Universal platform for genetic code expansion

12203115 ยท 2025-01-21

Assignee

Inventors

Cpc classification

International classification

Abstract

Methods and compositions are described for selecting and identifying orthogonal aminoacyl synthetase-tRNA pairs and their use to incorporate unnatural amino acids in a site-specific manner in proteins. Specifically described is a novel E. coli tyrptophanyl synthetase-tRNA pair that functions as both an opal and amber suppressor and that incorporates tryptophan analogs into proteins.

Claims

1. A method of producing orthogonal aminoacyl synthetase-tRNA pairs that aminoacylate unnatural amino acids for incorporation of unnatural amino acids into specific sites in proteins produced in E. coli or eukaryotic cells, the method comprising the steps of: a. introducing into an E. coli host cell an orthogonal eukaryotic or archaeal aminoacyl synthetase-tRNA pair for a target amino acid resulting in an E.coli host cell comprising an endogenous E.coli aminoacyl synthetase-tRNA pair for an amino acid and a counter-part orthogonal eukaryotic or archaeal aminoacyl synthetase-tRNA pair for the same amino acid, wherein: i) the introduced orthogonal eukaryotic or archaeal aminoacyl synthetase-tRNA pair does not cross-react with the E. coli host cell's counter-part endogenous E.coli aminoacyl synthetase-tRNA pair; and ii) the introduced orthogonal eukaryotic or archaeal aminoacyl synthetase-tRNA pair does not result in a growth rate defect in the E. coli host cell; b. deleting the endogenous E. coli aminoacyl synthetase-tRNA pair from the E. coli host cell, wherein the orthogonal eukaryotic or archaeal aminoacyl synthetase-tRNA pair of step a. replaces the endogenous E.coli aminoacyl synthetase-tRNA pair and its aminoacylation function, resulting in an altered translational machinery (ATM) E. coli cell; c. culturing the ATM E. coli cells of step b. under suitable culture conditions and monitoring the growth rate of the ATM E. coli cells and the growth rate of the E. coli host cells and selecting the ATM E. coli cells with no observable growth rate defect when compared to the growth rate of the E. coli host cells; d. constructing a library of E. coli aminoacyl synthetase variants corresponding to the aminoacyl synthetase of the deleted endogenous E. coli aminoacyl synthetase-tRNA pair of step b., wherein the variants selectively aminoacylate an unnatural amino acid; e. mutating the anti-codon of an E. coli tRNA corresponding to the tRNA of the deleted endogenous E. coli aminoacyl synthetase-tRNA pair of step b., resulting in a mutated E.coli tRNA comprising an anti-codon that recognizes a nonsense or stop codon; f. introducing the library of E. coli aminoacyl synthetase variants of step d. with the mutated E.coli tRNA of step e. and the unnatural amino acid that is selectively aminoacylated in step d. into the selected ATM E. coli cells of step c.; and g. subjecting the E.coli aminoacyl synthetase variants in the ATM E.coli cells to directed evolution to select one or more E. coli aminoacyl synthetase variants that aminoacylate the mutated E.coli tRNA with the unnatural amino acid, thereby producing an orthogonal aminoacyl synthetase-tRNA pair comprising an E. coli aminoacyl synthetase variant and a mutated E. coli tRNA that aminoacylates unnatural amino acids for incorporation of the unnatural amino acids into specific sites in proteins produced in E. coli and eukaryotic cells.

2. The method of claim 1, wherein in step b. the deleted endogenous E.coli aminoacyl synthetase-tRNA pair is-a TrpRS-tRNA.sup.Trp pair.

3. The method of claim 1, wherein in step e. the mutated E.coli tRNA recognizes an amber or opal selector codon.

4. The method of claim 1, wherein in step a., the orthogonal eukaryotic or archaeal aminoacyl synthetase t-RNA pair introduced into the E. coli host cell is an aminoacyl-tRNA.sup.typ pair; in step d., the unnatural amino acid is a tryptophan analog; in step f., the unnatural amino acid is a tryptophan analog; and in step g., the unnatural amino acid is a tryptophan analog, thereby producing an orthogonal aminoacyl synthetase-tRNA pair that aminoacylates and incorporates a tryptophan analog in specific sites of the E.coli or eukaryotic protein.

5. The method of claim 4, wherein the produced orthogonal aminoacyl synthetase-tRNA pair aminoacylates a tryptophan analog selected from the group consisting of: 5-azidotryptophan, 5-propargyloxytryptophan, 5-aminotryptophan, 5-methoxytryptophan, 5-O-allyltryptophan, or 5-bromotryptophan.

6. The method of claim 1, wherein the orthogonal eukaryotic or archaeal aminoacyl synthetase-tRNA pair of step a. is derived from yeast.

7. The method of claim 1, wherein the produced orthogonal aminoacyl synthetase-tRNA pair is an aminoacyl synthetase-tRNAUP pair.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) In the accompanying drawings, reference characters refer to the same parts throughout the different views. The drawings are not necessarily to scale; emphasis has instead been placed upon illustrating the principles of the invention. The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings(s) will be provided by the Office upon request and payment of the necessary fee. Of the drawings:

(2) FIG. 1 shows an overview of the general strategy to create ATM E. coli strains.

(3) FIG. 2A-B shows (A) depiction of ATMW1 recombination containing Ec-TrpRS replaced with ZeoR, Ec-Trp tRNA replaced with GentR, and complementation plasmid pUltraG ScW40 CCA. (B) Growth rate comparison of ATMW1 to progenitor EcNR1 strain containing pUltraG.

(4) FIG. 3A-E shows (A) Geobacillus stearothermophilus TrpRS (PDB 1I6M) active site. (B) Structures of tryptophan and 5-hydroxytryptophan (5HTP). (C) Mutations associated with 5HTP-specific EcTrpRS variants. (D) Expression of sfGFP-151-TGA using EcTrpRS hits 9, 10, 13, and 14 demonstrating 5HTP dependence. (E) SDS-PAGE analysis of sfGFP-151-TGA expression facilitated by various EcTrpRS variants in the presence or absence of added 5HTP.

(5) FIG. 4A-D shows (A) Structures of additional tryptophan analogs used here. (B) Demonstration of polyspecificity associated with EcTrpRS-h9 and h14 using sfGFP-151-TGA expression assay. (C) SDS-PAGE of sfGFP-151-TGA containing various 5-position Trp residues. (D) Expression of EGFP-39-TAG reporter incorporating various UAAs in HEK293T cells using EcTrpRS(variant)/tRNAEcTrpCUA pair.

(6) FIG. 5A-D shows (A) EGFP-39-TAG and sfGFP-151-TGA containing 5AzW or 5HTP were labeled with DBCO-Cy5 and imaged. (B) sfGFP151TGA containing 5PrW or 5MTP was labeled with Alexa 488-PCA and imaged. (C) Structure of DBCO-Cy5. (D) Structure of Alexa 488-PCA.

(7) FIG. 6 shows EGFP39*-fluorescence and white light images demonstrating E. coli tRNATrpCUA orthogonality and Trp-aaRS activity in HEK293T, imaged 24 hrs post-transfection with PEI-Max. pAcBac1 system previously described was used, with or without cognate aaRS.

(8) FIG. 7A-B shows the plasmid maps used to complement endogenous E. coli Trp-tRNA/aaRS removal. pUltraG ScW40 CCA contains a glnS promoted wild-type E. coli TrpRS, prok promoted E. coli Trp-tRNA, CloDF13 origin of replication, and Spectinomycin resistance. pUltra is as previously reported.

(9) FIG. 8A-D shows Colony PCR assay for genomic recombination. (A) Ec-TrpRS replaced with zeoR screen. Left: Primers anneal 150 bp upstream and downstream from trpS location (Zeocin 200 bp smaller than Ec-TrpRS). Middle: Forward primer anneals 150 bp upstream and an internal reverse primer anneals only to trpS. Right: Primers anneal directly to the N and C terminus of trpS. Lanes 1-6 are potential hits, lane 7 is EcNR1, and lane 8 is PBS. (B) Ec-Trp tRNA replaced with gentR screen. Primers anneal 150 bp upstream and downstream from the trpT genomic location. Successful hits will have a larger PCR product due to the increased gentamycin cassette. Lanes 1-4 are potential hits, lane 5 is EcNR1 pUG ScW40 trpS::zeoR prior to recombination, and lane 6 is PBS. (C) galK deletion screen: Primers anneal 150 bp upstream and downstream from the galK endogenous location. Successful hits will have a larger PCR product due to the increased gentamycin cassette. Lanes 1-8 are potential hits, lane 9 is EcNR1, lane 10 is C321, and lane 11 is PBS. (D) Genomic -Red replaced with galK screenATMW1. A: Forward primer anneals 150 bp upstream from the prophage and the reverse primer anneals only to galK. B: Primers anneal 150 bp upstream and downstream from the galK endogenous location. 1-4 are final ATMW1 hits, 5 is EcNR1, 6 is Top 10, and 7 is PBS. Associated primer maps are depicted with each screen.

(10) FIG. 9A-C shows (A) cross reactivity comparison with tRNAEcTrp CUA vs UCA via sfGFP151 assay. Strains were transformed with pEvolT5 EcW sfGFP151TAG or TGA, grown to 0.5 OD600 and induced with 1 mM IPTG. Fluorescence/OD600 was measured in a plate reader (488 ex, 534 em, 515CO). (B) LCMS of ATMW1 purified sfGFP151TAG+pBK MCS EcWRS (C) LCMS of ATMW1 purified sfGFP151TAG+pBK MCS EcWRS.

