzyme system for converting sucrose into allulose. The key enzymes include: (1) sucrose phosphorylase (EC: 2.4.1.7), which catalyzes the conversion of sucrose to glucose 1-phosphate and fructose, (2) phosphoglucomutase (EC: 5.4.2.2), which catalyzes the conversion of glucose 1-phosphate to glucose 6-phosphate; (3) glucose phosphate isomerase (EC: 5.3.1.9), which catalyzes the conversion of glucose 6-phosphate to fructose 6-phosphate; (4) allulose 6-phosphate 3-epimerase (EC: 5.1.3.-), which catalyzes the conversion of fructose 6-phosphate to allulose 6-phosphate; (5) allulose 6-phosphate phosphatase, which catalyzes the dephosphorylation of allulose 6-phosphate to allulose; (6) glucose isomerase (EC: 5.1.3.5), which catalyzes fructose to be glucose; (7) glucokinase (EC: 2.7.1.2), which catalyzes glucose to glucose 6-phosphate.
(110) In the present disclosure, sucrose phosphorylase was derived from Bifidobacterium longum and the gene number on KEGG is BL0536; phosphoglucomutase was derived from Thermotoga maritima and the gene number on KEGG is TM0769; glucose phosphate isomerase was derived from Clostridium thermocellum and the gene number on KEGG is Cthe0217; allulose 6-phosphate 3-epimerase was derived from Escherichia coli and the gene number on KEGG is b4085; allulose 6-phosphate phosphatase was derived from Escherichia coli and the gene number on KEGG is b1727; glucose isomerase was derived from Bacillus licheniformis and the gene number on KEGG is BL03867; glucokinase was derived from Microlunatus phosphovorus and the gene number on KEGG is MLP_2661. These genomic DNAs are available from ATCC official website (www.atcc.org). The seven genes were obtained from the corresponding genomic DNA by PCR using different primers and cloned into the pET21 vector by enzyme digestion and ligation, to obtain corresponding expression vectors: pET21-SP, pET21-PGM, pET21-PGI, pET21-P6PE, pET21-P6PP, pET21-GI, pET21-GK. These seven plasmids were converted into E. coli BL21 (DE3) (Invitrogen, Carlsbad, CA), and protein expression and purification were carried out.
(111) The reaction system was established as follows: 30 mM phosphoric acid buffer (pH 7.0), 5 mM magnesium chloride, 5 mM ATP, 30 mM polyphosphate, 20 g/L sucrose, 10 U/mL sucrose phosphorylase, 10 U/mL phosphoglucomutase, 10 U/mL glucose phosphate isomerase, 10 U/mL allulose 6-phosphate 3-epimerase, and 10 U/mL allulose 6-phosphate phosphatase, 10 U/mL glucose isomerase, and 10 U/mL glucokinase were used to carry out the catalytic reaction at 37 C. for 24 hours, and the final reaction sample was detected by liquid chromatography.
(112) After the reaction, 13.4 g/L of allulose, 4.5 g/L of residual sucrose, as well as by-products of 1.4 g/L glucose and 0.7 g/L fructose were obtained.
Example 15 Conversion of Maltodextrin to Allose by Extracellular Multienzyme Catalysis
(113) To establish an extracellular multienzyme system for converting maltodextrin into allose. The key enzymes include: (1) glucan phosphorylase (EC: 2.4.1.1), which catalyzes the conversion of glucan to glucose 1-phosphate, (2) phosphoglucomutase (EC: 5.4.2.2), which catalyzes the conversion of glucose 1-phosphate to glucose 6-phosphate; (3) glucose phosphate isomerase (EC: 5.3.1.9), which catalyzes the conversion of glucose 6-phosphate to fructose 6-phosphate; (4) allulose 6-phosphate 3-epimerase (EC: 5.1.3.-), which catalyzes the conversion of fructose 6-phosphate to allulose 6-phosphate; (5) ribose-5-phosphate isomerase (EC: 5.3.1.6), which catalyzes the conversion of allulose 6-phosphate to allose 6-phosphate; (6) allose 6-phosphate phosphatase, which catalyzes the dephosphorylation of allose 6-phosphate to allose; (7) isoamylase (AI), which catalyzes maltodextrin to be a linear glycan; (8) glucan transferase (GT), which catalyzes the polymerization of maltose to produce maltotetraose or oligosaccharides with higher degree of polymerization.
(114) Glucan phosphorylase, phosphoglucomutase, glucose phosphate isomerase, allulose 6-phosphate 3-epimerase, allulose 6-phosphate phosphatase, isoamylase, glucan transferase used were the same as those in Example 13. Ribose-5-phosphate isomerase was derived from Escherichia coli, and the gene number on KEGG is b4090 (SEQ ID NO:11). The primers were designed by using genomic DNA derived from Escherichia coli, and the corresponding genes were obtained by PCR and cloned into the pET21 vector by enzyme digestion and ligation, to obtain the corresponding expression vector pET21-RPIB. The plasmids were converted into E. coli BL21 (DE3) (Invitrogen, Carlsbad, CA), and protein expression and purification were carried out. 30)
(115) The reaction system was established as follows: 30 mM phosphoric acid buffer (pH 7.0), 5 mM magnesium chloride, 50 g/L maltodextrin, 10 U/mL glutan phosphorylase, 10 U/mL phosphoglucomutase, 10 U/mL glucose phosphate isomerase, 10 U/mL allulose 6-phosphate 3-epimerase, 10 U/mL ribose-5-phosphate isomerase, 10 U/mL allose 6-phosphate phosphatase, 10 U/mL isoamylase, and 10 U/mL glucan transferase were used to carry out the catalytic reaction at 37 C. for 24 hours, and the final sample was detected by liquid chromatography.