(11) FIG. 10A-C show predicted (A) EcTrp-tRNACCA (trpT) SEQ ID NO: 1 and (B) EcGln-tRNACUG (glnV) structures SEQ ID NO:2. (C) shows the respective DNA sequences and homology alignment of tRNA sequences SEQ ID NOS:3-5.

(12) FIG. 11A-D shows (A) EGFP39*-fluorescence images of EcWRS-h14 and (B) -h9 transfected HEK293T, as previously described. (C) SDS-PAGE of purified EGFP39* containing an UAA incorporated through the pacbac system expressing h14, h9, or the Pyl system. (D) Yields of aforementioned purified EGFP39*.

(13) FIG. 12A-C show the sequences (SEQ ID NOS:75, 76 and 77 respectively) that are the ds DNA PCR products that were electroporated for recombination. Primers are listed in MM and primer list. Important features are mentioned prior to the sequence with color code in parenthesis.

(14) FIG. 13A-B. FIG. 13A shows the plasmid map and FIG. 13B shows the plasmid sequence (SEQ ID NO: 78) for pUltra_ScW40.sub.CCA. GFP is highlighted in green, CAT/Barnase is orange, T7 RNA polymerase in purple, tRNA in red and aaRS in blue unless otherwise specified.

(15) FIG. 14A-B. FIG. 14A shows the plasmid map and FIG. 14B shows the plasmid sequence (SEQ ID NO: 79) for pRepAC-EcWtR-TAG.

(16) FIG. 15A-B. FIG. 15A shows the plasmid map and FIG. 15B shows the plasmid sequence (SEQ ID NO:80) of pRep-Cm3J-98TGA-EcWtR.

(17) FIG. 16A-B. FIG. 16A shows the plasmid map and FIG. 16B shows the plasmid sequence (SEQ ID NO:81) of pRepJI-EcW.

(18) FIG. 17A-B. FIG. 17A shows the plasmid map and FIG. 17B shows the plasmid sequence (SEQ ID NO: 82) of pEvolT5-EcW-sfGFP151TAG.

(19) FIG. 18A-B. FIG. 18A shows the plasmid map and FIG. 18B shows the sequence (SEQ ID NO:83) of pEvolT5-EcW-sfGFP151TAG.

(20) FIG. 19 shows the plasmid sequence (SEQ ID NO: 84) of pEvoltac-EcW-TGA-h14.

(21) FIG. 20 shows the plasmid sequence (SEQ ID NO: 85) of the plasmid pEvoltac-EcW-TGA-h9. The sequence is identical to pEvoltac-EcW-TGA-h14 except for the V144-146 region. The h9 aaRS is listed with mutations in blue.

(22) FIG. 21A-B. FIG. 21A shows the plasmid map and FIG. 21B shows the plasmid sequence (SEQ ID NO: 86) of pBK-EcWRS.

(23) FIG. 22 shows the sequence (SEQ ID NO:87) of pBK-EcWRS-h14. The pBK sequence is the same as with EcWRS-h14 with mutations shown in blue.

(24) FIG. 23 shows the sequence of pBK-EcWRS h-9 (SEQ ID NO:88). The pBK sequence is the same as with EcWRS-h9 with mutations shown in blue.

(25) FIG. 24A-B. FIG. 24A shows the plasmid map and FIG. 24B shows the plasmid sequence (SEQ ID NO:89) of pAcBac1-EGFP39*-U6-EcWtR-TAG.

(26) FIG. 25A-B. FIG. 25A shows the plasmid map and FIG. 25B shows the sequence (SEQ ID NO:90) of pAcBac1-TrpRS-U6EcWtR-TAG.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

(27) The above and other features of the invention including various novel details of construction and combinations of parts, and other advantages, will now be more particularly described with reference to the accompanying drawings and pointed out in the claims. It will be understood that the particular method and device embodying the invention are shown by way of illustration and not as a limitation of the invention. The principles and features of this invention may be employed in various and numerous embodiments without departing from the scope of the invention.

(28) As used herein, the term and/or includes any and all combinations of one or more of the associated listed items. Further, the singular forms and the articles a, an and the are intended to include the plural forms as well, unless expressly stated otherwise. It will be further understood that the terms: includes, comprises, including and/or comprising, when used in this specification, specify the presence of stated features, integers, steps, operations, elements, and/or components, but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and/or groups thereof.

(29) The present disclosure provides a universal platform for genetic code expansion and involves a bacterial tryptophanyl-tRNA/tryptophanyl-tRNA synthetase pair for site-specific incorporation of tryptophan analogs into proteins expressed in E. coli and eukaryotic cells. The current invention discloses an alternative strategy which takes advantage of an E. coli strain, where one of its native tRNA/aaRS pairs is functionally replaced with a eukaryotic/archaeal counterpart (FIG. 1). The liberated tRNA/aaRS pair can then be reintroduced in the resulting altered translational machinery (ATM) E. coli as a nonsense suppressor, and can be evolved to charge desirable UAAs. Owing to its bacterial origin, the same pair can also be directly used for eukaryotic genetic code expansion.

(30) The feasibility of substituting a tRNA/aaRS pair in E. coli with an evolutionarily distant counterpart has previously been demonstrated. However, the resulting strains often exhibit growth defect, presumably due to the suboptimal interaction of the heterologous tRNA/aaRS with the translational apparatus of E. coli. Moreover, whether variants of the liberated tRNA/aaRS pair with altered substrate specificity can be developed using the corresponding ATM strain as the selection host remains unknown. Optimizing the performance of the substituting tRNA/aaRS pair in E. coli using directed evolution may allow it to functionally replace its endogenous counterpart more efficiently, circumventing the growth defect associated with such substitution. A number of heterologous tRNA/aaRS pairs have already been engineered for efficient suppression of nonsense codons in E. coli, providing a pool of potential candidates.

(31) The endogenous tryptophanyl (Trp)-tRNA/aaRS pair in E. coli was targeted for functional replacement with a eukaryotic/archaeal counterpart. A S. cerevisiae derived tryptophanyl-tRNA/TrpRS pair has already been optimized in E. coli. for highly efficient nonsense suppression, providing a great candidate for substituting its endogenous counterpart. Additionally, the unique active site of TrpRS should enable the introduction of structurally novel UAAs in the eukaryotic, as well as the bacterial genetic code. To verify if the E. coli Trp-tRNA/aaRS pair is indeed suitable for eukaryotic genetic code expansion, HEK293T cells were co-expressed with the TAG-suppressing E. coli Trp-tRNA (tRNAEcTrpCUA) and an enhanced green fluorescent protein (EGFP) reporter harboring a stop codon at a permissive site (EGFP-39-TAG), with or without the cognate synthetase. Robust EGFP expression was only observed in the presence of the EcTrpRS (FIG. 6), suggesting that: 1) EcTrpRS/tRNAEcTrpCUA is capable of efficient TAG-suppression in eukaryotic cells, and 2) the pair is non-cross-reactive with its eukaryotic counterparts.

(32) To allow the deletion of the endogenous tryptophanyl pair from the E. coli genome, a plasmid (pUltra-ScW40CCA) was first generated expressing the aforementioned engineered ScTrpRS/tRNAScTrpCCA pair derived from yeast (FIG. 7). It harbors a unique CloDF13 origin of replication to maintain compatibility with most commonly used plasmids. The K12-derived EcNR1 strain of E. coli, encoding a heat-inducible -Red recombination system, was used as the host. Attempts at replacing the trpS (encoding EcTrpRS) and trpT (encoding Trp-tRNA) genes from the EcNR1 genome using a zeocin and gentamycin selectable markers (FIG. 2A), respectively, were successful in the presence of the pUltra-ScW40CCA complementation plasmid (FIG. 8). Finally, the -prophage encoding the Red-recombination system was removed from the genome using a galactose-selectable galK marker, to provide a strain named ATMW1, with the following genotype: EcNR1 pUltraG-ScW40CCA trpS::ZeoR trpT::GentR galK RED::galK. The E.coli ATMW1strain was deposited with the American Type Culture Collection (ATCC), 10801 University Boulevard, Manassas, Virginia 20110-2209, USA, on May 23, 2022 and designated with Patent Deposit Number PTA-127317 in accordance with the requirements of the Budapest Treaty on the Internationals Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure. The ATMW1 strain exhibited no observable growth defect when compared to its progenitor EcNR1, confirming efficient functional complementation by the engineered ScTrpRS/tRNAScTrpCCA pair (FIG. 2B).

(33) With ATMW1 in hand, the possibility of reintroducing the liberated EcTrpRS/tRNAEcTrp pair for TAG suppression into this strain as a TAG suppressor was investigated. Surprisingly, when the tRNAEcTrpCUA was expressed in ATMW1 along with a superfolder GFP reporter (sfGFP-151-TAG), robust protein expression was observed in the absence of EcTrpRS, indicating cross-reactivity of this tRNA with another E. coli aaRS (FIG. 9A). To identify the origin of this cross-reactivity, the reporter protein was isolated by Ni-NTA affinity purification, and subjected to mass-spectrometry analysis (whole protein, as well as tryptic digestion/MS), which identified the amino acid being charged in response to TAG as glutamine (FIG. 9B). Sequence alignment reveals remarkable homology between the tryptophanyl and glutaminyl tRNA of E. coli (FIG. 10). The middle U residue in the anticodon of EctRNAGlnCUG is a major identity element in its interaction with EcGlnRS. While the EctRNATrpCCA lacks this residue, enabling its distinction from EctRNAGln, it was inadvertently introduced in the TAG suppressor variant EctRNATrpCUA, leading to cross-reactivity with EcGlnRS.

(34) Circumventing this issue is envisioned by generating a TGA suppressor EctRNATrpUCA that avoids introducing the middle U-residue in the anticodon. Unfortunately, termination at the TGA stop codon in E. coli is often leakya result of non-specific suppression by the endogenous tryptophanyl tRNAmaking it a suboptimal choice for genetic code expansion. However, in the ATMW1 strainwhere the endogenous tryptophanyl pair was replaced with the yeast counterpartTGA did not exhibit such leaky behavior (FIG. 9A), suggesting the feasibility of its use for genetic code expansion with high fidelity. When the sfGFP-151-TGA reporter and EctRNATrpUCA were coexpressed in ATMW1, no reporter expression was observed un less the EcWRS was also present, confirming the non-cross-reactivity of EctRNATrpUCA in ATMW1 as well as the efficient opal suppression activity of the EcTrpRS/tRNAEcTrpUCA pair (FIG. 9A). MS analysis of the isolated protein further confirmed incorporation of tryptophan in response to TGA (FIG. 9C)

(35) Establishment of an efficient, orthogonal opal suppressing EcTrpRS/tRNAEcTrpUCA pair in the ATMW1 E. coli opens up the possibility of altering its substrate specificity using the facile E. coli-based selection system. The existing reporter plasmids used for this double-sieved selection scheme, which enables either enrichment (positive selection) or depletion (negative selection) of aaRS variants based on their ability to charge its amber suppressing cognate tRNACUA, were mutated to generate variants that would allow selection based on opal suppression instead. Based on the crystal structure (FIG. 3A) of the highly homologous Geobacillus stearothermophilus TrpRS (PDB ID 1I6M), a library of 3.15106 EcTrpRS mutants was constructed by simultaneously randomizing Phe 7(NBT), Ser 8(NST), Val 144(NNK), Pro 145(NNK), Val 146(NNK) residues using site-saturation mutagenesis, and covering the library using 3107 unique transformants. These residues point at C4-C5-C6 of the indole ring of the substrate tryptophan. A first attempt at identifying a mutant from this library that selectively charges 5-hydroxytryptophan is shown (5HTP; FIG. 3B). This UAA was previously genetically encoded in bacteria using a yeast-derived tryptophanyl pair. A report claiming its incorporation in mammalian cells using a bacteria-derived tRNA/aaRS pair was recently refuted.

(36) The aforementioned library of EcTrpRS variants was subjected to three rounds of selections (positive selection in the presence of 1 mM 5HTP, negative selection in the absence of the UAA, then another round of positive selection) in the ATMW1 strain, and 96 colonies from the surviving pool were individually screened for conditional survival under the positive selection conditions (40 g/mL chloramphenicol) in the presence of 5HTP. Sequence analysis of four of the most successful mutants show significant sequence-convergence, where Phe 7 and Pro 145 are conserved, Ser 8 is mutated to Ala, Val 144 changes to a small amino acid (Gly/Ser/Ala), and Val 146 is mutated to different small/hydrophobic amino acids (FIG. 3C). Next the ability of these mutant EcTrpRS variants to drive the expression of a sfGFP-151-TGA reporter along with its cognate tRNAEcTrpUCA were evaluated. All mutants were able to facilitate efficient reporter expression in the presence of 1 mM 5HTP, but EcTrpRS-h14 exhibited the least background in the absence of the UAA (FIG. 3D, E). The reporter protein was isolated using a C-terminal (His)6 tag and MS analysis confirmed 5HTP incorporation (Table 1).

(37) Table 1 below shows whole protein LCMS measurements.

(38) TABLE-US-00001 Expected Observed Reporter UAA aaRS mass mass Note sfGFP- None None No expr. 27562 pBK system 151-TAG in ATMW1 sfGFP- W EcWRSwt 27620 27562* pBK/tac system 151TAG in ATMW1 (Gln x-rxtive) sfGFP- W EcWRSwt 27620 27621 pBK/tac system 151-TGA in ATMW1 sfGFP- 5HTP Hit 14 27636 27637 pBK/tac system 151-TGA in ATMW1 sfGFP- 5MTP Hit 14 27652 27652 pBK/tac system 151-TGA in ATMW1 sfGFP- 5BrW Hit 14 27700 27699 pBK/tac system 151-TGA in ATMW1 sfGFP- 5AzW Hit 14 27663 27660 pBK/tac system 151-TGA in ATMW1 sfGFP- 5PropW Hit 14 27676 27674 pBK/tac system 151-TGA in ATMW1 sfGFP- 5HTP Hit 9 27636 27637 pBK/tac system 151-TGA in ATMW1 sfGFP- 5AmW Hit 9 27636 27635 pBK/tac system 151-TGA in ATMW1 EGFPwt Y None 29683 29683 Pacbac1 system in HEK293T EGFP- BocK MbPyl 29748 29748 Pacbac1 system 39-TAG in HEK293T EGFP- AzK MbPyl 29761 29761 Pacbac1 system 39-TAG in HEK293T EGFP- W EcWRSwt 29707 29708 Pacbac1 system 39-TAG in HEK293T EGFP- 5HTP Hit 14 29723 29724 Pacbac1 system 39-TAG in HEK293T EGFP- 5MTP Hit 14 29736 29736 Pacbac1 system 39-TAG in HEK293T EGFP- 5BrW Hit 14 29786 29785 Pacbac1 system 39-TAG in HEK293T EGFP- 5AzW Hit 14 29748 29747 Pacbac1 system 39-TAG in HEK293T EGFP- 5PropW Hit 14 29761 29760 Pacbac1 system 39-TAG in HEK293T EGFP- 5HTP Hit 9 29723 29724 Pacbac1 system 39-TAG in HEK293T EGFP- 5AmW Hit 9 29722 29721 Pacbac1 system 39-TAG in HEK293T sfGFP- 5AzW Hit 14 28368 28366 Labeled with 151-TAG DBCO-biotin EGFP- 5AzW Hit 14 30453 30453 Labeled with 39-TAG DBCO-biotin

(39) Since the negative selection step in the aforementioned scheme only discriminates against natural amino acids, but not other UAAs, the isolated mutants are sometimes capable of polyspecificity: The ability to charge a number of structurally similar UAAs, while discriminating against the 20 canonical amino acids. The isolated EcTrpRS mutants were screened for polyspecificity towards other 5-substituted tryptophan derivatives (FIG. 4A), using an assay that measures the enhancement of sfGFP-151-TGA expression in the presence of a particular UAA, relative to a no-UAA control. EcTrpRS-h14 exhibited high polyspecificity towards four additional amino acids, whereas EcTrpRS-h9 also enabled the incorporation 5-aminotryptophan (FIG. 4B). In all cases, the reporter protein was isolated and characterized by MS analysis to confirm the incorporation of these UAAs (FIG. 4C, Table 1). To demonstrate the feasibility of the evolved EcTrpRS variants for UAA-incorporation into proteins in mammalian cells, EcTrpRS-h14 and -h9 were cloned into the previously described pAcBac1 plasmid system together with its cognate tRNAEcTrpCUA, driven by CMV and U6 promoters, respectively, and this plasmid was co-transfected into HEK293T cells along with an EGFP-39-TAG reporter. Apart from 5-bromotryptophan, addition of all other UAAs led to robust reporter-expression relative to a no-UAA control (FIG. 4D). Expression levels were comparable with those obtained with the well-established pyrrolysyl system for the same reporter. Incorporation of 5-azidotryptophan (5AzW) and 5-propargyloxytryptophan (5PrW) into proteins introduces unique azido- and alkyne-functionalities, respectively, that can be utilized for bioorthogonal conjugation reactions using Cu-mediated or Cu-free click chemistry. This was demonstrated by conjugating DBCO-Cy5 or Alexa Fluor 488 picolyl azide to the 5AzW or 5PrW residue in reporter proteins, using strain-promoted or Cu-dependent click conjugation, respectively (FIG. 5).

(40) In conclusion, the present invention demonstrates here the feasibility of functionally replacing an endogenous tRNA/aaRS in E. coli with an E. coli-optimized counterpart from a different domain of life with no growth-penalty, and that the resulting strain can be used as a selection host for evolving variants of the liberated tRNA/aaRS pair for charging UAAs. In addition to E. coli, these variants also enable genetic code expansion in eukaryotes. Since bacterial tRNA/aaRS pairs are generally orthogonal in eukaryotic cells, this approach holds the potential to provide additional universal tRNA/aaRS platforms. The present invention also introduces a new tryptophanyl-tRNA synthetase/tRNA platform, the utility of which was illustrated by introducing several new UAA additions to the genetic code of E. coli as well as eukaryotes, including 5AzW and 5PrW which enable selective bioconjugation reactions. Access to new universal tRNA/aaRS pairs will augment the structural diversity of genetically encoded UAA toolbox, and facilitate the development of powerful new technology involving simultaneous incorporation of multiple UAAs into a polypeptide in both E. coli and eukaryotes.

(41) A number of tRNA/aminoacyl-tRNA synthetase (aaRS) pair has been developed to date to site specifically incorporate novel unnatural amino acids into proteins. The E. coli tryptophanyl-tRNA synthetase/tRNA pair developed in the present invention is unique and is a novel system because it can be used to incorporate new unnatural amino acids into proteins both in an engineered E. coli (the strain created where the endogenous tryptophanyl tRNA/aaRS pair was replaced with a counterpart from yeast) as well as in eukaryotic cells. This tRNA/aaRS pair has been engineered to enable site specific incorporation of six new unnatural tryptophan analogs into proteins expressed in both E. coli as well as eukaryotic cells.