(116) After the reaction, 15 g/L of allose, 10 g/L allulose, and 10 g/L of residual glucose and fructose were finally obtained.
Example 16 Conversion of Sucrose to Allose by Extracellular Multienzyme Catalysis
(117) To establish an extracellular multienzyme system for converting sucrose into allulose. The key enzymes include: (1) sucrose phosphorylase (EC: 2.4.1.7), which catalyzes the conversion of sucrose to glucose 1-phosphate and fructose, (2) phosphoglucomutase (EC: 5.4.2.2), which catalyzes the conversion of glucose 1-phosphate to glucose 6-phosphate; (3) glucose phosphate isomerase (EC: 5.3.1.9), which catalyzes the conversion of glucose 6-phosphate to fructose 6-phosphate; (4) allulose 6-phosphate 3-epimerase (EC: 5.1.3.-), which catalyzes the conversion of fructose 6-phosphate to allulose 6-phosphate; (5) ribose-5-phosphate isomerase (EC: 5.3.1.6), which catalyzes the conversion of allulose 6-phosphate to allose 6-phosphate; (6) allose 6-phosphate phosphatase, which catalyzes the dephosphorylation of allose 6-phosphate to allose; (7) glucose isomerase (EC: 5.1.3.5), which catalyzes fructose to be glucose; (8) glucokinase (EC: 2.7.1.2), which catalyzes glucose to glucose 6-phosphate.
(118) The used sucrose phosphorylase, phosphoglucomutase, glucose phosphate isomerase, allulose 6-phosphate 3-epimerase, allose 6-phosphate phosphatase were the same as those in Example 13. The used glucokinase and glucose 6-phosphate isomerase were the same as those in Example 14. The used ribose-5-phosphate isomerase was the same as that in Example 15. The expressive plasmids containing the above-mentioned genes were converted into E. coli BL21 (DE3) (Invitrogen, Carlsbad, CA), and protein expression and purification were carried out.
(119) The reaction system was established as follows: 30 mM phosphoric acid buffer (pH 7.0), 5 mM magnesium chloride, 5 mM ATP, 30 mM polyphosphate, 20 g/L sucrose, 10 U/mL sucrose phosphorylase, 10 U/mL phosphoglucomutase, 10 U/mL glucose phosphate isomerase, 10 U/mL allulose 6-phosphate 3-epimerase, and 10 U/mL ribose-5-phosphate isomerase, 10 U/mL allose 6-phosphate phosphatase, 10 U/mL glucose isomerase and 10 U/mL glucokinase were used to carry out the catalytic reaction at 37 C. for 24 hours, and the final reaction sample was detected by liquid chromatography.
(120) After the reaction, 8.4 g/L of allose, 4.5 g/L of allulose, 3.5 g/L of residual sucrose, as well as by-products of 2.4 g/L glucose and 1.2 g/L fructose were finally obtained.
Example 17 Conversion of Maltodextrin to Allulose by Coupling Extracellular Multienzyme Catalysis and Fermentation
(121) 1. Conversion of Maltodextrin to Allulose by Extracellular Multienzyme Catalysis
(122) The method for conversion of maltodextrin to allulose by extracellular multienzyme catalysis was the same as that in Example 13.
(123) 2. Synthesis of Allulose from Recombinant Strain Allulose5 by Fermentation
(124) A culture medium was prepared by using the reaction solution obtained by extracellular multienzyme catalysis as a carbon source and adding with 10 g/L yeast powder and 10 g/L sodium chloride, and sterilized. According to 2% inoculation amount of the strain, the seed solution of recombinant strain Allulose 5 after overnight cultivation was inoculated into the culture medium. The recombinant Corynebacterium glutamicum strain Allulose5 was cultured at 30 C. and 200 rmp for 24 h. After fermentation, the sample was centrifuged at 14000 rmp for 20 min and filtered with a 0.22 m microporous membrane. The filtrate was analyzed by HPLC.
(125) After fermentation, the yield of allulose increased from 25 g/L to 30 g/L, and allulose was the only sugar in the fermentation liquid, which facilitated the separation of final products.
Example 18 Conversion of Maltodextrin to Allose by Coupling Extracellular Multienzyme Catalysis and Fermentation
(126) 1. Conversion of Maltodextrin to Allose by Extracellular Multienzyme Catalysis
(127) The method for conversion of maltodextrin to allose by extracellular multienzyme catalysis was the same as that in Example 13.
(128) 2. Synthesis of Allose from Recombinant Strain Allose3 by Fermentation
(129) A culture medium was prepared by using the reaction solution obtained by extracellular multienzyme catalysis as a carbon source and adding with 10 g/L yeast powder and 10 g/L sodium chloride, and sterilized. According to 2% inoculation amount of the strain, the seed solution of recombinant strain Allose3 after overnight cultivation was inoculated into the culture medium. The recombinant Corynebacterium glutamicum strain Allose3 was cultured at 30 C. and 200 rmp for 24 h. After fermentation, the sample was centrifuged at 14000 rmp for 20 min and filtered with a 0.22 m microporous membrane. The filtrate was analyzed by HPLC.
(130) After fermentation, the yield of allose increased from 15 g/L to 18 g/L, and the content of allulose increased from 10 g/L to 12 g/L.
(131) The above descriptions are exemplary embodiments of the present disclosure. However, the embodiments are not intended to limit the scope of the present disclosure. Any modification, equivalent alternative, improvement made without departing from the spirit and scope of the present disclosure should fall within the scope of the present disclosure.