(42) The novel system described in the present invention has a number of potential applications. This includes site-specific bioconjugation using 5-azidotryptophan and 5-propargyltryptophan: These two unnatural amino acids can be incorporated into proteins expressed in both E. coli and eukaryotic cells (e.g., mammalian cells), and will allow site-specific bioconjugation using bioorthogonal azide-alkyne click reactions. This reaction can be used to site-specifically attach onto proteins a variety of entities such as drugs (for antibody-drug conjugation), attachment of biophysical probes (such as fluorophores, PET probe, etc.), polyethylene glycol (to improve pharmacokinetic properties of therapeutic proteins), onto recombinantly expressed proteins.

(43) The same strategy can also be used to label the capsid proteins of human viruses, which can be subsequently labeled with either probes to study its infection process, or attach synthetic receptor binding agents that target specific cell-surface receptors to generate cell-specific viral vectors. The site-specific conjugation strategy can also be used to attach relevant proteins on surfaces (e.g, sensor chips, electrodes, etc.) with precise control over its orientation and site of attachment.

(44) Another application involves 5-azidotryptophan, which is an aryl-azide, which upon irradiation forms a highly reactive nitrene intermediate. Its incorporation into proteins will allow light-induced capture of weak protein-protein interactions by the formation of a stable covalent linkage between the reactive nitrene intermediate and various residues from the interacting protein. This can be a powerful tool to interrogate weak or transient protein-protein interactions. Additionally tryptophan residues are frequently found at the interface of protein-protein interactions, making 5-azidotyrptophan an ideal candidate to capture such interactions.

(45) The tryptophanyl-tRNA synthetase/tRNA pair of the present invention can be further engineered to incorporate new tryptophan analogs such as fluorinated-tryptophan (NMR as well as fluorescence probe), nitrated tryptophans (these residues form naturally as post-translational modifications, but their physiological relevance remain poorly characterized, since such modified proteins cannot be homogeneously produced; however, the ability to specifically charge these nitrated amino acid into specific sites of proteins using the technology of the present invention will circumvent this problem). The large active site of the tryptophanyl-tRNA synthetase can also be engineered to charge other unnatural amino acids with large side chains, such as fluorophores.

(46) A variety of tryptophan analogs can be incorporated site-specifically into proteins expressed in E. coli or eukaryotic cells, enabling the study of the roles of functionally important tryptophan residues. 5-azidotryptophan, 5-propargytryptophan, which can be incorporated site-specifically into any protein expressed in bacteria or eukaryotic cells using our platform, will allow selective conjugation of various molecules to these proteins for applications such as PEGylation, generation of site-specific antibody-drug conjugates. 5-azidotryptophan which can be incorporated site-specifically into any protein expressed in bacteria or eukaryotic cells using the platform of the current invention, can be used as a photo-affinity probe to capture weak or transient protein-protein interactions within a living cell.

(47) The present invention has many commercial applications and could be useful to manufacturers of research kits, and to companies pursuing antibody-drug conjugate or other protein modification (such as PEGylation). Without further elaboration, it is believed that one skilled in the art can, based on the above description, utilize the present invention to its fullest extent. The following specific embodiments and examples are, therefore, to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever.

(48) Without further elaboration, it is believed that one skilled in the art can, based on the above description, utilize the present invention to its fullest extent. The following specific embodiments and examples are, therefore, to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever.

Materials and Methods

(49) For cloning and plasmid propagation, the DH10b (Life Technologies) strain of E. coli was used. Polymerase chain reaction (PCR) was performed using the Phusion Hot Start II DNA polymerase (Fisher Scientific) using manufacturer's protocol. For purification of DNA (plasmid as well as PCR products, etc.) spin columns from Epoch Life Science were used. Restriction enzymes and T4 DNA ligase were obtained from New England BioLabs (NEB). DNA oligomers for PCR were purchased from Integrated DNA Technologies (IDT). Verification of cloned DNA by Sanger sequencing was performed by Eton Biosciences. Antibiotics, isopropyl -D-1- thiogalactopyranoside (IPTG), and L-arabinose were purchased from Sigma-Aldrich or Fisher Scientific. Components of media were obtained from Fisher Scientific. Bacteria were grown on LB or M63 agar plates.sup.17 and LB liquid medium with the following antibiotic concentrations unless otherwise mentioned: 95 g/mL spectinomycin, 20 g/mL chloramphenicol, and 100 g/mL ampicillin, 30 g/mL kanamycin, 15 g/mL zeocin, 12 g/mL tetracycline, 10 g/mL gentamycin.

(50) Sequences of the oligonucleotides used herein are shown in Table 2, below SEQ ID NOS: 6-74, respectively.

(51) TABLE-US-00002 SEQID NO: 6 TrpRS.Z.ab- ATCAGTCTATAAATGACCTTCTGCCCGCATTAGGGCTTC F CGCATAGCGAAAATCAGGAATCGAAAAAGGTGTTGACA ATTAATCATCGGC 7 TrpRS.Z.ab- TGTAGGCCGGATAAGGCGTTCACGCCGCATCCGGCATGA R ACAAAGCGCAATTTGCCAGCAATAGTGAAAGCTTGCAA ATTAAAGCCTTCG 8 TrpRS150F GTCGGCCGACTCACGCAATGATATTCAGGCGGC 9 TrpRS150R AGCGAGATGTGGAAACGGCGAGGCACTTCAC 10 Zeo-iR CTGGTCCTGGACCGCGCTGATGAAC 11 TrpRS_sqiR ATCCTGGCGCACGGTGATCGCGTGTTG 12 trpTKO.Gen CAGTCGGTTAGAATACCTGCCTGTCACGCAGGGGGTCGC t-F GGGTTCGAGTCCCGTCCGTTCCGCCACCCTAATTACGCA CACCGTGGAAAC 13 trpTKO.Gen CGGTAGAAGGATTTACTTCGGAGAGGGTTATTTCAGATA t-R AAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCCCGGG AAGCCGATCTCG 14 trpTGsqF GGGGTCTCCCCATGCGAGAGTAGGGAAC 15 trpTGsqR CCGTTGTCGATAGCACAACACTTTCACGGCC 16 galK.90del CGCGCAGTCAGCGATATCCATTTTCGCGAATCCGGAGTG TAAGAACGCGCAGTCAGCGATATCCATTTTCGCGAATCC GGAGTGTAAGAA 17 galK_KO_v TGGCAGAGACCCAGCG erf_F 18 galK_KO_v ACCCCAGTCCATCAGCG erf_R 19 dlambda.ga GCTATGAAATAGAAAAATGAATCCGTTGAAGCCTGCTTT l.K-F TTTATACTAACTTGAGCGAAACGGGAAGCCTGTTGACAA TTAATCATCGGC 20 dlambda.gal GCCGCGTTGATTTTCTCCTGCCAGCTCATAATGCTGCCGC Kdterm-R GTTGTAATATTCAGCACTGTCCTGCTCCTT 21 diambda.sq GGTTTGATCAGAAGGACGTTGATCGGGCGG F 22 diambda.sq TTCAGATACTGGCGATCATCCGCCACCAG R 23 dlambda.sq AGCCCATTGATAGTTTTCATGTGCGACAATGGGCG iR 24 EcWRS_mu GAATCCCATATGATGACTAAGCCCATCGTTNBTNSTGGC t7_8-F GCACAGCCCTCAGGTGAATTG 25 libEcWRS- TACGCTTTGAGGAATCCCATATGATGACTAAGCCCATCG Ndel-F 26 EcWRS1_m CAGATTAGTTTGATACAGCAGGATGTCCGCTGCCATC ut-VPViR 27 EcWRS1_m GATGGCAGCGGACATCCTGCTGTATCAAACTAATCTGnnk ut144-6-F nnknnkGGTGAAGACCAGAAACAGCACCTCGAACTGAGC 28 EcWRS_NC agcgtttgaaactgcagccatggtaccTTACGGCTTCGCCA oI_PstI_ter CAAAACCAATCGC mR 29 proK-F GTTAGCCTGCAGGTAATTCCGCTTCGCAACATGTGAG 30 TrpHNcoI- GGCCGCCATGGCAAATTCGACCCTG R 31 Trp40CCA- GCAACCAGGCGCTTTGGAGGCGCCAGCTCTACCCTTGAG iR 32 Trp40CCA- AGCTGGCGCCTCCAAAGCGCCTGGTTGCAGGTTC iF 33 SmR-R CGCGCGCAGATCAGTTGGAAGAATTTGTCCACTACGTG 34 PNP-Spet-F ATAATGGACTAGTGCGCTTGTTTCGGC 35 pNP-BAB- CTCCTTAGATCTTCCTAGGTGGATCCACCATTCC R 36 pEvolCmR AATAATACTAGTGTTGATACCGGGAAGCCCTGG SpeI-F 37 pEvol_CmR AATAATCTGCAGCGAATTTCTGCCATTCATCCGCTTATTA PstI-R TCAC 38 CmR-TGA- GCTAAGGAAGCTAAAATGGAGAAAAAAATCACTTGATA 7 TACCACCGTTGATATATCCCAATGGC 39 CmR-TGA- GCAATGAAAGACGGTGAGCTGGTGTGATGGGATAGTGT 84 TCACCCTTGTTACACC 40 CmR- CCCTTGTTACACCGTTTTCCATGAGTGATCTGAAACGTTT TGAT-98 TCATCGCTCTGGAG 41 pRep-KpnI- AATAATaggtaccGTTCTGTTGCCCGTCTCACTGGTG tR-F 42 pRep- AATAATAcatatgCCTAGGTGGCAGGGGCGGAGAGACTC EcWtR- NdeI/AvrII- R. 43 EcW-TGA- GTTCAATTGGTAGAGCACCGGTCTTCAAAACCGGGTGTT MSDM GGGAGTTCGAG 44 T7F1 CAGGTTCGCAGCGTCAGCCGGAATGGTACCG 45 T7R3 GCGCCCGACAGCCTTCCAGTTCCTGTGAGAAATCAAGCC GGAAGCCGTAGCGTAC 46 T7F3 GTACGCTACGGCTTCCGGCTTGATTTCTCACAGGAACTG GAAGGCTGTCGGGCGC 47 T7R4b CCATGACCATGATTACCGTGCACTGAAATACCATTAACA TTGCTAAGAACG 48 T7F4 CGTTCTTAGCAATGTTAATGGTATTUCAGTGCACGGTAA TCATGGTCATGG 49 T7R5 CGAAGGCGAAGCGGCATGCATAATGTGCCTGTCAAATG G 50 T7mut- AATAATcctgcaggCTACTCAGGAGAGCGTTCACCGAC SbfI-F 51 T7mut- AATAATCCTGCAGGGCGGCCGCTACGGGAGGGCTTACC NotI/SbtI-R ATCTGG 52 Barnase TTTAACTTTAAGAAGGAGATATACATATGGCATgaGTTAT MSDM3 CAACACGTTTGACGGGGTTG TGA 53 Barnase GTGGCATCAAAAGGGAACCTTGCATGAGTCGCTCCGGG MSDM45 GAAAAGCATC TGA 54 EcWIR- TTAGCCTGCAGTGTGCTTCTCAAATGCCTGAGGCCAGTT PstI-F TGCTC 55 EcWIR- GCGCCCCGCATTTAGGGGCGTAGTTCAATTGGTAGAGCA prok-oF CCGGTC 56 EcWtR- ACTACGCCCCTAAATGCGGGGCGCATCTTACTGCGC proK-oR 57 EcWtR- ATATATGGTACCAAAAAATGGCAGGGGCGGAGAGACTC KpnI-R G 58 GFPflip- TCGATCCCGCGAAATTAATACGACTCACTATAG Notl-F+ 59 sfGFP- ATATACTGCAGCGCCAAGCTAGCTTGGATTCTCACCAAT T7+lam AAAAAACGC PstI-R. 60 MjYtRdel TGGCAGGGGCGGAGAGACTCGAACTCC F 61 MjYtRdel CGAGTCTCTCCGCCCCTGCCA oR AATTCGAAAAGCCTGCTCAACGAGCAGG 62 EcWtR GTTCAATTGGTAGAGCACCGGTCTTCAAAACCGGGTGTT TGA GGGAGTTCGAG MSDM 63 sfGFP CTCGAGTACAACTTTAACTCACACAATGTATGAATCACG (pEvol) GCAGACAAACAAAAGAATGG TGA151 64 EcWRS1.F AATAATAgcggccgcATGACTAAGCCCATCGTTTTTGCTGGC A.NotI-F GCAC 65 EcWRS- AATAATAgcggccgcTTACGGCTTCGCCACAAAACCAATCG NotI-R C 66 pUltraII- GGTGCCCTTAAACGCCTGGTTGC tRsqR 67 EcTrpRS- AAtAAAcatatgATGACTAAGCCCATCGTTTTTAGTGGCGCA NdeI-F C 68 EcTrpRS- TTATTCTGCAGTTACGGCTTCGCCACAAAACCAATCGC PstI-R 69 TrpRS-R ATTATTGAATTCTTACGGCTTCGCCACAA EcoRI 70 TrpRS-F- AATAAATGCTAGCATGACTAAGCCCATC NheI 71 U6-R AATTATTGCTAGCAAAAAATGGCAGGGGCG tRNAtrp* AvrII 72 tRNAtrp* AATTATTGCTAGCAAAAAATGGCAGGGGCG Nhe-R 73 EeWRS_ aataataGCTAGCgccaccATGACTAAGCCCATCGTT mamNheI-F 74 EcWRS_ma AATAATAgaattcTTACGGCTTCGCCACAAAACCAATCGC mEcoRI-R

(52) Statistical methods. For all expression analysis (sfGFP in bacteria or EGFP in HEK293T cells), mean of three independent experiments were reported, and error bars represent standard deviation. For the growth rate analysis, each data point represent the mean O.D.600 of three independent cultures of the same strain (error bars represent S.D.). In our experience, a mean of three experiments provides adequate levels of accuracy for these experiments.

(53) Strains, cell lines. The EcNR1 strain was a gift from Prof. George M. Church. The HEK293T cell-line was obtained from ATCC, and propagated without further confirmation. Cell lines are regularly monitored for Mycoplasma contamination. Even though HEK293T is listed under misidentified cell lines in ICLAC database, we used it for our expression analyses as a representative mammalian cell-line. Given the wide-spread use of this cell-line as a model mammalian expression host, and since our conclusions does not rely on its specific identity (beyond a representative mammalian cell-line), we believe that the use of this strain is justified.

(54) Lambda-Red recombination. All strains were derived from EcNR1.sup.16. This strain contains temperature inducible lambda-recombinase genes (Exo, Beta, Gam) and a constitutive ampicillin resistance gene disrupting the bioA/bioB genomic locus. Strains were grown in 10 mL LB at 30 C. to 0.5 OD.sub.600 and then induced for 15 minutes in a 42 C. water bath (250 rpm). The cell pellet was then washed twice with 10 mL ddH.sub.2O by centrifuging at 4500 g. Cells were resuspended in residual ddH.sub.2O (250 L) and 50 L aliquots were electroporated with 50 ng dsDNA or 2 M 90 bp oligo containing 45-77 bp genomic homology, depending on the desired recombination. Electroporated cells were recovered for 1-6 hours and plated on either LB or minimal media. Single colonies from selection plates were re-streaked and subjected to colony PCR using KAPA-2G polymerase (Kapa Biosystems), following manufacturer's instructions, to verify desired recombination.

(55) Building ATMW1. EcNR1 was transformed with pUltraG_ScW40.sub.CCA. To remove the E. coli tryptophanyl-tRNA synthetase (trpS) from this strain, the gene encoding zeocin resistance (ShBle) driven by the EM-7 promoter and the CYC1 transcription terminator was PCR amplified using primers TrpRS.Z.ab-F and TrpRS.Z.ab-R to generate the PCR product trpS::Zeo.sup.R. 50 ng of the trpS::ZeoR PCR cassette was transformed in the recombination following the aforementioned protocol, and the resulting strains were plated on LB-Agar plates supplemented with Zeocin. The resulting colonies were screened via colony PCR using TrpRS150F+TrpRS150R, TrpRS150F+Zeo-iR, and TrpRS150F+TrpRS_sqiR, as well as sequencing these colony PCR products. This strain was named EZ4.

(56) To replace the E. coli trp-tRNA.sub.CCA (trpT), the trpT::Gent.sup.R PCR cassette was amplified using trpTKO.Gent-F and trpTKO.Gent-R (965 bp). 50 ng of trpT::Gent.sup.R PCR cassette was transformed into EZ4, induced as previously described. Resulting gentamycin resistant colonies were screened for the desired recombination using colony PCR primers trpT GsqF and trpT GsqR, as well as sequencing of the PCR product. The resulting strain was named EZG4.

(57) 2 M 90 bp oligo, galK. 90 del, was used to delete galK from the endogenous genomic location. Following transformation, cells were recovered for 6 hours, washed twice with M9 minimal media at 5000g for 5 min and 100 L of a 10.sup.4 dilution was plated on M63 minimal media supplemented with glycerol and 2-deoxygalactose to select for successful galK deletion. Colony PCR was used to verify the deletion of galK using galK_KO_verf-F/R. The resulting strain was named G4.

(58) galK.PCR cassette was amplified containing the endogenous promoter dlambda.GalK-F and dlambda.galK dterm-R (1348 bp) and was used to remove the -RED genes from the G strain. Following transformation of 50 ng of this PCR product into strain G, successful insertion of the galK.PCR cassette into the -RED site was selected by plating the cells on M63 plates containing galactose as the sole carbon source for three days..sup.17 Surviving colonies were screened by colony PCR using dlambda.sqF with dlambda.sqR or dLambda.sqiR for the desired deletion. This final strain was named ATMW1 (EcNR1 trpS::Zeo.sup.R trpT::Gent.sup.R galK -RED::galK.

(59) Essentially the same procedure as described above for producing ATMW1 was used to produce BL21(DE3).

(60) Growth Comparison. 5 mL starter cultures of EcNR1G, EcNR1G+pUltraG_ScW40.sub.CCA, and ATMW1 strains were grown for 16 hrs in LB with all strain-dependent antibiotics. For each strain, the starter culture was diluted to an initial OD.sub.600 of 0.01 in three identical cultures of 80 mL LB with no antibiotics and allowed to grow in 250 mL sterile Erlenmeyer flasks at 30 C., with shaking (250 rpm). Growth was monitored every 30 min by measuring OD.sub.600 in a 10 mm cuvette.

(61) Assessment of tRNA/aaRS activity using a chloramphenicol reporter. Overnight cultures of ATMW1 harboring pRepAC-EcW-TAG or pRepJI-EcW-TGA, with or without pBK-EcWRSwt, were diluted to an OD.sub.600 of 0.1 and 3 L was spot plated on LB agar plates supplemented with kanamycin (+pBK plates), spectinomycin, tetracycline, and varying chloramphenicol concentrations. Growth was analyzed after 48 hrs of incubation at 37 C.

(62) Assessment of tRNA/aaRS activity using a sfGFP151 reporter. EcNR1 or ATMW1 harboring pEvolT5-EcW sfGFP151 (TAG or TGA) with or without pBK-EcWRSwt, pBK-EcWRS-h14, or pBK-EcWRS-h9 were grown overnight in LB. The starter cultures were diluted in LB supplemented with required antibiotics to 0.05 OD.sub.600. Cultures were grown at 30 C. or 37 C. (30 C. when comparing to progenitor strain EcNR1) until 0.55 OD.sub.600, at which point the sfGFP expression was induced with a final concentration of 1 mM IPTG. Unnatural amino acids (UAA) were added during induction to a final concentration of 1 mM. Cultures were grown for an additional 17-20 hours at 37 C. with shaking. To evaluate sfGFP expression, cells from 150 L of the cultures were pelleted at 5000g, resuspended in 150 L PBS, and transferred to a 96-well clear-bottom assay plate. Fluorescence was measured by using a SpectraMAX M5 (Molecular Devices) (Ex. 488 nm; Em. 534 nm). Fluorescence for each sample was normalized using its OD.sub.600.

(63) Protein purification. To maximize the yield of UAA-modified protein expression, a different plasmid combination was used: EcTrpRS-h14 and -h9 was cloned into a pEvoltac plasmid that expresses them from a strong tacI promoter, while the tRNA.sup.EcTrp.sub.UCA is expressed from the proK promoter. The sfGFP reporter gene (sfGFP-151-TGA or wild type sfGFP) was expressed from pET22b-T5lac plasmid driven by the strong t5.lac promoter. Overnight expression cultures were centrifuged and resuspended in lysis buffer: B-PER Bacterial Protein Extraction Reagent (Thermo Scientific)+1X Halt Protease Inhibitor Cocktail (Thermo Scientific)+0.01% Pierce Universal Nuclease (Thermo Scientific). After 30 min incubation at room temperature, the lysate was clarified by centrifuging at 22,000g for 5 min. The C-terminally polyhistidine tagged soluble sfGFP in the supernatant was purified using a HisPur Ni-NTA resin (Thermo Scientific) following manufacturer's protocol. Protein purity was confirmed by SDS-PAGE and purified protein molecular weight was confirmed by ESI-MS (Agilent Technologies 1260 Inifinity ESI-TOF).

(64) Construction of the EcWRS-5HTP pBK library. Overlap extension was used to introduce degenerate codons, creating the five-residue tryptophanyl tRNA-synthetase library pBK-EcWRS1.5 (786,432 diversity): F7-NBT, S8-NST, V144-NNK, P145-NST, V146-NNK. Using Phusion HSII (Fisher Scientific) and manufacturer's protocol, EcWRS1_mut7-8-F+EcWRS1_mut-VPViR and EcWRS1_mut144-6_F+EcWRS_NcoI_PstI_termR were used to PCR amplify the N-term and C-term of the EcWRS PCR product, respectively. The N-term and C-term PCR products were joined together by overlap extension PCR using the following terminal primers: libEcWRS-NdeI-F and EcWRS_NcoI_PstI_termR. These inserts were digested with NdeI/NcoI (NEB) and ligated by T4 DNA Ligase (NEB) into pBK vector cut with the same restriction enzymes. The ligation mixture was ethanol precipitated with Yeast-tRNA (Ambion) and transformed into electrocompetent DH10b cells. The library was covered using 10.sup.7 distinct colony forming units.

(65) Selection for Synthetase Charging 5HTP. ATMW1 was co-transformed with the pBK-EcWRS1.5b library and the positive selection reporter plasmid pRepJI EcW TGA. The reporter plasmid harbors a lpp-promoted E. coli tRNA.sup.Trp.sub.UCA, a CAT reporter modified to contain TGA codons (Q98TGA), an arabinose-inducible T7 RNA polymerase harboring two TGA nonsense codons (at positions 8 and 114), and a wild-type GFPuv reporter expressed from a t7 promoter. Suppression of CAT leads to chloramphenicol resistance, and suppression of T7 RNA polymerase drives expression of a t7-promoted GFPuv. 9.210.sup.7 cfu (colony forming units) were plated on LB+0.5 Spec/0.5 Tet/Kan/0.02% arabinose+chloramphenicol (25, 35, 45 g/mL) in the presence of 1 mM 5HTP for 36 hrs at 37 C.

(66) Colonies from the 35 and 45 g/mL chloramphenicol positive selection plates were harvested, and the pBK plasmids harboring mutant EcTrpRS were purified by miniprep and gel purification. These were co-transformed into ATMW1 harboring the negative selection plasmid pNegJ2-EcW (araBad-Barnase harboring two TGA codons at 3 and 45). 310.sup.7 cfu were plated on LB+Amp/0.5Kan/0.02% arabinose and incubated for 12 hrs at 37 C. Cells were harvested and library pBK plasmid was purified by miniprep/gel purification.

(67) Isolated pBK plasmids from the negative selection were transformed again into ATMW1 pRepJI-EcW TGA, and 10.sup.6 cfu were plated on LB+0.5Spec/Tet/Kan/0.02% arabinose+chloramphenicol (30, 40, 50 g/mL) in the presence or absence of 1 mM 5HTP for 18 hrs, 37 C., which revealed significantly higher number of colonies in the presence of the UAA. 96 colonies were picked into a 1 mL LB supplemented with Spec/Tet/Kan in deep 96 well polypropylene plates and grown overnight. The resulting cultures were diluted to 0.01 OD.sub.600 and 3 L of each was spot plated on LB/Agar plates supplemented with Spec/Tet/Kan, and chloramphenicol (50, 60 g/mL) in the presence or absence of 5HTP. Four clones exhibiting the most prominent UAA dependent growth were picked and sequenced.

(68) Assessing activity of tRNA.sup.EcTrp.sub.CUA and synthetase hits in HEK293T. Dulbecco's modified Eagle's medium (high glucose DMEM) supplemented with 10% fetal bovine serum (FBS) and Penicillin/Streptomycin (0.5) was used to culture HEK293T cells. Cells were incubated in a humidified incubator at 37 C. in the presence of 5% CO.sub.2. HEK293T were seeded at a density of 600,000 per well for a 12-well plate one day prior to transfection and transfected at 70% confluence. Polyethylenimine (PEI, Sigma) and DNA were mixed at a ratio of 4 L PEI (1 mg/mL) to 1 g DNA in DMEM. After 20 min incubation, 100 L of this mixture was used to transfect one single well in a 12-well plate. For these transfections, 500 ng of pAcBac EGFP39* U6-EcWtR TAG was transfected in the presence or absence of pAcBac-TrpRS (wt, h14, or h9) U6-EcWtR TAG. UAAs were added to the culture medium to a final concentration of 1 mM at the time of transfection. Fluorescence images were taken at 48 hrs post-transfection using a Zeiss Axio Observer fluorescence microscope.

(69) To obtain EGFP39*-expression data, cells were harvested, washed once with PBS buffer (5000g), and lysed with CelLytic-M lysis buffer (Sigma) supplemented with 1X Halt protease inhibitor and 0.01% Pierce universal nuclease. 50 L lysis buffer was used for each well of a 12-well plate, and was allowed to incubate for 20 min. After incubation, the lysate was clarified by centrifuging at 22000g for 5 minutes and was transferred to a clear bottom 96-well assay plate. Fluorescence was measured using a SpectraMAX M5 (Molecular Devices) (Ex. 488 nm; Em. 534 nm).

(70) Isolation of EGFP-39-TAG reporters from HEK293T. HEK293T cells were cultured as previously described. One day prior to transfection, cells were seeded at a density of 8-million cells/10 cm dish. 50 L PEI MAX (Polysciences) was mixed with 10 g total DNA (5 g reporter, 5 g tRNA/aaRS plasmid) with 180 L DMEM (no FBS), incubated for 20 min, and added evenly to the dish at 90% confluence. Desired UAAs were supplemented at a final concentration of 1 mM and cells were allowed to express the desired protein for 48 hours.

(71) Cells from a 10 cm dish were harvested and lysed with 600 L CelLytic M lysis buffer (Sigma, 1X Halt protease inhibitor, 0.01% Pierce universal nuclease). Lysate was clarified as described and purified via Ni.sup.2+-NTA, following manufacturer's protocol. Purified protein was analyzed by SDS-PAGE and molecular weight was confirmed by ESI-MS (Agilent Technologies 1260 Infinity ESI-TOF).

(72) Click-labeling of 5AzW and 5PrW residues. Purified proteins containing 5AzW were incubated with or without 20 M DBCO-Cy5 (Sigma) for 1 hr in the dark at room temp. Proteins samples were resolved by SDS-PAGE gel and imaged using Cy5 specific settings on a Chemidoc MP Imaging System (Bio-Rad). The SDS-PAGE gels were then coomassie stained and imaged.

(73) 5PrW containing proteins were labeled using the Click-iT Plus Alexa Fluor Picolyl Azide kit (Life Technologies) with a modified protocol. The following were mixed in order: 1 g protein (4 L), 3 L 10 buffer additive, 0.3 L 100 mM CuSO.sub.4, 0.3 L copper protectant, 1.2 L Alexa 488 PCA (50 M, 2 M final), 21.2 L 1 Click-iT reaction buffer, to a final volume of 30 L. Samples were incubated for 40 min in dark and subsequently resolved by SDS-PAGE and imaged using the Chemidoc MP Imaging System (Bio-Rad) with Alexa 488 specific settings.

(74) Tryptic Digestion and LC-MS/MS Analysis of reporter proteins. 12 g purified reporter protein was treated with DMSO (0.2 M) and precipitated with 5 L 100% solution of trichloracetic acid. Sample was frozen at 80 C overnight. Thawed sample was centrifuged at 15000 rpm for 10 min, room temp. Supernatant was removed and pellets were vortexed to resuspend in 500 L cold acetone. Samples were then centrifuged at 5000 rpm for 10 min. Acetone was then removed and pellet was allowed to air dry. Pellet was resuspended in 30 L 8M urea in PBS, followed by 70 L 100 mM ammonium bicarbonate and then 1.5 L 1 M DTT was added. Samples were incubated at 65 C. for 15 minutes. After incubation, 2.5 L of 500 mM iodoacetamide in PBS was added and the sample was left at room temperature for 30 minutes. Following incubation, 120 L PBS was added to each sample and vortexed rapidly. 4 L of trypsin was added to samples, followed by 2.5 L 100 mM CaCl.sub.2. Samples were then agitated for 37 C. overnight. Trypsin was then quenched with 10 L formic acid and pelleted at 15,000 rpm for 20 min. Supernatants were stored at 20 C.

(75) Samples were subsequently analyzed by LC MS/MS using a LTQ Orbitrap XL mass spectrometer (ThermoFisher) coupled to an EASY-nLC 1000 nanoLC (ThermoFisher). 10 L samples were loaded onto 100 m fused silica column with a 5 m tip packed with 10 cm of Aqua C18 reverse phase resin (Phenomenex) using the EASY-nLC 1000 autosampler. The digests were eluted using a gradient 0-100% Buffer B in Buffer A (Buffer A: 95% water, 5% acetonitrile, 0.1% formic acid; Buffer B; 20% water, 80% acetonitrile, 0.1% formic acid). The flow rate through the column was set to 400 nL/min and the spray voltage was set to 3.5 kV. One fuL1 MS scan (FTMS) (400-1800 MW) was followed by 7 data dependent scans (ITMS) of the nth most intense ion from the imported mass list with dynamic exclusion. The tandem MS data were searched using the SEQUEST algorithm using a concatenated target/decoy variant of the human IPI databases. A static modification of +57.02146 on cysteine was specified to account for iodoacetamide alkylation. SEQUEST output files were filtered using DTASelect 2.0.

Construction of Various Plasmids

(76) Complementation plasm id pUltraG_ScW40.sub.CCA. Previously reported pUltra Hit14, containing a tacI promoted wild type yeast tryptophanyl-tRNA synthetase and proK promoted evolved yeast tRNA amber suppressor,.sup.14 was used to generate additional pUltra derivatives. To generate pUltra_ScW40.sub.CUA, a previously evolved tRNA 40A was amplified from 40A gblock (IDT) using primers proK-F and TrpH NcoI-R..sup.15 The fill-length proK-tRNA PCR product was cloned into pUltra Hit14 via SbfI/NcoI (NEB), producing pUltra ScW40.sub.CUA.

(77) To build pUltraG_ScW40.sub.CCA, a complementation plasmid with a constitutively active synthetase, the tacI promoter region was removed by digesting the pUltra_ScW40.sub.CUA vector with XbaI/SbfI, and a glnS-ScWRS cassette was amplified from an pEVOL.sup.8 derived plasmid, pEvol ScW, using glnS-XbaI-F+glnS-SbfI-R and subsequently cloned using the same set of restriction sites. The 40A tRNA anticodon was then mutated to CCA using overlap extension PCR. The two PCR products were amplified with proK-F+Trp40CCA-iR and Trp40CCA-iF+SmR-R, overlap extended, and cloned into pUltraG_ScW40.sub.CUA using SbfI/NcoI, producing the final complementation plasmid pUltraG_ScW40.sub.CCA.

(78) Construction of selection plasmids. To generate the TAG positive selection plasmid, pRep-ScW14.sup.14 was digested with SpeI/BglII. The lpp-promoted E. coli tRNA.sup.Trp.sub.CUA was amplified from gblock I-EcWtR TAG with pNP-SpeI-F+pNP-BAB-R. The PCR product was digested with SpeI/BamHI, and cloned into the SpeI/BglII sites of the prep vector creating pRepAC-EcWtR-TAG.

(79) In order to create a selection plasmid based on TGA suppression, a smaller pRep-Cm3b.sup.32 was used as a starting template. In order to delete the chloramphenicol-UPP fusion protein, chloramphenicol acetyl transferase was amplified from pEvol.sup.33 with pEvol CmR SpeI-F+pEvol CmR PstI-R, digested with SpeI/PstI, and ligated into the same sites of pRep-Cm3b, creating pRep-Cm3J-wt. TGA sites were introduced into the CAT gene by replacing G7, 184, or Q98 via site-directed mutagenesis using primers CmR-TGA-7, CmR-TGA-84, or CmR-TGAT-98, building three different reporters. The lpp-promoted E. coli tRNA.sup.Trp.sub.CUA was amplified from pRepAC-EcWtR-TAG with pRep-KpnI-tR-F and pRep-EcWtR-NdeI/AvrII-R and cloned via KpnI/AvrII into these pRep-Cm3J plasmids, creating three different pRep-Cm3J-#TGA-EcWtR TAG. The anti-codon of the tRNA was mutated to TGA using site-directed mutagenesis with primer EcWtR-TGA-MSDM. While all three reporter plasmids exhibited desired phenotypes upon TGA suppression, pRep-Cm3J-98TGA-EcWtR was used for the subsequent cloning steps.

(80) To add the T7 RNA polymerase-GFPuv reporter system into pRep-Cm3J-98TGA-EcWtR, these elements were amplified from pRepAC-EcWtR-TAG using multiple overlap extension PCR reactions to change the two TAG nonsense codons in the T7RP gene to TGA: Three PCR products were first amplified using T7F1+T7R3, T7F3+T7R4b, T7F4+T7R5, which were overlapped to produce T7-araC PCR cassette. This cassette was first cloned back into pRepAC-EcWtR-TAG via KpnI/NsiI, and then the entire GFP-T7araC cassette was amplified from the resulting plasmid with T7_mut-SbfI-F+T7_mut-NotI/SbfI-R, digested with SbfI, and ligated into the PstI site of pRep-Cm3J-98TGA-EcWtR vector producing pRepJI-EcW.

(81) The negative selection plasmid was built by modifying an existing pNeg plasmid..sup.3,4 The two barnase suppression sites (3TAG, 45TAG) were mutated to TGA with site-directed mutagenesis using primers Barnase MSDM 3 TGA and Barnase MSDM 45 TGA, creating plasmid pNegJ2. The E. coli tRNA.sup.Trp.sub.CUA was amplified from pRep-Cm3J-98TGA-EcWtR with pRep_NegtR-EcoRI-R and pRep_KpnI-tR-F and then cloned into pNegJ2, replacing the preexisting tRNA, creating pNegJ2-EcW.

(82) Construction of bacterial suppression plasmids. Since ATMW1 uses the pUltraG plasmid to express the yeast tryptophanyl pair, the suppression plasmids cannot use the CloDF13 origin of replication, or the spectinomycin marker. The previously described pEvoltac MjY plasmid,.sup.8 which harbors a compatible p15a origin of replication and a chloramphenicol resistance marker, was used as the template to generate these plasmids. The plasmids pEvolT5 EcW sfGFP151 (TAG or TGA) were built to allow the rapid evaluation of various EcTrpRS mutants isolated from the selection scheme (encoded in pBK vector). Initially, a t5.lac-promoted sfGFP-151-TAG was amplified from pET22b-T5-sfGFP151TAG using GFPflip-NotI-F+sfGFP-T7+1am-PstI-R and subsequently cloned into pEvoltac MjY using EcoNI/PstI, to generate pEvolT5 MjY sfGFP151TAG.

(83) A proK-promoted E. coli tRNA.sup.Trp.sub.CUA was assembled by overlap extension as follows. The proK promoter was amplified from pUltraG ScW40 using EcWtR-PstI-F+EcWtR proK-oR, which was overlapped with tRNA.sup.EcTrp.sub.CUA amplified with EcWtR-proK-oF and EcWtR-KpnI-R. This PCR product was cloned into pEvoltac MjY sfGFP151TAG using PstI/KpnI, producing pEvoltac MjY EcWtR sfGFP151TAG. The MjY tRNA was removed by using Polymerase Incomplete Primer Extension (PIPE) cloning with primers MjYtR-del-oF and MjYtR-del-oR, producing the final plasmid pEvolT5-EcW-sfGFP151TAG. Additionally, site-directed mutagenesis was used to build the TGA reporter pEvolT5-EcW-sfGFP151TGA with primers sfGFP(pEvol)TGA151 and EcWtR TGA MSDM.

(84) For more efficient protein expression using evolved tRNA/aaRS pairs, plasmids containing the proK promoted tRNA.sup.EcTrp.sub.UCA and tacI promoted EcWRS-h14 or -h9 were assembled. The tRNA in pEvoltac MjY was first replaced by amplifying the EcTrp-tRNA.sub.UCA from pEvoltac-EcW-sfGFP151TGA with EcWtR PstI-F and pUltraII-tRsqR, and subsequently cloning into PstI/SphI to generate pEvoltac-EcW-MjYRS. EcWRS-h14 and -h9 were then amplified from their respective pBK plasmids using EcWRS1.FA.NotI-F and EcWRS-NotI-R, digested with NotI, and cloned into NotI-digested pEvoltac-EcW-MjYRS-pAcF, producing pEvoltac-EcW-TGA-h14 or h9.

(85) pBK MjYRS.sup.4 was used as a template to introduce tryptophanyl-tRNA synthetase variants. Top 10 genomic DNA was purified using previously described protocols,.sup.34 and used as the template to amplify the EcTrpRS using EcTrpRS-NdeI-F and EcTrpRS-PstI-R. The PCR product was digested with NdeI/PstI, producing pBK EcWRS.

(86) Construction of mammalian suppression plasmids. Previously reported pAcBac1 was used to generate mammalian reporter and suppression plasmids..sup.30 To build pAcBac1 TrpRS, EcTrpRS was amplified from Top 10 genomic DNA with TrpRS-F-NheI+TrpRS-R-EcoRI and subsequently cloned into pAcBac1 via NheI/EcoRI. U6-EcWtR Gblock was used as a template and amplified with tRNAtrp*-NheI-R+tRNAtrp* Nhe-R to produce the human U6 promoted. E. coli tRNA.sup.EcTrp.sub.CUA PCR product. This PCR product was then digested with AvrII/NheI and cloned into the AvrII site in the pAcBac variants, resulting in pAcBac1-TrpRS-U6EcWtR-TAG and pAcBac1-EGFP39*-U6EcWtR-TAG. EcWRS-h14 and -h9 synthetase variants were cloned into the pAcBac1-TrpRS-U6EcWtR-TAG plasmid via NheI/EcoRI digestion after amplification with EcWRS_mamNheI-F+EcWRS_mamEcoRI-R to make pAcBac1-EcWRS-h14-U6EcWtR-TAG and pAcBac1-EcWRS-h9-U6EcWtR-TAG.

(87) Unnatural amino acids. 5HTP and 5MTP were purchased from Fisher Scientific, 5BrW and 5AmW were purchased from Chem-Impex International (Wood Dale, Ill.). AzK was purchased from Sirius Fine Chemicals. 5AzW was synthesized as previously described..sub.35

(88) Yield of sfGFP reporters incorporating various UAAs expressed in ATMW1 are shown in Table 3, below.

(89) TABLE-US-00003 TABLE 3 UAA aaRS Yield (mg/L) 5HTP h14 92 5MTP h14 89 5BrW h14 25 5AzW h14 80 5PrW h14 61 5AmW h9 68 sfGFPwt N/A 140

REFERENCES

(90) 1. Chin, J. W. Expanding and reprogramming the genetic code of cells and animals. Annu. Rev. Biochem. 83, 379-408 (2014).

(91) 2. Dumas, A., Lercher, L., Spicer, C. D. & Davis, B. G. Designing logical codon reassignment-Expanding the chemistry in biology. Chem. Sci. 6, 50-69 (2015).

(92) 3. Liu, C. C. & Schultz, P. G. Adding new chemistries to the genetic code. Annu. Rev. Biochem. 79, 413-444 (2010).

(93) 4. Wang, L., Brock, A., Herberich, B. & Schultz, P. G. Expanding the genetic code of Escherichia coli, Science 292, 498-500 (2001).

(94) 5. Chin, J. W. et al. An expanded eukaryotic genetic code. Science 301, 964-967 (2003).

(95) 6. Wan, W., Tharp, J. M. & Liu, W. R. Pyrrolysyl-tRNA synthetase: an ordinary enzyme but an outstanding genetic code expansion tool. Biochim. Biophys. Acta 1844, 1059-1070 (2014).

(96) 7. Anderson, J. C. et al. An expanded genetic code with a functional quadruplet codon. Proc. Natl. Acad. Sci. USA 101, 7566-7571 (2004).

(97) 8. Chatterjee, A., Sun, S. B., Furman, J. L., Xiao, H. & Schultz, P. G. A versatile platform for single- and multiple-unnatural amino acid mutagenesis in Escherichia coli. Biochemistry 52, 1828-1837 (2013).

(98) 9. Neumann, H., Wang, K., Davis, L., Garcia-Alai, M. & Chin, J. W. Encoding multiple unnatural amino acids via evolution of a quadruplet-decoding ribosome. Nature 464, 441-444 (2010).

(99) 10. Wan, W. et al. A facile system for genetic incorporation of two different noncanonical amino acids into one protein in Escherichia coli. Angew. Chem. Int. Ed. 49, 3211-3214 (2010).

(100) 11. Xiao, H. et al. Genetic incorporation of multiple unnatural amino acids into proteins in mammalian cells. Angew. Chem. Int. Ed. 52, 14080-14083 (2013).

(101) 12. Iraha, F. et al. Functional replacement of the endogenous tyrosyl-tRNA synthetase-tRNATyr pair by the archaeal tyrosine pair in Escherichia coli for genetic code expansion. Nucleic Acids Res. 38, 3682-3691 (2010).

(102) 13. Chatterjee, A., Xiao, H. & Schultz, P. G. Evolution of multiple, mutually orthogonal prolyl-tRNA synthetase/tRNA pairs for unnatural amino acid mutagenesis in Escherichia coli. Proc. Natl. Acad. Sci. USA 109, 14841-14846 (2012).

(103) 14. Chatterjee, A., Xiao, H., Yang, P. Y., Soundararajan, G. & Schultz, P. G. A tryptophanyl-tRNA synthetase/tRNA pair for unnatural amino acid mutagenesis in E. coli. Angew. Chem. Int. Ed. 52, 5106-5109 (2013).

(104) 15. Ellefson, J. W. et al. Directed evolution of genetic parts and circuits by compartmentalized partnered replication. Nat. Biotechnol. 32, 97-101 (2014).

(105) 16. Wang, H. H. et al. Programming cells by multiplex genome engineering and accelerated evolution. Nature 460, 894-898 (2009).

(106) 17. Warming, S., Costantino, N., Court, D. L., Jenkins, N. A. & Copeland, N. G. Simple and highly efficient BAC recombineering using galK selection. Nucleic Acids Res. 33, e36 (2005).

(107) 18. Soll, L. & Berg, P. Recessive lethal nonsense suppressor in Escherichia coli which inserts glutamine. Nature 223, 1340-1342 (1969).

(108) 19. Jahn, M., Rogers, M. J. & Soll, D. Anticodon and acceptor stem nucleotides in tRNA(Gln) are major recognition elements for E. coli glutaminyl-tRNA synthetase. Nature 352, 258-260 (1991).

(109) 20. Rogers, M. J., Adachi, T., Inokuchi, H. & Soll, D. Switching tRNA(Gln) identity from glutamine to tryptophan. Proc. Natl. Acad. Sci. USA 89, 3463-3467 (1992).

(110) 21. Kopelowitz, J., Hampe, C., Goldman, R., Reches, M. & Engelberg-Kulka, H. Influence of codon context on UGA suppression and readthrough. J. Mol. Biol. 225, 261-269 (1992).

(111) 22. O'Donoghue, P. et al. Near-cognate suppression of amber, opal and quadruplet codons competes with aminoacyl-tRNAPyl for genetic code expansion. FEBS Lett. 586, 3931-3937 (2012).

(112) 23. Santoro, S. W., Wang, L., Herberich, B., King, D. S. & Schultz, P. G. An efficient system for the evolution of aminoacyl-tRNA synthetase specificity. Nat. Biotechnol. 20, 1044-1048 (2002).

(113) 24. Zhang, Z. et al. Selective incorporation of 5-hydroxytryptophan into proteins in mammalian cells. Proc. Natl. Acad. Sci. USA 101, 8882-8887 (2004).

(114) 25. Antonczak, A. K. et al. Importance of single molecular determinants in the fidelity of expanded genetic codes. Proc. Natl. Acad. Sci. USA 108, 1320-1325 (2011).

(115) 26. Cooley, R. B., Karplus, P. A. & Mehl, R. A. Gleaning unexpected fruits from hard-won synthetases: probing principles of permissivity in non-canonical amino acid-tRNA synthetases. ChemBioChem 15, 1810-1819 (2014).

(116) 27. Young, D. D. et al. An evolved aminoacyl-tRNA synthetase with atypical polysubstrate specificity. Biochemistry 50, 1894-1900 (2011).

(117) 28. Prather, N. E., Murgola, E. J. & Mims, B. H. Primary structure of an unusual glycine tRNA UGA, suppressor. Nucleic Acids Res. 9, 6421-6428 (1981).

(118) 29. Raftery, L. A., Egan, J. B., Cline, S. W. & Yarus, M. Defined set of cloned termination suppressors: in vivo activity of isogenetic UAG, UAA, and UGA suppressor tRNAs. J. Bacteriol. 158, 849-859 (1984).

(119) 30. Chatterjee, A., Xiao, H., Bollong, M., Ai, H. W. & Schultz, P. G. Efficient viral delivery system for unnatural amino acid mutagenesis in mammalian cells. Proc. Natl. Acad. Sci. USA 110, 11803-11808 (2013).

(120) 31. Guo, J., Melancon, C. E., 3rd, Lee, H. S., Groff, D. & Schultz, P. G. Evolution of amber suppressor tRNAs for efficient bacterial production of proteins containing nonnatural amino acids. Angew. Chem. Int. Ed. 48, 9148-9151 (2009).

(121) 32. Melancon, C. E., 3rd & Schultz, P. G. One plasmid selection system for the rapid evolution of aminoacyl-tRNA synthetases. Bioorg. Med. Chem. Lett. 19, 3845-3847 (2009).

(122) 33. Young, T. S., Ahmad, I., Yin, J. A. & Schultz, P. G. An enhanced system for unnatural amino acid mutagenesis in E. coli. J. Mol. Biol. 395, 361-374 (2010).

(123) 34. Syn, C. K. & Swarup, S. A scalable protocol for the isolation of large-sized genomic DNA within an hour from several bacteria. Anal. Biochem. 278, 86-90 (2000).

(124) 35. Li, M. & Johnson, M. E. An efficient synthesis of 5-azidotryptophan. Tetrahedron Lett. 35, 6255-6258 (1994).

(125) While this invention has been particularly shown and described with references to preferred embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims.